Hybridization Capture for Targeted NGS

User Manual
Version 5.02 March 2022

For myBaits Custom DNA-Seq

myBaits Custom RNA-Seq
myBaits Expert (excluding Wheat Exome and Human Affinities)
Access additional manuals at [Link]/mybaits-manual

FOR RESEARCH USE ONLY. Not intended for diagnostic use.

© Daicel Arbor Biosciences

5840 Interface Drive, Suite 101
Ann Arbor, MI 48103 (USA)
+1 (734) 998-0751
info@[Link]

MYBAITS is a registered trademark of Biodiscovery, LLC dba Arbor Biosciences. DAICEL ARBOR BIOSCIENCES is a registered trademark of Daicel Corporation. ION
TORRENT is a registered trademark of Life Technologies Corporation. DYNABEADS is a registered trademark of Thermo Fisher Scientific. MYONE is a trademark of
Thermo Fisher Scientific. NEXTERA, ILLUMINA, and TRUSEQ are registered trademarks of Illumina, Inc. KAPA is a registered trademark of Roche Molecular Systems, Inc.
IDT and XGEN are registered trademarks of Integrated DNA Technologies, Inc. PACBIO is a registered trademark of Pacific Biosciences of California, Inc. OXFORD
NANOPORE TECHNOLOGIES is a registered trademark of Oxford Nanopore Technologies, Ltd.
INTRODUCTION
myBaits® is an in-solution NGS library target enrichment system, compatible with Illumina®, Ion Torrent®,
and essentially any amplifiable sequencing library. We use a versatile nucleic acid synthesis technology to
produce biotinylated RNA “baits” that are complementary to your sequence targets. Baits and other reagents
for NGS target enrichment are supplied with your myBaits kit. After enrichment with myBaits, libraries may
then be sequenced on the aforementioned platforms, or further prepared for PacBio® or Oxford Nanopore
Technologies® sequencing.

Procedure Overview

1. Amplified sequencing library, adapter

blockers, and other hybridization reagents
are combined.

2. Libraries are denatured, allowing blockers

to hybridize to adapters. Baits are then
introduced and hybridized to targets for
several hours.

3. Bait-target hybrids are bound to

streptavidin-coated magnetic beads and
pulled out of suspension with a magnet.

4. Most non-target DNA is washed away. The

remaining library is then amplified and
either taken directly to sequencing or
further treated.

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 March 2022 2
Arbor Biosciences products compatible with this manual

This manual is compatible with current generation myBaits Custom DNA-Seq, Custom RNA-Seq, and Expert
kits, but not Custom Methyl-Seq, Expert Wheat Exome, or Expert Human Affinities kits. Visit
[Link]/mybaits-manual to download other manuals, or email techsupport@[Link] for
assistance. See Page 4 to select the correct protocol within this manual to follow for your application.

Changes since myBaits manual version 5.01

● Hyb reagent volumes are updated; minor text edits

Changes since myBaits manual version 4

● Three distinct myBaits protocols are included for different applications (See Page 4)
✓ These protocols are compatible with version 4 reagents and baits
● Block X replaces Block A and typically provides improved specificity
● Buffer E is now supplied for post-cleanup bead resuspension
● New application-specific recommendations for experiment design are included

Note for returning users: Version 5 reagent chemistry typically provides significantly higher target
specificity (= percentage of on-target reads) compared to version 4 and earlier kits.

Kit components and stability

Reagent Cap color Volume (8 rxn) Volume (16 rxn) Volume (48+ rxn)
Hyb N Red 400 µL 400 µL 1000 µL
Hyb S Teal 1500 µL 1500 µL 1500 µL
Box 1
Beads Clear 550 µL 550 µL 1600 µL
Store at 4˚C
Binding Buffer - 12 mL 12 mL 36 mL
Wash Buffer - 20 mL 20 mL 60 mL
Hyb D Yellow 140 µL 140 µL 400 µL
Hyb R Purple 50 µL 50 µL 150 µL
Box 2 Block C Dark Green 50 µL 50 µL 130 µL
Store at -20˚C Block O Blue 90 µL 90 µL 270 µL
Block X Orange 5 µL 9 µL 27 µL
Buffer E Light Green 550 µL 550 µL 1600 µL
Box 3
Baits White 50 µL per 8 rxns 50 µL per 8 rxns 50 µL per 8 rxns
Store at -80˚C

At the recommended storage temperatures, myBaits kit components have a shelf life of one year.
It is strongly recommended that sub-aliquots of Baits are made in reaction sizes appropriate for your
experiment plans to minimize freeze-thaw cycles.

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 March 2022 3
 IMPORTANT
READ BEFORE PROCEEDING
CHOOSE A PROTOCOL
This manual includes three separate myBaits protocols. Please select from the list below depending on the
nature of your sequencing libraries. If you are unsure which protocol to follow, email
techsupport@[Link] for consultation with one of our NGS scientists.

Note that these are suggested starting points. Identification of optimal parameters for enrichment with a
specific bait set and library will require testing and evaluation. These protocols have worked well across
many bait set and library combinations.

Standard Begins on Page 5

For most targeted sequencing applications
Recommended when enriching NGS libraries that:
- derive from high-quality genomic DNA, with target inserts of 80-1,000 bp in length,
- contain a mean target sequence GC content of >25%,
- are free of substantial (>50%) contamination from non-target organisms, and
- do not have extensive base substitutions (from e.g. deamination or bisulfite conversion)

High Sensitivity Begins on Page 17

For high background contamination, ancient DNA, high bait-target divergence, OR short target sequences
Recommended when enriching NGS libraries that have ANY of the following characteristics:
- derive from DNA samples heavily contaminated with exogenous DNA (e.g. pathogen
targets in host DNA background, ancient DNA, environmental DNA),
- contain mostly target sequences shorter than 80 bp,
- contain a mean target sequence GC content of <25%, or
- contain targets that are on average ≥25% divergent from the bait sequences

Long Insert Begins on Page 29

For target enrichment of NGS libraries containing inserts 1-10 kilobase pairs in length
Recommended when enriching NGS libraries that:
- are dominated by inserts longer than 1,000 bp, and
- can be amplified with universal adapter primers prior to platform-specific library prep (e.g.
PacBio or Nanopore library prep)

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 March 2022 4
Standard Protocol
For most targeted sequencing applications

CONTENTS

REQUIREMENTS AND RECOMMENDATIONS

Input library 6
Blocking oligos 6
Equipment and reagents 7

PROCEDURE Part 1: Hybridization Setup

S1.1 Choose a hybridization temperature 8
S1.2 Prepare materials 8
S1.3 Hybridization Mix setup 9
S1.4 Blockers Mix setup 9
S1.5 Reaction assembly 10

PROCEDURE Part 2: Bind and Wash

S2.1 Choose a wash temperature 11
S2.2 Prepare materials 11
S2.3 Wash Buffer X preparation 12
S2.4 Bead preparation 12
S2.5 Binding beads and hybrids 12
S2.6 Bead washing 12

PROCEDURE Part 3: Library Resuspension and Amplification

S3.1 Prepare materials 13
S3.2 Enriched library recovery 13
S3.3 Library amplification 13

APPENDIX
SA1 Troubleshooting 15
SA2 myBaits Standard Protocol Quick Guide 16

5
REQUIREMENTS AND RECOMMENDATIONS

Input library
TYPE Use myBaits with PCR-amplified and amplifiable NGS libraries, including Illumina
TruSeq®-style, Illumina Nextera® Flex-style, Ion Torrent, or other libraries with universal adapter priming
sites. It is NOT recommended to use myBaits with PCR-free libraries; additionally, myBaits are incompatible
with libraries made using original Nextera or Nextera XT library preparation kits, or any library type
containing biotin. Dual-indexed libraries are strongly recommended to reduce the hazard of mis-indexing
induced by PCR jumping events.

VOLUME Each myBaits target enrichment reaction has space for 7 µL total NGS library volume. Many
pools will require concentration to 7 µL with vacuum centrifugation or other means. Complete this in
advance of your myBaits experiments. Libraries should be suspended in nuclease-free buffer or water.

MASS A wide range of total library mass can be successfully enriched with myBaits (nanograms
to micrograms). However, best results are seen when 100 ng or more total mass is used per enrichment
reaction. It is strongly recommended that library qPCR is used to measure library mass, rather than e.g. dye
assay or electrophoresis. See note below on default recommendations for mass input for library pools.

POOLING Optimal pooling parameters (both in terms of number of libraries and total mass per library)
will vary between library types and bait sets, and will require trials to identify. However, many configurations
should work well. To minimize variation in capture performance among pooled samples, only pool libraries
based on comparable anticipated bait-genome sequence identity (i.e, taxon), DNA quality, starting DNA
amount, library insert length, and relative target constituent vs. background. Pool equal amounts of each
library. We recommend that when libraries derive from organisms with genome sizes smaller than 5 Gbp,
pool eight libraries, 250 ng each, for a total of 2 µg per enrichment reaction. For genomes 5 Gbp or larger,
pool eight libraries, 1 µg each for a total of 8 µg.

