0% found this document useful (0 votes)
72 views7 pages

Childhood Diarrhoea and E. coli in Thailand

This study analyzed 2629 E. coli isolates collected between 1996-2000 from 2100 Thai children under 12 with acute diarrhea. The isolates were tested for virulence markers and adherence patterns to identify the five major diarrheagenic E. coli pathotypes (ETEC, EPEC, EIEC, STEC, EAEC). EAEC was found to be the most prevalent pathotype, identified in 10.2-12.5% of isolates annually. EPEC and ETEC were also commonly identified, in 0-8% and 2-5.4% of isolates respectively. The isolation rates of pathotypes generally decreased with increasing age of the children. About 38% of diarrheagenic E. coli

Uploaded by

Avisena Azis
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
72 views7 pages

Childhood Diarrhoea and E. coli in Thailand

This study analyzed 2629 E. coli isolates collected between 1996-2000 from 2100 Thai children under 12 with acute diarrhea. The isolates were tested for virulence markers and adherence patterns to identify the five major diarrheagenic E. coli pathotypes (ETEC, EPEC, EIEC, STEC, EAEC). EAEC was found to be the most prevalent pathotype, identified in 10.2-12.5% of isolates annually. EPEC and ETEC were also commonly identified, in 0-8% and 2-5.4% of isolates respectively. The isolation rates of pathotypes generally decreased with increasing age of the children. About 38% of diarrheagenic E. coli

Uploaded by

Avisena Azis
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

Journal of Medical Microbiology (2004), 53, 237–243 DOI 10.1099/jmm.0.

05413-0

Prevalence of childhood diarrhoea-associated


Escherichia coli in Thailand
Orn-Anong Ratchtrachenchai,1 Sarayoot Subpasu,1 Hideo Hayashi2 and
William Ba-Thein3
1
Correspondence Enteric Laboratory, National Institute of Health, Department of Medical Sciences, Ministry of Public
William Ba-Thein Health, Tiwanonth Road, Amphur Muang Nonthaburi, 11000, Thailand
[email protected] 2
Department of Human Nutrition, Faculty of Contemporary Sciences, Chugoku-Gakuen University,
83 Niwase, Okayama, 701-0197, Japan
3
Department of Infection Biology, Institute of Basic Medical Sciences, University of Tsukuba, Tsukuba,
305-8575, Japan

Escherichia coli isolates (n ¼ 2629) were collected between 1996 and 2000 from 2100 Thai
children less than 12 years of age with acute diarrhoea. Enterotoxigenic (ETEC), enteroinvasive
(EIEC), Shiga-toxin-producing (STEC), enteropathogenic (EPEC) and enteroaggregative (EAEC) E.
coli were identified by their virulence marker profiles, as determined by multiplex PCR, and HeLa cell-
adherence patterns. Serogroups of isolates were determined using 43 monovalent O antisera. Of
2629 isolates, 16.9 % were identified as diarrhoeagenic E. coli, and the mean isolation rates per year
were 10.2 % for EAEC (range 8–12.5 %), 3.2 % for EPEC (0–8 %), 3.0 % for ETEC (2–5.4 %),
0.5 % for EIEC (0–1 %) and 0.04 % for STEC (0–0.1 %). The isolation rates of pathotypes from four
different age groups (0–5 months, 6–11 months, 1–2 years and 2–12 years) in 905 children
whose ages were recorded were respectively 19.3, 18.2, 9.1 and 8.1 % for EAEC, 3.1, 4.3, 1.7 and
2.2 % for EPEC and 2.6, 2.3, 1.3 and 5 % for ETEC. About 38 % of diarrhoeagenic E. coli, including
55.1, 66.7, 100, 45.9 and 29 %, respectively, of ETEC, EIEC, STEC, EPEC and EAEC, and 24 % of
non-diarrhoeagenic E. coli were O-antigen typable. Only four serogroups (9.3 %) were restricted to
Received 1 August 2003 single pathotypes, whereas 27 serogroups (62.8 %) were not restricted to any pathotype. This study
Accepted 24 November 2003 shows that EAEC are the most prevalent diarrhoea-associated pathotype in Thai children.

