ORIGINAL RESEARCH ARTICLE

published: 09 August 2013

doi: 10.3389/fendo.2013.00098

IGF-I, IGF-II, and insulin stimulate different gene expression

responses through binding to the IGF-I receptor
Soetkin Versteyhe 1 *, Birgit Klaproth 1 † , Rehannah Borup 2 , Jane Palsgaard 1 † , Maja Jensen 1 † ,
Steven G. Gray 1,3 and Pierre De Meyts 1 †
1
Receptor Systems Biology Laboratory, Hagedorn Research Institute, Novo Nordisk A/S, Gentofte, Denmark
2
Genomic Medicine, Microarray Center, Copenhagen University Hospital, Copenhagen, Denmark
3
Thoracic Oncology Research Group, Trinity Centre for Health Sciences, Institute of Molecular Medicine, St. James’s Hospital, Dublin, Ireland

Edited by: Insulin and the insulin-like growth factors (IGF)-I and -II are closely related peptides impor-
Kenneth Siddle, University of
tant for regulation of metabolism, growth, differentiation, and development. The IGFs exert
Cambridge, UK
their main effects through the IGF-I receptor. Although the insulin receptor is the main phys-
Reviewed by:
Ramasamy Paulmurugan, Stanford iological receptor for insulin, this peptide hormone can also bind at higher concentrations
University, USA to the IGF-I receptor and exert effects through it. We used microarray gene expression
Andrew Chantry, University of East profiling to investigate the gene expression regulated by IGF-I, IGF-II, and insulin after
Anglia, UK
stimulation of the IGF-I receptor. Fibroblasts from mice, knockout for IGF-II and the IGF-
*Correspondence:
II/cation-independent mannose-6-phosphate receptor, and expressing functional IGF-I but
Soetkin Versteyhe, Faculty of Health
Sciences, The Novo Nordisk no insulin receptors, were stimulated for 4 h with equipotent saturating concentrations
Foundation Center for Basic of insulin, IGF-I, and IGF-II. Each ligand specifically regulated a group of transcripts that
Metabolic Research, Integrative was not regulated by the other two ligands. Many of the functions and pathways these
Physiology, University of
regulated genes were involved in, were consistent with the known biological effects of
Copenhagen, Blegdamsvej 3B, 2200
København N, Denmark these ligands. The differences in gene expression might therefore account for some of the
e-mail: [email protected] different biological effects of insulin, IGF-I, and IGF-II. This work adds to the evidence that
†
Present address: not only the affinity of a ligand determines its biological response, but also its nature, even
Birgit Klaproth and Maja Jensen, through the same receptor.
Insulin Biology, Novo Nordisk A/S,
Måløv, Denmark; Keywords: IGF-I receptor, microarray gene expression, insulin, IGF, differential signaling
Jane Palsgaard , Novo Nordisk
Foundation Center for Basic
Metabolic Research, University of
Copenhagen, Copenhagen, Denmark;
Pierre De Meyts, Department of
Diabetes Biology and Hagedorn
Research Institute, Gentofte,
Denmark.

INTRODUCTION kinase activity of the receptor, enabling it to phosphorylate mul-

Insulin and the closely related insulin-like growth factors (IGF)-I tiple cytoplasmic substrates, which activates signaling cascades,
and -II are important for the regulation of metabolism and cell resulting in ligand-specific biological effects (4, 13).
growth, survival, motility, differentiation, and development (1– Both the ligands and the receptors are closely related (and
6). These ligands bind to closely related receptor tyrosine kinases. therefore the ligands can bind to their non-cognate receptors)
The main physiological receptor for insulin is the insulin receptor, and the signaling pathways they activate are largely overlapping
while the IGFs mainly exert their effects through the IGF-I recep- (14). Microarray profiling showed that the two receptors are
tor (7, 8). The insulin receptor exists under two isoforms, A and capable of stimulating the same gene expression response (15).
B, due to alternative splicing of exon 11 of the insulin receptor Nevertheless, insulin is mainly a metabolic regulator, while the
gene (9, 10). IGFs exert mainly mitogenic effects (growth, proliferation . . .).
Insulin-like growth factor-II in mammals also binds to the IGF- The molecular basis of this signaling specificity is still not
II/cation-independent mannose-6-phosphate receptor, which is understood (6, 16).
thought to act as a scavenger for IGF-II rather than a signaling As mentioned, the three ligands can also bind to their non-
receptor (11, 12). Its presence on most cells however complicates cognate receptors, though with lower affinity, and by doing so
the study of IGF-II binding and signaling mediated through the they can exert different effects in comparison to the cognate lig-
IGF-I receptor. and. Frasca et al. and Morrione et al., e.g., showed independently
Binding of the ligands to the insulin or IGF-I receptor leads that IGF-II is more potent in stimulating proliferation through the
to autophosphorylation of the receptor on tyrosine residues. This insulin receptor A isoform than insulin (17, 18). Frasca et al. also
creates binding sites for SH2 and PTB domain-containing dock- showed that insulin is a more potent metabolic regulator through
ing proteins such as IRS-1–4 and Shc, and stimulates the tyrosine this isoform than IGF-II (17). Pandini et al. found that insulin

www.frontiersin.org August 2013 | Volume 4 | Article 98 | 1

Versteyhe et al. Differential signaling through IGF-I receptor

and IGF-II induce different gene expression patterns after binding DETERMINING THE AFFINITIES OF IGF-I, IGF-II, AND INSULIN FOR THE
to the A isoform of the insulin receptor (19). Malaguarnera et al. IGF-I RECEPTOR
found that proinsulin binds with high affinity the insulin recep- To determine the apparent affinities of the ligands for the IGF-
tor isoform A and predominantly activates the mitogenic pathway I receptor on the mouse fibroblast cell line, homologous and
(20). Also, insulin analogs with different residence times on the heterologous radioligand competition assays were performed in
insulin receptor have been shown to have different relative poten- quadruplets. Cells were detached with 10 mM EDTA (Gibco, Invit-
cies for mitogenic versus metabolic signaling (21–23). Previous rogen, Denmark). Three million cells per milliliter were incubated
work from our laboratory has described an insulin mimetic pep- with a constant concentration of 125 I-IGF-I (20,000 cpm/ml) and
tide that despite binding to the insulin receptor with an affinity increasing concentrations of cold IGF-I, IGF-II, or insulin for 2.5 h
similar to insulin’s is less potent in stimulating thymidine incor- (time needed to reach steady-state binding) at 15°C in Hepes Bind-
poration and induces a different gene expression response in com- ing Buffer (100 mM Hepes, 120 mM NaCl, 5 mM KCl, 1.2 mM
parison to insulin (24). All in all, it is becoming increasingly clear MgSO4 , 1 mM EDTA, 10 mM Glucose, 15 mM Na Acetate, and 1%
that various ligands acting through the same receptor may acti- BSA). After centrifugation unbound 125 I-IGF-I was removed and
vate different patterns of end-point cellular effects (“differential cell-bound 125 I-IGF-I was counted in a Wallac WIZARD gamma
signaling”). counter (PerkinElmer). K d values were calculated after fitting
In this study we measured gene expression by microarray pro- the data to a one-site model using a program developed in our
filing after stimulating mouse fibroblasts expressing the IGF-I laboratory by Ronald M. Shymko and Andreas V. Groth.
receptor, but devoid of insulin and IGF-II/cation-independent
mannose-6-phosphate receptors (25) with equipotent concentra- PREPARATION OF THE CELLS FOR THE MICROARRAY EXPERIMENTS
tions of insulin, IGF-I, and IGF-II. During the analysis the focus Mouse fibroblasts were seeded out into 145 cm2 TC dishes (Nunc,
was on finding differences, rather than similarities, in gene expres- Denmark) at two million cells per dish and subsequently allowed
sion between the three ligands. The results show that insulin, IGF-I, to recover for 24 h. In quadruplets, but at the same cell passage
and IGF-II indeed create different gene expression responses when and after washing the cells twice with D-PBS (w/o Calcium and
stimulating the IGF-I receptor. We hope that these results and Magnesium; Gibco, Invitrogen, Denmark), the cells were serum
further studies will lead to a better understanding of the sig- starved for 24 h and afterward either left unstimulated or stimu-
naling specificity and different biological effects of these three lated for 4 h with 20 nM IGF-I, 177 nM IGF-II, or 5168 nM insulin.
ligands. These concentrations compensate for the relative affinities of the
ligands for the receptor, measured as described above.
MATERIALS AND METHODS
MATERIALS ISOLATION AND PURIFICATION OF TOTAL RNA
Fibroblasts from mice knockout for IGF-II and the IGF-II/cation- Total RNA was isolated by using the TRI® reagent method (Mol-
independent mannose-6-phosphate receptor were a gift from Dr. ecular Research Gene, USA) and cleaned up using the RNeasy™
Kurt von Figura (25). Insulin was from Novo Nordisk A/S, Den- Mini Kit (Qiagen) according to the manufacturers’ protocol. RNA
mark, and IGF-I and IGF-II from Novozymes GroPep, Thebarton, quality was verified by 1% agarose gel electrophoresis. Concen-
SA, Australia. 125 I-IGF-I was prepared by Novo Nordisk A/S. tration and purity were determined by measuring absorbance at
Unless otherwise specified all chemicals were from Sigma-Aldrich, A 260 and A 280 in a spectrophotometer (Brinkmann Eppendorf
Denmark. BioPhotometer, Germany).