Blocking oligos
When ordering your myBaits kit, please indicate the sequencing library configuration you intend to enrich.
The standard adapter blocking reagent provided with the kit (Block X) is compatible with Illumina
TruSeq-style or Nextera-style libraries with single 6-12 bp or dual 6-12 bp indexing. For different adapter
configurations, we recommend ordering Custom IDT® xGen® Blocking Oligos customized for your NGS
library adapter sequences. At a concentration of 1 μg/μL, any custom adapter-blocking oligos can be used
in lieu of myBaits Block X.

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - Standard Protocol March 2022 6
Equipment required
Item Notes
50 mL tubes 1 per 44 reactions
Microcentrifuge tubes (1.5, 1.7, or 1.8 mL) 2 per 8 reactions
0.2 mL PCR strips with attached lids 2 per 8 reactions (e.g., VWR Cat# 93001-118)
Pipettors and tips for 0.5 - 500 μL Multichannel for 20 and 500 μL recommended
✝
Thermal cycler with heated lid compatible with 0.2 mL strips 1 or 2
Magnetic particle collector for microcentrifuge tubes 1 (e.g., ThermoFisher Cat# 12321D)
Magnetic particle collector for 0.2 mL strips 1 (e.g., Permagen Cat# S500)
Vortex mixer and mini-centrifuge for tubes and strips
Water bath or incubation oven at 65°C
Heat block for microcentrifuge tubes at 60°C

✝
Ensure that the thermal cycler and strips allow no more than 4 µL of 30 µL volume evaporation overnight at 65°C

Reagents required
Reagent Notes
Nuclease-free (“NF”) water 900 µL per reaction
PCR primers to amplify sequencing libraries after capture, e.g.:
Illumina P5: AATGATACGGCGACCACCGA 2.5 uL @ 10 μM per reaction
Illumina P7: CAAGCAGAAGACGGCATACGA 2.5 uL @ 10 μM per reaction
PCR reagents for post-capture amplification 1 per reaction (e.g. Roche Cat# 07958927001)
PCR purification system, e.g., silica columns or SPRI beads 1 cleanup per reaction

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - Standard Protocol March 2022 7
PROCEDURE

PART 1: Hybridization setup

Sequencing libraries are mixed with various blocking nucleic acids, denatured, and then combined with other
hybridization reagents (including baits). These hybridization reactions incubate for several hours to allow
baits to encounter and hybridize with target library molecules.

S1.1 Choose a hybridization temperature (TH)

65°C 62°C 60°C

When bait-target sequence When bait-target sequence When bait-target sequence
divergence is expected to be divergence is expected to be divergence is expected to be
less than 10% 10 to 15% 15 to 25%

S1.2 Prepare materials

Reagents Equipment
Hyb N and Hyb S from Box 1 Nuclease-free microcentrifuge tubes (×2)
Hyb D and Hyb R from Box 2 0.2 mL strips with attached lids (×1 per 8 reactions)
Block C, Block O, and Block X from Box 2 Pipettors and tips; multichannel for 20 µL recommended
Baits from Box 3 KEEP ON ICE Vortex mixer and mini-centrifuge for above tube types
Libraries or library pools in 7 µL per reaction Heat block set to 60°C
Thermal cycler(s); 2 blocks recommended for 24 or more reactions

Program the thermal cycler: Step Temperature Time

1 95°C 5m
Set lid temperature 5 to 10°C above
each step temperature to minimize 2 TH 5m
evaporation 3 TH ∞

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - Standard Protocol March 2022 8
S1.3 Hybridization Mix setup
1. Once the Hyb reagents have thawed, vortex to homogenize and then briefly centrifuge.

Heat Hyb N and Hyb S to 60°C and vortex to dissolve any precipitate present after thawing

2. Assemble the Hybridization Mix in a microcentrifuge (MC) tube, briefly vortex and briefly centrifuge
the contents to collect. The following volumes are already adjusted for pipetting error:

Component µL / Reaction
Hyb N 9.25
Hyb D 3.5
Hyb S* 0.5 *Cloudiness caused by Hyb S addition will clear after step 3
Hyb R 1.25
Baits 5.5
TOTAL 20

3. Incubate the Hybridization Mix at 60°C for 10 minutes in the heat block. Vortex occasionally to
collect the condensate. Remove from the heat block and let sit 5 minutes at room temperature.

4. For each capture reaction, aliquot 18.5 µL of Hybridization Mix to a 0.2 mL well/tube.

These reaction aliquots of Hybridization Mix are now referred to as “HYBs”

S1.4 Blockers Mix setup

1. Assemble the Blockers Mix specific for your target taxon/taxa in an appropriately-sized tube and
mix by pipetting. The following volumes are already adjusted for pipetting error:

MOST TAXA PLANTS SALMONIDS

Component µL / Reaction Component µL / Reaction Component µL / Reaction
Block O 2.5 Block O 5.0 Block O -
Block C 2.5 Block C - Block C 2.5
Block X 0.5 Block X 0.5 Block X 0.5
NF Water - NF Water - NF Water 2.5
TOTAL 5.5 TOTAL 5.5 TOTAL 5.5

2. For each capture reaction, aliquot 5 µL of Blockers Mix to a 0.2 mL well/tube.

3. Add 7 µL of individual or pooled libraries to each Blockers Mix aliquot and mix by pipetting.
These libraries mixed with Blockers Mix aliquots are now referred to as “LIBs”

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - Standard Protocol March 2022 9
 S1.5 Reaction assembly
Double-check the thermal program: Step Temperature Time
Set lid temperature 5 to 10°C 1 95°C 5m
above each step temperature to 2 TH 5m
minimize evaporation 3 TH ∞

1. Put the LIBs in the thermal cycler, close

the lid, and start the thermal program.

2. Once the cycler reaches the

hybridization temperature during step 2,
pause the program, put the HYBs in the
thermal cycler, close the lid, and resume
the program.

3. After step 2 of the program is complete,

leaving all tubes in the thermal cycler,
pipette 18 µL of each HYB to each LIB.
Use a multichannel pipettor for easier
execution. Gently homogenize by
pipetting up and down 5 times.

4. Dispose of the HYB tubes. Briefly spin

down the LIBs, return to the thermal
cycler, close the lid, and allow the
reactions to incubate overnight (16 to 24
hours).

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - Standard Protocol March 2022 10
PART 2: Bind and Wash (“Cleanup”)
Bait-target hybrids are bound to streptavidin-coated magnetic beads, and then most non-target DNA is
removed with several rounds of washing with a warm buffer. This is usually performed the day following
completion of Part 1.

S2.1 Choose a wash temperature (TW - typically identical to TH)

65°C 62°C 60°C

When bait-target sequence When bait-target sequence When bait-target sequence
divergence is expected to be divergence is expected to be divergence is expected to be
10% or less 10 to 15% 15 to 25%

S2.2 Prepare materials

Start at least 90 minutes before intended hybridization stop time

Reagents
Hyb S (Box 1) *
Binding Buffer (Box 1) * * Allow these reagents to come to room temperature
Wash Buffer (Box 1) * before use; warm to 60°C and vortex to dissolve
Beads (Box 1) precipitate if necessary
Nuclease-free (NF) Water (up to 900 µL per reaction)

Equipment
Water bath or incubation oven set to the TW (e.g., 65°C)
Receptacles for 50 mL tubes, 0.2 mL strips and microcentrifuge tubes compatible with above incubation device
Vortex mixer and mini-centrifuge for 0.2 mL strips and MC tubes
Magnetic particle collector(s) (MPC) for above strips and/or tubes

When using only a When using a

microcentrifuge (MC) tube-compatible MPC 0.2 mL tube-compatible MPC
Nuclease-free 50 mL tube, 1 per 44 cleanups Nuclease-free 50 mL tube, 1 per 68 cleanups
Nuclease-free 0.2 mL PCR strips with
Nuclease-free MC tubes, 1 per reaction
individually-attached lids, 1 vessel per reaction
Heat block set to the TW Thermal cycler set to TW
Pipettors and tips for 20 – 200 µL;
Pipettors and tips for 20 – 500 µL
multichannel pipettor strongly recommended

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - Standard Protocol March 2022 11
S2.3 Wash Buffer X preparation
This step generates enough Wash Buffer X for 44 reactions in microcentrifuge (“MC”) tube cleanup format,
and 68 reactions in 0.2 mL cleanup format; scale up or down if needed.
1. Thaw and thoroughly homogenize Wash Buffer and Hyb S prior to aliquoting in order to dissolve any
visible precipitate; warm slightly if necessary.
2. Combine 400 µL Hyb S, 39.6 mL NF water and 10 mL Wash Buffer in a 50 mL tube. Vortex
thoroughly, label “Wash Buffer X.” Wash Buffer X can be stored at 4°C for 1 month
3. Heat the Wash Buffer X to the TW in the water bath or oven for at least 30 minutes before use.

S2.4 Bead preparation Prepare beads immediately prior to use

1. For each capture reaction, aliquot 30 µL beads to a microcentrifuge tube.

2. Pellet the beads in the MPC until the suspension is clear (1-2 minutes).
Leaving the tubes on the magnet, remove and discard the supernatant.
3. Add 200 µL Binding Buffer to each bead aliquot. Vortex to resuspend the beads and centrifuge
briefly. Place tube in the MPC and pellet beads; remove and discard the supernatant.
4. Repeat Step 3 above twice for a total of three washes.
5. Resuspend each washed bead aliquot in 70 µL Binding Buffer. If proceeding to washing in 0.2 mL
format, transfer the aliquots to PCR strips.

