CHAPTER ONE

1.0 Introduction

In 2013 it was estimated that over 382 million people throughout the world had diabetes.

(Cleveland et al. 2018). Approximately 10% of all diabetes cases are type 1. Harvey et al.

(2010). Diabetes affects approximately 537 million persons aged 20 to 79. The total number of

people living with diabetes is expected to climb 643 million by 2030 and 783 million by 2045

(Hocking S. 2019). In Africa, 1.24 million adults are living with diabetes and the total number of

people with diabetes is predicted to increase by 29% to 55 million by 2045. Flavonoids and

other phytochemicals are group of natural compounds that are widely distributed in plants and

have been shown to possess antioxidant and anti-inflammatory properties Harvey et al. (2010).

Diabetes mellitus (DM) is one of the oldest diseases known to man. It was first reported in

Egyptian manuscript about 3000 years ago. In 1936, the distinction between type 1 and type 2

DM was clearly made. (Cleveland et al. 2018). The better understanding of the complications of

diabetes mellitus laboratory mice (Albino Rat) as the experimental Animal, Diabetic Induce.

The dose of Streptozotocin (STZ) to induce diabetes mellitus in animals is important as it may

lead to inadequate induction of diabetes or mortality. Intravenous injection of STZ in adult

Albino rats, leads to the degeneration in Langerhans islet β-cells . Hibiscus sabdariffa has many

more uses like cultivated as ornamental plants, having medicinal qualities due to the presence of

vitamins, proteins, fatty substances, minerals, nutritional components and acids. Plant has very

powerful solution against anticancer, anti-hypertension, obesity and anti-hyperlipdemic etc.

(Hocking S. 2019). Instead of this, hibiscus is consumed for different purposes such as herbal

drinks in the forms of beverages. Extract depicts anti-hypertensive, antioxidant, anti-pyretic,

diuretic effect, anti- diabetic and anti-bacterial properties. Hibiscus sabdariffa shows various
beneficial properties such as anticancer, antioxidant, antipyretic, antibacterial, hepatoprotective

effects, diuretic effects, anticholestrol and antiobesity activities. (Hocking S. 2019). Hibiscus was

utilized for high blood pressure and source of many useful constituents like anthocyanins,

quercetin and alkaloids etc. It worthy of note that zobo Leaf has antioxidant and diuretic

properties. This tendency of increased morbidity and mortality is seen in patients with type 2

DM because of the commonness of this type of DM, its insidious onset and late recognition,

especially in Countries in Africa. (Owolabi et al. 1996). Hibiscus sabdariffa is one of the

famous crop which is gaining the popularity to tackle with many serious disorders. The extract

of zobo plant consist of saponins, glycosides, alkonoids and flavonoids. (Owolabi et al. 1996).

Hence , this study was designed to evaluate the potential impact of Hibiscus sabdariffa leaf,

flavonoid-rich extracts ameliorate homeostatic model assessment and atpase activities in

streptozotocin-induced pancreatic rats

1.1 Justification of the Study

Diabetes mellitus (Dm) is a condition where the body does not make enough insulin or does not

act on it properly, resulting in abnormally high blood sugar (glucose) levels. It is a major public

health issue that is becoming more prevalent around the world. (Cleveland et al. 2018). In recent

times, it has been reported that roughly In Africa, 1.24 million adults are living with diabetes

and the total number of people with diabetes is predicted to increase by 29% to 55 million by

2045. (Harvey et al. 2010). Other than the popular effect of diabetes on pancreases is Pancreatic

Dysfunction causes DM to be gaining more attention sporadically in the World Health

Organisation.
Hibiscus sabdariffa, also known as Roselle, is a plant that is rich in flavonoids. Flavonoids are

bioactive compounds known for their antioxidant and anti-inflammatory properties. Research has

suggested that these compounds may play a role in the prevention and management of various

chronic diseases, including diabetes.

Streptozotocin-induced diabetic rats are commonly used in research to mimic human diabetes.

These rats exhibit similar metabolic abnormalities and complications observed in diabetic

patients, making them a suitable model for studying the effects of potential treatments.

By examining the impact of hibiscus sabdariffa leaf flavonoid-rich Extract on carbohydrate

metabolic enzymes in the liver of streptozotocin-induced diabetic rats, this study aims to

determine if these Extract can ameliorate the negative effects of diabetes on liver function.

Carbohydrate metabolic enzymes, such as glucose-6-phosphatase, glucokinase, and glycogen

synthase, play key roles in glucose metabolism. The activity of these enzymes is often

dysregulated in diabetes, leading to abnormal glucose homeostasis.

1.2.1 Overall Objective

The overall objective of this research is to determine the ameliorate potential of Hibiscus

sabdariffa leaf flavonoid-rich extract on Homeostatic model assessment and ATPase activities

in streptozotocin-induced pancreatic rats.

1.2.2 Specific Objectives

The specific objectives of this study are to:

 assess the pancreatic insulin levels in streptozotocin-induced diabetic rats administered

Hibiscus sabdariffa leaf flavonoid-rich extract

 examine the entpdase and atpase activity in streptozotocin-induced diabetic rats

administering Hibiscus sabdariffa leaf flavonoid-rich extract

 determine the Lipase and Nucleotidase Activity in streptozotocin-induced diabetic rats

administering Hibiscus sabdariffa leaf flavonoid-rich extract

 investigate the homa-ir and homa-b activities in streptozotocin-induced diabetic rats

administering Hibiscus sabdariffa leaf flavonoid-rich extract

 evaluate gene expression of insulin receptor in streptozotozin-induced diabetic rats

administered Hibiscus sabdariffa leaf flavonoid-rich extract

 probe gene expression of glp-ir in streptozotozin-induced diabetic rats administered

Hibiscus sabdariffa leaf flavonoid-rich extract.

 CHAPTER TWO

2.0 Literature Review

2.1 Diabetes Mellitus

In ancient times, Greek physicians formulated different means to alleviate diabetes, although

most were not effective, some of which included exercises, drinking of wine, starvation diet,

wearing of warm clothes, wearing flannel, avoiding stress and so many others (Matovu et al.,

2017). It should be emphasized that determining the exact type of DM is difficult. The conditions

that lead to the diagnosis, whether it is detected early, the severity of the initial hypoglycemia,

and the existence of co-occurring diseases or medications can all affect how DM is classified.

Similar to this, it is important to remember that DM is a dynamic process that is constantly

changing. Zimmet et al. (2017).

Diabetes mellitus (DM) is describe as a metabolic illness with numerous etiologies characterized

by persistent hyperglycemia and changes in carbohydrate ,protein and lipid metabolism caused

by deficiencies in insulin production ,insulin action or both polyuria, polydipsia, and

unexplained weight loss are common symptoms of diabetes. (Micheal, 2008). Diabetes is an

assortment of metabolic illnesses known as diabetes produce high blood glucose (blood sugar),

either as a result of insufficient insulin synthesis, improper cell response to insulin, or both.

There are two main categories of problems brought on by diabetes. Diabetes retinopathy,

diabetes nephropathy, and diabetes neuropathy are examples of micro-vascular problems.

Atherosclerosis, coronary heart disease, stroke, and cerebrovascular disease are examples of

macro-vascular problems. etc. (Harvey et al. 2010).

2.1.1 Types Of Diabetes Mellitus

The old and confusing terms of insulin-dependent or non-insulin-dependent DM have

disappeared and the terms DM type 1 and 2 remain. The other types of DM included in the

classification refer to; other specific types of diabetes associated with genetic β-cell defects,

genetic defects in insulin action, disease associated with processes that affect the exocrine

pancreas, endocrinopathies, pharmacological or chemical substances, infections, infrequent

forms of autoimmune diabetes, and other syndromes that are at times associated with the disease,

and GD. Zimmet et al. (2017).

It should be emphasized that determining the exact type of DM is difficult. The conditions that

lead to the diagnosis, whether it is detected early, the severity of the initial hypoglycemia, and

the existence of co-occurring diseases or medications can all affect how DM is classified. Similar

to this, it is important to remember that DM is a dynamic process that is constantly changing.

Zimmet et al. (2017). As a result, it can worsen, get better, or get worse, and the degree of

metabolic control is closely related to the course of the illness or the treatment that is deemed to

be most effective at any particular time.

2.2 Risk Factors Of Diabetes Mellitus

Type 1 diabetes, formerly known as insulin-dependent, juvenile, or childhood-onset diabetes, is

defined by inadequate insulin synthesis in the body. It is most common in children and

adolescents. Type 1 diabetes' specific causes remain unknown, and it is presently not avoidable.

Amiel et al. (2018) Insulin must be given daily to people with type 1 diabetes in order to control

their blood glucose levels. They cannot survive if they do not have access to insulin. Ellard et al.
(2017). Everyone acknowledged that type 1 diabetes is the consequence of a complex interaction

between genes and the environment, despite the fact that no single environmental risk factor has

been demonstrated to be the primary determinant in a sizable proportion of cases. The Symptoms

include; (Figure2.2) Excessive urination, Thirst, Constant Hunger, Weight loss, Vision changes,

Fatigue, Etc.

Gestational diabetes (GDM) is a temporary condition that occurs in pregnancy and carries

longterm risk of type 2 diabetes. The condition is present when blood glucose values are above

normal but still below those diagnostic of diabetes. Women with gestational diabetes are at

increased risk of some complications during pregnancy and delivery, as are their infants.

Gestational diabetes is diagnosed through prenatal screening, rather than reported symptoms

Ellard et al. (2017). Risk factors and risk markers for GDM include age (the older a woman of

reproductive age is, the higher her risk of GDM); overweight or obesity; excessive weight gain

during pregnancy; a family history of diabetes. (Harrison et al. 2015). GDM during a previous

pregnancy; a history of still birth or giving birth to an infant with congenital abnormality; and

excess glucose in urine during pregnancy. Diabetes in pregnancy and GDM increase the risk of

future obesity and type 2 diabetes in offspring. (Rabbit et al. 2013). Type 2 diabetes mellitus

(DM) is a chronic metabolic disorder in which prevalence has been increasing steadily all over

the world. As a result of this trend, it is fast becoming an epidemic in some countries of the

world with the number of people affected expected to double in the next decade due to increase

in ageing population, thereby adding to the already existing burden for healthcare providers,

especially in poorly developed countries. (Rabbit et al. 2013).

Figure 2.2: SYMPTOMS OF DIABETES MELLITUS

Source: Science Direct

2.3 Symptoms Of Diabetes Mellitus

Symptoms may be similar to those of type 1 diabetes, but are often less marked or absent. As a

result, the disease may go undiagnosed for several years, until complications have already arisen.

For many years type 2 diabetes was seen only in adults but it has begun to occur in children.

Ellard et al. (2017). Type 2 diabetes (formerly called non-insulin-dependent or adult onset

diabetes) results from the body’s ineffective use of insulin. Type 2 diabetes accounts for the vast

majority of people with diabetes around the world. Ellard et al. (2017).