CELL LINE AND CULTURE CONDITIONS cRNA GENERATION AND HYBRIDIZATION TO GENE CHIP
The mouse fibroblasts were routinely cultured in 80 cm2 TC flasks MICROARRAYS
(Nunc, Denmark) in DMEM medium (with Glutamax-1 and cRNA was produced using the One-cycle Target Labeling Kit
4.5 g/l glucose; Gibco, Invitrogen, Denmark) supplemented with (Affymetrix, Santa Clara, CA, USA). One-cycle Target Labeling Kit
10% Fetal Bovine Serum (Gibco, Invitrogen, Denmark), 100 U/ml and procedures followed protocols in the GeneChip Expression
Penicillin, and 100 µg/ml Streptomycin (Gibco, Invitrogen, Den- Analysis Technical Manual (Affymetrix, Santa Clara, CA, USA).
mark). The cells were grown at 37°C in a 5% CO2 humidified Fragmented biotin-labeled cRNA was hybridized to Affymetrix
atmosphere. They were passaged three times a week by wash- GeneChip® Mouse Genome 430 2.0 Arrays according to manufac-
ing in D-PBS (w/o Calcium and Magnesium; Gibco, Invitrogen, turer’s protocol. The arrays were incubated at 45°C for 16 h under
Denmark), trypsinization in Trypsin-EDTA (Gibco, Invitrogen, rotation (60 rpm), washed in the GeneChip® Fluidics Station
Denmark), and subsequent resuspension and dilution in fresh (Affymetrix) and scanned using the GeneChip® Scanner 3000.
medium.
The mouse fibroblasts, devoid of IGF-II and the IGF-II/cation- DATA ANALYSIS
independent mannose-6-phophate receptor, did not bind 125 I- The quality of the arrays was verified by quality control in the
insulin, indicating the absence of biologically active insulin recep- R package1 from Bioconductor2 . The probe level data (CEL files)
tors (results not shown), but did bind 125 I-IGF-I. From the below were transformed into expression values using R and the GC-RMA
mentioned homologous competition assay data, we found that
approximately 75,000 IGF-I receptor sites/cell are present on this 1 http://www.r-project.org/

cell line. 2 http://www.bioconductor.org/

Frontiers in Endocrinology | Molecular and Structural Endocrinology August 2013 | Volume 4 | Article 98 | 2
Versteyhe et al. Differential signaling through IGF-I receptor

package from Bioconductor (see text footnote 2) (26). Briefly, the Identification of gene function themes and canonical pathways
background was subtracted, the data were normalized by the quan- was done using the web-based software Ingenuity Pathways Analy-
tile normalization method and the expression values of a probe set sis (IPA)4 . IPA takes the gene IDs in the dataset file and maps them
were summarized into one expression value. to genes in the Ingenuity Pathways Knowledge Base (IPKB). The
For data analysis, the expression values were imported into functional and canonical pathway analyses identified the molecu-
the software package DNA-Chip Analyzer (dChip) (version 2008), lar and cellular functions and canonical pathways that were most
freeware developed by Li and Wong (27)3 . When generating origi- significant to the data set. This significance value is a measure
nal lists of transcripts, a fold change and p-value cut-off of respec- for how likely it is that genes from the dataset file under inves-
tively 1.2 and 0.05 were chosen. The lower confidence bound of tigation participate in that function. In this method, the p-value
fold changes was used for filtering and the threshold for absolute is calculated by comparing the number of user-specified genes
difference between two group means was set to 35. Using these of interest that participate in a given function or pathway, rel-
cut-offs gave empirical median false discovery rates (FDR) of max- ative to the total number of occurrences of these genes in all
imum 2% after running 100 permutations in dChip (FDRs were functional/pathway annotations stored in the IPKB. Ingenuity
0% for all but the lists of genes regulated by insulin, IGF-I, or IGF-II uses a right-tailed Fisher’s Exact Test in order to calculate a p-
in comparison to the control). dChip recommends a median FDR value. In the right-tailed Fisher’s Exact Test, only over-represented
of <5 or 10%. Composing a list of transcripts regulated by insulin, functional/pathway annotations, annotations which have more
IGF-I, and IGF-II together or separately was done by selecting tran- Functions/Canonical Pathways Analysis Genes than expected by
scripts that fulfilled the above-mentioned criteria for the ligands chance (“right-tailed” annotations), are used.
in comparison to the control. In order to generate lists containing
transcripts only regulated by one of the ligands, transcripts were PREPARATION OF TOTAL RNA FOR qRT-PCR
selected that fulfilled the criteria for one of the ligands in compar- To validate the microarray data two-step RT-PCR was performed
ison to the control and in comparison to the two other ligands. on a subset of genes. To perform the validation on biological repli-
Transcripts that also fulfilled the criteria for one of the other lig- cates, new (in comparison to the RNA used for the arrays) total
ands in comparison to the control were excluded. The resulting RNA samples were prepared at three different cell passages.
transcripts, uniquely regulated by one of the ligands, were after-
qRT-PCR
ward filtered for a fold change of 1.5 in comparison to the control,
The total RNA was reverse transcribed into single-stranded cDNA
in order to focus the below mentioned functional analysis on the
using the Transcriptor First Strand cDNA Synthesis Kit (Roche
transcripts with the highest biological relevance. In order to study
Applied Science) according to the manufacturer’s protocol. The
differences between one ligand and the two other ligands as a
cDNA was transcribed using FastStart TaqMan Probe Master
group, transcripts were selected that fulfilled the criteria for the
(Rox) (Roche Applied Science). Probes were purchased from Uni-
two ligands in comparison to the control and to the other ligand.
versal ProbeLibrary (Roche). Probes were selected and primer
The resulting transcripts were afterward filtered for a fold change
sequences designed using the ProbeFinder software (Universal
of 1.5 in comparison to the control, in order to focus the below
ProbeLibrary, Roche). The primers were purchased from DNA-
mentioned functional analysis on the transcripts with the highest
technologies, Denmark. Primers and probes used are listed in
biological relevance.
Table 1. Per qRT-PCR assay the cDNA samples were run in

3 http://www.dchip.org 4 http://www.ingenuity.com

Table 1 | Primers and probes used for qRT-PCR.

Transcript Accession nr. Universal probe no. Primer Sequence 50 –30

18S 77 left gattgatagctctttctcgattcc

Right gacaaatcgctccaccaact
Ccnd1 (cyclin D1) NM_007631 67 Left gagattgtgccatccatgc
Right ctcttcgcacttctgctcct
Areg (amphiregulin) NM_009704 73 Left gacaagaaaatgggactgtgc
Right ggcttggcaatgattcaact
Egr2 (early growth response 2) X06746 60 Left ctacccggtggaagacctc
NM_010118 Right aatgttgatcatgccatctcc
HB-EGF (heparin-binding EGF-like growth factor) L07264 55 Left cgtgggacttctcatgtttagg
NM_010415 Right cgcccaacttcactttctct
Dusp6 (dual specificity phosphatase 6) NM_026268 66 Left tggtggagagtcggtcct
Right tggaacttactgaagccacctt
Jun-B (Jun-B oncogene) NM_008416 3 Left accacggagggagagaaaag
Right agttggcagctgtgcgtaa

www.frontiersin.org August 2013 | Volume 4 | Article 98 | 3

Versteyhe et al. Differential signaling through IGF-I receptor

quadruplets with 18S as the internal control gene, in 384-well ligands stimulate similar responses, the overlap is partial and we
optical plates on an ABI 7900HT Prism sequence detection sys- identified transcripts selectively regulated by each ligand.
tem (Applied Biosystems). Each 15 µl TaqMan reaction contained
1.5 µl cDNA, 7.5 µl 2× FastStart TaqMan Probe Master (Rox), TRANSCRIPTS SELECTIVELY REGULATED BY IGF-I, IGF-II, OR INSULIN
0.15 µl Universal Probe (10 µM), 0.15 µl left primer (20 µM), Transcripts selectively regulated by IGF-I
0.15 µl right primer (20 µM), and 5.55 µl PCR-grade water. PCR A total of 75 transcripts were only regulated by IGF-I (Table 3;
parameters were 50°C for 2 min, 95°C for 10 min, 40 cycles of fold change cut-off 1.5). Fold changes and p-values for insulin
95°C for 15 s, and 60°C for 1 min. For each gene and for each and IGF-II can be found in Table S5 in Supplementary Material.
biological replicate TaqMan PCR assays were performed in tripli- According to IPA the top five molecular and cellular functions
cates. The data were analyzed using Sequence Detector Software these transcripts are involved in are molecular transport, protein
(Applied Biosystems), where after the fold changes were calculated trafficking, post-translational modification, protein folding, and
by use of the ∆∆C t method (28). To compare the qRT-PCR data cell morphology.
with the microarray results, negative microarray fold changes were
converted into values between 0 and 1. When multiple probe sets Transcripts selectively regulated by IGF-II
for one gene were regulated on the microarrays, the average fold Eight transcripts were only regulated by IGF-II (see Table 4; fold
change was calculated. Significant differences in the qRT-PCR data change cut-off 1.5; for fold changes and p-values for insulin and
were calculated by a two-tailed t -test. IGF-I: see Table S6 in Supplementary Material). Two of these
transcripts were TNF receptor-associated factor 1 (Traf1) and
RESULTS TRAF and TNF receptor-associated protein (Ttrap), which are
AFFINITIES OF IGF-I, IGF-II, AND INSULIN FOR THE IGF-I RECEPTOR functionally related proteins.
In order to stimulate the IGF-I receptor on mouse fibroblasts with
concentrations that are adjusted for the relative affinities of IGF-I,
IGF-II, and insulin for the receptor, the apparent affinities of the
three ligands were measured by allowing the cold ligands to com-
pete with 125 I-IGF-I for binding to the IGF-I receptor (Figure 1).
IGF-I had a K d value of 1.49 ± 0.14 nM, IGF-II a K d value of
13.11 ± 0.69 nM, and insulin of 383 ± 27 nM. These results are in
accordance with the known relative affinities of the ligands for the
IGF-I receptor (29). Taking these relative affinities into account,
it was decided to stimulate the cells for 4 h with 20 nM IGF-I,
177 nM IGF-II, or 5168 nM insulin, concentrations then are near
saturation of the receptor with either ligand.