TIP: Beads can be prepared in 8 (or fewer) reaction batches (240 µL) in a microcentrifuge tube. Multiply all
volumes by the number of reactions in the batch; i.e., for 8 reactions-worth, wash with 1.6 mL and resuspend in
560 µL Binding Buffer, then aliquot 70 µL suspension to individual tubes.

S2.5 Binding beads and hybrids

1. Heat the bead aliquots to the TW (e.g., 65°C) for at least 2 minutes.
2. Transfer each capture reaction to the heated bead aliquots. Mix by pipetting.
3. Incubate the libraries + beads on the heat block or thermal cycler for 5 minutes. Agitate at the 2.5
minute mark by flicking or inverting the tubes to keep the beads suspended, followed by briefly
centrifuging.

S2.6 Bead washing

1. Pellet the beads with the MPC until the solution is clear. Remove and discard the supernatant.
2. Add 375 µL (MC tube format) or 180 µL (0.2 mL format) warmed Wash Buffer X to the beads,
remove from the MPC, place on heat block for 15 seconds, and briefly vortex or mix by pipetting.
Briefly centrifuge the mixture.
3. Incubate for 5 minutes at the TW in the heat block or thermal cycler. Agitate at the 2.5 minute mark
via gentle vortexing and then briefly centrifuge.
4. Repeat steps 1 through 3 two times for MC tube format (three washes total), or three times for 0.2
mL format (four washes total). After the last wash and pelleting, remove as much liquid as
possible without touching the bead pellet.

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - Standard Protocol March 2022 12
PART 3: Library Resuspension and Amplification
Bead-bound enriched library is resuspended in Buffer E and amplified.

S3.1 Prepare materials

Reagents Equipment
Buffer E (Box 2) Tubes appropriate for PCR master mix assembly
PCR primers for amplifying libraries (e.g., P5 and P7) Tubes or strips for 50 µL PCR amplification
PCR reagents for post-capture amplification Pipettors and tips capable of 5 – 100 µL volumes
PCR purification system, e.g., silica columns or SPRI beads Vortex mixer and mini-centrifuge for above tube types
Nuclease-free (NF) Water Thermal cycler

S3.2 Enriched library recovery

1. Add 30 µL Buffer E to the washed beads and thoroughly resuspend by pipetting.
Then, depending on your library amplification system, choose workflow A or B:

WORKFLOW A: When using KAPA HiFi HotStart or NEB WORKFLOW B: When not using the polymerase
Ultra II Q5 polymerase systems for amplification systems for amplification in workflow A
2B. Incubate the suspension at 95°C
2A. Proceed directly to section S3.3 using for 5 minutes
this bead resuspension as the template in 3B. Immediately pellet the beads in the MPC
amplification and collect the supernatant containing
the enriched libraries

S3.3 Library amplification

This is an example post-capture amplification using KAPA HiFi HotStart ReadyMix and Illumina libraries:
1. Assemble the following PCR master mix:

Component Final Concentration µL / Reaction Sequence

NF Water - 5 -
2X KAPA HiFi HotStart Ready Mix 1X 25 -
P5 library primer (at 10 μM) 500 nM 2.5 AATGATACGGCGACCACCGA
P7 library primer (at 10 μM) 500 nM 2.5 CAAGCAGAAGACGGCATACGA
Enriched Library (on- or off-bead) - 15 * -
TOTAL 50 -
*Remaining bead-bound library can be stored at -20°C for several months.

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - Standard Protocol March 2022 13
S3.3 Library amplification (continued)
2. Cycle the reactions with the following thermal program:

Step Temperature Time

1 98°C 2 minutes
2 98°C 20 seconds *Minimize cycles where possible.
×8 to 14 Cycles required to meet molarity
3 60°C 30 seconds
cycles* requirements of sequencing
4 72°C 45 seconds platform may exceed 14.
5 72°C 5 minutes
6 8°C ∞

3. After amplification:
- If beads were included in the amplification reaction and you intend to use silica columns
for purification, pellet the beads first and purify only the supernatant.

- Otherwise, purify the reaction using your preferred PCR cleanup (e.g., silica columns or
SPRI beads).

The enriched libraries are now ready for quantification, quality-assessment, and sequencing.

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - Standard Protocol March 2022 14
APPENDIX

SA1: Troubleshooting
During hybridization, my thermal cycler dropped below the hybridization temperature.
You can expect a lower on-target read proportion and target read complexity for these libraries than
if the temperature remained where intended, but not outright enrichment failure. Shallow preliminary
sequencing will determine whether targets are likely to be retrieved at sufficient coverage within budget.

My enriched and amplified library is not visible on electrophoresis gel or similar.

Successful captures frequently yield a total mass of just a few nanograms even after
re-amplification, which can be difficult to visualize with electrophoresis. This is most common when
capturing especially small targets (<100 bp), or targets that are present at low frequency in the starting
library (like those in degraded/ancient/environmental DNA), or if there is under-reamplification of the library
post-capture. Often a few more cycles of library amplification will render the captured product sufficiently
high in concentration to view with electrophoresis. Alternatively, determine with library qPCR whether the
library is of sufficient mass for sequencing. If cycling is halted before reaching PCR plateau, the qPCR
product can be visualized with electrophoresis to determine length distribution. Consult with your
sequencing provider for library concentration and volume requirements.

My enriched and amplified library appears significantly longer than my original library, or has two peaks.

This may happen if the libraries are over-amplified and have formed ‘daisy-chains’ or ‘bubbles’ by
experiencing cycles of denature-renature without template extension. These can be reverted to their original
appearance in electrophoresis by applying three PCR cycles using regular library amplification.

I observe a high ratio of PCR duplicates in my enriched library sequence data.

Percent duplicates in sequencing data (i.e. “clonality” or “duplication rate”) increases as you
sequence deeper, and therefore it can only be fairly compared between experiments when the sequencing
depth is normalized before analysis. Evaluate whether you have simply over-sequenced the libraries by
plotting raw sequencing reads obtained on the X axis, and unique reads observed on the Y axis. If this
complexity curve has plateaued, but you achieved sufficient unique reads, you sequenced more deeply than
necessary. If it has not flattened, or you need to increase the total potential unique read yield of the library,
use more DNA per library preparation and/or more library per capture reaction. Avoid diluting baits before
capture. When working with heavily contaminated or damaged DNA target molecules, consider reducing
temperatures used in all steps to improve capture sensitivity. Reducing PCR cycles when possible may also
improve target coverage uniformity and complexity for a given sequencing depth, in some cases having an
indirect effect on duplication rate. For more information about library complexity for any NGS application,
we recommend Daley & Smith 2013 (doi: 10.1038/nmeth.2375).

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - Standard Protocol March 2022 15
SA2: myBaits Procedure Quick Guide - Standard Protocol
1. For each reaction, build the following Mixes; pipetting error is built in:

Hybridization Mix Blockers Mix

Component μL / Reaction Component μL / Reaction
Hyb N 9.25 Block X 0.5
Hyb D 3.5 Block C 2.5
Hyb S 0.5 Block O 2.5*
Hyb R 1.25 NF Water 0✝
Baits 5.5 TOTAL 5.5
*Plants: 5.0; Salmonids: 0
TOTAL 20 ✝
Plants: 0; Salmonids: 2.5

2. After pre-warming the Hybridization mix for 10 minutes @ 60°C, for each reaction, aliquot 18.5 µL of
Hybridization Mix to their own tubes – now “HYBs”.
3. For each reaction, aliquot 5 µL of Blockers Mix and then add 7 µL of each library – now “LIBs”.
4. Incubate the LIBs in the thermal cycler for 5 minutes @ 95°C and then drop to the hybridization temperature
(e.g., 65°C). Be sure to use a heated lid.
5. Put the HYBs in the thermal cycler and warm to the hybridization temperature for 5 minutes.
6. Transfer 18 µL of each HYB to each LIB, mix by pipetting, and incubate for 16-24 hours.
7. 1.5 hours before step 9, prepare Wash Buffer X by combining 400 µL Hyb S, 39.6 mL nuclease-free molecular
biology-grade water and 10 mL Wash Buffer in a 50 mL tube. Vortex thoroughly and warm to the hybridization
temperature for at least 45 minutes.
8. Prepare 30 µL of beads per reaction by washing three times in 200 µL Binding Buffer. Resuspend the washed
bead aliquots in 70 µL Binding Buffer and warm the suspensions to the hybridization temperature for at least 2
minutes.
9. Combine the warmed beads with the hybridization reactions and incubate for 5 minutes at the hybridization
temperature, agitating at 2.5 minutes to keep beads suspended.
10. Pellet the beads and remove the supernatant. If using microcentrifuge tubes for cleanup, wash the beads three
times with 375 µL warmed Wash Buffer X, incubating 5 minutes at the hybridization temperature. Wash four
times with 180 µL washes if using a 96-well magnetic particle concentrator and 0.2 mL strips/tubes.
11. Resuspend the beads in 30 µL Buffer E and then use 15 µL of this in a 50 µL amplification reaction with KAPA®
HiFi or NEB Ultra II Q5 polymerase systems. If not using these polymerase systems, instead elute the library
from the beads by incubating the suspension for 5 minutes at 95°C, immediately pellet the beads, and then use
15 µL of the supernatant in a 50 µL amplification reaction.
12. Purify the amplification reactions using silica columns or SPRI beads. If using silica columns and beads were
included in the amplification reaction, pellet the beads first and purify only the supernatant.