Impaired glucose tolerance (IGT) and impaired fasting glycaemia (IFG) are intermediate

conditions in the transition between normal blood glucose levels and diabetes (especially type 2),

though the transition is not inevitable. And it is determined by an interplay of genetic and

metabolic factors. (Rabbit et al. 2013). The majority of symptoms are typical in both types of

diabetes, but they may vary in the degree and development, as they more severe in type 1 than

type 2. (Baynest, 2015).

Clinical symptoms and signs type I diabetes includes; weight loss, polyuria, polydipsia,

constipation fatigue,blurred vision (glucoma), candidiasis, lethargy, etc. (Figure. 2.3). Clinical

symptoms and signs type II diabetes includes; atherosclerosis, hyperlipidemia, hypertension,

obesity, cardiovascular complications (Figure. 2.3)

Complications of Diabetes Mellitus

Diabetes significantly increases the risk of developing Pancreatic Dysfunction. These

complications can include, acute or chronic. (Krent et al. 2015). An acute complication includes
hypoglycemia, diabetic ketoacidosis, and diabetic hypersmolar Non-ketoacidotic coma. Chronic
complications microvascluar complications or macrovascular complications. Microvascular
complications includes; Neuropathy,Retinopathy, Nephropathy Diabetic food. Macrovascular
complications include;Hypertension., Cardiovascular disease., Cerebrovascular disease,
Peripheral vascular disease. Erectile dysfunction. (Figure. 2.3)

Figure 2.3: Complication of Diabetes Mellitus

Source: Science Direct

2.4 Pathophysiology Of Diabetes Mellitus

There is direct association between hyperglycemia and the physiological responses. The brain

recognizes the hyperglycemia and send a message via nerve impulses to pancreas to decrease

the effect of hyperglycemia. kumara et al. (2017). Type 1 diabetes mellitus is known by

autoimmune reduction of insulin producing cells in the pancreas by CD4+ and CD8+ T cells and

macrophages which infiltrates the islets various features classify type 1 diabetes mellitus as an

autoimmune disease, Immune-competent and accessory cells present and infiltrates in

pancreatic islets, the associated susceptibility for the disease with class II genes of major

histocompatibility complex and human leucocytes antigen.

The physiological response to hyperglycemia

The majority of islet antibodies are move against glutamic acid decarboxylase (GAD) inside the

pancreatic B cells. As a result of the autoimmune destruction of the pancreatic beta cells;

(Vanderloo et al 2011). a deficiency in insulin secretion, which leads to metabolic derangement

linked with type 1 diabetes mellitus. It was also found that there is a defect in administration of

insulin. Joseph, et al. (2010). Islet specific autoantibodies are present, the remarked alteration if

T cell mediated immune-regulation, especially in CD4+ T cell compartment, the participation of

monokines and TH1 cells which aid in production of interleukins in the disease process. kumara

et al. (2017).

The significant resistance to the insulin leads to impaired insulin mediated glucose uptake in the

peripheral, in addition, incomplete suppressed hepatic glucose output and impaired triglyceride

uptake by fat. In order to overcome the insulin resistance, a significant increase in islet cells

leads to increase in amount of insulin secreted. (Vanderloo et al, 2011). Patients with type 2
diabetes has elevated and accelerated endogenous glucose production or impairment in fasting

glucose. As this increase happens in hyperinsulinemia. (Baynest, 2015)

Pathophysiology of hyperglycemia and increased fatty acids in type 2 diabetes glucose tolerance

testing is of value for the early detection of diabetes in a high-risk patient with a glucose level

close to the diagnostic cut-off value. Joseph, et al. (2010). The oral glucose tolerance test

(OGTT) also has a role in women with impaired fasting glucose (fasting glucose 5.6–6.9

mmol/L), who often have postprandial glucose excursions in the diabetic range. The OGTT uses

the 2-hour glucose response following a 75 g oral glucose load to determine the presence of

diabetes. Adegunloye et al. (1996).

Current criteria from the ADA require confirmation by repeat testing on a subsequent day.

(Rabbit et al. 2013). This should be tempered by the clinical situation. For example, it would

not be necessary to confirm in a young hyperglycemic patient with symptoms and ketoacidosis.

Similarly, confirmation would be unnecessary for the unwell patient found to be hyperglycemic

with sepsis, acute infection or acute myocardial infarction, or following a transplant procedure,

where treatment of both the acute underlying illness and associated hyperglycemia is indicated.

Joseph, et al. (2010).

2.5 Diagnosis Of Diabetes Mellitus

Diagnosis in prediabetes or diabetes in one of three different ways (tests):

The A1C test

 At least 6.5% means diabetes

 Between 5.7% and 5.99% means prediabetes

 Less than 5.7% means normal

The FPG (fasting plasma glucose) test Kenny et al. (2017).

 At least 126 mg/dl means diabetes

 Between 100 mg/dl and 125.99 mg/dl means prediabetes

 Less than 100 mg/dl means normal

An abnormal reading following the FPG means the patient has impaired fasting glucose (IFG)

The OGTT (oral glucose tolerance test)

 At least 200 mg/dl means diabetes

 Between 140 and 199.9 mg/dl means prediabetes

 Less than 140 mg/dl means normal

 An abnormal reading following the OGTT means the patient has impaired glucose tolerance

(IGT).

2.6 Complications Of Diabetes Mellitus

Diabetes can lead to various complications that affect different organ systems in the body
William et al. (2006). These complications can arise due to long-term high blood sugar levels
and other factors associated with diabetes McBain et al. (2003) Here are some common
complications of diabetes:

Long-term complications of diabetes include Retinopathy with potential loss of vision,

Nephropathy leading to renal failure, Peripheral neuropathy with risk of foot ulcers,

Amputations, Charcot joints, Autonomic neuropathy causing gastrointestinal, Genitourinary,

Cardiovascular symptoms, Sexual dysfunction, Hypertension and abnormalities of lipoprotein

metabolism are often found in people with diabetes. Kumara et al. (2017).
2.6.1 Pancreatic Dysfunction

Figure 2.6.1: ETIOLOGY OF EXOCRINE PANCREATIC INSUFFICIENCY

Source: Wiley online library

FIGURE 2.6.2: RISKS OF ETIOLOGY OF EXOCRINE PANCREATIC INSUFFICIENCY

Source: pancreapedia
2.7 Management Of Diabetes Mellitus

Type 1 diabetes mellitus (Insulin dependent diabetes mellitus):

 Insulin.

 Diet.

 Exercise.

Type 2 diabetes mellitus (Non-insulin dependent diabetes mellitus)

Start with diet regulation and exercise, If failed (Diet regulation and exercise), include:

Mondifferentapy, Metformin or Acarbose., If the above failed, add a sulfonylurea. If

sulfonylurea failed, add a glitazone. Vanderloo et al 2011). If the above failed, stop the

sulfonylurea (Continue with Metformin and glitazone), Start insulin therapy. If stress (infection,

operation, pregnancy), stop temporarily oral hypoglycemic and use soluble insulin subcutaneous

30 minutes before the three main meals toll recovery then go back to the previous treatment. If

renal impairment; stop permanently oral hypoglycemic, and use intermediate acting insulin such

as lente or isophane. (Baynest, 2015)

2.7.1 DRUGS USED TO MANAGE DIABETES MELLITUS

Treatment modalities include lifestyle modifications, treatment of oral hypoglycemic agents.

Vanderloo et al 2011). Obesity, and insulin sensitizers ie. metformin, a biguanide that reduces

insulin resistance, is still the recommended first line medication especially for obese patients.

Different effective medications include nonsulfonylurea secretagogues, thiazolidinediones, alpha

glucosidase inhibitors, and insulin. Komolafe et al. (2017).

The Physiology of Type 2 Diabetes Mellitus has led to the introduction of new medications like

glucagon-like peptide 1 analogoues: dipeptidyl peptidase-IV inhibitors, inhibitors of the sodium-

glucose cotransporter 2 and 11ß-hydroxysteroid dehydrogenase 1, insulin-releasing glucokinase

activators and pancreatic-G-protein-coupled fatty-acid-receptor agonists, glucagon-receptor

antagonists, metabolic inhibitors of hepatic glucose output and quick-release bromocriptine.

kumara et al. (2017).

 Table 2.7.1: Classes of Drugs

Drug classes Example Mode of Action Sources

Insulin secretagogues Sulfonylureas Inhibit -cell K++ ATP channel and Clin. (2012)

Meglitinides facilitate insulin secretion

GLP-1 agonist Liraglutide Increase glucose-dependent insulin Garber (2011);

Exenatide secretion, reduces glucagon secretion and Filippatos

Lixisenatide decay gastric emptying (2012)

Glucosidase inhibitors Acarbose Reduces the rate of digestion of Kalraet al.

Miglitol carbohydrate in the intestine hence less (2014)

Voglibose glucose absorption

SGLT-2-inhibitors Canagliflozin Increases glucose excretion in urine Hsia et al.

Dapagliflozin (2016)

Empagliflozin

DPP4 inhibitors Vildagliptins Increases endogenous GLP-1 and GIP Sebokovaet al.

Linagliptin levels (2007); Pathak

Saxagliptin et al. (2010)

Sitagliptin
2.7.2 Medicinal Plants

Over 300 species of hibiscus are found worldwide which are basically represented to the

Malvaceae family. The main focus of this plant is its fleshy sepals which are commercially very

valuable and increased its quality. This plant is used to make plethora of food items such as

jellies, candies, sauces and act as flavonoids and coloring agent as well as utilized in many kinds

of drinks. Hibiscus sabdariffa has many more uses like cultivated as ornamental plants, having

medicinal qualities due to the presence of vitamins, proteins, fatty substances, minerals,

nutritional components and acids. Plant has very powerful solution against anticancer, anti-

hypertension, obesity and anti-hyperlipdemic etc. Hibiscus is consumed for different purposes

such as herbal drinks in the forms of beverages, food and hallocinogentic intakes to prevent

from various ailments. Extract depicts anti-hypertensive, antioxidant, anti-pyretic, diuretic effect,

anti- diabetic and anti-bacterial properties. Homeida A. et al. (1991). Hibiscus sabdariffa is one

of the famous crop which is gaining the popularity to tackle with many serious disorders. The

extract of roselle consist of saponins, glycosides, alkonoids and flavonoids. It represents

antibacterial activities against Bacillus steardifferentmophilus, Clostridium sporogenes,

Klebsiella pneumonia, Staphylococcus aureus, Escherichia coli and Bacillus cereus. (Owolabi et

al. 1996).

Anti-diabetic Activity: It is a therapeutic process by the inhibition of α-amylase and α-

glucosidase to control postprandial hyperglycaemia. It shows the ability of pancreatic α-amylase

inhibitor and inhibited intestinal αglycosidase and pancreatic α-amylase enzyme. The report

depicts polyphenolic extract of roselle having antiinsulin preventing potential. Homeida A. et al.