GLOBAL GENE REGULATION PATTERNS

FIGURE 1 | Affinities of insulin, IGF-I, and IGF-II for the IGF-I receptor. To
A total of 698 transcripts were regulated by both insulin and the determine the apparent affinities of the ligands for the IGF-I receptor on the
IGFs (fold changes and p-values for these transcripts are in Table mouse fibroblasts, homologous and heterologous radioligand competition
S1 in Supplementary Material). Table 2 shows the number of assays were performed in quadruplets. Three million cells/ml were
incubated with a constant concentration of 125 I-IGF-I (20,000 cpm/ml) and
transcripts regulated by each ligand in comparison to the con-
increasing concentrations of cold IGF-I, IGF-II, or insulin for 2.5 h (time
trol and the number of transcripts commonly regulated between needed to reach steady-state binding) at 15°C. After centrifugation unbound
ligands. Fold changes and p-values for these transcripts can be 125
I-IGF-I was removed and bound 125 I-IGF-I was counted in a gamma
found in Table S2 in Supplementary Material (IGF-I), Table S3 counter. Specifically bound 125 I-IGF-I/specifically bound 125 I-IGF-I at 0 nM cold
in Supplementary Material (IGF-II), and Table S4 in Supplemen- ligand was plotted versus the concentration of cold ligand. K d values were
calculated after fitting the data to a one-site model using a program
tary Material (insulin). All the transcripts regulated in common
developed by Ron M. Shymko and Andreas V. Groth. Results are
between ligands were either up-regulated by all regulating ligands averages ± standard deviations.
or down-regulated by all regulating ligands. Even though the three

Table 2 | Global gene regulation patterns.

Transcripts regulated in Fraction of transcripts also Fraction of transcripts also Fraction of transcripts also
comparison to control regulated by IGF-I regulated by IGF-II regulated by insulin

IGF-I 2715 1213 754

IGF-II 1779 1213 956
Insulin 1215 754 956

The number of transcripts regulated by each of the three ligands in comparison to the control and the number of transcripts commonly regulated between ligands (in
comparison to the control) are shown. Cut-offs for fold change and p-value are 1.2 and 0.05 respectively.

Frontiers in Endocrinology | Molecular and Structural Endocrinology August 2013 | Volume 4 | Article 98 | 4
Versteyhe et al. Differential signaling through IGF-I receptor

Table 3 | Transcripts selectively regulated by IGF-I.

Transcript Probe set Accession nr. Fold p-Value

(Affymetrix) change

Eif5: eukaryotic translation initiation factor 5 1415723_at BQ176989 1.54 0.000187

Srp54a /// Srp54b /// Srp54c: signal recognition particle 54a /// signal recognition particle 54b 1416153_at NM_011899 1.55 0.003558
/// signal recognition particle 54C
Pafah1b1: platelet-activating factor acetylhydrolase, isoform 1b, beta1 subunit 1417086_at BE688382 1.69 0.005799
Dnaja2: DnaJ (Hsp40) homolog, subfamily A, member 2 1417182_at C77509 1.67 0.000129
Orc2l: origin recognition complex, subunit 2-like (S. cerevisiae) 1418226_at BB830976 1.77 0.000088
Ctcf: CCCTC-binding factor 1418330_at BB836888 1.53 0.026056
AI837181: expressed sequence AI837181 1418775_at NM_134149 −1.86 0.007512
Il17rc: interleukin 17 receptor C 1419671_a_at NM_134159 −1.80 0.006468
Supt16h: suppressor of Ty 16 homolog (S. cerevisiae) 1419741_at AW536705 1.52 0.002900
Nap1l1: nucleosome assembly protein 1-like 1 1420477_at BG064031 1.51 0.000989
Shoc2: soc-2 (suppressor of clear) homolog (C. elegans) 1423129_at BQ032685 1.51 0.000692
Lin7c: lin-7 homolog C (C. elegans) 1423322_at BQ176612 1.68 0.000844
Stk17b: serine/threonine kinase 17b (apoptosis-inducing) 1423452_at AV173139 1.64 0.000103
Usp1: ubiquitin specific peptidase 1 1423675_at BC018179 1.55 0.008911
Nop14: NOP14 nucleolar protein homolog (yeast) 1423991_at BC024998 1.75 0.001692
Uso1: USO1 homolog, vesicle docking protein (yeast) 1424274_at BC016069 1.77 0.002483
Flad1: RFad1, flavin adenine dinucleotide synthetase, homolog (yeast) 1424421_at BC006806 −1.59 0.004350
Rbm26: RNA binding motif protein 26 1426803_at BM120471 1.71 0.031929
Ythdf3: YTH domain family 3 1426841_at BB183208 1.68 0.014072
Rbbp8: retinoblastoma binding protein 8 1427061_at BB167067 1.56 0.000050
Zc3h15: zinc finger CCCH-type containing 15 1427876_at BB703070 1.65 0.000917
Zmpste24: zinc metallopeptidase, STE24 homolog (S. cerevisiae) 1427923_at BM233793 1.52 0.005861
Spin4: spindlin family, member 4 1427985_at BC027796 2.17 0.001115
Fip1l1: FIP1 like 1 (S. cerevisiae) 1428280_at BM199874 1.59 0.022198
2810026P18Rik: RIKEN cDNA 2810026P18 gene 1428529_at AK012825 1.57 0.016748
Uba6: ubiquitin-like modifier activating enzyme 6 1428945_at BB417360 1.73 0.001773
Cep57: centrosomal protein 57 1428968_at AW457682 1.58 0.006762
Nat13: N-acetyltransferase 13 1428970_at AV113878 1.82 0.000018
1300003B13Rik: RIKEN cDNA 1300003B13 gene 1429690_at AK004870 1.56 0.012148
9030419F21Rik: RIKEN cDNA 9030419F21 gene 1433101_at AK018519 −1.70 0.026402
Ddx52: DEAD (Asp-Glu-Ala-Asp) box polypeptide 52 1434608_at BB132474 1.71 0.001952
Ankle2: ankyrin repeat and LEM domain containing 2 1434721_at AV378849 1.50 0.009946
Wapal: wings apart-like homolog (Drosophila) 1434835_at BM230523 1.59 0.006908
Tsr2: TSR2, 20S rRNA accumulation, homolog (S. cerevisiae) 1435170_at BQ177187 1.89 0.021023
Ube2n: ubiquitin-conjugating enzyme E2N 1435384_at BE980685 1.79 0.000704
Trpm4: transient receptor potential cation channel, subfamily M, member 4 1435549_at BI685685 −1.59 0.007237
Scyl2: SCY1-like 2 (S. cerevisiae) 1436313_at BM249802 1.91 0.003117
Mmgt1: membrane magnesium transporter 1 1436705_at BB262218 1.89 0.000040
Exoc5: exocyst complex component 5 1436817_at AV025913 1.70 0.003981
B230380D07Rik: RIKEN cDNA B230380D07 gene 1436841_at AV229336 1.84 0.040661
Arl13b: ADP-ribosylation factor-like 13B 1437021_at AV225959 1.59 0.000559
Eif1ay: eukaryotic translation initiation factor 1A, Y-linked 1437071_at BB471576 1.55 0.024542
Slc18a2: solute carrier family 18 (vesicular monoamine), member 2 1437079_at AV334638 2.71 0.002010
Rnps1: ribonucleic acid binding protein S1 1437359_at BI793607 −1.55 0.017189
Acvr2a: activin receptor IIA 1437382_at BG066107 1.71 0.005407
Mm.138561.1 1438307_at AV317732 1.54 0.008071
Fars2: phenylalanine-tRNA synthetase 2 (mitochondrial) 1439406_x_at BB530332 −1.56 0.015768
Sgol1: shugoshin-like 1 (S. pombe) 1439510_at BB410537 1.56 0.000354
Mm.44035.1 1440222_at BB530180 −1.87 0.004195
Mm.33045.1 1440272_at BB232473 1.58 0.001142