INTRODUCTION Standard methods currently used in the identification of


major E. coli pathotypes are based on distinct sets of virulence
Diarrhoea caused by Escherichia coli infection is one of the
markers, such as toxins [heat-labile and heat-stable enter-
major health problems for children in many developing
otoxins LTh and STh or STp (ETEC) (Kuhnert et al., 2000)
countries and travellers to those countries (Adachi et al.,
and Shiga-like toxins SLT1 and SLT2 (STEC) (Nataro &
2001; Ogata et al., 2002; Robins-Browne & Hartland, 2002).
Kaper, 1998)], adhesins [intimin (Cravioto et al., 1996) and
Diarrhoeagenic E. coli are recognized as five major patho-
EPEC adherence factor (EAF) (Donnenberg et al., 1997)
types: enterotoxigenic (ETEC), enteropathogenic (EPEC),
(EPEC)] and invasins (EIEC) (Robins-Browne, 1987), and
enteroinvasive (EIEC), Shiga-like toxin-producing (STEC)
their cell-adherence characteristics (Clarke, 2001; Nataro &
or enterohaemorrhagic (EHEC) and enteroaggregative
Kaper, 1998). None of these methods is available for use in
(EAEC) E. coli (Nataro & Kaper, 1998). Diffuse-adherent E.
routine clinical laboratories in developing countries such as
coli (DAEC), also known as diarrhoea-associated haemolytic
Thailand. Although surveillance of diarrhoeagenic E. coli
E. coli (DHEC), and cytolethal distending toxin-producing E.
using standard identification methods had been carried
coli (CDT-EC) have also been described recently as diar-
out sporadically in Thailand in the past until 1986
rhoeagenic (Clarke, 2001; Nataro & Kaper, 1998). Their
(Chatkaeomorakot et al., 1987; Sunthadvanich et al., 1990),
epidemiology and diarrhoeagenic potential are, however, not
these surveillance studies were not designed to detect all
yet clear (Scaletsky et al., 2002).
major pathotypes.

Abbreviations: AA, aggregative adherence; EAEC, enteroaggregative E.


coli; EAF, EPEC adherence factor; EIEC, enteroinvasive E. coli; EPEC, In this study, we have categorized E. coli isolates collected
enteropathogenic E. coli; ETEC, enterotoxigenic E. coli; LA, localized over a 5-year period (1996–2000) from Thai children with
adherence; STEC, Shiga-toxin-producing E. coli. acute diarrhoea by examining their virulence markers and
Downloaded from www.microbiologyresearch.org by
05413 & 2004 SGM Printed in Great Britain IP: 182.1.186.51 237
On: Wed, 05 Sep 2018 13:47:45
O.-A. Ratchtrachenchai and others

cell-adherence patterns. The isolates were further examined Japan, were used as positive control strains and JM109 was used as a
for their O antigens. The prevalence of diarrhoeagenic E. coli negative control strain for virulence markers. E. coli strains 28-3, 1228
pathotypes, with their age distribution and the isolation rate and JM109 were respectively used as controls for aggregative adherence
(AA), localized adherence (LA) and non-adherence on HeLa cells.
per year, is presented.
Identification of virulence markers by multiplex PCR. E. coli
METHODS isolates were subjected to two PCR assays using two multiplex primer
sets (Table 1). The first set was used to identify ETEC, EIEC and STEC
Clinical samples and bacterial strains. Rectal swabs (one per (Itoh et al., 1992), and the second set was used to detect EPEC (Franke
patient) were collected from 2100 Thai children less than 12 years of et al., 1994; Sueyoshi et al., 1996). Boiled lysates from overnight-grown
age with acute diarrhoea who attended 15 different hospitals across bacterial colonies on LB plates were used as PCR templates. PCR assays
Thailand between 1 January 1996 and 31 December 2000. were carried out in 25 ìl reaction mixtures consisting of 1 ìl template
DNA, 20 mM Tris/HCl, pH 8.4, 50 mM KCl, 1.5 mM MgCl2 , 0.25 mM
Rectal swab samples collected in Cary-Blair transport medium were dNTPs (New England Biolabs), 0.1 ìM of each primer (0.2 ìM for stIA
inoculated directly onto MacConkey agar, sorbitol MacConkey agar, primers) and 1 U Taq DNA polymerase (Gibco). The reaction mixtures
thiosulfate/citrate/bile salt/sucrose agar, Salmonella–Shigella agar, xy- were run in a thermal cycler (model 9700; Perkin-Elmer) with the
lose lysine desoxycholate agar, selenite broth and alkaline peptone water following cycling profile: 94 8C for 5 min, 25 cycles of denaturation at
for culture overnight at 37 8C. Sorbitol non-fermenting colonies were 94 8C for 1 min, annealing at 48 8C for 1.5 min and primer extension at
again tested with O157 : H7 antisera. One to three colonies of each 72 8C for 2 min and a final extension at 72 8C for 5 min. The annealing
sorbitol non-fermenting, lactose-fermenting and lactose non-ferment- temperature for EPEC PCR was 50 8C. Amplified products were
ing isolate with typical E. coli morphology were initially selected and resolved by 2 % agarose gel electrophoresis and visualized under UV
examined further biochemically following Edwards’ and Ewing’s transillumination after ethidium bromide staining. DNA templates
identification methods (Ewing, 1986). E. coli isolates that had been from positive and negative control strains for virulence markers and a
biochemically confirmed at the hospitals concerned were submitted to minus-template sample were included in each PCR.
our institute (National Institute of Health, Thailand), where they were
stored on Dorset egg yolk agar (Nissui Pharmaceutical Inc.) until used.
Samples derived from mixed infections with salmonellae, shigellae and HeLa cell-adherence assay. Cell-adherence patterns of E. coli isolates
vibrios were excluded from our study. A total of 2629 isolates thus were examined using monolayers of HeLa cells (ATCC CCL-2) as
obtained as single pathogens were included in this study. described by Nataro et al. (1987). HeLa cells were grown to 70–80 %
confluence on circular coverslips (13 mm diameter) in 24-well tissue
E. coli strains 1298 (invEþ ), EDL931 (stx1/2þ ), 682 (eltIAþ ), 825 (stIAþ , culture plates (Nalge Nunc) with DMEM supplemented with 10 % fetal
STp), 1296 (stIAþ , STh) and 1228 (eaeAþ , bfpAþ , EAF þ ), which were bovine serum in a 37 8C incubator with 5 % CO2 . After washing three
kindly provided by the National Institute of Public Health, Tokyo, times with PBS, fresh DMEM containing 1 % methyl Æ-D-mannoside