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - Standard Protocol March 2022 16
High Sensitivity Protocol
For high background contamination, ancient DNA, high bait-target divergence, and/or short insert fragments

CONTENTS

REQUIREMENTS AND RECOMMENDATIONS

Input library 18
Blocking oligos 18
Special note on two-round enrichment protocols 19
Equipment and reagents 19

PROCEDURE Part 1: Hybridization Setup

H1.1 Choose a hybridization temperature 20
H1.2 Prepare materials 20
H1.3 Hybridization Mix setup 21
H1.4 Blockers Mix setup 21
H1.5 Reaction assembly 22

PROCEDURE Part 2: Bind and Wash

H2.1 Choose a wash temperature 23
H2.2 Prepare materials 23
H2.3 Wash Buffer X preparation 24
H2.4 Bead preparation 24
H2.5 Binding beads and hybrids 24
H2.6 Bead washing 24

PROCEDURE Part 3: Library Resuspension and Amplification

H3.1 Prepare materials 25
H3.2 Enriched library recovery 25
H3.3 Library amplification 25
H3.4 Perform a second round of enrichment 26

APPENDIX
HA1 Troubleshooting 27
HA2 myBaits High Sensitivity Protocol Quick Guide 28

17
REQUIREMENTS AND RECOMMENDATIONS

Input library
TYPE Use myBaits with PCR-amplified and amplifiable NGS libraries, including Illumina
TruSeq®-style, Illumina Nextera® Flex-style, Ion Torrent, or other libraries with universal adapter priming
sites. It is NOT recommended to use myBaits with PCR-free libraries; additionally, myBaits are incompatible
with libraries made using original Nextera or Nextera XT library preparation kits, or any library type
containing biotin. Dual-indexed libraries are strongly recommended to reduce the hazard of mis-indexing
induced by PCR jumping events.

VOLUME Each myBaits target enrichment reaction has space for 7 µL total NGS library
volume. Many pools will require concentration to 7 µL with vacuum centrifugation or other means. Perform
this in advance of your myBaits experiments. Libraries should be suspended in nuclease-free buffer or
water.

MASS & POOLING A wide range of total library mass can be successfully enriched with myBaits
(nanograms to micrograms). Optimal pooling parameters (both in terms of number of libraries and total
mass per library) will vary between library types and bait sets and may require trials to identify. However,
many configurations should work well.

Non-degraded, non-contaminated DNA libraries (e.g. libraries with bait-target divergence

expected mean >25%): To minimize variation in capture performance among pooled samples, only pool
libraries of comparable anticipated bait-genome sequence identity (i.e, taxon), DNA quality, starting DNA
amount, library insert length, and relative target constituent vs. background. Pool equal amounts of each
library. When libraries derived from organisms with genome sizes smaller than 5 Gbp, pool eight libraries,
250 ng each, for a total of 2 µg per enrichment reaction. For genomes 5 Gbp or larger, pool eight libraries, 1
µg each for a total of 8 µg.

Degraded and contaminated DNA libraries: Pool as few libraries as possible, and input as much as
possible to capture, up to a total of 12 µg. If pooling is required, make certain that libraries are balanced by
endogenous content to ensure each sample contributes the same amount of target content. For example, if
two libraries are to be pooled, and library A has 20% endogenous template and library B has 10%
endogenous template, include twice the mass of library B as library A in the enrichment pool.

Blocking oligos
When ordering your myBaits kit, please indicate the sequencing library configuration you intend to enrich.
The standard adapter blocking reagent provided with the kit (Block X) is compatible with Illumina
TruSeq-style or Nextera-style libraries with single 6-12 bp or dual 6-12 bp indexing. For different adapter
configurations, we recommend ordering Custom IDT® xGen® Blocking Oligos customized for your NGS

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - High Sensitivity Protocol March 2022 18
library adapter sequences. At a concentration of 1 μg/μL, any custom adapter-blocking oligos can be used
in lieu of myBaits Block X.

Special note on two-round enrichment protocols:

The High Sensitivity protocol includes two rounds of enrichment. This may require that you purchase
additional myBaits Reagents (without Baits). For example, if you plan to use all 16 reactions of a myBaits kit
in the High Sensitivity protocol, you will need to have both the 16 reaction kit as well as at least 16
additional reactions-worth of myBaits Reagents. These can be purchased in 16 or 48 reaction kits, catalog
numbers 300016 and 300048, respectively.

Equipment required
Item Notes
50 mL tubes 1 per 44 reactions
Microcentrifuge tubes (1.5, 1.7, or 1.8 mL) 2 per 8 reactions
0.2 mL PCR strips with attached lids 2 per 8 reactions (e.g., VWR Cat# 93001-118)
Pipettors and tips for 0.5 - 500 μL Multichannel for 20 and 500 μL recommended
✝
Thermal cycler with heated lid compatible with 0.2 mL strips 1 or 2
Magnetic particle collector for microcentrifuge tubes 1 (e.g., ThermoFisher Cat# 12321D)
Magnetic particle collector for 0.2 mL strips 1 (e.g., Permagen Cat# S500)
Vortex mixer and mini-centrifuge for tubes and strips
Water bath or incubation oven at 65°C
Heat block for microcentrifuge tubes at 60°C

✝
Ensure that the thermal cycler and strips allow no more than 4 µL of 30 µL volume evaporation overnight at 65°C

Reagents required
Reagent Notes
Nuclease-free (“NF”) water 900 µL per reaction
PCR primers to amplify sequencing libraries after capture, e.g.:
Illumina P5: AATGATACGGCGACCACCGA 2.5 uL @ 10 μM per reaction
Illumina P7: CAAGCAGAAGACGGCATACGA 2.5 uL @ 10 μM per reaction
PCR reagents for post-capture amplification 1 per reaction (e.g. Roche Cat# 07958927001)
PCR purification system, e.g., silica columns or SPRI beads 1 cleanup per reaction

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - High Sensitivity Protocol March 2022 19
PROCEDURE

PART 1: Hybridization setup

Sequencing libraries are mixed with various blocking nucleic acids, denatured, and then combined with other
hybridization reagents (including baits). These hybridization reactions incubate for several hours to allow
baits to encounter and hybridize with target library molecules.

H1.1 Choose a hybridization temperature (TH)

63°C 60°C 55°C

For DNA libraries with low GC For libraries with expected For libraries with insert length
content or with expected bait-target bait-target sequence divergence distributions mostly shorter than
divergence of less than 15% of 15 to 25% the myBaits probe length, or
expected bait-target sequence
divergence higher than 25%

H1.2 Prepare materials

Reagents Equipment
Nuclease-free Water (“H2O”) Nuclease-free microcentrifuge tubes (×2)
Hyb N and Hyb S from Box 1 0.2 mL strips with attached lids (×1 per 8 reactions)
Hyb D and Hyb R from Box 2 Pipettors and tips; multichannel for 20 µL recommended
Block C, Block O, and Block X from Box 2 Vortex mixer and mini-centrifuge for above tube types
Baits from Box 3 KEEP ON ICE Heat block set to 60°C
Libraries or library pools in 7 µL per reaction Thermal cycler(s); 2 blocks recommended for 24 or more reactions

Program the thermal cycler: Step Temperature Time

1 95°C 5m
Set lid temperature 5 to 10°C above
each step temperature to minimize 2 TH 5m
evaporation 3 TH ∞

H1.3 Hybridization Mix setup

1. Once the Hyb reagents have thawed, vortex them to homogenize and then briefly centrifuge.

Heat Hyb N and Hyb S to 60°C and vortex to dissolve any precipitate present after thawing

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - High Sensitivity Protocol March 2022 20
 2. Assemble the Hybridization Mix in a microcentrifuge (MC) tube, briefly vortex and briefly centrifuge
to collect the sample. The following volumes are already adjusted for pipetting error:

Component µL / Reaction
Hyb N 9.25
Hyb D 3.5
Hyb S* 0.5 *Cloudiness caused by Hyb S addition will clear after step 3
Hyb R 1.25
H2O (round 1 / round 2) 1.1 / 4.4 First enrichment round: 1.1 μL Second round: 4.4 μL
Baits (round 1 / round 2) 4.4 / 1.1 First enrichment round: 4.4 μL Second round: 1.1 μL
TOTAL 20

3. Incubate the Hybridization Mix at 60°C for 10 minutes in the heat block. Vortex occasionally to
collect condensate. Remove from the heat block and let sit 5 minutes before proceeding.