(Continued)

www.frontiersin.org August 2013 | Volume 4 | Article 98 | 5

Versteyhe et al. Differential signaling through IGF-I receptor

Table 3 | Continued

Transcript Probe set Accession nr. Fold p-Value

(Affymetrix) change

Sbno2: strawberry notch homolog 2 (Drosophila), mRNA (cDNA clone IMAGE:3376209) 1441840_x_at BB533975 −2.24 0.002180
Mm.37220.1 1444785_at AI503808 −1.72 0.011949
. . . Predicted gene/similar to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) . . . 1447999_x_at AI840508 −1.53 0.005202
Rab1: RAB1, member RAS oncogene family 1448210_at AW108405 1.65 0.000205
Lrrfip1: leucine rich repeat (in FLII) interacting protein 1 1448487_at NM_008515 1.60 0.002779
Pafah1b1: platelet-activating factor acetylhydrolase, isoform 1b, beta1 subunit 1448578_at BE688382 1.66 0.001433
Siah1a: seven in absentia 1A 1449733_s_at AA982064 1.66 0.006169
Kpna3: karyopherin (importin) alpha 3 1450386_at BM213828 1.53 0.006954
Twsg1: twisted gastrulation homolog 1 (Drosophila) 1450388_s_at BC004850 1.54 0.003421
Stk17b: serine/threonine kinase 17b (apoptosis-inducing) 1450997_at AV173139 2.04 0.003338
Yipf3: Yip1 domain family, member 3 1451284_at BC019384 −1.64 0.026951
LOC100044383 /// Pnpt1: similar to polynucleotide phosphorylase-like protein /// 1452676_a_at BB777815 1.67 0.000248
polyribonucleotide nucleotidyltransferase 1
6820431F20Rik: RIKEN cDNA 6820431F20 gene 1452997_at BE692399 1.85 0.009694
Gas2l3: growth arrest-specific 2-like 3 1453416_at BE199211 2.05 0.004200
Usp15: ubiquitin specific peptidase 15 1454036_a_at AK014891 1.57 0.028362
Arfip1: ADP-ribosylation factor interacting protein 1 1454916_s_at AV087417 1.59 0.000091
Alg10b: asparagine-linked glycosylation 10 homolog B (yeast, alpha-1,2-glucosyltransferase) 1454917_at BB795206 1.63 0.007541
Mm.24436.1 1455206_at BQ175276 1.51 0.014053
Ccdc127: coiled-coil domain containing 127 1455248_at AW542786 1.71 0.000473
Map3k7: mitogen-activated protein kinase kinase kinase 7 1455441_at AW547374 1.77 0.003661
Mm.178349.1 1456547_at BM119402 −2.02 0.026517
Lyrm5: LYR motif containing 5 (Lyrm5), mRNA 1459793_s_at AV301944 1.72 0.009359
Dnaja1: DnaJ (Hsp40) homolog, subfamily A, member 1 1460179_at BF141076 1.75 0.000232
Sfrs2ip: splicing factor, arginine/serine-rich 2, interacting protein 1460445_at AK012092 1.63 0.000533
AI848100: expressed sequence AI848100 1460573_at BM240684 1.51 0.000521

Transcripts that fulfilled the criteria of 1.2 and 0.05 for fold change and p-value respectively for IGF-I versus the control and versus insulin and IGF-II were selected.
Transcripts also regulated by insulin or IGF-II versus the control were excluded. The transcripts were then filtered for a fold change of 1.5 in comparison to the control.

Table 4 | Transcripts selectively regulated by IGF-II.

Transcript Probe set Accession nr. Fold p-Value

(Affymetrix) change

Jun oncogene 1417409_at NM_010591 1.72 0.002886

LOC100046232 /// Nfil3: similar to NFIL3/E4BP4 transcription factor /// nuclear factor, 1418932_at AY061760 1.55 0.007144
interleukin 3, regulated
expressed sequence AI467606 1433465_a_at BB234337 1.99 0.004292
MOB1, Mps one binder kinase activator-like 2A (yeast) 1434388_at BB023868 1.50 0.006665
LOC632433: ADP-ribosylation factor-like 4C /// similar to ADP-ribosylation factor-like protein 7 1436512_at BI964400 1.75 0.005263
LOC634417: fos-like antigen 2 /// similar to fos-like antigen 2 1437247_at BM245170 1.78 0.007075
TNF receptor-associated factor 1 (Traf1), mRNA 1445452_at BB218245 1.77 0.022057
Traf and TNF receptor-associated protein 1448706_at NM_019551 −1.68 0.000103

Transcripts that fulfilled the criteria of 1.2 and 0.05 for fold change and p-value respectively for IGF-II versus the control and versus insulin and IGF-I were selected.
Transcripts also regulated by insulin or IGF-I versus the control were excluded. The transcripts were then filtered for a fold change of 1.5 in comparison to the control.

Transcripts selectively regulated by insulin GENE REGULATION PATTERNS OF LIGAND PAIRS

Four transcripts were only regulated by insulin (see Table 5; Transcripts selectively or more potently regulated by the IGFs than
fold change cut-off 1.5; for fold changes and p-values by insulin
for IGF-I and IGF-II: see Table S7 in Supplementary Sixty five transcripts fulfilled the set criteria for IGF-I and IGF-II
Material). in comparison to the control and to insulin. The IGFs regulated

Frontiers in Endocrinology | Molecular and Structural Endocrinology August 2013 | Volume 4 | Article 98 | 6
Versteyhe et al. Differential signaling through IGF-I receptor

Table 5 | Transcripts selectively regulated by insulin.

Transcript Probe set (Affymetrix) Accession nr. Fold change p-Value

Solute carrier family 39 (zinc transporter), member 10 1433751_at BM250411 −2.01 0.001528
Mm.168098.1 1444326_at BB414484 1.55 0.030559
Kruppel-like factor 6 1447448_s_at C86813 −2.35 0.009036
Kruppel-like factor 6 1433508_at AV025472 −1.59 0.011606

Transcripts that fulfilled the criteria of 1.2 and 0.05 for fold change and p-value respectively for insulin versus the control and versus IGF-I and IGF-II were selected.
Transcripts also regulated by IGF-I or IGF-II versus the control were excluded. The transcripts were then filtered for a fold change of 1.5 in comparison to the control.

46 transcripts that were not regulated by insulin in comparison 1.51 on the array and 1.46 by qRT-PCR, two values that lay very
to the control (Table 6). Interestingly, the 19 transcripts that were close and are only just separated by the 1.5 fold change cut-off. In
also regulated by insulin were always more regulated by the IGFs conclusion, the qRT-PCR data validate very well the microarray
than by insulin. results.
The top five molecular and cellular functions in IPA for these
genes were cellular development, cellular growth and prolifer- DISCUSSION
ation, cell cycle, gene expression, and cell death and survival. We compared the gene expression responses stimulated by insulin,
Two of the top five canonical pathways represented by these IGF-I, and IGF-II through the IGF-I receptor using Affymetrix
genes were ErbB signaling and neuregulin signaling. The reg- gene expression profiling. In order to eliminate the influence of
ulated transcripts in these pathways were amphiregulin, epireg- the affinity of the ligands stimulating the receptor, we stimulated
ulin, heparin-binding EGF-like growth factor, FBJ osteosarcoma the IGF-I receptor on a mouse fibroblast cell line with concen-
oncogene, and Jun oncogene for ErbB signaling and amphireg- trations of insulin, IGF-I, and IGF-II that compensated for the
ulin, epiregulin, heparin-binding EGF-like growth factor, ERBB relative affinities of the ligands for the receptor on this cell line. Our
receptor feedback inhibitor 1, and myelocytomatosis oncogene for analyses revealed that these three ligands stimulate overlapping but
neuregulin signaling. specific gene expression responses.
Some of the regulated transcripts that appeared in our analyses
Selective gene regulation by insulin and IGF-II were also found by Mulligan et al. who studied the gene expres-
Twenty transcripts fulfilled the criteria for insulin and IGF-II in sion pattern after stimulating a chimeric receptor containing the
comparison to the control and to IGF-I (Table 7). Fourteen of intracellular domain of the IGF-I receptor (30), and Dupont et
these were not influenced by IGF-I in comparison to the control, al. who studied gene expression after stimulation of the IGF-I
while they were either down-regulated or up-regulated by insulin receptor with IGF-I (31). As in our study, Mulligan et al., e.g.,
and IGF-II. found the up-regulation of heparin-binding EGF-like growth fac-
The top five molecular and cellular functions in IPA for the 14 tor and Dupont et al. found the up-regulation of early growth
genes specifically regulated by insulin and IGF-II were cell cycle, response 1 and Jun oncogene. The fact that transcripts regulated
cellular assembly and organization, DNA replication, recombi- after stimulation of the IGF-I receptor with IGF-I found in our
nation and repair, cellular function and maintenance, and cell study and, e.g., the one by Dupont et al. only partially overlap, is
morphology. most likely due to the differences in experimental set-up. We used
a different cell line, concentrations of ligands, stimulation time,
Gene regulation by insulin and IGF-I microarray platform and normalization, and analysis methods and
Eleven transcripts fulfilled the criteria for insulin and IGF-I in criteria.
comparison to the control and to IGF-II (Table 8). In contrast to Boucher et al. recently showed that IGF-I and insulin, at equal
the selective gene regulation by the IGFs and by insulin and IGF-II, concentrations, regulate the expression of the same genes through
10 of these 11 transcripts were also, and more strongly, influenced the IGF-I receptor (15). Insulin does that with a smaller magnitude
by IGF-II. of response than IGF-I. We show here that when compensating
for the different affinities of the ligands, each ligand does specifi-
VALIDATION OF THE MICROARRAY DATA BY qRT-PCR cally influence the expression of certain genes through the IGF-I
To validate the microarray data qRT-PCR was performed for six receptor.
transcripts on the total RNA of three independent biological repli- Each ligand specifically regulated a group of transcripts that
cates. These RNA samples are independent of the RNA used to was not regulated by the other two ligands. When stimulat-
generate the microarray data. Fold changes were calculated in ing the IGF-I receptor with IGF-II for example, two of the
comparison to the control and plotted in Figure 2. For the IGFs, eight specifically regulated genes were Traf1 and Ttrap. Traf1
the regulation trends from the microarray experiments (Table 6) was up-regulated by IGF-II and is an inhibitor of apoptosis,
are confirmed by qRT-PCR for all six genes: the IGFs regulate which may be due to increased activation of nuclear factor-
these genes more potently than insulin. For insulin, gene regula- kappa B (NF-κB), an anti-apoptotic transcription factor (32–34).
tion (Table 6) was confirmed for four out of six genes (Areg, Egr2, Ttrap was down-regulated by IGF-II and inhibits the transcrip-
HB-EGF, and Jun-B). In addition, for Ccnd1 the fold change was tional activation of NF-κB (35). These results are consistent with

www.frontiersin.org August 2013 | Volume 4 | Article 98 | 7

Versteyhe et al. Differential signaling through IGF-I receptor

Table 6 | Transcripts selectively or more potently regulated by the IGFs than by insulin.