Table 1. Multiplex PCR primer sets used to identify recognized virulence markers of ETEC, EIEC, STEC and EPEC
LTh, Heat-labile enterotoxin; STh/STp, heat-stable enterotoxin (human/pig alleles); SLT1/2, Shiga-like toxins 1 and 2; BFP,
bundle-forming pili. Primers for stIA can detect both STh and STp.

Virulence gene (factors) Sequence (59–39) PCR product Reference


(bp)

Primer set 1
ETEC
eltIA (LTh) (F) AGCAGGTTTCCCACCGGATCACCA 132 Itoh et al. (1992)
(R) CGTGCTCAGATTCTGGGTCTC
stIA (STh/STp) (F) ATTTCTGTATTGTCTTT 171 Itoh et al. (1992)
(R) ATTACAACACAGTTCACAG
EIEC
invE (regulator for cell invasion) (F) ATATCTCTATTTCCAATCGCGT 382 Itoh et al. (1992)
(R) GATGGCGAGAAATTATATCCCG
STEC
stx1/2 (SLT1/2) (F) TTTACGATAGACTTCTCGAC 228 Itoh et al. (1992)
(R) CACATATAAATTATTTCGCTC
Primer set 2
EPEC
eaeA (intimin) (F) GCTTAGTGCTGGTTTAGGAT 488 Sueyoshi et al. (1996)
(R) TCGCCGTTCAGAGATCGC
bfpA (BFP) (F) GAAGTAATGAGCGCAACGTC 234 Sueyoshi et al. (1996)
(R) ACATGCCGCTTTATCCAACC
EAF (EPEC adherence factor) (F) CAGGGTAAAAGAAAGATGATAA 397 Franke et al. (1994)
(R) TATGGGGACCATGTATTATCA

Downloaded from www.microbiologyresearch.org by


238 IP: 182.1.186.51 Journal of Medical Microbiology 53
On: Wed, 05 Sep 2018 13:47:45
Childhood diarrhoea-associated E. coli in Thailand