4. For each capture reaction, aliquot 18.5 µL of Hybridization Mix to a 0.2 mL well/tube.

These reaction aliquots of Hybridization Mix are now referred to as “HYBs”

H1.4 Blockers Mix setup

1. Assemble the Blockers Mix specific for your target taxon/taxa in an appropriately-sized tube and
mix by pipetting. The following volumes are already adjusted for pipetting error:

MOST TAXA PLANTS SALMONIDS

Component µL / Reaction Component µL / Reaction Component µL / Reaction
Block O 2.5 Block O 5.0 Block O -
Block C 2.5 Block C - Block C 2.5
Block X 0.5 Block X 0.5 Block X 0.5
NF Water - NF Water - NF Water 2.5
TOTAL 5.5 TOTAL 5.5 TOTAL 5.5

2. For each capture reaction, aliquot 5 µL of Blockers Mix to a 0.2 mL well/tube.

3. Add 7 µL of individual or pooled libraries to each Blockers Mix aliquot and mix by pipetting.
These libraries mixed with Blockers Mix aliquots are now referred to as “LIBs”

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - High Sensitivity Protocol March 2022 21
 H1.5 Reaction assembly
Double-check the thermal program: Step Temperature Time
Set lid temperature 5 to 10°C 1 95°C 5m
above each step temperature to 2 TH 5m
minimize evaporation 3 TH ∞

1. Put the LIBs in the thermal cycler, close

the lid, and start the thermal program.

2. Once the cycler reaches the

hybridization temperature during step 2,
pause the program, put the HYBs in the
thermal cycler, close the lid, and resume
the program.

3. After step 2 of the program is complete,

leaving all tubes in the thermal cycler,
pipette 18 µL of each HYB to each LIB.
Use a multichannel pipettor for easier
execution. Gently homogenize by
pipetting up and down 5 times.

4. Dispose of the HYB tubes. Briefly spin

down the LIBs, return to the thermal
cycler, close the lid, and allow the
reactions to incubate overnight (16 to 24
hours).

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - High Sensitivity Protocol March 2022 22
PART 2: Bind and Wash (“Cleanup”)
Bait-target hybrids are bound to streptavidin-coated magnetic beads, and then most non-target DNA is
removed with several rounds of washing with a warm buffer. This is usually performed the day following
completion of Part 1.

H2.1 Choose a wash temperature (TW - typically identical to TH)

63°C 60°C 55°C

When bait-target sequence When bait-target sequence When bait-target sequence
divergence is expected to be divergence is expected to be divergence is expected to be
15% or less 15 to 25% higher than 25%

H2.2 Prepare materials

Start at least 90 minutes before intended hybridization stop time

Reagents
Hyb S (Box 1) *
Binding Buffer (Box 1) * * Allow these reagents to come to room temperature
Wash Buffer (Box 1) * before use; warm to 60°C and vortex to dissolve
Beads (Box 1) precipitate if necessary
Nuclease-free (NF) Water (up to 900 µL per reaction)

Equipment
Water bath or incubation oven set to the TW (e.g., 65°C)
Receptacles for 50 mL tubes, 0.2 mL strips and microcentrifuge tubes compatible with above incubation device
Vortex mixer and mini-centrifuge for 0.2 mL strips and MC tubes
Magnetic particle collector(s) (MPC) for above strips and/or tubes

When using only a When using a

microcentrifuge (MC) tube-compatible MPC 0.2 mL tube-compatible MPC
Nuclease-free 50 mL tube, 1 per 44 cleanups Nuclease-free 50 mL tube, 1 per 68 cleanups
Nuclease-free 0.2 mL PCR strips with
Nuclease-free MC tubes, 1 per reaction
individually-attached lids, 1 vessel per reaction
Heat block set to the TW Thermal cycler set to TW
Pipettors and tips for 20 – 200 µL;
Pipettors and tips for 20 – 500 µL
multichannel pipettor strongly recommended

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - High Sensitivity Protocol March 2022 23
H2.3 Wash Buffer X preparation
This step generates enough Wash Buffer X for 44 reactions in microcentrifuge (“MC”) tube cleanup format,
and 68 reactions in 0.2 mL cleanup format; scale up or down if needed.
1. Thaw and thoroughly homogenize Wash Buffer and Hyb S prior to aliquoting in order to dissolve any
visible precipitate; warm slightly if necessary.
2. Combine 400 µL Hyb S, 39.6 mL NF water and 10 mL Wash Buffer in a 50 mL tube. Vortex
thoroughly, label “Wash Buffer X.” Wash Buffer X can be stored at 4°C for 1 month
3. Heat the Wash Buffer X to the TW in the water bath or oven for at least 30 minutes before use.

H2.4 Bead preparation Prepare beads immediately prior to use

1. For each capture reaction, aliquot 30 µL beads to a microcentrifuge tube.

2. Pellet the beads in the MPC until the suspension is clear (1-2 minutes).
Leaving the tubes on the magnet, remove and discard the supernatant.
3. Add 200 µL Binding Buffer to each bead aliquot. Vortex to resuspend the beads and centrifuge
briefly. Pellet in the MPC, remove and discard the supernatant.
4. Repeat Step 3 above twice for a total of three washes.
5. Resuspend each washed bead aliquot in 70 µL Binding Buffer. If proceeding to washing in 0.2 mL
format, transfer the aliquots to PCR strips.

TIP: Beads can be prepared in 8 (or fewer) reaction batches (240 µL) in a microcentrifuge tube. Multiply all
volumes by the number of reactions in the batch; i.e., for 8 reactions-worth, wash with 1.6 mL and resuspend in
560 µL Binding Buffer, then aliquot 70 µL suspension to individual tubes.

H2.5 Binding beads and hybrids

1. Heat the bead aliquots to the TW (e.g., 63°C) for at least 2 minutes.
2. Transfer each capture reaction to the heated bead aliquots. Mix by pipetting.
3. Incubate the libraries + beads on the heat block or thermal cycler for 5 minutes. Agitate at the 2.5
minute mark by flicking or inverting the tubes to keep the beads suspended, followed by briefly
centrifuging to collect.

H2.6 Bead washing

1. Pellet the beads with the MPC until the solution is clear. Remove and discard the supernatant.
2. Add 375 µL (MC tube format) or 180 µL (0.2 mL format) warmed Wash Buffer X to the beads,
remove from the MPC, place on heat block for 15 seconds, and briefly vortex or mix by pipetting.
Briefly centrifuge to collect.
3. Incubate for 5 minutes at the TW in the heat block or thermal cycler. Agitate at the 2.5 minute mark
via gentle vortexing and briefly centrifuge.
4. Repeat steps 1 through 3 two times for MC tube format (three washes total), or three times for 0.2
mL format (four washes total). After the last wash and pelleting, remove as much fluid as possible
without touching the bead pellet.

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - High Sensitivity Protocol March 2022 24
PART 3: Library Resuspension and Amplification
Bead-bound enriched library is resuspended in Buffer E and amplified.

H3.1 Prepare materials

Reagents Equipment
Buffer E (Box 2) Tubes appropriate for PCR master mix assembly
PCR primers for amplifying libraries (e.g., P5 and P7) Tubes or strips for 50 µL PCR amplification
PCR reagents for post-capture amplification Pipettors and tips capable of 5 – 100 µL volumes
PCR purification system, e.g., silica columns or SPRI beads Vortex mixer and mini-centrifuge for above tube types
Nuclease-free (NF) Water Thermal cycler

H3.2 Enriched library recovery

1. Add 30 µL Buffer E to the washed beads and thoroughly resuspend by pipetting.
Then, depending on your library amplification system, choose workflow A or B:

WORKFLOW A: When using KAPA HiFi HotStart or NEB WORKFLOW B: When not using the polymerase
Ultra II Q5 polymerase systems for amplification systems for amplification in workflow A
2B. Incubate the suspension at 95°C
2A. Proceed directly to section H3.3 using for 5 minutes
this bead resuspension as template in 3B. Immediately pellet the beads in the MPC
amplification and collect the supernatant containing
the enriched libraries

H3.3 Library amplification

This is an example post-capture amplification using KAPA HiFi HotStart ReadyMix and Illumina libraries.

If this is the first time performing step H3.3, generate two of the following reactions per enrichment
reaction (each with 15 µL enriched library as template). Otherwise, generate only one:

1. Assemble the following PCR master mix:

Component Final Concentration µL / Reaction Sequence

NF Water - 5 -
2X KAPA HiFi HotStart Ready Mix 1X 25 -
P5 library primer (at 10 μM) 500 nM 2.5 AATGATACGGCGACCACCGA
P7 library primer (at 10 μM) 500 nM 2.5 CAAGCAGAAGACGGCATACGA
Enriched Library (on- or off-bead) - 15 * -
TOTAL 50 -
*Remaining bead-bound library can be stored at -20°C for several months.

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - High Sensitivity Protocol March 2022 25
H3.3 Library amplification (continued)
2. Cycle the reactions with the following thermal program:

Step Temperature Time

1 98°C 2 minutes
2 98°C 20 seconds
×14 or 8 *First round of enrichment: 14
3 60°C 30 seconds
cycles* Second round of enrichment: 8
4 72°C 45 seconds
5 72°C 5 minutes
6 8°C ∞

3. After amplification:
- If beads were included in the amplification reaction and you intend to use silica columns
for purification, pellet the beads first and purify only the supernatant.

- Otherwise, purify the reaction using your preferred PCR cleanup (e.g., silica columns or
SPRI beads).