Transcript Probe set Accession FC p-Value FC p-Value FC p-Value

(Affymetrix) nr. IGF-I IGF-I IGF-II IGF-II insulin insulin

Dusp6: dual specificity phosphatase 6 1415834_at NM_026268 2.96 0.000037 4.45 0.000114 1.66 0.024401
Jun-B: Jun-B oncogene 1415899_at NM_008416 1.97 0.000470 3.03 0.000185 1.22 0.107818
Klf10: Kruppel-like factor 10 1416029_at NM_013692 2.28 0.006007 2.58 0.000466 1.34 0.004550
Errfi1: ERBB receptor feedback inhibitor 1 1416129_at NM_133753 2.48 0.000009 3.30 0.000797 1.50 0.002918
Nfe2l2: nuclear factor, erythroid derived 2, like 2 1416543_at NM_010902 1.77 0.000045 1.59 0.000011 1.10 0.286909
Egr1: early growth response 1 1417065_at NM_007913 2.06 0.000005 2.51 0.000152 1.37 0.002267
Ptgs2: prostaglandin-endoperoxide synthase 2 1417262_at M94967 5.01 0.002321 5.83 0.001415 1.88 0.001026
Ptgs2: prostaglandin-endoperoxide synthase 2 1417263_at M94967 5.12 0.004035 5.86 0.003544 1.82 0.010523
Klf4: Kruppel-like factor 4 (gut) 1417394_at BG069413 2.93 0.000277 2.91 0.001910 1.34 0.019087
Klf4: Kruppel-like factor 4 (gut) 1417395_at BG069413 2.38 0.000136 2.36 0.001509 1.10 0.330387
Ccnd1: cyclin D1 1417420_at NM_007631 2.19 0.000812 2.49 0.000605 1.53 0.008594
Ddit3: DNA-damage inducible transcript 3 1417516_at NM_007837 3.90 0.000022 3.52 0.007483 1.95 0.003623
Bhlhe40: basic helix-loop-helix family, member 1418025_at NM_011498 2.42 0.000026 3.46 0.000576 1.66 0.005081
e40
Rbpj: recombination signal binding protein for 1418114_at NM_009035 1.64 0.001503 1.64 0.042760 −1.01 0.869918
immunoglobulin kappa J region
HB-EGF: heparin-binding EGF-like growth factor 1418349_at L07264 2.93 0.000389 4.11 0.003861 1.67 0.016481
HB-EGF: heparin-binding EGF-like growth factor 1418350_at L07264 2.37 0.000879 3.43 0.002878 1.39 0.003493
Fzd2: frizzled homolog 2 (Drosophila) 1418533_s_at BB371406 −2.73 0.002491 −2.72 0.001879 −1.74 0.008244
Snai2: snail homolog 2 (Drosophila) 1418673_at NM_011415 2.55 0.003833 2.43 0.016438 1.45 0.039762
Arc: activity regulated cytoskeletal-associated 1418687_at NM_018790 3.46 0.004766 5.51 0.014618 1.72 0.065388
protein
Phlda1: pleckstrin homology-like domain, family 1418835_at NM_009344 2.50 0.000016 3.42 0.000137 1.45 0.006783
A, member 1
Ereg: epiregulin 1419431_at NM_007950 3.81 0.003989 4.98 0.007224 1.59 0.013385
Errfi1: ERBB receptor feedback inhibitor 1 1419816_s_at AI788755 2.18 0.000303 2.82 0.003084 1.43 0.013860
Vegfa: vascular endothelial growth factor A 1420909_at NM_009505 3.57 0.003003 3.60 0.001070 2.14 0.049047
Areg: amphiregulin 1421134_at NM_009704 18.39 0.004443 32.85 0.001366 6.46 0.018404
Hmga2: high mobility group AT-hook 2 1422851_at X58380 2.17 0.012765 2.90 0.015282 1.20 0.178787
Fos: FBJ osteosarcoma oncogene 1423100_at AV026617 2.79 0.000301 3.58 0.000988 1.43 0.011280
Spred1: sprouty protein with EVH-1 domain 1, 1423160_at BQ044290 1.65 0.002015 1.79 0.003587 1.18 0.246347
related sequence
Spred1: sprouty protein with EVH-1 domain 1, 1423161_s_at BQ044290 2.04 0.003684 1.95 0.004457 1.24 0.055176
related sequence
Socs5: suppressor of cytokine signaling 5 1423350_at AA510713 1.74 0.000238 2.15 0.001624 1.25 0.041765
Eif1a: eukaryotic translation initiation factor 1A 1424344_s_at BM200591 2.33 0.004717 1.79 0.023539 1.12 0.358396
Myc: myelocytomatosis oncogene 1424942_a_at BC006728 2.57 0.001522 3.41 0.001457 1.57 0.004404
Ppm1a: protein phosphatase 1A, magnesium 1425537_at AF259672 1.91 0.021188 1.70 0.022908 1.02 0.912487
dependent, alpha isoform
Egr2: early growth response 2 1427682_a_at X06746 2.39 0.000571 3.21 0.001597 −1.03 0.747696
Egr2: early growth response 2 1427683_at X06746 2.35 0.000002 3.19 0.000841 −1.16 0.214812
Cdc42ep2: CDC42 effector protein (Rho GTPase 1428750_at BF453885 −2.77 0.000119 −2.53 0.000292 −1.30 0.080566
binding) 2
Dusp4: dual specificity phosphatase 4 1428834_at AK012530 3.66 0.005728 5.33 0.003373 1.53 0.118230
Zbtb2: zinc finger and BTB domain containing 2 1434901_at BB484975 1.71 0.008994 1.68 0.004970 1.19 0.019503
Btaf1: BTAF1 RNA polymerase II, B-TFIID 1435249_at BG917504 2.28 0.001543 1.99 0.003586 1.34 0.009186
transcription factor-associated (Mot1 homolog,
S. cerevisiae)
Prkg2: protein kinase, cGMP-dependent, type II 1435460_at BB363188 2.41 0.000317 2.39 0.010622 1.26 0.091109
Tmcc3: transmembrane and coiled-coil 1435554_at BB771888 2.94 0.000570 2.85 0.000256 1.80 0.009428
domains 3

(Continued)

Frontiers in Endocrinology | Molecular and Structural Endocrinology August 2013 | Volume 4 | Article 98 | 8
Versteyhe et al. Differential signaling through IGF-I receptor

Table 6 | Continued

Transcript Probe set Accession FC p-Value FC p-Value FC p-Value

(Affymetrix) nr. IGF-I IGF-I IGF-II IGF-II insulin insulin

1810011O10Rik: RIKEN cDNA 1810011O10 gene 1435595_at AV016374 2.14 0.001640 2.01 0.002508 1.01 0.959922
Egr3: early growth response 3 1436329_at AV346607 3.82 0.000013 5.32 0.005082 1.23 0.105988
Marveld1: MARVEL (membrane-associating) 1436830_at BB324084 −1.91 0.000054 −1.68 0.007970 −1.07 0.296806
domain containing 1
Mex3b: mex3 homolog B (C. elegans) 1437152_at BG072837 2.66 0.000721 3.02 0.018407 1.21 0.436275
Bmp2k: BMP2 inducible kinase 1437419_at BB329439 2.35 0.003344 2.02 0.000029 1.39 0.033634
Zfp36l2: zinc finger protein 36, C3H type-like 2 1437626_at BB031791 2.15 0.000301 2.53 0.011093 1.43 0.036717
C130039O16Rik: RIKEN cDNA C130039O16 1444107_at BB091357 1.60 0.010486 1.69 0.022667 −1.02 0.894938
gene
Snai2: snail homolog 2 (Drosophila) 1447643_x_at BB040443 3.22 0.010688 2.43 0.003249 1.48 0.071908
Pogk: pogo transposable element with KRAB 1447864_s_at AV377712 2.20 0.016223 2.04 0.003467 1.31 0.014693
domain
Myd116: myeloid differentiation primary 1448325_at NM_008654 2.00 0.000179 2.01 0.006734 1.24 0.070585
response gene 116
Jun: Jun oncogene 1448694_at NM_010591 1.78 0.008793 1.90 0.011924 1.04 0.807786
Atf3: activating transcription factor 3 1449363_at BC019946 2.88 0.001391 2.90 0.004451 1.92 0.005831
Ces1: carboxylesterase 1 1449486_at NM_021456 −2.01 0.018317 −1.96 0.023919 −1.16 0.351288
Hmga2: high mobility group AT-hook 2 1450780_s_at X58380 2.74 0.006298 3.29 0.010165 1.43 0.035048
Hmga2: high mobility group AT-hook 2 1450781_at X58380 2.36 0.018209 3.22 0.007611 1.31 0.019092
Gtpbp4: GTP binding protein 4 1450873_at AI987834 3.10 0.000236 2.75 0.006583 1.87 0.002062
Pvr: poliovirus receptor 1451160_s_at BB049138 2.21 0.011238 2.13 0.002468 1.47 0.001190
Arl4c /// LOC632433: ADP-ribosylation factor-like 1454788_at BQ176306 1.70 0.005522 1.57 0.022003 1.00 0.976940
4C /// similar to ADP-ribosylation factor-like
protein 7
Zbtb11: zinc finger and BTB domain 1454826_at BM195115 2.04 0.001240 1.78 0.015361 1.11 0.277271
containing 11
Foxn2: forkhead box N2 1454831_at AV221013 2.85 0.000516 2.85 0.004267 1.71 0.037944
Tmcc3: transmembrane and coiled-coil 1454889_x_at BB711990 1.99 0.000120 1.89 0.003292 1.29 0.001608
domains 3
Spty2d1: SPT2, Suppressor of Ty, domain 1455130_at BM242524 2.06 0.000339 2.04 0.000495 1.34 0.043771
containing 1 (S. cerevisiae)
Plcxd2: phosphatidylinositol-specific 1455324_at BQ176176 4.03 0.000971 3.50 0.005766 2.21 0.007254
phospholipase C, X domain containing 2
LOC631639 /// Lonrf1: similar to CG32369-PB, 1455665_at BB705689 4.56 0.003239 4.17 0.002087 2.17 0.008852
isoform B /// LON peptidase N-terminal domain
and ring finger 1
Nfkbie: nuclear factor of kappa light polypeptide 1458299_s_at BB820441 1.71 0.000989 1.94 0.002873 1.24 0.053832
gene enhancer in B-cells inhibitor, epsilon

