Article

Evolution of polarity protein BASL and the capacity

for stomatal lineage asymmetric divisions
Highlights Authors
d BASL is a eudicot-specific regulator of stomatal lineage Ido Nir, Gabriel Amador, Yan Gong,
asymmetric cell divisions Nicole K. Smoot, Le Cai, Hagai Shohat,
Dominique C. Bergmann
d BASL features polarity domains added to an ancestral MAPK-
binding chassis Correspondence
d Cellular quiescence and BASL-guided polarity generate dbergmann@[Link]
stomatal spacing in tomato
In brief
d Cell size and fate asymmetries are uncoupled in the tomato Nir, Amador, et al. trace the evolution of
stomatal lineage Arabidopsis polarity protein AtBASL and
show that eudicot proteins of similar
domain organization but low sequence
conservation polarize and function in
Arabidopsis. They show SlBASL also
mediates asymmetric divisions in tomato,
but the repertoire of epidermal division
types diverges between species.

Nir et al., 2022, Current Biology 32, 1–9

January 24, 2022 ª 2021 The Author(s). Published by Elsevier Inc.
[Link] ll
 Please cite this article in press as: Nir et al., Evolution of polarity protein BASL and the capacity for stomatal lineage asymmetric divisions, Current
Biology (2021), [Link]

ll
OPEN ACCESS

Article
Evolution of polarity protein BASL and the
capacity for stomatal lineage asymmetric divisions
Ido Nir,1,2,5 Gabriel Amador,3,5 Yan Gong,1 Nicole K. Smoot,2 Le Cai,1 Hagai Shohat,4 and Dominique C. Bergmann1,2,6,7,*
1Department of Biology, Stanford University, Stanford, CA 94305, USA
2Howard Hughes Medical Institute, Stanford University, Stanford, CA 94305, USA
3Department of Developmental Biology, Stanford University School of Medicine, Stanford, CA 94305, USA
4Institute of Plant Sciences and Genetics in Agriculture, The Robert H. Smith Faculty of Agriculture, Food and Environment, The Hebrew

University of Jerusalem, PO Box 12, Rehovot 76100, Israel

5These authors contributed equally
6Twitter: @stanfordstomata
7Lead contact

*Correspondence: dbergmann@[Link]
[Link]

SUMMARY

Asymmetric and oriented stem cell divisions enable the continued production of patterned tissues. The mol-
ecules that guide these divisions include several ‘‘polarity proteins’’ that are localized to discrete plasma
membrane domains, are differentially inherited during asymmetric divisions, and whose scaffolding activities
can guide division plane orientation and subsequent cell fates. In the stomatal lineages on the surfaces of
plant leaves, asymmetric and oriented divisions create distinct cell types in physiologically optimized pat-
terns. The polarity protein BREAKING OF ASYMMETRY IN THE STOMATAL LINEAGE (BASL) is a major regu-
lator of stomatal lineage division and cell fate asymmetries in Arabidopsis, but its role in the stomatal lineages
of other plants is unclear. Here, using phylogenetic and functional assays, we demonstrate that BASL is a
eudicot-specific polarity protein. Dicot BASL orthologs can polarize in heterologous systems and rescue
the Arabidopsis BASL mutant. The more widely distributed BASL-like proteins, although they share BASL’s
conserved C-terminal domain, are neither polarized nor do they function in asymmetric divisions of the sto-
matal lineage. Comparison of BASL protein localization and loss of function BASL phenotypes in Arabidopsis
and tomato revealed previously unappreciated differences in how asymmetric cell divisions are employed for
pattern formation in different species. This multi-species analysis therefore provides insight into the evolution
of a unique polarity regulator and into the developmental choices available to cells as they build and pattern
tissues.

INTRODUCTION its own asymmetric inheritance (Figure 1A, stage III). Fate asym-
metry between the smaller, meristemoid (M) daughter and larger,
Patterned surfaces adorn representatives of all major clades of BASL-inheriting stomatal lineage ground cell (SLGC) daughter is
multicellular life. These patterns serve functional roles in mature critical for proper patterning of the leaf epidermis as the subse-
organisms and can bear imprints of the developmental trajec- quent division types available to these cells differ (Figure 1A,
tories underlying their production. Asymmetric and oriented stage IV). Through continued ‘‘amplifying divisions’’ in a spiral
stem cell divisions are often employed in the creation and pattern, meristemoids can surround themselves with a buffer
patterning of tissues, particularly when development is flexible zone of non-meristemoid cells before differentiating into sto-
and environmentally responsive. In plants, stomatal lineages mata.5 SLGCs can immediately differentiate or generate new
on the surfaces of leaves are prime models for investigating meristemoid and SLGC pairs through ‘‘spacing divisions’’ pre-
how cell polarity and asymmetric cell divisions (ACDs) link to tis- cisely oriented to avoid placing meristemoids next to existing
sue-wide patterns.1 stomata.6 Polarity and cell-cell signaling regulate ACD propen-
In the stomatal lineage of the dicot angiosperm Arabidopsis sity and orientation, resulting in stomata obeying a ‘‘one-cell
thaliana, BREAKING OF ASYMMETRY IN THE STOMATAL LINE- spacing’’ rule.1 Loss of BASL has profound effects on division
AGE (BASL) is the central regulator of cell size and fate asymme- plane placement, self-renewing divisions, and cell fates in meris-
tries.2–4 Asymmetric ‘‘entry’’ divisions among protodermal cells temoids and SLGCs, resulting ultimately in the accumulation of
initiate the stomatal lineage (Figure 1A, stages I and II). During clustered stomatal precursors and clustered stomata (green
these entry divisions, BASL becomes polarly localized in a and purple shading, respectively, in Figure 1B). A central role
cortical crescent (Figure 1A, stage II) that guides the division for BASL in polarity and ACDs is supported by genetic and pro-
plane to create cells of different size and identity and ensures tein interaction experiments showing that BASL is required for