was added to the wells to inhibit type 1 fimbriae-mediated cell Statistical analysis. The  2 and Fisher’s exact tests were used to report
adherence. Cells were infected with bacteria (approx. 2 3 106 cells) the significance of differences between variables.
that had been grown statically in LB broth at 37 8C for 18 h, to give an
m.o.i. of 1 : 20. After 3 h incubation, cells were washed three times with
PBS, fixed with 100 % methanol for 10 min and stained with 10 % RESULTS AND DISCUSSION
Giemsa stain for 30 min. Cell-adherence patterns were determined
using a light microscope (Nikon) following the criteria described by
E. coli isolates (n ¼ 2629) were initially examined for their
Nataro et al. (1987). Each assay was done in duplicate using positive and virulence markers by two multiplex PCR assays. Strains
negative control strains. negative for all tested virulence markers (n ¼ 2453) were
further examined for their HeLa cell-adherence patterns.
Additionally, 85 EPEC strains were included in the HeLa cell-
Determination of diarrhoea-associated E. coli pathotypes. E. coli
isolates were categorized using the following criteria: isolates positive for adherence assay to differentiate typical EPEC from atypical
eltIA, stIA or both as ETEC; isolates positive for invE as EIEC; isolates EPEC. We did not investigate DAEC or CDT-EC in this study
positive for stx1/2, eaeA or both as STEC; isolates negative for stx1/2 and as their role in diarrhoea is still not clear (Scaletsky et al.,
positive for eaeA as EPEC; EPEC with LA pattern on HeLa cells as typical 2002).
EPEC; EPEC with non-LA pattern on HeLa cells as atypical EPEC;
isolates negative for all tested virulence markers but positive for AA Prevalence of diarrhoea-associated E. coli
pattern on HeLa cells as EAEC; and isolates negative for both tested
virulence markers and AA pattern on HeLa cells as non-diarrhoeagenic Tables 2 and 3 show the characteristics and isolation
E. coli. In this study, we used the AA phenotype as the marker for EAEC, frequency of diarrhoea-associated E. coli during the 5-year
because the known virulence-associated genes of EAEC, which have
study period. The mean isolation rates per year were 16.9 %
been widely used as genotypic markers in identifying EAEC, are also
present in non-EAEC strains (Elias et al., 2002). (range 13.3–22.6 %) for total diarrhoeagenic E. coli, 10.2 %
(8–12.5 %) for EAEC, 3.2 % (0–8 %) for EPEC, 3.0 % (2–
5.4 %) for ETEC, 0.5 % (0–1 %) for EIEC and 0.04 % (0–
Serogrouping. O antigen determination was done by slide agglutina- 0.1 %) for STEC. EAEC, EPEC, ETEC, EIEC and STEC
tion test using a heated suspension (100 8C for 1 h) of bacterial cells and
eight polyvalent and 43 monovalent O antisera (Denka Seiken Co.) that
respectively accounted for 60.4 % (269/445), 19.1 % (85/
are targeted against common O-serogroups of EPEC, ETEC, EIEC and 445), 17.5 % (78/445), 2.7 % (12/445) and 0.2 % (1/445) of
STEC. The following 43 serogroups were determined: O1, O6, O8, O15, diarrhoeagenic E. coli.
O18, O20, O25, O26, O27, O28ac, O29, O44, O55, O63, O78, O86a,
O111, O112ac, O114, O115, O119, O124, O125, O126, O127a, O128,
The relatively high prevalence of EAEC in this study (10.2 %)
O136, O142, O143, O144, O146, O148, O151, O152, O153, O157, O158, and in previous studies from Calcutta (9 %; Dutta et al.,
O159, O164, O166, O167, O168 and O169. Results were confirmed by 1999), northern India (12.3 % in acute diarrhoea and 34.5 %
the test-tube agglutination test (Ewing, 1986). in persistent diarrhoea; Bhan et al., 1989) and southern Israel

Table 2. Determination of pathotypes among 2629 childhood diarrhoea-associated E. coli isolates on


the basis of virulence marker profiles and HeLa cell-adherence patterns
Virulence markers were examined by multiplex PCR.

Pathotype n (%) Virulence marker profile

eltIA stIA invE stx1/2 eaeA bfpA EAF n

ETEC 78 (3)  +      42
+       30
+ +      6
EIEC 12 (0.5)   +     12
STEC 1 (0.04)    + +   1
EPEC 85 (3.2)     +   61*
    + +  12†
    +  + 7†
    + + + 5†
EAEC 269 (10.2)        269‡
Non-diarrhoeagenic 2184 (83.1)        2184§

*Non-adherent to HeLa cells; classified as atypical EPEC.


†LA pattern on HeLa cells; classified as typical EPEC.
‡Negative for virulence markers but positive for AA phenotype in HeLa cell-adherence assay.
§Negative for both virulence markers and AA phenotype in HeLa cell-adherence assay.
Downloaded from www.microbiologyresearch.org by
http://jmm.sgmjournals.org IP: 182.1.186.51 239
On: Wed, 05 Sep 2018 13:47:45
O.-A. Ratchtrachenchai and others

Table 3. Prevalence of childhood diarrhoea-associated E. coli in Thailand, 1996–2000

Category Number of isolates (%)

Total 1996 1997 1998 1999 2000

EAEC 269 (10.2) 29 (8) 55 (8.1) 26 (12.5) 30 (12.4) 129 (11.3)


EPEC 85 (3.2) 9 (2.5) 23 (3.4) 17 (8) 0 (0) 36 (3.1)
ETEC 78 (3.0) 9 (2.5) 20 (3) 4 (2) 13 (5.4) 32 (2.8)
EIEC 12 (0.5) 1 (0.3) 7 (1) 0 (0) 0 (0) 4 (0.3)
STEC 1 (0.04) 0 (0) 1 (0.1) 0 (0) 0 (0) 0 (0)
Diarrhoeagenic 445 (16.9) 48 (13.3) 106 (15.7) 47 (22.6) 43 (17.8) 201 (17.6)
Non-diarrhoeagenic 2184 (83.1) 313 (86.7) 570 (84.3) 161 (77.4) 198 (82.2) 942 (82.4)
Total 2629 361 676 208 241 1143