(1991). Hibiscus sabdariffa helps to clean the blood and liver, reduce urinary and high

cholesterol troubles. It helps to decrease hypertension for diabetic patients, high blood pressure
and jaundice. Hibiscus sabdariffa shows various beneficial properties such as anticancer,

antioxidant, antipyretic, antibacterial, hepatoprotective effects, diuretic effects, anticholestrol and

antiobesity activities and so on. In past time Hibiscus was utilized for high blood pressure and

source of many useful constituents like anthocyanins, quercetin and alkaloids etc. It reckons that

zobo Leaf has antioxidant and diuretic properties. Which lower down the blood pressure and

having relaxation potential. (Owolabi et al. 1996).

Three qualities of this antioxidant activity have been utilizing in liposome mechanism Cox-2

shows lower inhibition as compared to ethyl acetate and methonal inhibition. Researchers depict

Zobo Plant has antioxidant properties in case of in vitro and in vivo condition. Adegunloye et al.

(1996).

The antioxidant potential is noticed in its flowers: Additionally, leaf extract of Hibiscus

sabdariffa revealed stronger antioxidant properties rather than leaf extraction zobo mulbery leaf

due to the enrichment of polyphenolic compound. Homeida A. et al. (1991). Earlier studies

shows that leaf extraction of Hibiscus sabdariffa had more radical scavenging effect and

flavonoid content than flowers of Hibiscus Sabdariffa. Roselle consisting natural pigments in

dried calyces which indicates liver protective property, antioxidant activity, hypocholesterolemic

and cardioprotective.

Anti-Diabetic Activity: It is a therapeutic process on the basis of inhibition of α-amylase and α-

glucosidase to control postprandial hyperglycaemia. It shows the ability of pancreatic α-amylase

inhibitor and inhibited intestinal α glycosidase and pancreatic α-amylase enzyme. Hibiscus

sabdariffa is well-known plant all over the world, Called (Zobo Leaf in the Southern part Of

Nigeria). It is also called by roselle and karkade. This plant is good source to earn money. It is

used to make pharmaceutical, folk as well as therapeutic medicines. Adegunloye et al. (1996)
Moreover, it is utilized to prepare various food items such as jams, jellies, sauces, candies and

containing flavoring properties. Komolafe et al. (2017).

All plant parts consist of proteins vitamins and minerals. Zobo Plant shows anti-hypertension,

anti-cancerous, antibacterial, anti-fungal, antipyretic, anti-parasitic, antioxidant, anti- cholesterol

and anti-microbial activities. Some people used it as herbal tea against diabetic, heart and blood

pressure diseases. It can be consumed as dye, cold drink due to its natural dark reddish color.

Owolabi et al. (1996).

FIGURE 2.7.2: Hibiscus Sabdariffa
2.7.3 Overview Of Hibiscus Sabdariffa

Hibiscus sabdariffa is representing the family Malvaceae. This plant needs 4-8 months care to

grow by providing night time temperature at 20°c and 13 hours under sunlight. The yield and

quality of calyces is affected by high humidity and rainfall. It is superior crop which is resistant

to virus, insects, bacteria and fungi attacks. It gives 10t/ha yield from the leaves and 1-5 kg from

the fruits which is nearby 8t/ha

Zobo Plant shows anti-hypertension, anti-cancerous, antibacterial, anti-fungal, antipyretic, anti-

parasitic, antioxidant, anti- cholesterol and anti-microbial activities. Some people used it as

herbal tea against diabetic, heart and blood pressure diseases. It can be consumed as dye, cold

drink due to its natural dark reddish color. Owolabi et al. (1996).

Overall, it is best choice to prevent from some serious ailments and can also be used for cosmetic

and animal feed purposes.

2.8 Methods Of Inducing Diabetes In Rats

Streptozotocin (STZ, 69%) and alloxan (31%) are by far the most frequently used agents and this

model has been useful for the study of multiple aspects of the disease. Both streptozotocin and

alloxan wield their antidiabetic action when they are administered parenterally (intraperitoneally,

intravenously, or subcutaneously). The required dose of these agents for inducing diabetes

depends on the animal species, route of administration (Etuk 2010).

2.8.1 Streptozotocin-Induced Model

STZ-induced diabetes is important animal model and extensively used to mimic human diabetic

condition in the Laboratory Mice (Albino Rats). Type I DM and Type II DM can be produced by

STZ depending on the dose and route of administration but couldn’t be affective every time.

After a two weeks of Aclimitization the Laboratory Mice were fed with Fructose Water.

Streptozotozin (STZ) was induced in rats by intraperitoneal (injection.) The effects induced in

rats by STZ vary depending on the doses of these two compounds, the age of the animals and the

time of administration in relation to the administration of STZ. Factors, such as the

administration route of STZ and the nutritional state of rats may also have some influence. The

age of rats is also of major importance since β-cells of younger animals are less sensitive to STZ.

2.8.2 Mechanism Of Action Of Streptozotocin (Stz)

Streptozotocin (STZ) STZ (2-deoxy-D-glucose derivative of N-methyl-Nnitrosylurea) is a

glucosamine nitrosourea, hydrophilic compound which was first isolated from a soil

microorganism Streptomyces acromogenes and showed broad spectrum antibiotic activity. The

diabetogenic action of STZ is related to its selective destruction of pancreatic β-cells, which are

the only source of insulin in body.(Figure 2.8.2). As STZ is glucose derivative, the blood glucose

moieties enables STZ to be selectively transported to pancreatic β-cells via the low-affinity

GLUT2 glucose transporter in the plasma membrane. Exposure of STZ to pancreatic β-cells

results in damage via different pathways:

a. STZ destructs β-cells by damaging the major macromolecule i.e. DNA by alkylating.

Alkylation of DNA results in fragmentation of DNA in β-cells. DNA injury by STZ leads to

overstimulation of PARP-1 [(poly(ADPribose) polymerase-1] in the insulin-secreting cells and is

harmful to the cell as a result of a substantial depletion of the intracellular PARP-1 substrate,

NAD+. NAD+ is an important molecule implicated in energy metabolism at the cellular level

b. STZ also decreases the activity of islet mitochondrial aconitase, reduces oxygen consumption

by mitochondria and decreases the mitochondrial membrane potential. Komolafe et al. (2017).

c. Generation of nitric oxide may play a role in the cytotoxic action of STZ on insulin-secreting

cells. This assumption is supported by results demonstrating that scavengers of nitric oxide (NO)

attenuate early DNA-strand breaks induced by STZ.

d. STZ generates low amounts of ROS in pancreatic β-cells. These effects may partially

contribute to β-cells damage induced by STZ because of a weak antioxidant defense in these

cells. Komolafe et al. (2017).

e. It has also been revealed that c-Jun N-terminal kinase (JNK) is also involved in the

cytotoxicity of STZ. Increased activity of this enzyme is observed in the case of cellular stress

leading to cell death. Studies on insulin-secreting cells exposed to STZ demonstrated increased

activity of JNK, whereas inhibitors of this enzyme attenuated the cytotoxic action of STZ.

Activation of JNK by STZ is supposed to be preceded by increased activity of PARP-1 since

PARP-1 inhibitors are able to decrease the activity of both PARP-1 and JNK. Nicotinamide

(NIC) NIC (pyridine-3-carboxamide) also known as niacinamide, is an active and water soluble

form of vitamin B3 (niacin). Niacine converted into NIC in the body and is a food additive. NIC

is essential to the coenzymes NADH and NADPH and consequently for numerous enzymatic

reactions in the body including formation of ATP. NIC has neuro-protective and antioxidant

functions and is given to animals to partially protect pancreatic β-cells against STZ.
Figure 2.8.2: Mechanism of action of Streptozotocin

Source: kumara et al. (2017).

2.9 ASSAY STUDIED

2.9.1 Pancreatic Insulin

Pancreatic insulin is a hormone produced by the beta cells of the pancreas. It plays a crucial role

in regulating blood sugar levels by allowing cells to take in glucose from the bloodstream for

energy. Insulin also helps store excess glucose as glycogen in the liver and muscles. Issues with

insulin production or function can lead to conditions like diabetes, where blood sugar levels

become difficult to manage.

2.9.2 Atpases, Entpdases And Their Roles In Pancreatic Function

ATPase, short for Adenosine Triphosphatase, is an enzyme that catalyzes the hydrolysis of ATP

(adenosine triphosphate) into ADP (adenosine diphosphate) and inorganic phosphate (Pi). This

hydrolysis releases energy that can be used for various cellular processes that require energy,

such as muscle contraction, active transport of ions across cell membranes, and synthesis of

molecules.

There are several classes of ATPase enzymes, including P-type ATPases, F-type ATPases, V-

type ATPases, and ABC (ATP-binding cassette) transporters. These enzymes differ in their

structures, mechanisms, and functions. Monsciotti et al. (1983).

Major Types of ATPases

1. ATP Synthase (F1Fo-ATPase): Found in the inner mitochondrial membrane, ATP synthase

operates in reverse of different ATPases, using a proton gradient created by the electron transport
chain to convert ADP and Pi back into ATP. This process is often referred to as oxidative

phosphorylation. Komolafe et al. (2017).

2. Na+/K+-ATPase (Sodium-Potassium Pump): Present in the cell membranes of most animal

cells, this enzyme maintains the proper balance of sodium and potassium ions within cells and

across the cell membrane. It's essential for nerve and muscle cell function and contributes

significantly to the resting membrane potential.

3. Ca2+-ATPase (Calcium Pump): Located in the membranes of the endoplasmic reticulum

and sarcoplasmic reticulum of muscle cells, this ATPase is responsible for actively transporting

calcium ions from the cytoplasm back into these organelles after they've been released during

signaling events or muscle contraction.

4. H+-ATPase (Proton Pump): Found in the membranes of various organelles, including

lysosomes, vacuoles, and the plasma membrane, this enzyme is involved in creating proton

gradients that are utilized for a variety of cellular functions, such as maintaining pH balance and

powering transport processes. Monsciotti et al. (1983).

5. F-ATPase: This ATPase is found in bacteria and particular archaea. It is related to the ATP

synthase and is involved in generating ATP by utilizing the energy from the electrochemical

gradient across the cell membrane.

ATPases actions involved in pancreatic functions:

1. Insulin Secretion: The pancreas contains clusters of cells called islets of Langerhans, which

include beta cells responsible for producing and releasing insulin. Insulin is a hormone that

regulates blood glucose levels. ATP-sensitive potassium (KATP) channels on the surface of beta

cells are modulated by ATP levels. High intracellular ATP levels close these channels, leading to

membrane depolarization and subsequent calcium influx, which triggers insulin release. The
sodium-potassium pump (Na+/K+-ATPase) helps maintain the ion gradients necessary for

proper beta cell function, indirectly contributing to insulin secretion. Komolafe et al. (2017).