Transcripts that fulfilled the criteria of 1.2 and 0.05 for fold change and p-value respectively for IGF-I and IGF-II versus the control and versus insulin were selected. The
transcripts were then filtered for a fold change of 1.5 in comparison to the control. Transcripts that also fulfilled the criteria for insulin versus the control are in italic.
FC, fold change.

the known anti-apoptotic activity of IGF-II through the IGF-I between the two pathways were amphiregulin, epiregulin, and
receptor. heparin-binding EGF-like growth factor (HB-EGF). These were
In order to identify common gene regulation patterns between up-regulated more potently by the IGFs than by insulin. Pandini
ligands, we studied the gene expression induced by two ligands et al. showed that amphiregulin, HB-EGF, and epiregulin were
in comparison to the control and to the third ligand. Interest- similarly up-regulated by insulin and IGF-II through the insulin
ingly, a group of 65 transcripts was identified to be selectively or receptor isoform A in mouse fibroblasts (19). Mulligan et al.
more potently regulated by the IGFs than by insulin. ErbB signal- showed that HB-EGF transcript expression was up-regulated more
ing and neuregulin signaling were significant canonical pathways potently after signaling through the IGF-I receptor than through
over-represented in the data set; regulated transcripts in common the insulin receptor in fibroblasts (30). Amphiregulin, HB-EGF,

www.frontiersin.org August 2013 | Volume 4 | Article 98 | 9

Versteyhe et al. Differential signaling through IGF-I receptor

Table 7 | Selective gene regulation by insulin and IGF-II.

Transcript Probe set Accession FC p-Value FC p-Value FC p-Value

(Affymetrix) nr. insulin insulin IGF-II IGF-II IGF-I IGF-I

Dusp6: dual specificity phosphatase 6 1415834_at NM_026268 1.66 0.024401 4.45 0.000114 2.96 0.000037
Nusap1: nucleolar and spindle associated protein 1 1416309_at BC009096 −1.61 0.000141 −1.61 0.000022 −1.14 0.097812
Ndc80: NDC80 homolog, kinetochore complex 1417445_at NM_023294 −1.73 0.000121 −1.61 0.000253 −1.16 0.056240
component (S. cerevisiae)
Ghr: growth hormone receptor 1417962_s_at NM_010284 −1.67 0.008693 −1.69 0.008944 −1.15 0.197168
Bhlhe40: basic helix-loop-helix family, member e40 1418025_at NM_011498 1.66 0.005081 3.46 0.000576 2.42 0.000026
Nfyb: nuclear transcription factor-Y beta 1419267_at AV250496 1.53 0.007996 1.60 0.005883 2.43 0.005169
Areg: amphiregulin 1421134_at NM_009704 6.46 0.018404 32.85 0.001366 18.39 0.004443
PQlc2: PQ loop repeat containing 2 1425632_a_at BC019216 2.31 0.001027 2.12 0.001076 1.40 0.029326
Cebpb: CCAAT/enhancer binding protein (C/EBP), 1427844_a_at AB012278 1.74 0.018553 1.80 0.005586 1.13 0.445063
beta
Sema3c: sema domain, immunoglobulin domain (Ig), 1429348_at AK004119 −1.70 0.006766 −1.72 0.008802 1.03 0.733222
short basic domain, secreted (semaphorin) 3C
Cyld: cylindromatosis (turban tumor syndrome) 1429617_at BM119209 −1.61 0.005787 −1.50 0.003897 −1.03 0.807135
Bop1: block of proliferation 1 1430491_at AV128350 1.78 0.013556 1.93 0.006039 1.04 0.820081
Rhobtb3: Rho-related BTB domain containing 3 1433647_s_at BM942043 −1.62 0.027000 −1.64 0.022981 −1.02 0.890963
Sc5d: sterol-C5-desaturase (fungal ERG3, 1434520_at AU067703 2.18 0.006626 2.25 0.001725 3.34 0.000004
delta-5-desaturase) homolog (S. cerevisae)
Foxp1: forkhead box P1 1435222_at BM220880 −2.10 0.010890 −1.94 0.017867 −1.44 0.055486
Kif11: kinesin family member 11 1435306_a_at BM234447 −1.92 0.003119 −1.76 0.006149 −1.20 0.115116
Ppm2c: protein phosphatase 2C, magnesium 1438201_at AV290622 −2.18 0.000445 −1.54 0.028117 1.05 0.650024
dependent, catalytic subunit
Matr3: Matrin 3, mRNA (cDNA clone MGC:28206 1441272_at BI249188 2.63 0.004643 2.78 0.000614 1.72 0.006058
IMAGE:3989914)
Kif11: kinesin family member 11 1452314_at BB827235 −2.02 0.003923 −1.54 0.017306 1.11 0.406989
Kif11: kinesin family member 11 1452315_at BB827235 −1.85 0.000158 −1.83 0.000706 −1.13 0.347961

Transcripts that fulfilled the criteria of 1.2 and 0.05 for fold change and p-value respectively for insulin and IGF-II versus the control and versus IGF-I were selected. The
transcripts were then filtered for a fold change of 1.5 in comparison to the control. Transcripts that also fulfilled the criteria for IGF-I versus the control are in italic. FC,
fold change.

Table 8 | Gene regulation by insulin and IGF-I.

Transcript Probe set Accession FC p-Value FC p-Value FC p-Value

(Affymetrix) nr. insulin insulin IGF-I IGF-I IGF-II IGF-II

Dusp6: dual specificity phosphatase 6 1415834_at NM_026268 1.66 0.024401 2.96 0.000037 4.45 0.000114
Slc40a1: solute carrier family 40 (iron-regulated 1417061_at AF226613 −2.63 0.000644 −2.99 0.000973 −4.48 0.000804
transporter), member 1
Fosl1: fos-like antigen 1 1417487_at U34245 3.85 0.002671 4.54 0.000291 7.87 0.003065
Fosl1: fos-like antigen 1 1417488_at U34245 4.48 0.001278 5.31 0.001160 8.69 0.001387
Bhlhe40: basic helix-loop-helix family, member e40 1418025_at NM_011498 1.66 0.005081 2.42 0.000026 3.46 0.000576
Rgs2: regulator of G-protein signaling 2 1419248_at AF215668 1.69 0.003144 1.99 0.033929 1.04 0.849605
Areg: amphiregulin 1421134_at NM_009704 6.46 0.018404 18.39 0.004443 32.85 0.001366
LOC100047324 /// Sesn1: similar to Sesn1 protein 1433711_s_at BG076140 −1.63 0.016249 −1.71 0.017257 −2.64 0.002200
/// sestrin 1
Plk3: polo-like kinase 3 (Drosophila) 1434496_at BM947855 2.74 0.002507 2.21 0.007719 4.79 0.000021
Mm.52043.1 1437199_at BB442784 2.05 0.035779 2.27 0.022600 4.81 0.000445
D8Ertd82e: DNA segment, Chr 8, ERATO Doi 82, 1442434_at BM195829 2.17 0.008597 2.55 0.004759 4.47 0.001872
expressed

Transcripts that fulfilled the criteria of 1.2 and 0.05 for fold change and p-value respectively for insulin and IGF-I versus the control and versus IGF-II were selected. The
transcripts were then filtered for a fold change of 1.5 in comparison to the control. Transcripts that also fulfilled the criteria for IGF-II versus the control are in italic. FC,
fold change.