H3.4 Perform a second round of enrichment

If this is the end of the first time through step H3.3 (one of two):

1. Combine both purified amplification reactions generated above and concentrate to 7 µL.
2. Repeat steps H1.1 through H3.3 using this once-enriched template as input.

If this is the end of your second time through step H3.3 (two of two), the enriched libraries are now ready
for quantification, quality-assessment, and sequencing.

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - High Sensitivity Protocol March 2022 26
APPENDIX

HA1: Troubleshooting
During hybridization, my thermal cycler dropped below the hybridization temperature
You can expect a lower on-target read proportion and target read complexity for these libraries than
if the temperature had remained where intended, but not outright enrichment failure. Shallow preliminary
sequencing will determine whether targets are likely to be retrieved at sufficient coverage within budget.

My enriched and amplified library is not visible on electrophoresis gel or similar

Successful captures frequently yield a total mass of just a few nanograms even after
re-amplification, which can be difficult to visualize with electrophoresis. This is most common when
capturing especially small targets (<100 bp), or targets that are present at low frequency in the starting
library (like those in degraded/ancient/environmental DNA), or if there is under-reamplification of the library
post-capture. Often a few more cycles of library amplification will render the captured product sufficiently
high in concentration to view with electrophoresis. Alternatively, determine with library qPCR whether the
library is of sufficient mass for sequencing. If cycling is halted before reaching PCR plateau, the qPCR
product can be visualized with electrophoresis to determine length distribution. Consult with your
sequencing provider for library concentration and volume requirements.

My enriched and amplified library appears significantly longer than my original library, or has two peaks.

This may happen if the libraries are over-amplified and have formed ‘daisy-chains’ or ‘bubbles’ by
experiencing cycles of denature-renature without template extension. These can be reverted to their original
appearance in electrophoresis by applying three PCR cycles using regular library amplification.

I observe a high ratio of PCR duplicates in my enriched library sequence data.

Percent duplicates in sequencing data (i.e. “clonality” or “duplication rate”) increases as you
sequence deeper, and therefore it can only be fairly compared between experiments when the sequencing
depth is normalized before analysis. Evaluate whether you have simply over-sequenced the libraries by
plotting raw sequencing reads obtained on the X axis, and unique reads observed on the Y axis. If this
complexity curve has plateaued, but you achieved sufficient unique reads, you sequenced more deeply than
necessary. If it has not flattened, or you need to increase the total potential unique read yield of the library,
use more DNA per library preparation and/or more library per capture reaction. Avoid diluting baits before
capture. When working with heavily contaminated or damaged DNA target molecules, consider reducing
temperatures used in all steps to improve capture sensitivity. Reducing PCR cycles when possible may also
improve target coverage uniformity and complexity for a given sequencing depth, in some cases having an
indirect effect on duplication rate. For more information about library complexity for any NGS application,
we recommend Daley & Smith 2013 (doi: 10.1038/nmeth.2375).

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - High Sensitivity Protocol March 2022 27
HA2: myBaits Procedure Quick Guide - High Sensitivity Protocol
1. For each reaction, build the following Mixes; pipetting error is built in:

Hybridization Mix Blockers Mix

Component μL / Reaction Component μL / Reaction
Hyb N 9.25 Block X 0.5
Hyb D 3.5 Block C 2.5
Hyb S 0.5 Block O 2.5*
Hyb R 1.25 NF Water 0✝
Baits (round 1 / 2) 4.4 / 1.1 TOTAL 5.5
H2O (round 1 / 2) 1.1 / 4.4
*Plants: 5.0; Salmonids: 0
TOTAL 20 ✝
Plants: 0; Salmonids: 2.5

2. After pre-warming the Hybridization mix for 10 minutes @ 60°C, for each reaction, aliquot 18.5 µL of
Hybridization Mix to their own tubes – now “HYBs”.
3. For each reaction, aliquot 5 µL of Blockers Mix and then add 7 µL of each library – now “LIBs”.
4. Incubate the LIBs in the thermal cycler for 5 minutes @ 95°C and then drop to the hybridization temperature
(e.g., 63°C). Be sure to use a heated lid.
5. Put the HYBs in the thermal cycler and warm to the hybridization temperature for 5 minutes.
6. Transfer 18 µL of each HYB to each LIB, mix by pipetting, and incubate for 16-24 hours.
7. 1.5 hours before step 9, prepare Wash Buffer X by combining 400 µL Hyb S, 39.6 mL nuclease-free molecular
biology-grade water and 10 mL Wash Buffer in a 50 mL tube. Vortex thoroughly and warm to the hybridization
temperature for at least 45 minutes.
8. Prepare 30 µL of beads per reaction by washing three times in 200 µL Binding Buffer. Resuspend washed bead
aliquots in 70 µL Binding Buffer and warm the suspensions to the hybridization temperature for at least 2
minutes.
9. Combine the warmed beads with the hybridization reactions and incubate for 5 minutes at the hybridization
temperature, agitating at 2.5 minutes to keep beads suspended.
10. Pellet the beads and remove the supernatant. If using microcentrifuge tubes for cleanup, wash the beads three
times with 375 µL warmed Wash Buffer X, incubating 5 minutes at the hybridization temperature. Wash four
times with 180 µL washes if using a 96-well magnetic particle concentrator and 0.2 mL strips/tubes.
11. Resuspend the beads in 30 µL Buffer E and then use 15 µL of this in a 50 µL amplification reaction with KAPA®
HiFi or NEB Ultra II Q5 polymerase systems. If not using these polymerase systems, instead elute the library
from the beads by incubating the suspension for 5 minutes at 95°C, immediately pellet the beads, and then use
15 µL of the supernatant in a 50 µL amplification reaction. Do two amplifications if this is the first round of
enrichment; do one if this is the second and last round of enrichment.
12. Purify the amplification reactions using silica columns or SPRI beads. If using silica columns and beads were
included in the amplification reaction, pellet the beads first and purify only the supernatant.
13. If this is the end of your first round of enrichment: combine both post-capture amplifications and concentrate to
7 uL, then repeat steps 1-12. Otherwise, the enriched libraries are ready for QC and sequencing.

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - High Sensitivity Protocol March 2022 28
Long Insert Protocol
For target enrichment of NGS libraries containing inserts 1-10 kilobase pairs in length

CONTENTS

REQUIREMENTS AND RECOMMENDATIONS

Input library 30
Blocking oligos 30
Special note for handling long-insert libraries 30
Equipment and reagents 31

PROCEDURE Part 1: Hybridization Setup

L1.1 Choose a hybridization temperature 32
L1.2 Prepare materials 32
L1.3 Hybridization Reaction Setup 33

PROCEDURE Part 2: Bind and Wash

L2.1 Choose a wash temperature 34
L2.2 Prepare materials 34
L2.3 Wash Buffer X preparation 35
L2.4 Bead preparation 35
L2.5 Binding beads and hybrids 35
L2.6 Bead washing 35

PROCEDURE Part 3: Library Resuspension and Amplification

L3.1 Prepare materials 36
L3.2 Enriched library recovery 36
L3.3 Library amplification 36

APPENDIX
LA1 Troubleshooting 38
LA2 myBaits Long Insert Protocol Quick Guide 39

29
REQUIREMENTS AND RECOMMENDATIONS

Input library
TYPE Use myBaits with PCR-amplified and amplifiable NGS libraries with universal adapter
priming sites. For long insert library preparation, we recommend the procedure described in Witek et al.
2016 (doi: 10.1038/protex.2016.027). It is NOT recommended to use myBaits with PCR-free libraries;
additionally, myBaits are incompatible with libraries made using original Nextera or Nextera XT library
preparation kits, or any library type containing biotin. Dual-indexed libraries are strongly recommended to
reduce the hazard of mis-indexing induced by PCR jumping events.

VOLUME Each myBaits target enrichment reaction has space for 7 µL total NGS library volume. Many
pools will require concentration to 7 µL with vacuum centrifugation or other means. Complete this in
advance of your myBaits experiments. Libraries should be suspended in nuclease-free buffer or water.

MASS For long insert capture, we recommend using 250 ng total library per enrichment reaction,
as quantified with intercalating dye assay (e.g. Qubit).

POOLING Optimal pooling parameters (both in terms of number of libraries and total mass per library)
will vary between library types and bait sets, and will require trials to identify. However, many configurations
should work well. To minimize variation in capture performance among pooled samples, only pool libraries
of comparable anticipated bait-genome sequence identity (i.e, taxon), starting DNA amount, library insert
length, and relative target constituent vs. background. Pool equal amounts of each library. For long insert
capture, by default we recommend pooling three libraries, 83 ng each, for a total of ~250 ng per enrichment
reaction.

Blocking oligos
When ordering your myBaits kit, please indicate the sequencing library configuration you intend to enrich.
The standard adapter blocking reagent provided with the kit (Block X) is compatible with Illumina
TruSeq-style or Nextera-style libraries with single 6-12 bp or dual 6-12 bp indexing. For different adapter
configurations, we recommend ordering Custom IDT® xGen® Blocking Oligos customized for your NGS
library adapter sequences. At a concentration of 1 μg/μL, any custom adapter-blocking oligos can be used
in lieu of myBaits Block X.