2. Exocrine Function: The exocrine portion of the pancreas secretes digestive enzymes into the

small intestine to aid in the breakdown of food. These enzymes are initially secreted as inactive

proenzymes to prevent autodigestion of the pancreas. (Reddington et al. 1984).The pancreas also

secretes bicarbonate ions to neutralize the acidic chyme entering the small intestine from the

stomach. Monsciotti et al. (1983). This bicarbonate secretion is facilitated by a sodium-proton

exchanger (NHE) that exchanges sodium for protons, and the proton gradient is maintained by

the proton pump (H+-ATPase). Komolafe et al. (2017).

3. Zymogen Granule Acidification: Enzymes produced by the pancreas are stored in zymogen

granules within the acinar cells. These granules are acidic, which prevents premature enzyme

activation. The vacuolar-type H+-ATPase pumps protons into the granules, creating an acidic

environment that helps maintain the stability of stored enzymes. W et al. (1996).

4. Electrolyte Transport: Electrolyte transport is vital for both fluid secretion in the exocrine

pancreas and islet cell function. ATPases, such as the Na+/K+-ATPase, contribute to establishing

and maintaining ion gradients that drive electrolyte transport across cell membranes.

5. Regulation of Fluid and Enzyme Secretion: ATPases are involved in regulating fluid

secretion in the exocrine pancreas. The sodium-potassium pump and different transporters help

establish osmotic gradients that drive fluid movement. These processes are crucial for proper

enzyme delivery and digestion in the intestines. Elekofehinti et al. (2017).

6. Metabolic Support: Pancreatic cells, especially islet cells, have high metabolic demands.

ATPases, particularly the Na+/K+-ATPase, are critical for maintaining cellular membrane
potential, ion gradients, and energy balance, which are essential for cell survival and function.

Homeida A. et al. (1991).

Significant role is played by ATPase in maintaining the ion gradients, membrane potentials, and

energy balance required for proper pancreatic function. Dysregulation of ATPase activity in the

pancreas can lead to disruptions in insulin secretion, impaired digestion, and different metabolic

imbalances, contributing to conditions like diabetes and pancreatic insufficiency. W et al. (1996).

Exocrine Pancreatic Function:

In the exocrine portion of the pancreas, ATPases are involved in the secretion of digestive

enzymes into the small intestine. This process is crucial for the breakdown of ingested food and

nutrient absorption. The pancreas secretes enzymes such as amylases, lipases, and proteases,

which aid in the digestion of carbohydrates, lipids, and proteins, respectively.

ATPase activity is necessary for maintaining the ion gradients and electrochemical potential

required for the secretion of digestive enzymes. The secretion process involves the transport of

ions, such as chloride and bicarbonate, across the epithelial cells of the pancreatic ducts. This ion

transport is facilitated by various ion channels and pumps, including ATPases, which help

establish the appropriate ion concentrations for efficient enzyme secretion. Homeida A. et al.

(1991).

Endocrine Pancreatic Function:

The endocrine portion of the pancreas is responsible for producing hormones, primarily insulin

and glucagon, which regulate blood sugar levels. The islets of Langerhans are clusters of

endocrine cells within the pancreas, and beta cells within these islets secrete insulin in response

to elevated blood glucose levels. Monsciotti et al. (1983).

ATP-sensitive potassium (KATP) channels are critical components in the regulation of insulin

secretion from pancreatic beta cells. (Skyler et al.,2017). These channels are inhibited by

increased levels of ATP, which causes the channels to close. Closure of KATP channels

depolarizes the cell membrane, leading to calcium influx and triggering insulin release. ATPases

are involved in maintaining ATP levels within the cell and regulating the function of KATP

channels. Elekofehinti et al. (2017).

The breakdown of ATP and ADP by ENTPDases is typically a two-step process:

1. Nucleoside Triphosphate Hydrolysis: ENTPDases first cleave the terminal phosphate group

from the nucleoside triphosphate, resulting in the formation of a nucleoside diphosphate and an

inorganic phosphate (Pi).

2. Nucleoside Diphosphate Hydrolysis: The nucleoside diphosphate is further hydrolyzed to

form a nucleoside monophosphate and andifferent Pi.

Subtypes of ENTPDases, denoted as NTPDase1, NTPDase2, NTPDase3 etc, each with specific

tissue distribution and substrate preferences. These enzymes are involved in modulating the

duration and strength of purinergic signaling, a form of cell communication that relies on

nucleotides like ATP and its breakdown products. W et al. (1996). Purinergic signaling has

diverse roles, including neurotransmission, vasodilation, immune responses, wound healing,

and more.

ENTPDases are categorized based on their substrate specificity:

1. ENTPD1 (CD39): CD39 is one of the most well-known ENTPDases. It primarily hydrolyzes

ATP and ADP into AMP and inorganic phosphate. CD39 is found on the surface of various cell

types, including endothelial cells, immune cells, and platelets. (Reddington et al. 1984).
Its activity plays a crucial role in modulating extracellular nucleotide levels, which are involved

in cell signaling, inflammation, thrombosis, and immune responses. Homeida A. et al. (1991).

2. ENTPD3: This enzyme is specific for nucleoside triphosphates and diphosphates. It

hydrolyzes NTPs and NDPs into nucleoside monophosphates, such as AMP, GMP, CMP, and

UMP. ENTPD3 is expressed in various tissues and is involved in regulating nucleotide

concentrations in the extracellular environment.

3. ENTPD8: Also known as alkaline phosphodiesterase 1 (ALPD1), this enzyme has a broader

substrate specificity and can hydrolyze NTPs, NDPs, and nucleoside monophosphates (NMPs) to

their respective nucleosides. It is found in the liver and different tissues and plays a role in

nucleotide metabolism. (Reddington et al. 1984).

ENTPDases have several physiological and pathological implications:

Purinergic Signaling Regulation: Extracellular nucleotides, such as ATP, ADP, and UTP, are

important signaling molecules in various cellular processes, including neurotransmission,

immune responses, and vasodilation. ENTPDases help maintain appropriate levels of these

nucleotides, preventing excessive signaling. Komolafe et al. (2017).

Immune Responses: ENTPDases, particularly CD39, are involved in modulating immune

responses. By hydrolyzing ATP and ADP to AMP, they can inhibit pro-inflammatory signaling

and contribute to immune regulation. (Reddington et al. 1984).

Blood Coagulation and Thrombosis: CD39 expressed on platelets and endothelial cells can

play a role in preventing excessive platelet activation and thrombus formation by degrading ADP

and ATP released during platelet aggregation. W et al. (1996).

ENTPDases Role in pancreatic Function

ENTPDase (Ectonucleoside Triphosphate Diphosphohydrolase) is an enzyme that plays a

significant role in various physiological processes, including pancreatic function. It is also

commonly referred to as NTPDase (Nucleoside Triphosphate Diphosphohydrolase). This

enzyme is part of the larger family of ectonucleotidases, which are enzymes found on the cell

surface or in the extracellular space that hydrolyze nucleotides and regulate extracellular

nucleotide concentrations. Komolafe et al. (2017).

2.9.3 Lipase And 5' Nucleotidase Activities In Pancreatic Rats

Lipase and 5'Nucleotidase activities in Pancreatic Rat

Lipase and 5'-Nucleotidase are enzymes that play roles in pancreatic function and lipid

metabolism.

1. Lipase Activity:

Lipase is an enzyme that catalyzes the hydrolysis of dietary triglycerides into fatty acids and

glycerol. In the context of the pancreas, pancreatic lipase is a critical enzyme for digesting

dietary fats in the small intestine. (Skyler et al.,2017). It is secreted by the pancreas into the

duodenum, where it acts on triglycerides in the presence of bile salts to break them down into

absorbable components. In rats, pancreatic lipase activity is typically measured in units per gram

of pancreatic tissue. The activity levels can vary based on factors such as diet, hormonal

regulation, and experimental conditions. Lipase activity is an important indicator of the

pancreas's ability to contribute to fat digestion and absorption.

2. 2. 5'-Nucleotidase Activity:

5'-Nucleotidase is an enzyme that catalyzes the hydrolysis of 5'-nucleotides to yield nucleosides

and inorganic phosphate. It is involved in the breakdown of nucleotides and the regulation of

nucleotide levels in various tissues, including the pancreas.

2.9.4 Homeostatic Model Assessment (Homa)

The Homeostatic Model Assessment (HOMA) is a method used to estimate insulin resistance

and beta-cell function in individuals. It's commonly used in medical research and clinical settings

to assess the status of glucose metabolism and to help understand the potential risk of developing

conditions like diabetes. (Skyler et al.,2017). There are two main variants of the HOMA model:

1. HOMA-IR (Homeostatic Model Assessment of Insulin Resistance): This variant is used to

estimate insulin resistance, which is a condition where the body's cells become less responsive to

the effects of insulin. Insulin resistance is a key factor in the development of type 2 diabetes and

different metabolic disorders. W et al. (1996).

2. HOMA-B (Homeostatic Model Assessment of Beta-cell Function): This variant is used to

estimate the function of the pancreatic beta cells, which are responsible for producing insulin.

HOMA-B provides insight into the capacity of the beta cells to secrete insulin in response to

changes in blood glucose levels.

2.9.5 HOMA-IR and HOMA-B

HOMA-IR (Homeostatic Model Assessment of Insulin Resistance): This calculation is used

to estimate insulin resistance, which is a condition where the body's cells become less responsive
to the effects of insulin. Insulin resistance is a key factor in the development of type 2 diabetes.

(Skyler et al.,2017).

The formula for HOMA-IR is:

HOMA-IR = (Fasting Insulin [μU/ mL] × Fasting Glucose [mmol/L]) / 22.5

In this equation, "Fasting Insulin" represents the concentration of insulin in the blood after an

overnight fast, and "Fasting Glucose" represents the blood glucose level in the same fasting state.

Kenny et al. (2017).

HOMA-B (Homeostatic Model Assessment of Beta-cell function): This calculation is used to

estimate pancreatic beta-cell function, which is responsible for producing and secreting insulin.

HOMA-B provides an indication of how well the beta cells are functioning in response to

glucose levels. The formula for HOMA-B is:

HOMA-B = (20 × Fasting Insulin [μU/ mL]) / (Fasting Glucose [mmol/L] - 3.5)

"Fasting Insulin" and "Fasting Glucose" have the same meanings as in the HOMA-IR formula.

2.9.6 HOMA - IR

HOMA-IR stands for Homeostatic Model Assessment of Insulin Resistance. It's a method used

to estimate insulin resistance, which is a condition where the body's cells become less responsive

to the effects of insulin. Insulin resistance is a key factor in the development of type 2 diabetes

and is often associated with obesity, sedentary lifestyle, and different metabolic disorders.
Component of the formula means:

1. Fasting Insulin: This is the concentration of insulin in the blood after an overnight fast. It

reflects the baseline insulin level when the body is not actively processing food. High fasting

insulin levels are often indicative of insulin resistance.

2. Fasting Glucose: This is the blood glucose level after an overnight fast. It represents the

baseline sugar level in the blood when no recent food intake has occurred. Kenny et al. (2017).