Frontiers in Endocrinology | Molecular and Structural Endocrinology August 2013 | Volume 4 | Article 98 | 10
Versteyhe et al. Differential signaling through IGF-I receptor

and epiregulin are all EGF receptor (also named ErbB-1 or HER1)
ligands (36). HB-EGF acts both as a regulated autocrine/paracrine
and a juxtacrine growth factor (36, 37). Amphiregulin has been
suggested to have both growth inhibitory and stimulatory effects
(38). Epiregulin is a growth promoter in primary rat hepatocytes
(39, 40) and an autocrine growth factor in human keratinocytes
(41). HB-EGF and amphiregulin also bind and activate ErbB-3 and
HB-EGF binds and activates ErbB-4 (42), just like the neuregulins,
which bind ErbB-3 and ErbB-4. HB-EGF induces chemotaxis after
stimulation of ErbB-4 (43).
As for the IGFs, we identified 14 transcripts selectively regu-
lated by insulin and IGF-II. Using the same analysis criteria, this
was however not the case when looking at insulin and IGF-I as a
group. Ten of the 11 transcripts that were regulated by insulin and
IGF-I in comparison to the control and IGF-II were also regulated
by IGF-II. So the IGFs on one hand and insulin and IGF-II on the
other hand seem to provoke more similar gene expression patterns
than insulin and IGF-I. This is in accordance with the numbers
FIGURE 2 | Validation of microarray data by qRT-PCR. Two-step RT-PCR
presented in Table 2. Of all the transcripts regulated by insulin in
was performed on a subset of transcripts. 18S was used as an internal
comparison to the control, a larger fraction was also regulated by control. The results are expressed as fold change in comparison to the
IGF-II than by IGF-I, even though IGF-I overall regulated more control (unstimulated samples). Full bars represent the microarray data
transcripts than IGF-II. (Table 6). Bars with patterns represent the average qRT-PCR
Although some of the transcripts identified in this study were results ± standard deviations. Black: insulin, gray: IGF-I, light gray: IGF-II.
Significant differences in the qRT-PCR data were calculated by a two-tailed
involved in metabolic functions, the overall biological patterns
t -test. ∧ Significantly up-regulated by insulin in comparison to the control at
were of a non-metabolic nature. This is not surprising, consider- the 1.5 fold change and 0.05 p-value level. *Significantly more up-regulated
ing the tissue origin of the cell line used. From this study, no general by this IGF than by insulin at the 0.05 p-value level.
conclusions could thus be drawn on whether certain ligands cre-
ated a more metabolic or mitogenic response in comparison to the
other ligands. by the other two ligands. Also, insulin and IGF-I seemed to stimu-
Many of the functions, pathways, and genes mentioned above late the least overlapping response. The different gene expression
are consistent with the known effects of insulin, IGF-I, and IGF-II. profiles for the three ligands might explain some of their differ-
One could thus speculate that these differences in gene expres- ent biological effects. These results also add to the accumulating
sion might account for some of the different biological effects of evidence that different ligands can bind to the same receptor and
these three ligands. It should be mentioned that these gene expres- stimulate different cellular responses and that the nature of a ligand
sion patterns were measured after stimulating the receptor with bound to a receptor, and not just its concentration and affinity, is
supraphysiological concentrations of ligands. Therefore studying determinant for the downstream cellular response. Further studies
the concentration dependence of these gene expression profiles, should help bringing a mechanistic understanding to the different
together with performing time series of gene expression, could functional consequences of different ligands activating the same
provide a more subtle picture. receptor.
Since the influences of affinity of the three ligands were largely
ACKNOWLEDGMENTS
accounted for in this study, it is likely that the differences in gene
We thank Susanne Smed and Elisabeth Schiefloe for help with
expression are due to intrinsic properties of each ligand. Different
scanning of the microarrays. The Hagedorn Research Institute
suggestions have been made to explain the mechanism responsi-
and the Receptor Systems Biology Laboratory were independent
ble for this signaling specificity. Both differences in ligand binding
basic research components of Novo Nordisk A/S. Soetkin Ver-
kinetics and internalization properties have been correlated with
steyhe, Jane Palsgaard, and Maja Jensen were the recipient of
different responses after stimulating the insulin receptor with dif-
an Industrial Ph.D. scholarship from the Danish Ministry of
ferent ligands (21–23, 44–46). More studies are needed in order
Science, Technology and Innovation. Steven Gray was the recip-
to clarify at which level the cellular signal of different ligands
ient of a BIO + IT postdoctoral fellowship from the Oresund IT
stimulating the same receptor diverges.
Academy.
CONCLUSION SUPPLEMENTARY MATERIAL
We studied the gene expression patterns after stimulating the IGF- The Supplementary Material for this article can be found
I receptor with equipotent concentrations of IGF-I, IGF-II, and online at http://www.frontiersin.org/Molecular_and_Structural_
insulin by microarray gene expression profiling and found signifi- Endocrinology/10.3389/fendo.2013.00098/abstract
cant differences in responses between the three ligands. Each ligand
specifically regulated a group of transcripts that was not regulated Table S1 | Transcripts regulated by insulin and the IGFs.

www.frontiersin.org August 2013 | Volume 4 | Article 98 | 11

Versteyhe et al. Differential signaling through IGF-I receptor

Table S2 | Transcripts regulated by IGF-I. Table S5 | Transcripts selectively regulated by IGF-I.

Table S3 | Transcripts regulated by IGF-II. Table S6 | Transcripts selectively regulated by IGF-II.

Table S4 | Transcripts regulated by insulin. Table S7 | Transcripts selectively regulated by insulin.