(25.9 %; Porat et al., 1998) is consistent with reports that 20–40 % of diarrhoeal cases amongst travellers and ST-
EAEC is the pathotype responsible for persistent diarrhoea producing ETEC, in particular, are known to be associated
among international travellers who visit developing coun- with the majority of endemic cases (Nataro & Kaper, 1998).
tries (Adachi et al., 2001; Jiang et al., 2002; Vargas et al., Although the occurrence of ETEC in Thai children had been
1998). rather steady during the last 5 years, most strains (61.5 %) in
this study were stIA positive, indicating that there is a
By the definition adopted at the Second International persistent risk of ETEC-associated outbreak in Thailand.
Symposium on EPEC in Sao Paulo in 1995, typical EPEC On the other hand, similar to reports from south-western
possess the bundle-forming pili (BFP)-producing EAF plas- Nigeria (Okeke et al., 2000), southern Israel (Porat et al.,
mid with the LA pattern on cultured cells, whereas atypical 1998) and Bangladesh (Albert et al., 1995), EIEC and STEC
EPEC lack this plasmid and the LA pattern (Nataro & Kaper, seem to be only minor diarrhoeagenic pathogens for children
1998; Trabulsi et al., 2002). We used the LA pattern on HeLa in Thailand, since their occurrence was negligible among
cells as the only marker for classifying typical EPEC, because diarrhoea-associated E. coli in three studies, including
the methods commonly used to detect the BFP-producing this one, from Thailand (Chatkaeomorakot et al., 1987;
EAF plasmid, such as hybridization with EAF and bfpA Sunthadvanich et al., 1990).
probes (Nataro & Kaper, 1998) and PCR amplification of the
EAF region and bfpA gene (Franke et al., 1994), can be In two previous studies from Thailand in 1985 and 1986
misleading, as some LA-expressing EPEC strains, which are (Chatkaeomorakot et al., 1987; Sunthadvanich et al., 1990),
positive for either EAF or bfpA, may not carry the true BFP- ETEC (6 and 7 %, respectively), EIEC (, 1 and 2 %), STEC
producing EAF plasmid (Nataro & Kaper, 1998; Trabulsi (0 and 0 %) and EAF-positive EPEC (4 and 6 %), as
et al., 2002). Accordingly, 71.8 % (61/85) of our EPEC strains determined by probe hybridization, colony hybridization
were non-adherent to HeLa cells and therefore classified as and HeLa adherence-assay, were recovered from 393 chil-
atypical EPEC, whereas the remaining 24 EPEC strains dren in 16 district hospitals (Sunthadvanich et al., 1990)
exhibited the classical LA pattern on HeLa cells (Table 2). and 278 children in the Children’s Hospital in Bangkok
In addition, we also observed that 50 % (12/24) of LA- (Chatkaeomorakot et al., 1987). Compared with these data,
positive EPEC strains were positive for eaeA and bfpA but the prevalence of ETEC (3 %) and EAF-positive EPEC
negative for EAF and that 29 % (7/24) of LA-positive EPEC (0.5 %) in this study was significantly lower (P , 0.002 and
strains were positive for eaeA and EAF but negative for bfpA. P , 0.0001, respectively). Nonetheless, the overall preva-
Only 20.8 % (5/24) were positive for eaeA, bfpA and EAF. lence of major diarrhoeagenic E. coli pathotypes in Thailand
Some atypical EPEC strains have been shown to express did not change much during the 5-year study period.
the intimin-mediated LA-like pattern (Pelayo et al., 1999;
Trabulsi et al., 2002), but all our atypical EPEC strains were Age distribution of diarrhoea-associated E. coli
non-adherent. Although geographical specificities may exist,
the high presentation of atypical EPEC in this study and in The prevalence of diarrhoeagenic E. coli in four different age
previous reports from Brazil (Gomes et al., 1989) and other groups among 905 children whose ages were recorded was
industrialized countries (Nataro & Kaper, 1998) underscores 25 % (48/192) in those aged 0–5 months, 24.8 % (64/258) in
the emergence of atypical EPEC strains worldwide. those aged 6–11 months, 12.1 % (28/232) in those aged 1–2
years and 16.1 % (36/223) in those aged 2–12 years (Fig. 1).
Among ETEC isolates, 53.8 % (42/78) and 38.5 % (30/78) The isolation rate of diarrhoeagenic E. coli was significantly
were respectively positive for stIA and eltIA and 7.7 % (6/78) higher in children less than 1 year of age, compared with
were positive for both eltIA and stIA. Taken together, 61.5 % children older than 1 year (P , 0.0001). The prevalence of
(48/78) of ETEC were stIA positive. ETEC are responsible for EAEC was 19.3 % (37/192) in 0–5 months, 18.2 % (47/258)
Downloaded from www.microbiologyresearch.org by
240 IP: 182.1.186.51 Journal of Medical Microbiology 53
On: Wed, 05 Sep 2018 13:47:45
Childhood diarrhoea-associated E. coli in Thailand

Table 4. Distribution of O serogroups in E. coli isolates of this study


Values in parentheses are percentages.