Elevated fasting glucose levels are associated with impaired glucose metabolism and diabetes.

The resulting HOMA-IR value indicates the degree of insulin resistance. Higher HOMA-IR

values are associated with greater insulin resistance. A HOMA-IR value above a particular

threshold is often used as an indicator of increased risk for metabolic disorders, such as type 2

diabetes.

HOMA-IR can provide valuable insights into insulin sensitivity,

When insulin resistance is present, the cells become less sensitive to the effects of insulin,

leading to higher insulin levels expected to maintain normal blood glucose levels. An elevated

HOMA-IR value indicates higher insulin resistance.

Interpretation of HOMA-IR values:

- HOMA-IR < 1: Normal insulin sensitivity

- HOMA-IR 1 - 2.9: Mild insulin resistance

- HOMA-IR 3 - 4.9: Moderate insulin resistance

- HOMA-IR ≥ 5: Severe insulin resistance

It's important to note that while HOMA-IR is a useful tool for assessing insulin resistance, it has

its limitations. It provides an estimation rather than a direct measurement of insulin sensitivity.

Additionally, HOMA-IR is most accurate when used within a clinical context and in conjunction

with different assessments and tests.

HOMA-IR can be used by healthcare professionals to screen for insulin resistance, track changes

over time, and guide treatment decisions for conditions like type 2 diabetes and metabolic

syndrome. If you suspect you have insulin resistance or diabetes, it's recommended to consult a

healthcare provider for proper evaluation and management.

2.9.6 Gene Expression:

Gene expression refers to the process by which information encoded in a gene's DNA sequence

is used to synthesize functional gene products, (Skyler et al.,2017).

such as proteins or non-coding RNA molecules. It's a fundamental process that controls the

production of different molecules within cells and plays a critical role in various biological

processes.

The key steps and concepts involved in gene expression:

1. Transcription: Transcription is the first step in gene expression, where a specific segment of

DNA is copied into a molecule of RNA. This RNA molecule is called messenger RNA (mRNA)

because it carries the genetic information from the DNA to the cell's protein synthesis
machinery. (Famusiwa et al. 2020). Transcription is catalyzed by an enzyme called RNA

polymerase, which reads the DNA template and assembles the corresponding mRNA strand.

2. Post-Transcriptional Processing: In eukaryotic cells (cells with a nucleus), the newly

synthesized mRNA undergoes various modifications before leaving the nucleus. These

modifications include the addition of a protective cap at the 5' end (5' cap) and a poly-A tail at

the 3' end. Introns (non-coding regions) are removed through a process called splicing, resulting

in a mature mRNA molecule that can be transported to the cytoplasm for translation.

3. Translation: Translation is the process by which the information carried by the mRNA is

used to synthesize a protein. It takes place in the ribosomes, which are cellular structures

composed of ribosomal RNA (rRNA) and proteins. Transfer RNA (tRNA) molecules bring

specific amino acids to the ribosome based on the codons (three-letter sequences) in the mRNA.

The ribosome reads the codons and assembles the amino acids in the correct sequence to build a

protein.

4. Protein Folding and Function: Once the protein is synthesized, it often undergoes folding to

adopt a specific three-dimensional structure, which is critical for its function. Proteins are

essential molecules that perform a wide range of tasks in the cell, such as enzymes catalyzing

reactions, structural components, cell signaling, and more. (Skyler et al.,2017).

Gene expression is tightly regulated to ensure that the right genes are expressed in the right cells

at the right times. Regulation occurs at multiple levels, including transcriptional control, post-

transcriptional modifications, and translational regulation. Different factors, including

transcription factors, epigenetic modifications, and signaling pathways, influence gene

expression.
2.9.6.1 Insulin Receptor

Insulin Receptor

The insulin receptor is a protein found on the surface of various cells in the body, particularly on

the surface of cells in adipose tissue, skeletal muscle, and the liver. It plays a crucial role in

regulating blood sugar levels by facilitating the cellular response to insulin, (Famusiwa et al.

2020).a hormone produced by the pancreas.

The insulin receptor is a transmembrane protein that spans the cell membrane. It consists of two

alpha subunits and two beta subunits, which are linked by disulfide bonds. The extracellular part

of the receptor contains the insulin-binding sites, while the intracellular part contains the tyrosine

kinase domains.

The process of insulin signaling involves the following steps:

Insulin Binding: When insulin is released into the bloodstream after a meal, it binds to the
insulin receptors on the cell surface. (Famusiwa et al. 2020). This binding triggers a
conformational change in the receptor.

Autophosphorylation: The conformational change leads to the activation of the tyrosine kinase

domains within the beta subunits of the receptor. These domains phosphorylate specific tyrosine

residues on the intracellular portion of the receptor itself (autophosphorylation).

Recruitment of Downstream Proteins: Phosphorylated tyrosine residues on the receptor create

docking sites for various downstream signaling proteins, Adeoye O. O., et al. (2017). including

insulin receptor substrates (IRS). These proteins are then recruited to the receptor, leading to

further phosphorylation and activation.

Activation of PI3K/Akt Pathway: One of the major downstream pathways activated by the

insulin receptor is the phosphoinositide 3-kinase (PI3K)/Akt pathway. This pathway plays a key

role in glucose uptake, glycogen synthesis, and cell survival. Activation of Akt leads to

translocation of glucose transporters (such as GLUT4) to the cell membrane, allowing the cells

to take up glucose from the bloodstream.

Metabolic Effects: The activation of the insulin receptor and subsequent signaling pathways has

a variety of metabolic effects. It promotes glucose uptake into cells, enhances glycogen synthesis

in the liver and muscles, inhibits gluconeogenesis (glucose production) in the liver, and promotes

protein synthesis and cell growth. Defects in the insulin receptor or its signaling pathways can

lead to insulin resistance.

 CHAPTER THREE

3.0 MATERIALS AND METHODS

3.1 Plant Material Source, Authentication, and Processing

Hibiscus sabdariffa leaves was bought from Oja-Oba, Ado-Ekiti in Ekiti state. The identification
and authentication of the leaf were carried out by a senior taxonomist at the Federal Research
Institute of Nigeria (FRIN), Ibadan, Oyo State, Nigeria. Index number FHI 113742. Hibiscus
sabdariffa were bought and spread to air-dry for about two weeks at room temperature. It was
then grinded using an electric blender turning the air-dried leaves into powder.

3.2 Chemicals, Reagents, and Enzyme Kits

Chemical Used: Methanol, n-hexame, acetic acid, dilute ammonium hydroxide, Absolute

Ethanol, Sulphuric Acid, Distilled Water, Fructose, (STZ) Streptocotozin, Testosterone.

3.3 Extraction Of Flavonoid-Rich

Preparation of 100% of Sulphuric Acid

Procedure:

100 mL of distilled H20 into a Volumetric flask take 100% of sulphuric acid – 1000 mL of H 20

was taken. The Beaker was used to measure the Sulphuric acid, Poured into a measuring cylinder

to 100 mL. This was carried out in a Fume Cupboard into the two Volumetric Flask (100 mL of

Sulphuric acid in the volumetric flask fill distilled H20 to the line of the Volumetric Flask ) V.F.

Shaking Gently the {Sulphuric acid bottle} Winchister bottle.

Procedure:

A known gram of the power sample will be defatted in 80% methanol by maceration for 72

hours. The extract will be concentrated using rotary evaporator. Thereafter a known gram of the

residue will be dissolved in 200 mL of 10% H 2SO4 and hydrolyzed by heating in a water bath for

30 minutes at 100oC. The mixture will be placed on ice for 15 minutes for the precipitation of

the flavonoid aglycones. The flavonoid aglycones will be dissolved in 50 mL of warm 95%

ethanol, filtered into a 100 mL volumetric flask which will be made up to mark with 95%

ethanol. This will be concentrated by rotary evaporator The Extract were obtained and stored in

the refrigerator at 4°C and the refrigerated extract is used for analysis.

3.4 Experimental Animals

Laboratory Mice (Albino Rat)

Twenty Five (25) adult Albino rats of two months old, weighing 75-200g were obtained from

Show-Gold Animal House Idofin, Oye- Ekiti, Ekiti state, Nigeria. They were grouped into five

and each group was housed in a typical laboratory setting with a room temperature of 22 oC to

20°C and a 12-hour light/dark cycle. For a whole week, the rats were acclimatized. Normal rat

pellet chow and 20% of fructose were given as food to the rats for a week as previously

described by (Salau et al.,2021). The rats were studied for 21days prior to sacrifice, they were

dissected through abdominal dislocation. All visible organs were harvested and blood sample

was collected by intravenous interpolation.

3.5 Induction Of Diabetes Into Experimental Animals

Diabetes in Albino rats was induced chemically by diabetogenic agents Streptozotocin. Each rat

received a diabetogenic agent with a single dose Streptozotocin, (produced by Elabscience

Biotechnology Inc. ([email protected], website:www.elabscience.com) prior to the

time of induction food was removed from the rats for 12 hours, they and were served with only

water. 0.23g STZ was dissolved in sodium citrate buffer of pH 7.4 to a concentration of 0.1M

and the rats were infected with the dissolved STZ. 40 mg/kg body weight of STZ was injected

into the experimental animals after which an equal volume of citrate buffer pH 7.4 was injected

into the control group of the rats.

3.6 Experimental Design

The rats were placed into five groups, with five rats in each group. The rats were weighed

accurately and each group contains rats with similar weights.

Group 1. Rats without induction(Normal control or NC)

Group 2. Diabetic rats without treatment (Diabetic control or DC)

Group 3. Diabetic rats administered a low dose (150mg/kg body weight) of flavonoid-rich

extract of Hibisicus sabdariffa (LDHSFL)

Group 4. Diabetic rats administered a high dose (300mg/kg body weight) of flavonoid-rich

extract of Hibisicus sabdariffa (HDHSFL)

Group 5. Diabetic rats administered a standard drug (metformin or MET)

The treatment was carried out over 21 days and the blood glucose levels were measured and

recorded every week

3.7 Pancreatic Tissue Collection And Processing

On the twenty-second day of the oral administration, the rats were sacrificed under chloroform

anesthesia. Blood samples were immediately withdrawn by cardiac puncture from each rat. Their

blood was collected into a plain bottle and was centrifuged for a period of 15min at 5000rev/min

The serum was immediately refrigerated until it could be processed further. Each animal's liver

was collected, washed in normal saline, cleaned using filter paper, weighed using a weighing

balance, and homogenized in 0.1 potassium phosphate buffer at pH 6.5. The homogenized

samples were centrifuged at 4000rpm for 15 minutes before being analyzed Keen et al. (1980).

3.8 BIOCHEMICAL PARAMETERS STUDIED

3.8.1 DETERMINATION OF PANCREATIC INSULIN LEVELS

Insulin

The serum insulin was determined quantitatively using microplate

immunoenzymometric assay kit as described in the manufacturer’s protocol version which
adopted the principles of Tietz (1995).