REFERENCES 270:14975–82. doi:10.1074/jbc.270. Klein HH, et al. Sustained sig- Endocrinol (2004) 18:2502–12. doi:
1. Cohen P. Overview of the IGF-I 25.14975 naling from the insulin receptor 10.1210/me.2004-0183
system. Horm Res (2006) 65(Suppl 12. Brown J, Jones EY, Forbes BE. after stimulation with insulin ana- 30. Mulligan C, Rochford J, Denyer G,
1):3–8. doi:10.1159/000090640 Keeping IGF-II under control: logues exhibiting increased mito- Stephens R, Yeo G, Freeman T, et
2. Monzavi R, Cohen P. IGFs and lessons from the IGF-II-IGF2R crys- genic potency. Biochem J (1996) al. Microarray analysis of insulin
IGFBPs: Role in health and dis- tal structure. Trends Biochem Sci 315(Pt 1):271–9. and insulin-like growth factor-1
ease. Best Pract Res Clin Endocrinol (2009) 34:612–9. doi:10.1016/j.tibs. 22. Shymko RM, De Meyts P, Thomas (IGF-1) receptor signaling reveals
Metab (2002) 16:433–47. doi:10. 2009.07.003 R. Logical analysis of timing- the selective up-regulation of the
1053/beem.2002.0212 13. Laviola L, Natalicchio A, Giorgino F. dependent receptor signaling speci- mitogen heparin-binding EGF-like
3. Saltiel AR, Kahn CR. Insulin sig- The IGF-I signaling pathway. Curr ficity: application to the insulin growth factor by IGF-1. J Biol Chem
naling and the regulation of glu- Pharm Des (2007) 13:663–9. doi:10. receptor metabolic and mitogenic (2002) 277:42480–7. doi:10.1074/
cose and lipid metabolism. Nature 2174/138161207780249146 signaling pathways. Biochem J jbc.M206206200
(2001) 414:799–806. doi:10.1038/ 14. Dupont J, LeRoith D. Insulin and (1997) 326(Pt 2):463–9. 31. Dupont J, Khan J, Qu BH, Met-
414799a insulin-like growth factor I recep- 23. Shymko RM, Dumont E, De Meyts zler P, Helman L, LeRoith D. Insulin
4. Taniguchi CM, Emanuelli B, Kahn tors: similarities and differences P, Dumont JE. Timing-dependence and IGF-1 induce different pat-
CR. Critical nodes in signaling path- in signal transduction. Horm Res of insulin-receptor mitogenic ver- terns of gene expression in mouse
ways: insights into insulin action. (2001) 55(Suppl 2):22–6. doi:10. sus metabolic signaling: a plausible fibroblast NIH-3T3 cells: identifica-
Nat Rev Mol Cell Biol (2006) 7:85– 1159/000063469 model based on coincidence of hor- tion by cDNA microarray analysis.
96. doi:10.1038/nrm1837 15. Boucher J, Tseng YH, Kahn CR. mone and effector binding. Biochem Endocrinology (2001) 142:4969–75.
5. Siddle K. Signalling by insulin Insulin and insulin-like growth J (1999) 339(Pt 3):675–83. doi:10. doi:10.1210/en.142.11.4969
and IGF receptors: supporting acts factor-1 receptors act as ligand- 1042/0264-6021:3390675 32. Karin M, Lin A. NF-κB at the
and new players. J Mol Endocrinol specific amplitude modulators of 24. Jensen M, Palsgaard J, Borup R, De crossroads of life and death. Nat
(2011) 47:R1–10. doi:10.1530/JME- a common pathway regulating Meyts P, Schäffer L. Activation of Immunol (2002) 3:221–7. doi:10.
11-0022 gene transcription. J Biol Chem the insulin receptor (IR) by insulin 1038/ni0302-221
6. Siddle K. Molecular basis of sig- (2010) 285:17235–45. doi:10.1074/ and a synthetic peptide has differ- 33. Gupta S. Molecular signaling in
nalling specificity of insulin and IGF jbc.M110.118620 ent effects on gene expression in IR- death receptor and mitochondrial
receptors: neglected corners and 16. Kim JJ, Accili D. Signaling through transfected L6 myoblasts. Biochem pathways of apoptosis (Review). Int
recent advances. Front Endocrinol IGF-I and insulin receptors: where J (2008) 412:435–45. doi:10.1042/ J Oncol (2003) 22:15–20.
(Lausanne) (2012) 3:34. doi:10. is the specificity? Growth Horm IGF BJ20080279 34. Arch RH, Gedrich RW, Thompson
3389/fendo.2012.00034 Res (2002) 12:84–90. doi:10.1054/ 25. Dittmer F, Ulbrich EJ, Hafner A, CB. Tumor necrosis factor receptor-
7. De Meyts P. Insulin and its recep- ghir.2002.0265 Schmahl W, Meister T, Pohlmann associated factors (TRAFs) – a fam-
tor: structure, function and evolu- 17. Frasca F, Pandini G, Scalia P, Sci- R, et al. Alternative mechanisms ily of adapter proteins that regulates
tion. Bioessays (2004) 26:1351–62. acca L, Mineo R, Costantino A, for trafficking of lysosomal enzymes life and death. Genes Dev (1998)
doi:10.1002/bies.20151 et al. Insulin receptor isoform A, in mannose-6-phosphate receptor- 12:2821–30. doi:10.1101/gad.12.18.
8. De Meyts P, Wallach B, Christof- a newly recognized, high-affinity deficient mice are cell-type-specific. 2821
fersen CT, Ursø B, Grønskov K, insulin-like growth factor II recep- J Cell Sci (1999) 112:1591–7. 35. Pype S, Declercq W, Ibrahimi
Latus LJ, et al. The insulin-like tor in fetal and cancer cells. Mol Cell 26. Irizarry RA, Hobbs B, Collin A, Michiels C, Van Rietschoten
growth factor-I receptor. Structure, Biol (1999) 19:3278–88. F, Beazer-Barclay YD, Antonellis JG, Dewulf N, et al. TTRAP,
ligand-binding mechanism and 18. Morrione A, Valentinis B, Xu SQ, KJ, Scherf U, et al. Exploration, a novel protein that associates
signal transduction. Horm Yumet G, Louvi A, Efstratiadis A, normalization, and summaries of with CD40, tumor necrosis
Res (1994) 42:152–69. et al. Insulin-like growth factor II high density oligonucleotide array factor (TNF) receptor-75 and
doi:10.1159/000184188 stimulates cell proliferation through probe level data. Biostatistics (2003) TNF receptor-associated fac-
9. Moller DE, Yokota A, Caro JF, the insulin receptor. Proc Natl Acad 4:249–64. doi:10.1093/biostatistics/ tors (TRAFs), and that inhibits
Flier JS. Tissue-specific expression Sci U S A (1997) 94:3777–82. doi: 4.2.249 nuclear factor-κ B activation. J
of two alternatively spliced insulin 10.1073/pnas.94.8.3777 27. Li C, Wong WH. Model-based Biol Chem (2000) 275:18586–93.
receptor mRNAs in man. Mol 19. Pandini G, Medico E, Conte E, Sci- analysis of oligonucleotide arrays: doi:10.1074/jbc.M000531200
Endocrinol (1989) 3:1263–9. doi:10. acca L, Vigneri R, Belfiore A. Dif- expression index computation and 36. Harris RC, Chung E, Coffey RJ.
1210/mend-3-8-1263 ferential gene expression induced outlier detection. Proc Natl Acad Sci EGF receptor ligands. Exp Cell
10. Sesti G, Tullio AN, D’Alfonso R, by insulin and insulin-like growth U S A (2001) 98:31–6. doi:10.1073/ Res (2003) 284:2–13. doi:10.1016/
Napolitano ML, Marini MA, Bor- factor-II through the insulin recep- pnas.98.1.31 S0014-4827(02)00105-2
boni P, et al. Tissue-specific expres- tor isoform A. J Biol Chem 28. Livak KJ, Schmittgen TD. Analy- 37. Raab G, Klagsbrun M. Heparin-
sion of two alternatively spliced iso- (2003) 278:42178–89. doi:10.1074/ sis of relative gene expression binding EGF-like growth factor.
forms of the human insulin recep- jbc.M304980200 data using real-time quantitative Biochim Biophys Acta (1997)
tor protein. Acta Diabetol (1994) 20. Malaguarnera R, Sacco A, Voci C, PCR and the 2(-Delta Delta C(T)) 1333:F179–99.
31:59–65. doi:10.1007/BF00570536 Pandini G, Vigneri R, Belfiore A. method. Methods (2001) 25:402–8. 38. Shoyab M, McDonald VL, Bradley
11. Schmidt B, Kiecke-Siemsen C, Proinsulin binds with high affin- doi:10.1006/meth.2001.1262 JG, Todaro GJ. Amphiregulin: a
Waheed A, Braulke T, von Figura ity the insulin receptor isoform 29. Denley A, Bonython ER, Booker bifunctional growth-modulating
K. Localization of the insulin- A and predominantly activates the GW, Cosgrove LJ, Forbes BE, Ward glycoprotein produced by the phor-
like growth factor II binding mitogenic pathway. Endocrinology CW, et al. Structural determi- bol 12-myristate 13-acetate-treated
site to amino acids 1508-1566 (2012) 153:2152–63. doi:10.1210/ nants for high-affinity binding of human breast adenocarcinoma
in repeat 11 of the mannose-6- en.2011-1843 insulin-like growth factor II to cell line MCF-7. Proc Natl Acad
phosphate/insulin-like growth fac- 21. Hansen BF, Danielsen GM, Drejer insulin receptor (IR)-A, the exon Sci U S A (1988) 85:6528–32.
tor II receptor. J Biol Chem (1995) K, Sørensen AR, Wiberg FC, 11 minus isoform of the IR. Mol doi:10.1073/pnas.85.17.6528

Frontiers in Endocrinology | Molecular and Structural Endocrinology August 2013 | Volume 4 | Article 98 | 12
Versteyhe et al. Differential signaling through IGF-I receptor

39. Komurasaki T, Toyoda H, Uchida D, activate distinct subsets of ErbB (2007) 282:35179–86. doi:10.1074/ Citation: Versteyhe S, Klaproth B, Borup
Nemoto N. Mechanism of growth receptors and differ in their bio- jbc.M704599200 R, Palsgaard J, Jensen M, Gray SG and
promoting activity of epiregulin in logical activities. J Biol Chem 46. Morcavallo A, Genua M, Palummo De Meyts P (2013) IGF-I, IGF-II, and
primary cultures of rat hepatocytes. (1996) 271:6071–6. doi:10.1074/ A, Kletvikova E, Jiracek J, Brzo- insulin stimulate different gene expres-
Growth Factors (2002) 20:61–9. doi: jbc.271.11.6071 zowski AM, et al. Insulin and sion responses through binding to the
10.1080/08977190290024192 43. Elenius K, Paul S, Allison G, insulin-like growth factor II dif- IGF-I receptor. Front. Endocrinol. 4:98.
40. Toyoda H, Komurasaki T, Uchida D, Sun J, Klagsbrun M. Activation of ferentially regulate endocytic sort- doi: 10.3389/fendo.2013.00098
Takayama Y, Isobe T, Okuyama T, HER4 by heparin-binding EGF-like ing and stability of insulin recep- This article was submitted to Frontiers in
et al. Epiregulin. A novel epidermal growth factor stimulates chemo- tor isoform A. J Biol Chem Molecular and Structural Endocrinology,
growth factor with mitogenic activ- taxis but not proliferation. EMBO (2012) 287:11422–36. doi:10.1074/ a specialty of Frontiers in Endocrinology.
ity for rat primary hepatocytes. J J (1997) 16:1268–78. doi:10.1093/ jbc.M111.252478 Copyright © 2013 Versteyhe, Klaproth,
Biol Chem (1995) 270:7495–500. emboj/16.6.1268 Borup, Palsgaard, Jensen, Gray and De
41. Shirakata Y, Komurasaki T, Toy- 44. Drejer K. The bioactivity of insulin Conflict of Interest Statement: The Meyts. This is an open-access article dis-
oda H, Hanakawa Y, Yamasaki K, analogues from in vitro receptor authors declare that the research was tributed under the terms of the Creative
Tokumaru S, et al. Epiregulin, a binding to in vivo glucose uptake. conducted in the absence of any com- Commons Attribution License (CC BY).
novel member of the epidermal Diabetes Metab Rev (1992) 8:259– mercial or financial relationships that The use, distribution or reproduction in
growth factor family, is an autocrine 85. doi:10.1002/dmr.5610080305 could be construed as a potential con- other forums is permitted, provided the
growth factor in normal human 45. Jensen M, Hansen B, De Meyts flict of interest. original author(s) or licensor are cred-
keratinocytes. J Biol Chem (2000) P, Schäffer L, Ursø B. Activation ited and that the original publication in
275:5748–53. doi:10.1074/jbc.275. of the insulin receptor by insulin Received: 28 February 2013; paper pend- this journal is cited, in accordance with
8.5748 and a synthetic peptide leads to ing published: 21 March 2013; accepted: accepted academic practice. No use, dis-
42. Beerli RR, Hynes NE. Epider- divergent metabolic and mitogenic 26 July 2013; published online: 09 August tribution or reproduction is permitted
mal growth factor-related peptides signaling and responses. J Biol Chem 2013. which does not comply with these terms.

www.frontiersin.org August 2013 | Volume 4 | Article 98 | 13