Serogroup Diarrhoeagenic (n 445) Non-diarrhoeagenic

ETEC EIEC STEC EPEC EAEC

O1      70
O6* 10   2 1 73
O8* 2  1  3 34
O15* 1    16 38
O18*    1 1 16
O20* 1     
O25* 7    11 15
O26    3  18
O27 1    1 
O28ac  2    3
O44     4 18
O55    10  10
O63    1  1
O78 1     1
O86a* 3   1 12 59
O111    1  10
O112ac      3
O114    2  9
O115      1
O119*    12 1 10
O124†  1    
O125    1  15
O126* 4    15 28
O127a* 2   1 4 6
O128* 2   1  17
O142      2
O144      1
O146* 1    2 11
O148      2
O152†  1    
O153    2 1 22
O158     1 8
O159* 2    1 1
O164†  4    
O166*    1 1 18
O167      1
O168     2 1
O169 6    1 
Typable 43 (55.1) 8 (66.7) 1 (100) 39 (45.9) 78 (29) 522 (23.9)
Non-typable 35 (44.9) 4 (33.3) 0 (0) 46 (54.1) 191 (71) 1662 (76.1)
Total 78 12 1 85 269 2184

*Identified in three or more categories.


†Identified exclusively in a single pathotype.

in 6–11 months, 9.1 % (21/232) in 1–2 years and 8.1 % (18/ 192), 4.3 % (11/258), 1.7 % (4/232) and 2.2 % (5/223),
223) in 2–12 years. EAEC were significantly more common respectively, of children in age groups 0–5 months, 6–11
in children less than 1 year old, compared with the older months, 1–2 years and 2–12 years, whereas ETEC were
children (P , 0.0001). EPEC were isolated from 3.1 % (6/ isolated from 2.6 % (5/192), 2.3 % (6/258), 1.3 % (3/232) and
Downloaded from www.microbiologyresearch.org by
http://jmm.sgmjournals.org IP: 182.1.186.51 241
On: Wed, 05 Sep 2018 13:47:45
O.-A. Ratchtrachenchai and others