Principle:

The principle is based on the immobilization that takes on the surface of a microplate
wells through the interaction of streptavidin coated on the wells and exogenously added
biotinylated monoclonal insulin antibody. The enzyme labeled antibody and a serum containing
the native antigens and antibodies without competition or steric hindrance to form a soluble
sandwich complex. The activity of the enzyme in the antibody-bound fraction is directly
proportion al to the native antigen concentration.

Procedure:

An aliquot (0.05 mL) of the standard solution, control, serum samples were placed in
appropriate wells. Exactly 0.01 mL of the insulin reagent was dispensed into each well and the
microplates swirled gently for 20 seconds. The wells were washed three times with 0.35 mL of
working washing solution per well and aspirated using a micropipette. A known volume (0.1
mL) of the working substrate was added to each well and incubated at 25c for 15 minutes.
Exactly 0.05 mL 0f the stopping reagent was placed into each well and mixed gently for 20
seconds. The plate was read on microplate reader at 450 mm within 30 minutes after the addition
of the stopping reagent.

Calculation:

The absorbance of each calibrator, control and serum sample was plotted with the
absorbance on the y-axis and the concentration on the x-axis (Figureure 23). The insulin
concentration of the test samples were extrapolated from the calibration curve obtained by
plotting the absorbance of the standard solution against its corresponding concentrations.

3.8.2 DETERMINATION OF ATPASE ACTIVITY

Assay for ATPase activity

The assay of ATPase activities were carried out using the method described by Bewaji et al

(1985).

Principle: Adenosine triphosphate (ATP) is hydrolysed in the presence of appropriate cations to

release inorganic phosphate. The amount of inorganic phosphate is measured using the

ammonium molybdate-ascorbic acid system. Concentrated sulphuric acid oxidizes ammonium

molybdate to molybdic acid, which gives a yellow colour with inorganic phosphate. Ascorbic
acid reduces the molybdic acid to give a blue colouration whose intensity is proportional to the

concentration of inorganic phosphate liberated into the reaction medium.

Preparation of Calibration Curve for Phosphate

Varying volumes of 1 mM NaH2PO4.2H2O (20-120 µl) were pipetted into six test tubes.

Distilled water was then added to each test tube to make the volume up to 1 mL. 2 mL of

reagent C (H2SO4 - Ammonium molybdate - Ascorbate mix) was added and the mixtures were

left undisturbed at room temperature for 30 minutes, after which the absorbance were read at 820

nm against reagent blank (which contain no NaH2PO4.2H2O). The absorbance obtained was

then used to plot the calibration curve for phosphate .

Assay of Mg2+ ATPase Activity

The determination of Mg2+-ATPase activity was carried out by the method described by

Fleschner and Kraus-Friedmann (1986).

Procedure for determination of Mg2+ ATPase activity

For the test, 400 µl of 240 mM KCl / 60 mM Tris (pH 7.4) was pipetted into test tube.

Thereafter, 20 µl of MgCl2.6H2O (80 mM), 20µl of EGTA (20 mM), 220 µl of distilled water,

20 µl of appropriately diluted enzyme source and 20 µl of Vanadate (0.04 M) was added. This

was mixed and incubated at 370C for 5 minutes. Then 100 µl of ATP (8 mM) was added, this

was also mixed and incubated at 370C for 30 minutes. Thereafter, 200 µl of SDS (5%) and 2,000

µl of reagent C was added. The mixture was left undisturbed at room temperature for 30 minutes

for color development. The blank was similarly prepared but 20 µl of distilled water was used
instead of the 20 µl enzyme source. The absorbance of the test was read against the blank at 820

nm. The absorbance obtained was then extrapolated from the calibration curve for phosphate to

obtain concentration of inorganic phosphate.

Calculation: Specific activity (µmole Pi/mg Prot./hr) = [Pi] × 2 × D.F

1000 × Protein Conc (mg/ mL)

Where;

[Pi] = Concentration of inorganic phosphate in nmoles (obtained from the calibration

curve).

2 = Factor introduced to obtain the amount of Pi released per hour

D.F = Dilution Factor

1000 = factor introduced to convert the Pi release to µmoles.

Assay of ATPases’ activities

The assay of ATPases’ activities was carried out basically by the method of Ronneret al.

(1977).

Principle

Adenosine triphosphate (ATP) is hydrolysed in the presence of appropriate cations to

release inorganic phosphate. The amount of inorganic phosphate is measured using the

ammonium molybdate-ascorbic acid system. Concentrated sulphuric acid oxidizes ammonium

molybdate to molybdic acid, which gives a yellow colour with inorganic phosphate. Ascorbic
acid reduces the molybdic acid to give a blue colouration whose intensity is proportional to the

concentration of inorganic phosphate liberated into the reaction medium.

Preparation of Calibration Curve for Phosphate

Varying volumes of 1 mM NaH2PO4.2H2O (20-120µl) were pipetted into six test tubes.

Distilled water was then added to each test tube to make the volume up to 1 mL. 2 mL of

reagent C (H2SO4-Ammonium molybdate-Ascorbate mix) was added and the mixtures allowed to

stand at room temperature for 30 min, after which the absorbances were read at 820 nm against

reagent blank (which contain no NaH 2PO4.2H2O). The absorbances obtained were then used to

plot the calibration curve for phosphate (Appendix IX).

Assay of Mg2+-ATPase Activity

The determination of Mg2+-ATPase activity was carried out by the method of Ronneret

al. (1977) as modified by Fleschner and Kraus-Friedmann (1986).

Procedure for determination of Mg2+-ATPase activity in tissue supernatant

For the test, 400µlof 240 mM KCl/60 mM Tris(pH 7.4) was pippetted into test tube.

Thereafter, 20µl of MgCl2.6H2O (80 mM), 20µl of EGTA (20 mM), 220µl of distilled water,

20µl of appropriately diluted tissue supernatant and 20 µl of Vanadate (0.08 M) were added.

This was mixed and incubated at 37 0C for 5 minutes. Then, 100 µl of ATP (8 mM) was added.

This was mixed and incubated at 370C for 30 minutes. Thereafter, 200µl of SDS (5%) and

2,000µl of reagent C were added. The mixture was allowed to stand at room temperature for 30
minutes for colour development. The blank was similarly prepared but 20µl of distilled water

was used instead of the 20µl tissue supernatant. The absorbance of the test was read against the

blank at 820 nm. The absorbances obtained were then extrapolated from the calibration curve for

phosphate (Appendix IX) to obtain concentration of inorganic phosphate.

Calculation

Specific activity (µmole Pi/mg Prot./hr) = [Pi] × 2 × D.F

1000 × Protein Conc (mg/ mL)

Where;

[Pi] = Concentration of inorganic phosphate in nmoles (obtain from calibration

Curve).

2 = Factor introduced to obtain the amount of Pi released per hour

D.F = Dilution Factor

1000 = factor introduced to convert the Pi release to µmoles.

Assay of Na+, K+-ATPase Activity

This assay was carried out by the method of Ronneret al (1977) as modified by Bewajiet

al (1985).

Procedure for determination of Na+,K+-ATPase activity in tissue supernatant

For the test, 400µlof 200 mM NaCl/40 mM KCl/60 mM Tris (pH 7.4)waspippetted into

test tube. Thereafter, 20µl of MgCl2.6H2O (80 mM), 20µl of EGTA (20 mM), 240µl of distilled

water and 20µl of appropriately diluted tissue supernatant were added. This was mixed and

incubated at 370C for 5 minutes. Then, 100 µl of ATP (8 mM) was added. This was mixed and

incubated at 370C for 30 minutes. Thereafter, 200µl of SDS (5%) and 2,000µl of reagent C were
added. The mixture was allowed to stand at room temperature for 30 minutes for colour

development. The blank was similarly prepared but 20µl of distilled water was used instead of

the 20µl of tissue supernatant. The absorbance of the test was read against the blank at 820 nm.

The absorbances obtained were then extrapolated from the calibration curve for phosphate

(Appendix IX) to obtain concentration of inorganic phosphate.

Calculations

Specific activity (µmole Pi/mg Prot./hr) = [Pi] × 2 × D.F

1000 × Protein Conc (mg/ mL)

Where;

[Pi] = Concentration of inorganic phosphate in nmoles (obtain from calibration

Curve).

2 = Factor introduced to obtain the amount of Pi released per hour

D.F = Dilution Factor

1000 = factor introduced to convert the Pi release to µmoles.

NOTE:

The actual specific activity of Na+,K+-ATPase was obtained by the subtraction of the

specific activity of Mg2+-ATPase from that of Na+,K+-ATPase (obtained from calculation above).

Assay of Ca2+, Mg2+-ATPase Activity

The determination of Ca2+,Mg2+-ATPase activity was carried out by the method of

Ronneret al (1977) and modified by Bewajiet al (1985).

Procedure for Determination of Ca2+,Mg2+-ATPase activity in tissue supernatant

 For the test, 400µlof 240mM KCl/60mM Tris(pH 7.4) was pippetted into test tube.

Thereafter, 40µl of CaCl2 (4 mM), 20µl of MgCl2.6H2O (80 mM), 220µl of distilled water and

20µl of appropriately diluted tissue supernatant were added. This was mixed and incubated at

370C for 5 minutes. Then, 100 µl of ATP (8 mM) was added. This was mixed and incubated at

370C for 30 minutes. Thereafter, 200µl of SDS (5%) and 2,000µl of reagent C were added. The

mixture was allowed to stand at room temperature for 30 minutes for colour development. The

blank was similarly prepared but 20µl of distilled water was used instead of the 20µl of tissue

supernatant. The absorbance of the test was read against the blank at 820 nm. The absorbances

obtained were then extrapolated from the calibration curve for phosphate (Appendix IX) to

obtain concentration of inorganic phosphate

Calculations

Specific activity (µmole Pi/mg Prot./hr) = [Pi] × 2 × D.F

1000 × Protein Conc (mg/ mL)

Where;

[Pi] = Concentration of inorganic phosphate in nmoles (obtain from calibration

Curve).

2 = Factor introduced to obtain the amount of Pi released per hour

D.F = Dilution Factor

1000 = factor introduced to convert the Pi release to µmoles.

3.8.3 DETERMINATION OF ENTPDASE ACTIVITY

Ecto-nucleoside triphosphate diphosphohydroase (ENTPDase)

The purinergic enzyme activities was determined according to the procedure reported by

Akomolafe et al. 2017

Briefly, 20 μl of the reaction samples was incubated with a mixture containing 200 μl of the

reaction buffer (1.5 mM CaCl2, 5 mM KCl, 0.1 mM EDTA, 10 mM glucose, 225 mM sucrose

and 45 mM Tris-HCl) for 10 min at 37°C. 20 μl of 50 mM ATP was then added to the reaction

mixture and further incubated in a shaker for 20 min at 37°C. Reaction was halted by adding

200 μl of 10% TCA, followed by 200 μl of 1.25% ammonium molybdate and a freshly prepared

9% ascorbic acid. The mixture was allowed to stand on ice for 10 min. Absorbance was read at

600 nm.