Special note for handling long-insert libraries

Use gentle repeated pipetting rather than vortexing to homogenize solutions that contain both beads
(MyOne C1 or SPRI) and long insert library. This helps reduce potential mechanical shearing.

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - Long Insert Protocol March 2022 30
Equipment required
Item Notes
50 mL tubes 1 per 44 reactions
Microcentrifuge tubes (1.5, 1.7, or 1.8 mL) 2 per 8 reactions
0.2 mL PCR strips with attached lids 2 per 8 reactions (e.g., VWR Cat# 93001-118)
Pipettors and tips for 0.5 - 500 μL Multichannel for 20 and 500 μL recommended
✝
Thermal cycler with heated lid compatible with 0.2 mL strips 1 or 2
Magnetic particle collector for microcentrifuge tubes 1 (e.g., ThermoFisher Cat# 12321D)
Magnetic particle collector for 0.2 mL strips 1 (e.g., Permagen Cat# S500)
Vortex mixer and mini-centrifuge for tubes and strips
Water bath or incubation oven at 65°C
Heat block for microcentrifuge tubes at 60°C

✝
Ensure that the thermal cycler and strips allow no more than 4 µL of 30 µL volume evaporation overnight at 65°C

Reagents required
Reagent Notes
Nuclease-free (“NF”) water 900 µL per reaction
PCR primers to amplify sequencing libraries after capture, e.g.:
Illumina P5: AATGATACGGCGACCACCGA 2.5 uL @ 10 μM per reaction
Illumina P7: CAAGCAGAAGACGGCATACGA 2.5 uL @ 10 μM per reaction
PCR reagents for post-capture amplification 1 per reaction (e.g. Roche Cat# 07958927001)
PCR purification system, e.g., silica columns or SPRI beads 1 cleanup per reaction

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - Long Insert Protocol March 2022 31
PROCEDURE

PART 1: Hybridization setup

Sequencing libraries are mixed with various blocking nucleic acids, denatured, and then combined with other
hybridization reagents (including baits). These hybridization reactions incubate for several hours to allow
baits to encounter and hybridize with target library molecules.

L1.1 Choose a hybridization temperature (TH)

65°C 62°C 60°C

When bait-target sequence When bait-target sequence When bait-target sequence
divergence is expected to be divergence is expected to be divergence is expected to be
less than 10% 10 to 15% 15 to 25%

L1.2 Prepare materials

Reagents Equipment
Hyb N and Hyb S from Box 1 Nuclease-free microcentrifuge tubes (×2)
Hyb D and Hyb R from Box 2 0.2 mL strips with attached lids (×1 per 8 reactions)
Block C, Block O, and Block X from Box 2 Pipettors and tips; multichannel for 20 µL recommended
Baits from Box 3 KEEP ON ICE Vortex mixer and mini-centrifuge for above tube types
Libraries or library pools in 7 µL per reaction Heat block set to 60°C
Thermal cycler(s); 2 blocks recommended for 24 or more reactions

Program the thermal cycler: Step Parameters

1 60°C, 10 minutes
Set lid temperature 5 to 10°C
2 95°C, 10 minutes
above each step temperature to
3 Reduce 0.1°C per second to TH
minimize evaporation
4 Hold at TH

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - Long Insert Protocol March 2022 32
L1.3 Hybridization Reaction Setup
1. Once all reagents have thawed, vortex them to homogenize and then briefly centrifuge.

Heat Hyb N and Hyb S to 60°C and vortex to dissolve any precipitate present after thawing

2. Assemble the Capture Mix in a microcentrifuge (MC) tube combining the reagents in the order
indicated. The following volumes are already adjusted for pipetting error:

MOST TAXA PLANTS SALMONIDS

Component µL / Reaction Component µL / Reaction Component µL / Reaction
Hyb N 9.25 Hyb N 9.25 Hyb N 9.25
Hyb D 3.5 Hyb D 3.5 Hyb D 3.5
Hyb S* 0.5 Hyb S* 0.5 Hyb S* 0.5
Hyb R 1.25 Hyb R 1.25 Hyb R 1.25
Block O 2.5 Block O 5.0 Block O -
Block C 2.5 Block C - Block C 2.5
Block X 0.5 Block X 0.5 Block X 0.5
NF Water - NF Water - NF Water 2.5
Baits 5.5 Baits 5.5 Baits 5.5
TOTAL 25.5 TOTAL 25.5 TOTAL 25.5
*Cloudiness caused by Hyb S addition will clear after step 3

Briefly vortex and centrifuge to collect.

3. For each capture reaction, aliquot 23 µL of Capture Mix to a 0.2 mL well/tube.

4. Add 7 µL of individual or pooled libraries to each Capture Mix aliquot and mix by gently pipetting.
5. Place the reactions in the thermal cycler and run the thermal program, incubating overnight.

Set lid temperature 5 to 10°C above Step Parameters

each step temperature to minimize 1 60°C, 10 minutes
evaporation 2 95°C, 10 minutes
3 Reduce 0.1°C per second to TH
4 Hold at TH

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - Long Insert Protocol March 2022 33
PART 2: Bind and Wash (“Cleanup”)
Bait-target hybrids are bound to streptavidin-coated magnetic beads, and then most non-target DNA is
removed with several rounds of washing with a warm buffer. This is usually performed the day following
completion of Part 1.

For long insert libraries, mix reactions using gentle pipetting or inversion rather than vortexing in
order to minimize shearing effects

L2.1 Choose a wash temperature (TW - typically identical to TH)

65°C 62°C 60°C

When bait-target sequence When bait-target sequence When bait-target sequence
divergence is expected to be divergence is expected to be divergence is expected to be
10% or less 10 to 15% 15 to 25%

L2.2 Prepare materials

Start at least 90 minutes before intended hybridization stop time

Reagents
Hyb S (Box 1) *
Binding Buffer (Box 1) * * Allow these reagents to come to room temperature
Wash Buffer (Box 1) * before use; warm to 60°C and vortex to dissolve
Beads (Box 1) precipitate if necessary
Nuclease-free (NF) Water (up to 900 µL per reaction)

Equipment
Water bath or incubation oven set to the TW (e.g., 65°C)
Receptacles for 50 mL tubes, 0.2 mL strips and microcentrifuge tubes compatible with above incubation device
Vortex mixer and mini-centrifuge for 0.2 mL strips and MC tubes
Magnetic particle collector(s) (MPC) for above strips and/or tubes

When using only a When using a

microcentrifuge (MC) tube-compatible MPC 0.2 mL tube-compatible MPC
Nuclease-free 50 mL tube, 1 per 44 cleanups Nuclease-free 50 mL tube, 1 per 68 cleanups
Nuclease-free 0.2 mL PCR strips with
Nuclease-free MC tubes, 1 per reaction
individually-attached lids, 1 vessel per reaction
Heat block set to the TW Thermal cycler set to TW
Pipettors and tips for 20 – 200 µL;
Pipettors and tips for 20 – 500 µL
multichannel pipettor strongly recommended

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - Long Insert Protocol March 2022 34
L2.3 Wash Buffer X preparation
This step generates enough Wash Buffer X for 44 reactions in microcentrifuge (“MC”) tube cleanup format,
and 68 reactions in 0.2 mL cleanup format; scale up or down if needed.
1. Thaw and thoroughly homogenize Wash Buffer and Hyb S prior to aliquoting in order to dissolve any
visible precipitate; warm slightly if necessary.
2. Combine 400 µL Hyb S, 39.6 mL NF water and 10 mL Wash Buffer in a 50 mL tube. Vortex
thoroughly, label “Wash Buffer X.” Wash Buffer X can be stored at 4°C for 1 month.
3. Heat the Wash Buffer X to the TW in the water bath or oven for at least 30 minutes before use.

L2.4 Bead preparation Prepare beads immediately prior to use

1. For each capture reaction, aliquot 30 µL beads to a microcentrifuge tube.

2. Pellet the beads in the MPC until the suspension is clear (1-2 minutes).
Leaving the tubes on the magnet, remove and discard the supernatant.
3. Add 200 µL Binding Buffer to each bead aliquot. Vortex to resuspend the beads and centrifuge
briefly. Pellet in the MPC, remove and discard the supernatant.
4. Repeat Step 3 above twice for a total of three washes.
5. Resuspend each washed bead aliquot in 70 µL Binding Buffer. If proceeding to washing in 0.2 mL
format, transfer the aliquots to PCR strips.

TIP: Beads can be prepared in 8 (or fewer) reaction batches (240 µL) in a microcentrifuge tube. Multiply all
volumes by the number of reactions in the batch; i.e., for 8 reactions-worth, wash with 1.6 mL and resuspend in
560 µL Binding Buffer, then aliquot 70 µL suspension to individual tubes.

L2.5 Binding beads and hybrids

1. Heat the bead aliquots to the TW (e.g., 65°C) for at least 2 minutes.
2. Transfer each capture reaction to the heated bead aliquots. Mix by pipetting.
3. Incubate the libraries + beads on the heat block or thermal cycler for 5 minutes. Agitate at the 2.5
minute mark by flicking or inverting the tubes to keep the beads suspended, followed by briefly
centrifuging to collect.