pathotypes, more than 60 % of serogroups tested were not


restricted to any pathotype, signifying the unrestricted
nature of serogroups among different pathotypes.
Taken together, EAEC were the most common pathotype in
every age group examined and in every year during the 5-year
study period. Inasmuch as this is the first study to report
EAEC isolates from Thailand, further characterization of
these strains is required in order to understand better their
role in diarrhoeal diseases in Thailand. The findings in this
study will be of great importance in implementing manage-
ment guidelines for E. coli-associated diarrhoea in Thailand.
Given that Thailand is one of the popular tourist destinations
in Asia, hosting 7–8 million international travellers every
year, the results presented here would also have a significant
impact on the management of E. coli-associated acute and
Fig. 1. Isolation frequencies of EAEC (filled bars), EPEC (hatched persistent diarrhoea among travellers.
bars), ETEC (shaded bars) and EIEC (open bars) among diarrhoea-
In conclusion, this study highlights that O antigen examina-
associated E. coli from 905 Thai children with diarrhoea. mo, Months;
tion alone is of little value in epidemiological studies related
yr, years.
to diarrhoeagenic E. coli and that the comprehensive
surveillance of diarrhoeagenic E. coli in developing countries
remains an important part of preventative and control
measures in reducing the overall incidence of diarrhoeal
5 % (11/223) of children in the corresponding age groups. diseases around the world.
ETEC were more common in children older than 2 years,
compared with the younger children (P , 0.05). We did not
find any significant difference in the age distribution of ACKNOWLEDGEMENTS
EPEC. EIEC were isolated from only two children in age
We are grateful to the technicians and physicians who collected the
group 2–12 years. STEC were not identified in children of samples for this study. Funding for this project was provided in part by
known age. NIH Thailand and grant no. 00L01411 from the Japan Society for the
Promotion of Science (JSPS) and the Ministry of Education, Culture,
Sports, Science and Technology, Japan. O.-A. R. is a fellow of the
RONPAKU (Dissertation PhD) program (JSPS).
Serogroups
With the 43 monovalent antisera used in this study, 38 %
(169/445) of diarrhoeagenic E. coli and 23.9 % (522/2184) of
REFERENCES
non-diarrhoeagenic E. coli were typable for their O antigens. Adachi, J. A., Jiang, Z. D., Mathewson, J. J., Verenkar, M. P., Thompson,
S., Martinez-Sandoval, F., Steffen, R., Ericsson, C. D. & DuPont, H. L.
In addition, 55.1 % (43/78), 66.7 % (8/12), 100 % (1/1),
(2001). Enteroaggregative Escherichia coli as a major etiologic agent
45.9 % (39/85) and 29 % (78/269) of ETEC, EIEC, STEC, in traveler’s diarrhea in 3 regions of the world. Clin Infect Dis 32,
EPEC and EAEC, respectively, were O-antigen typable and 1706–1709.
they were distributed respectively into 14, 4, 1, 14 and 18
Albert, M. J., Faruque, S. M., Faruque, A. S., Neogi, P. K., Ansaruzza-
different serogroups. O antigen-typable non-diarrhoeagenic man, M., Bhuiyan, N. A., Alam, K. & Akbar, M. S. (1995). Controlled
E. coli were distributed into 32 serogroups. Twenty-seven study of Escherichia coli diarrheal infections in Bangladeshi children.
serogroups were observed in more than one category, J Clin Microbiol 33, 973–977.
accounting for 62.8 % of total serogroups tested: 13 ser- Bhan, M. K., Bhandari, N., Sazawal, S., Clemens, J., Raj, P., Levine, M. M.
ogroups (O6, O8, O15, O18, O25, 86a, O119, O126, O127a, & Kaper, J. B. (1989). Descriptive epidemiology of persistent diarrhoea
O128, O146, O159 and O166) were identified in three or among young children in rural northern India. Bull World Health Organ
more different categories, including non-diarrhoeagenic E. 67, 281–288.
coli. There were only four serogroups that were exclusively Chatkaeomorakot, A., Echeverria, P., Taylor, D. N., Bettelheim, K. A.,
associated with a single pathotype: O20 (ETEC), O124, O152 Blacklow, N. R., Sethabutr, O., Seriwatana, J. & Kaper, J. (1987). HeLa
and O164 (all EIEC). cell-adherent Escherichia coli in children with diarrhea in Thailand.
J Infect Dis 156, 669–672.
That about 71 % of EAEC, 54 % of EPEC, 45 % of ETEC and Clarke, S. C. (2001). Diarrhoeagenic Escherichia coli – an emerging
33 % of EIEC strains were non-typable while 24 % of non- problem? Diagn Microbiol Infect Dis 41, 93–98.
diarrhoeagenic E. coli strains were typable indicates that a Cravioto, A., Trujillo, F., Leon, L. A., Hernandez, J. M. & Eslava, C.
significant number of isolates would have been misidentified (1996). Infections caused by enteropathogenic Escherichia coli. Gac Med
by serogroup-based diagnosis. Besides, although only about Mex 132, 611–615 (in Spanish).
9 % of serogroups were identified exclusively in single Donnenberg, M. S., Zhang, H. Z. & Stone, K. D. (1997). Biogenesis of the
Downloaded from www.microbiologyresearch.org by
242 IP: 182.1.186.51 Journal of Medical Microbiology 53
On: Wed, 05 Sep 2018 13:47:45
Childhood diarrhoea-associated E. coli in Thailand