Ecto-5 1 -nucleotidase (E-NTDase) activity assay

E-NTDaseactivitywas determined as described by Heymann et al. (1984). The assay mixture

consisted of 10 mM MgSO4 and 100 mMTris–HCl buffer, pH 7.5, in a final volume of 200 mL.

Twenty microliters of tissue (brain or cerebral cortex) (8–12 mg of protein) homogenate was

singly added to the reaction mixture and pre-incubated at 37°C for 10 min. The reaction was

initiated by the addition of AMP to a final concentration of 2.0 mM and proceeded for 20 min. In

all cases, reaction was stopped by the addition of 200 mL of 10% trichloroacetic acid (TCA).

Thereafter, the tubes were chilled on ice for 10 min. The released inorganic phosphate (Pi) was

assayed by the method of Bewaji et al. (1985).

Glucose-6-Phosphatase Activity

Briefly, the tissue lysates were incubated with 50 mM ATP, 0.25 M glucose, 5 mM KCl, and 0.1

M Tris-HCl buffer in a shaker for 30 min at 37 °C. Water and 1.25% ammonium molybdate were
used to stop the reaction. Freshly prepared 9% ascorbic acid was added to the reaction mixture

and further incubated for 30 min. Absorbance was read at 660 nm. Glucose 6-phosphatase

activity was extrapolated from a standardcurve ofinorganicphosphate and reportedastheamount

of inorganic phosphate (Pi) released/min/mg.

3.8.4 DETERMINATION OF LIPASE ACTIVITY

Serum Triglycerides concentration (Usung Lipase)

The method describe by Hainlineet al. (1980) was used for the determination of serum

triglyceride concentration.

Principle:

Triglyceride is determined after enzymatic hydrolysis with lipases. The indicator is quinoneimine

formed from hydrogen-peroxide, 4-aminophenazome and 4-chlorophenol under the catalytic

influence of peroxidase.

Procedure:

Using a micropippette, 10ul of appropriately diluted sample, standard and distilled water

were pipetted into clean test tubes labelled sample, standard and blank respectively. 100ul of

working reagent comprising of 4-aminophenazone, ATP, lipases, glycerokinase, glyceryl-3-

phosphate oxidase and peroxidase were added to each test tube. The solution was mixed, left

undisturbed for 10min at room temperature (20-25 0 C). The absorbance of sample and standard

was measured against the blank within 60 min at 500nm.

Calculation:

Concentration of TG (mmol/L) = Asample × Concentration of standard

Astandard

Concentration of standard = 2.21 mmol/L

3.8.5 Determination of 5' Nucleotidase Activity

Ecto-5 1 -nucleotidase (E-NTDase) activity assay

E-NTDaseactivitywas determined as described by Heymann et al. (1984). The assay mixture

consisted of 10 mM MgSO4 and 100 mMTris–HCl buffer, pH 7.5, in a final volume of 200 mL.

Twenty microliters of tissue (brain or cerebral cortex) (8–12 mg of protein) homogenate was

singly added to the reaction mixture and pre-incubated at 37°C for 10 min. The reaction was

initiated by the addition of AMP to a final concentration of 2.0 mM and proceeded for 20 min. In

all cases, reaction was stopped by the addition of 200 mL of 10% trichloroacetic acid (TCA).

Thereafter, the tubes were chilled on ice for 10 min. The released inorganic phosphate (Pi) was

assayed by the method of Bewajiet al (1985).

3.8.6 Calculation of HOMA-IR and HOMA-B

3.8.7 Gene Expression Analysis: Insulin Receptor and GLP-IR

Isolation of Total RNA

Total RNA was isolated from tissue samples with Quick-RNAMiniPrep™ Kit (Zymo Research).

The DNA contaminant was removed following DNAse I (NEB, Cat: M0303S) treatment. The
RNAwas quantified at 260 nm and the purity confirmed at 260 nm and 280 nm using A&E

Spectrophotometer (A&E Lab. UK).

cDNA conversion

One (1 μg) of DNA-free RNA was converted to cDNA by reverse transcriptase reactionwith the

aid of cDNA synthesis kit based on ProtoScriptII first-strand technology (New EnglandBioLabs)

in a conditionof 3-step reaction: 65 °C for 5 min, 42 °C for 1 h, and80 °C for 5 min.

(Elekofehinti et al., 2020).

PCR amplification and agarose gel electrophoresis

Polymerase chain reaction (PCR) for the amplification ofgene of interest was carried out with

OneTaqR2X MasterMix (NEB) using the following primers (Inqaba Biotec,Hatfield, South

Africa). PCR amplification was performed in a total of 25 μl volume reaction mixture

containing cDNA, primer (forward and reverse SEE BELOW) and Ready Mix Taq PCR master

mix. Under the following condition: Initial denaturation at 95 ◦C for 5 min, followed by 30

cycles of amplification (denaturation at 95 ◦C for 30 s, annealing for 30 s and extension at 72 ◦C

for 60 s) and ending with final extension at 72 ◦C for 10 min. The amplicons were resolved on

1.0% agarose gel. The GAPDH gene was used to normalize the relative level of expression of

each gene, and quantification of band intensity was done using “image J” software (Elekofehinti

et al. 2020).

Insulin receptor

Forward: CGGACCATGCCTGAAGCTAA

Reverse: AATGCTTCCGGGAGACACAG
GLP-IR

GLP-1 5’- TCCCAAAGGAGCTCCACCTG-3’ 5’- TTCTCCTCCGTGTCTTGAGGG-3’

 CHAPTER FOUR

4.0 Results

4.1 Effects of Hibiscus sabdariffa Leaf Flavonoid-Rich Extract on Pancreatic Insulin Levels

in Streptozotocin-Induced Rats

Figure 4.1:Pancreatic insulin concentration and lipase activityof flavonoid-rich extracts from
Hibiscus sabdariffa leaf in streptozotocin-induced diabetic rats

Each value is a mean of eight determinations ± SD. # p<0.05 vs. NC, * p<0.05 vs. DC

NC: Normal Control, DC: Diabetic Control, LDHSFL: Diabetic rats administered low dose (150
mg/kg body weight) of flavonoid-rich extract of Hibiscus sabdariffa, HDHSFL: Diabetic rats
administered high dose (300 mg/kg body weight) of flavonoid-rich extract of Hibiscus
sabdariffa, MET: Diabetic rats administered 200 mg/kg of metformin

4.2 Effects of Hibiscus sabdariffa Leaf Falvonoid-Rich Extract on ATPase and ENTPDase

Activity in Streptozotocin-Induced Rats

Figure 4.2: Purinergic enzyme activities of flavonoid-rich extracts from Hibiscus sabdariffa leaf
in streptozotocin-induced diabetic rats

Each value is a mean of eight determinations ± SD. # p<0.05 vs. NC, * p<0.05 vs. DC
Legend: NC: Normal Control, DC: Diabetic Control, LDHSFL: Diabetic rats administered low
dose (150 mg/kg body weight) of flavonoid-rich extract of Hibiscus sabdariffa, HDHSFL:
Diabetic rats administered high dose (300 mg/kg body weight) of flavonoid-rich extract of
Hibiscus sabdariffa, MET: Diabetic rats administered 200 mg/kg of metformin, E-
NTPDase:Ecto-nucleoside triphosphate diphosphohydrolase

4.3 Effects of Hibiscus sabdariffa Leaf Flavonoid-Rich Extract on HOMA-IR and (HOMA-

β) in Streptozotocin-Induced Rats
Figure 4.3:Homeostasis Model Assessment of β-cells (HOMA-β) and Homeostasis Model
Assessment of Insulin Resistance (HOMA-IR)of flavonoid-rich extracts from Hibiscus
sabdariffa leaf in streptozotocin-induced diabetic rats

Each value is a mean of eight determinations ± SD. # p<0.05 vs. NC, * p<0.05 vs. DC

Legend: NC: Normal Control, DC: Diabetic Control, LDHSFL: Diabetic rats administered low
dose (150 mg/kg body weight) of flavonoid-rich extract of Hibiscus sabdariffa, HDHSFL:
Diabetic rats administered high dose (300 mg/kg body weight) of flavonoid-rich extract of
Hibiscus sabdariffa, MET: Diabetic rats administered 200 mg/kg of metformin

4.4 Effects of Hibiscus sabdariffa Leaf Flavonoid-Rich Extract on Gene Expression of

Insulin Receptor and GLP-IR in Streptozotocin-Induced Rats

Figure 4.4: Relative gene expressions of insulin receptor and GLP-1 levels of flavonoid-rich
extracts from Hibiscus sabdariffa leaf in streptozotocin-induced diabetic rats

Each value is a mean of eight determinations ± SD. # p<0.05 vs. NC, * p<0.05 vs. DC
Legend: NC: Normal Control, DC: Diabetic Control, LDHSFL: Diabetic rats administered low
dose (150 mg/kg body weight) of flavonoid-rich extract of Hibiscus sabdariffa, HDHSFL:
Diabetic rats administered high dose (300 mg/kg body weight) of flavonoid-rich extract of
Hibiscus sabdariffa, MET: Diabetic rats administered 200 mg/kg of metformin, GLP-1:Glucagon
-like peptide
 CHAPTER FIVE

5.0 Discussion and Conclusion

5.1 Discussion

Diabetes mellitus (DM) is describe as a metabolic illness with numerous etiologies characterized

by persistent hyperglycemia and changes in carbohydrate ,protein and lipid metabolism caused

by deficiencies in insulin production ,insulin action or both polyuria, polydipsia, and

unexplained weightloss are common symptoms of diabetes. (Micheal, 2008). Diabetes is a group

of metabolic diseases in which there is high blood glucose (blood sugar), either because insulin

production is inadequate, or because the body’s cells do not respond properly to insulin, or both.

Hibiscus sabdariffa shows various beneficial properties such as anticancer, antioxidant,

antipyretic, antibacterial, hepatoprotective effects, diuretic effects, anticholestrol and antiobesity

activities and so on. It reckons that zobo Leaf has antioxidant and diuretic properties. (Owolabi

et al. 1996). There is direct association between hyperglycemia and the physiological responses.

The brain recognizes the hyperglycemia and send a message via nerve impulses to pancreas to

decrease the effect of hyperglycemia by the inhibition of α-amylase and α-glucosidase to control

postprandial hyperglycaemia. It shows the ability of pancreatic α-amylase inhibitor and inhibited

intestinal αglycosidase and pancreatic α-amylase enzyme. This depicts extract of zobo leaf

having anti insulin preventing potential. Study have shown that Hibiscus sabdariffa effects of

aqueous and 80% ethanolic Zobo leaf flavonoid extracts on the ability to reduce the production

and the realease of insulin.