L2.6 Bead washing

1. Pellet the beads with the MPC until the solution is clear. Remove and discard the supernatant.
2. Add 375 µL (MC tube format) or 180 µL (0.2 mL format) warmed Wash Buffer X to the beads,
remove from the MPC, place on heat block for 15 seconds, and mix by pipetting. Briefly centrifuge
to collect.
3. Incubate for 5 minutes at the TW in the heat block or thermal cycler. Agitate at the 2.5 minute mark
by gentle pipetting. Briefly centrifuge to collect the mixture.
4. Repeat steps 1 through 3 two times for MC tube format (three washes total), or three times for 0.2
mL format (four washes total). After the last wash and pelleting, remove as much liquid as
possible without touching the bead pellet.

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - Long Insert Protocol March 2022 35
PART 3: Library Resuspension and Amplification
Bead-bound enriched library is resuspended in Buffer E and amplified.

L3.1 Prepare materials

Reagents Equipment
Buffer E (Box 2) Tubes appropriate for PCR master mix assembly
PCR primers for amplifying libraries (e.g., P5 and P7) Tubes or strips for 50 µL PCR amplification
PCR reagents for post-capture amplification Pipettors and tips capable of 5 – 100 µL volumes
PCR purification system, e.g., silica columns or SPRI beads Vortex mixer and mini-centrifuge for above tube types
Thermal cycler

S3.2 Enriched library recovery

1. Add 30 µL Buffer E to the washed beads and thoroughly resuspend by pipetting.
Then, depending on your library amplification system, choose workflow A or B:

WORKFLOW A: When using KAPA HiFi HotStart or NEB WORKFLOW B: When not using the polymerase
Ultra II Q5 polymerase systems for amplification systems for amplification in workflow A
2B. Incubate the suspension at 95°C
2A. Proceed directly to section L3.3 using for 5 minutes
this bead resuspension as template in 3B. Immediately pellet the beads in the MPC
amplification and collect the supernatant containing
the enriched libraries

L3.3 Library amplification

This is an example post-capture amplification using KAPA HiFi HotStart ReadyMix and Illumina libraries:
1. Assemble the following PCR master mix:

Component Final Concentration µL / Reaction Sequence

NF Water - 5 -
2X KAPA HiFi HotStart Ready Mix 1X 25 -
P5 library primer (at 10 μM) 500 nM 2.5 AATGATACGGCGACCACCGA
P7 library primer (at 10 μM) 500 nM 2.5 CAAGCAGAAGACGGCATACGA
Enriched Library (on- or off-bead) - 10 * -
TOTAL 50 -
*Remaining bead-bound library can be stored at -20°C for several months.

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - Long Insert Protocol March 2022 36
L3.3 Library amplification (continued)
2. Cycle the reactions with the following thermal program:

Step Temperature Time

1 98°C 3 minutes
2 95°C 30 seconds *Minimize cycles where possible.
×25 Cycles required to meet molarity
3 62°C 20 seconds
cycles* requirements of sequencing
4 68°C 10 minutes platform may exceed 25.
6 8°C ∞

3. After amplification:
- If beads were included in the amplification reaction and you intend to use silica columns
for purification, pellet the beads first and purify only the supernatant.

- Otherwise, purify the reaction using your preferred PCR cleanup (e.g., silica columns or
SPRI beads).

The enriched libraries are now ready for quantification, quality-assessment, additional size-selection
(if required), and then platform-specific library preparation and sequencing.

If insufficient total mass was acquired from a single amplification reaction for e.g. PacBio or
Oxford Nanopore library preparation, perform additional amplifications using the remaining
non-amplified enriched library.

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - Long Insert Protocol March 2022 37
APPENDIX

LA1: Troubleshooting
During hybridization, my thermal cycler dropped below the hybridization temperature.
You can expect a lower on-target read proportion and target read complexity for these libraries than
if the temperature had remained where intended, but not outright enrichment failure. Shallow preliminary
sequencing will determine whether targets are likely to be retrieved at sufficient coverage within budget.

My enriched and amplified library is not visible on electrophoresis gel or similar.

Successful captures frequently yield a total mass of just a few nanograms even after
re-amplification, which can be difficult to visualize with electrophoresis. This is most common when
capturing especially small targets (<100 bp), or targets that are present at low frequency in the starting
library (like those in degraded/ancient/environmental DNA), or if there is under-reamplification of the library
post-capture. Often a few more cycles of library amplification will render the captured product sufficiently
high in concentration to view with electrophoresis. Alternatively, determine with library qPCR whether the
library is of sufficient mass for sequencing. If cycling is halted before reaching PCR plateau, the qPCR
product can be visualized with electrophoresis to determine length distribution. Consult with your
sequencing provider for library concentration and volume requirements.

My enriched and amplified library appears significantly longer than my original library, or has two peaks.

This may happen if the libraries are over-amplified and have formed ‘daisy-chains’ or ‘bubbles’ by
experiencing cycles of denature-renature without template extension. These can be reverted to their original
appearance in electrophoresis by applying three PCR cycles using regular library amplification.

I observe a high ratio of PCR duplicates in my enriched library sequence data.

Percent duplicates in sequencing data (i.e. “clonality” or “duplication rate”) increases as you
sequence deeper, and therefore it can only be fairly compared between experiments when the sequencing
depth is normalized before analysis. Evaluate whether you have simply over-sequenced the libraries by
plotting raw sequencing reads obtained on the X axis, and unique reads observed on the Y axis. If this
complexity curve has plateaued, but you achieved sufficient unique reads, you sequenced more deeply than
necessary. If it has not flattened, or you need to increase the total potential unique read yield of the library,
use more DNA per library preparation and/or more library per capture reaction. Avoid diluting baits before
capture. When working with heavily contaminated or damaged DNA target molecules, consider reducing
temperatures used in all steps to improve capture sensitivity. Reducing PCR cycles when possible may also
improve target coverage uniformity and complexity for a given sequencing depth, in some cases having an
indirect effect on duplication rate. For more information about library complexity for any NGS application,
we recommend Daley & Smith 2013 (doi: 10.1038/nmeth.2375).

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - Long Insert Protocol March 2022 38
LA2: myBaits Procedure Quick Guide - Long Insert Protocol
1. For each reaction, build in the following Capture Mix appropriate to your target taxon; pipetting error is built in:
MOST TAXA PLANTS SALMONIDS
Component µL / Reaction Component µL / Reaction Component µL / Reaction
Hyb N 9.25 Hyb N 9.25 Hyb N 9.25
Hyb D 3.5 Hyb D 3.5 Hyb D 3.5
Hyb S 0.5 Hyb S 0.5 Hyb S 0.5
Hyb R 1.25 Hyb R 1.25 Hyb R 1.25
Block O 2.5 Block O 5.0 Block O -
Block C 2.5 Block C - Block C 2.5
Block X 0.5 Block X 0.5 Block X 0.5
NF Water - NF Water - NF Water 2.5
Baits 5.5 Baits 5.5 Baits 5.5
TOTAL 25.5 TOTAL 25.5 TOTAL 25.5

2. For each enrichment reaction, aliquot 23 µL of Capture Mix to their own tubes.
3. To each Capture Mix aliquot, add 7 µL of each library or library pool.
4. Incubate the reactions in the thermal cycler for 10 minutes @ 60°C, then 10 minutes @ 95°C, and then drop to
the hybridization temperature (e.g., 65°C) at a rate of 0.1°C per second. Be sure to use a heated lid. Incubate at
the hybridization temperature for 16-24 hours.
5. 1.5 hours before step 9, prepare Wash Buffer X by combining 400 µL Hyb S, 39.6 mL nuclease-free molecular
biology-grade water and 10 mL Wash Buffer in a 50 mL tube. Vortex thoroughly and warm to the hybridization
temperature for at least 45 minutes.
6. Prepare 30 µL of beads per reaction by washing three times in 200 µL Binding Buffer. Resuspend the washed
bead aliquots in 70 µL Binding Buffer and warm the suspensions to the hybridization temperature for at least 2
minutes.
7. Combine the warmed beads with the hybridization reactions and incubate for 5 minutes at the hybridization
temperature, agitating at 2.5 minutes to keep beads suspended.
8. Pellet the beads and remove the supernatant. If using microcentrifuge tubes for cleanup, wash the beads three
times with 375 µL warmed Wash Buffer X, incubating 5 minutes at the hybridization temperature. Wash four
times with 180 µL washes if using a 96-well magnetic particle concentrator and 0.2 mL strips/tubes.
9. Resuspend the beads in 30 µL Buffer E and then use 10 µL of this in a 50 µL library amplification reaction with
KAPA® HiFi or NEB Ultra II Q5 polymerase systems. If not using these polymerase systems, instead elute the
library from the beads by incubating the suspension for 5 minutes at 95°C, immediately pellet the beads, and
then use 10 µL of the supernatant in a 50 µL amplification reaction.
10. Purify the amplification reactions using silica columns or SPRI beads. If using silica columns and beads were
included in the amplification reaction, pellet the beads first and purify only the supernatant. The enriched
libraries are now ready for quantification, quality-assessment, and sequencing.

myBaits® - Hybridization Capture for Targeted NGS - Manual v.5.02 - Long Insert Protocol March 2022 39