bundle-forming pilus of enteropathogenic Escherichia coli: reconstitu- Ogata, K., Kato, R., Ito, K. & Yamada, S. (2002). Prevalence of
tion of fimbriae in recombinant E. coli and role of DsbA in pilin stability Escherichia coli possessing the eaeA gene of enteropathogenic E. coli
–a review. Gene 192, 33–38. (EPEC) or the aggR gene of enteroaggregative E. coli (EAggEC) in
Dutta, S., Pal, S., Chakrabarti, S., Dutta, P. & Manna, B. (1999). Use of traveler’s diarrhea diagnosed in those returning to Tama, Tokyo from
PCR to identify enteroaggregative Escherichia coli as an important cause other Asian countries. Jpn J Infect Dis 55, 14–18.
of acute diarrhoea among children living in Calcutta, India. J Med Okeke, I. N., Lamikanra, A., Steinruck, H. & Kaper, J. B. (2000).
Microbiol 48, 1011–1016. Characterization of Escherichia coli strains from cases of childhood
Elias, W. P., Barros, S. F., Moreira, C. G., Trabulsi, L. R. & Gomes, T. A. diarrhea in provincial southwestern Nigeria. J Clin Microbiol 38, 7–12.
(2002). Enteroaggregative Escherichia coli strains among classical Pelayo, J. S., Scaletsky, I. C., Pedroso, M. Z., Sperandio, V., Giron, J. A.,
enteropathogenic Escherichia coli O serogroups. J Clin Microbiol 40, Frankel, G. & Trabulsi, L. R. (1999). Virulence properties of atypical
3540–3541. EPEC strains. J Med Microbiol 48, 41–49.
Ewing, W. H. (1986). The genus Escherichia. In Edwards and Ewing’s
Identification of Enterobacteriaceae, pp. 93–134. New York: Elsevier. Porat, N., Levy, A., Fraser, D., Deckelbaum, R. J. & Dagan, R. (1998).
Prevalence of intestinal infections caused by diarrheagenic Escherichia
Franke, J., Franke, S., Schmidt, H., Schwarzkopf, A., Wieler, L. H., coli in Bedouin infants and young children in southern Israel. Pediatr
Baljer, G., Beutin, L. & Karch, H. (1994). Nucleotide sequence analysis of Infect Dis J 17, 482–488.
enteropathogenic Escherichia coli (EPEC) adherence factor probe and
development of PCR for rapid detection of EPEC harboring virulence Robins-Browne, R. M. (1987). Traditional enteropathogenic Escher-
plasmids. J Clin Microbiol 32, 2460–2463. ichia coli of infantile diarrhea. Rev Infect Dis 9, 28–53.
Gomes, T. A., Vieira, M. A., Wachsmuth, I. K., Blake, P. A. & Trabulsi, L. Robins-Browne, R. M. & Hartland, E. L. (2002). Escherichia coli as a cause
R. (1989). Serotype-specific prevalence of Escherichia coli strains with of diarrhea. J Gastroenterol Hepatol 17, 467–475.
EPEC adherence factor genes in infants with and without diarrhea in Sao
Scaletsky, I. C., Fabbricotti, S. H., Silva, S. O., Morais, M. B. &
Paulo, Brazil. J Infect Dis 160, 131–135.
Fagundes-Neto, U. (2002). HEp-2-adherent Escherichia coli strains
Itoh, F., Ogino, T., Itoh, K. & Watanabe, H. (1992). Differentiation and associated with acute infantile diarrhea, Sao Paulo, Brazil. Emerg Infect
detection of pathogenic determinants among diarrheagenic Escherichia Dis 8, 855–858.
coli by polymerase chain reaction using mixed primers. Nippon Rinsho
50 (Suppl.), 343–347 (in Japanese). Sueyoshi, M., Fukui, H., Tanaka, S., Nakazawa, M. & Ito, K. (1996). A
new adherent form of an attaching and effacing Escherichia coli (eaeA+,
Jiang, Z. D., Lowe, B., Verenkar, M. P., Ashley, D., Steffen, R., bfp) to the intestinal epithelial cells of chicks. J Vet Med Sci 58,
Tornieporth, N., von Sonnenburg, F., Waiyaki, P. & DuPont, H. L. 1145–1147.
(2002). Prevalence of enteric pathogens among international travelers
with diarrhea acquired in Kenya (Mombasa), India (Goa), or Jamaica Sunthadvanich, R., Chiewsilp, D., Seriwatana, J., Sakazaki, R. &
(Montego Bay). J Infect Dis 185, 497–502. Echeverria, P. (1990). Nationwide surveillance program to identify
Kuhnert, P., Boerlin, P. & Frey, J. (2000). Target genes for virulence
diarrhea-causing Escherichia coli in children in Thailand. J Clin
assessment of Escherichia coli isolates from water, food and the Microbiol 28, 469–472.
environment. FEMS Microbiol Rev 24, 107–117. Trabulsi, L. R., Keller, R. & Tardelli Gomes, T. A. (2002). Typical and
Nataro, J. P. & Kaper, J. B. (1998). Diarrheagenic Escherichia coli. Clin atypical enteropathogenic Escherichia coli. Emerg Infect Dis 8, 508–513.
Microbiol Rev 11, 142–201. Vargas, M., Gascon, J., Gallardo, F., Jimenez De Anta, M. T. & Vila, J.
Nataro, J. P., Kaper, J. B., Robins-Browne, R., Prado, V., Vial, P. & (1998). Prevalence of diarrheagenic Escherichia coli strains detected by
Levine, M. M. (1987). Patterns of adherence of diarrheagenic Escherichia PCR in patients with travelers’ diarrhea. Clin Microbiol Infect 4,
coli to HEp-2 cells. Pediatr Infect Dis J 6, 829–831. 682–688.

Downloaded from www.microbiologyresearch.org by


http://jmm.sgmjournals.org IP: 182.1.186.51 243
On: Wed, 05 Sep 2018 13:47:45

You might also like