Study have shown that effects of aqueous and 80% ethanolic Hibiscus sabariffa (Zobo leaf)

flavonoid extracts have the ability to inhibit pancreatic insulin concentration when administered
Hibiscus sabarifa (Zobo leaf) flavonoid extracts of (150 mg/kg body weight). The pancreatic

insulin concentration is equally low when administered Hibiscus sabarifa (Zobo leaf) flavonoid

extracts of (300 mg/kg body weight), It had a similar effect on pancreatic insulin concentration

with rats administered with a standard drug (200 mg/kg of metformin), While the DC had a very

strong concentration pancreatic insulin concentration this is also the same with the Pancreatic

Lipase Activity was low (5 ± 7 µg/ mL) when administered Hibiscus sabarifa (Zobo leaf)

flavonoid extracts of (150 mg/kg body weight). The Pancreatic Lipase Activity was low (5 ± 7

µg/ mL) when Hibiscus sabarifa (Zobo leaf) flavonoid extracts of (300 mg/kg body weight) was

administered, It does have a similar effect on Pancreatic Lipase Activity when the laboratory

rats was administered a standard drug (200 mg/kg of metformin), While the DC had a very

strong concentration Pancreatic Lipase Activity. (15 ± 20 µg/ mL).

The effects of aqueous and 80% ethanolic Hibiscus sabarifa (Zobo leaf) flavonoid extracts on

ATPase specific Activity in Streptozotocin-Induced Rats showed an increased in the activity of

Atpase and E-NTPDase. Hibiscus sabarifa (Zobo leaf) flavonoid extracts of (150 mg/kg body

weight), (300 mg/kg body weight) and the Standard drug (Metformin) on Na +/K+ Atpase Specific

Activities The Na+/K+ Atpase concentration was high (10 ±20 mmol/min/mg/protein). Hibiscus

sabarifa (Zobo leaf) flavonoid extracts had an increasing effect on Ca +2/Mg+2 Atpase Specific

Activities The Ca+2/Mg+2 Atpase concentration was very high (15 ± 20 mmol/min/mg/protein),

(150 mg/kg body weight) (300 mg/kg body weight) and the Standard drug (Metformin) close to

the Normal rat control as oppose the diabetic Rats. ATPase specific Activity in Streptozotocin-

Induced Rats showed a Corrected in the activity of The Mg +2 Atpase Specific Activities was high

(7 ±13 mmol/min/mg/protein). The (150 mg/kg body weight) (300 mg/kg body weight) and the

Standard drug (Metformin). E-NTPDase Specific activity was relatively balanced between (7 ±
10 mmol/min/mg/protein) while the NC was (10 mmol/min/mg/protein). The Diabetic rat has a

very low Atpase and E-NTPDase specific activities all below (5 mmol/min/mg/protein).

Hibiscus sabdariffa (Zobo leaf) flavonoid extracts had an lowered effect on 5’nuleotidase

Specific Activities, The 5’nuleotidase Specific Activities concentration was lowered (below 5

mmol/min/mg/protein), (150 mg/kg body weight) (300 mg/kg body weight) and the Standard

drug (Metformin) as oppose the diabetic Rats. (13 ± 15 mmol/min/mg/protein).

Effects of Hibiscus sabdariffa Leaf Flavonoid-Rich Extract on HOMA-IR Activity in

Streptozotocin-Induced Rats was kept very low below (5 mmol/min/mg/protein), The HOMA-IR

activity of diabetic rat was very high opposed to the Normal and the treaded rats (15 ± 20 ).

HOMA-β in Streptozotocin-Induced Rats Activity in Streptozotocin-Induced Rats was kept high

above (100 ± 150). The HOMA- β of the Diabetic rat had below 25. Hence the insulin resistance

could not be effectively estimated, the function of pancreatic beta cells could not be effectively

estimated.

This is presumed to be due to Zobo leaf active compounds, such as flavonoid, which to

indirectly affect the sodium-glucose co-transporter-2 (SGLT-2) and sodium-glucose co-

transporter-4 and (SGLT-4) This in turn leads regulation to glucose in the blood stream.,
5.2 Conclusion

It was confirmed according this experiment that the Hibiscus sabdariffa Leaf Flavonoid-Rich

Extract extract was a very strong inhibitor of the studied enzymes Pancreatic Insulin and

Pancreatic lipase, and it is Anti Diabetic in Nature, with a very strong antioxidant properties

increasing the activities of the Atpase in the body which directly affect the flow of Glucose in

various organs.

References

Adegunloye B, Omoniyi J, Owolabi O, (1996). “Mechanisms of the blood pressure

lowering effect of the calyx extract of Hibiscus sabdariffa in rats”.

Ahrén B, Corrigan CB. (1984) “Intermittent need for insulin in a subgroup of diabetic

patients in Tanzania”.

Akomolafe S. F., Akinyemi A. J., Ogunsuyi O. B., Oyeleye S. I., Oboh G., Adeoye O. O.,

(2017). “Effect of Caffeine, Caffeic Acid and Their Various Combinations on Enzymes of

Cholinergic, Monoaminergic and Purinergic Systems Critical to Neurodegeneration in Rat

Brain-In Vitro”. NeuroToxicology 62, 6–13. 10.1016/j.neuro.2017.04.008

Alberti (1996). “The clinical implications of Impaired Glucose Tolerance”.

Alberti KGMM, Zimmet PZ, (1998). “Definition, diagnosis and classification of diabetes

mellitus and its complications”.

Ali M, Salih W, Mohamed A, Homeida A. (1991). “Investigation of the antispasmodic

potential of Hibiscus sabdariffa calyces. J Ethnopharmaco”.

Banerji MA, Chaiken RI, Huey H, Tuomi T, Norin AJ, MacKay IR (1994). “GAD antibody

negative NIDDM in adult black subjects with diabetic ketoacidosis and increased frequency

of human leukocyte antigen DR3 and DR4: flatbush diabetes”.

Betterle C, Zanette F, Pedini B, Presotto F, Rapp LB, Monsciotti CM (1983).” Clinical and

subclinical organ– specific autoimmune manifestations in type 1 (insulin– dependent)

diabetic patients and their first–degree relatives”.

Bogardus C, Lillioja S, Mott DM, Hollenbeck C, Reaven G. (1985). “Relationship between

degree of obesity and in vivo insulin action in man”.

Byrne MM, Sturis J, Menzel S, Yamagata K, Fajans SS, Dronsfield MJ (1996). “Altered

insulin secretory response to glucose in diabetic and nondiabetic subjects with mutations in

the diabetes susceptibility gene MODY 3 on chromosome 20”.

Campbell PJ, Carlson MG. (1993). “Impact of obesity on insulin action in NIDDM”.

Diabetes; 42: 405–10.

Chen C, Chou F, Ho W, (1996). “Inhibitory effects of Hibiscus sabdariffa L extract on low-

density lipoprotein oxidation and anti-hyperlipidemia in fructose-fed and cholesterol-fed

rats”.

Clement K, Pueyo ME, Vaxillaire M, Rakotoambinina B, Thuillier F, Passa P et al.(1996).

“Assessment of insulin sensitivity in glucokinase–deficient subjects”.

Courten M, Bennett PH, Tuomilehto J, Zimmet P. (1997). “Epidemiology of NIDDM in

Non–Europids. In: Alberti KGMM, Zimmet P, DeFronzo RA, eds. International Textbook of

Diabetes Mellitus”. 2nd edn. Chichester: John Wiley, pp 143–70.

De Vegt F, Dekker JM, Stehouwer CDA, Nijpels G, Bouter LM, Heine RJ. (1998). “The

American Diabetes Association criteria versus the World Health Organization criteria for the

diagnosis of abnormal glucose tolerance: poor agreement in the Hoorn Study”.

DeFronzo RA, Bonadonna RC, Ferrannini E. (1997).

Engelgau MM, Thompson TJ, Herman WH, Boyle JP, Aubert RE, Kenny SJ (1997).

“Comparison of fasting and 2–hour glucose and HbA1c levels for diagnosing diabetes:

diagnostic criteria and performance revisited”. Diabetes Care; 20: 785–91.

Froguel P, Vaxillaire M, Sun F, Velho G, Zouali H, Butel MO (1992). “Close linkage of

glucokinase locus on chromosome 7p to early–onset non–insulin–dependent diabetes”.

Nature; 356: 162–64. 42

Fuller JH, Shipley MJ, Rose G, Jarrett RJ, Keen H. (1980). “Coronary heart disease risk and

impaired glucose tolerance”: the Whitehall Study. Lancet; i: 1373– 76. 37

Gallanosa AG, Spyker DA, (1981).

Gullo L, Pezzilli R, Morselli–Labate AM, (1994). “Diabetes and the risk of cancer”. N Engl

J Med; 331: 81–84. 68.

Gurrola-Diaz C, Garcia-Lopez P, Sanchez-Enriquez S, (2010). “Effects of Hibiscus

sabdariffa extract powder and preventive treatment (diet) on the lipid profiles of patients

with metabolic syndrome (MeSy)”. Phytomedicine ;17:500-505.

Haneda M, Polonsky KS, Bergenstal RM, Jaspan JB, Shoelson SE, Blix PM (1984).

“Familial hyperinsulinemia due to a structurally abnormal insulin. Definition of an emerging

new clinical syndrome”. N Engl J Med; 310: 1288–94. 43

Harris MI, Cowie CC, Stern MP, Boyko ES, Reiber GE, Bennett PH, (1468). “clinical and

public health issues”. Diabetes Care; 16: 642–52.

Herra-Arellano A, Flores-Romero S, Chavez-Soto M, Tortoriello J. (2004). “Effectiveness

and tolerability of a standardized extract from Hibiscus sabdariffa in patients with mild to

moderate hypertension: a controlled and randomized clinical trial”. Phytomedicine;11:375-

382.

Herrera-Arellano A, Miranda-Sanchez J, Avila-Castro P, (2007). “Clinical effects produced

by a standardized herbal medicinal product of Hibiscus sabdariffa on patients with

hypertension”.

Hoet JJ, Tripathy BB, Rao RH, Yajnik CS. (1996). “Malnutrition and diabetes in the

tropics”. Diabetes Care; 19: 1014–17.

Hother–Nielsen O, Faber O, Sørensen NS, Beck– Nielsen H. (1988). “Classification of newly

diagnosed diabetic patients as insulin–requiring or non–insulin–requiring based on clinical

and biochemical variables”. Diabetes Care; 11: 531–37.

Heymann, D., Reddington, M., Kreutzberg,, G.W., 1984. Subcellular localization of 50-

nucleotidase in rat brain. J. Neurochem. 43, 971–978.

Humphrey ARG, McCarty DJ, Mackay IR, Rowley MJ, Dwyer T, Zimmet P. (1988).

Autoantibodies to glutamic acid decarboxylase and phenotypic features associated with early

insulin treatment in individuals with adult– onset diabetes mellitus. Diabetic Med; 15: 113–

19.

Larsen S, Hilsted J, Tronier B, Worning H. (1987). “Metabolic control and B cell function in

patients with insulin– dependent diabetes mellitus secondary to chronic pancreatitis”.

Metabolism; 36: 964–67.