Current Biology 32, 1–9, January 24, 2022 ª 2021 The Author(s). Published by Elsevier Inc. 1
This is an open access article under the CC BY license ([Link]
 Please cite this article in press as: Nir et al., Evolution of polarity protein BASL and the capacity for stomatal lineage asymmetric divisions, Current
Biology (2021), [Link]

ll
OPEN ACCESS Article
Figure 1. Stomatal asymmetric division
regulator gene BASL homologs are
restricted to eudicots
(A) Schematic of AtBASL activity during asym-
metric cell divisions (ACDs) in the Arabidopsis
stomatal lineage. After progenitors enter the sto-
matal lineage (I), BASL (blue) becomes localized to
the nucleus and to a polar crescent at the cell
cortex before division (II) and is coordinated with
the cell division plane to ensure its asymmetric
inheritance (III). The larger, BASL-inheriting
daughter is a stomatal lineage ground cell (SLGC)
that may differentiate into a pavement cell (gray).
The smaller, non-BASL-inheriting daughter is a
meristemoid (M) that may differentiate into a stoma
(purple). Both SLGCs and meristemoids, however,
may undergo additional divisions requiring re-
expression or reorientation of the BASL crescent
(IV).
(B) Differential interference contrast (DIC) images
of the abaxial epidermis of wild-type (WT) and at-
basl cotyledons, false colored with stomata in
purple and clustered small cells in green. Scale
bars, 30 mm.
(C) Phylogenetic tree of protein sequences
showing BASL clade arising from larger BSLL
family.
(D) Schematic of experimentally defined AtBASL
domains and motifs from Dong et al.2 and Zhang
et al.3 and major conserved domains in BASLs and
BSLLs, shown approximately to scale.
(E) Amino acid similarity scores (STAR Methods)
displayed over two independent alignments of
putative BASL and BSLL orthologs, annotated with
major domains of sequence conservation in BASLs
(D1–D3) and BSLLs (N and D3).
See also Figure S1 and Table S1.

asymmetric localization and inheritance of signaling cascades RESULTS

linked to cell fates3,7,8 as well as other polarity proteins.9–11
Despite a pivotal role in Arabidopsis stomatal lineage develop- BASL is a rapidly evolving eudicot-specific gene
ment and the fact that asymmetric divisions have been observed Previous efforts to reconstruct the evolutionary history of BASL
in the stomatal lineages of angiosperms, gymnosperms, and were hampered by low overall sequence conservation beyond
ferns,12 it is not known whether BASL acts in diverse stomatal close relatives of Arabidopsis,13,14 although select protein do-
lineages. This is due, in part, to debates as to whether BASL homo- mains could be found in more distantly related species.7 Using
logs are even present in other plants.13,14 Here, we use a combina- a reciprocal best hit heuristic, we found a rapid drop off in
tion of phylogenetic analyses, cross-species complementation, sequence similarity of candidate BASL orthologs outside the
and functional analysis in native contexts to identify likely BASL or- Brassicaceae, with a plateau of around 60% amino acid similar-
thologs. We find proteins that can polarize and function as BASL ity (30% identity) for eudicots followed by a sharp drop to 30%
are restricted to the dicots but are related to more broadly distrib- similarity (10% identity) for non-eudicot candidates (Figure S1A).
uted proteins, suggesting that BASL may be built from an ancestral To untangle the relationships between these sequences, we
MITOGEN-ACTIVATED PROTEIN KINASE (MAPK) interacting queried the UniProt KB database using jackhmmer and a high-
domain, to which polarization capacity was added. Analysis of quality reference alignment of putative BASL orthologs from
SlBASL dynamics and loss-of-function mutants in tomato reveal the Brassicaceae (DNA sequences and trees are available at
conservation in cell-autonomous BASL roles but unique imple- [Link]
mentation of those roles in the context of divergent patterning This relatively permissive search strategy returned many hun-
regimes, including novel cell fate transitions and spacing mecha- dreds of putative orthologs across the plant kingdom (Fig-
nisms. This multi-species analysis provides insight into the evolu- ure 1C). Inspection of hits from 33 land plants revealed that
tion of a unique polarity regulator and into the developmental eudicot genomes typically contain a single BASL ortholog
choices available to cells as they build coordinated tissues and candidate with two or three short but well-conserved domains
organs. in common with AtBASL (termed D1–D3; Figures 1D, 1E, and

2 Current Biology 32, 1–9, January 24, 2022

 Please cite this article in press as: Nir et al., Evolution of polarity protein BASL and the capacity for stomatal lineage asymmetric divisions, Current
Biology (2021), [Link]

ll
Article OPEN ACCESS

Figures 1D, 1E, and S1B). BSLLs are present in the genomes
of both eudicot and non-eudicot land plants, including the
distantly related moss Physcomitrium patens, but not the alga
Chlamydomonas reinhardtii or the liverwort Marchantia poly-
morpha, which lack stomata. These data suggest that BASL
may have arisen via duplication from an ancient clade of
BSLL proteins encoding a MAPK docking site embedded in
the D3 domain. In eudicots, addition of a structured domain
at the D2 position may have created a distinct BASL clade,
given that functional AtBASL requires both D2 and D3 do-
mains.2 Some eudicot orthologs also contain an N-terminal
D1 domain that includes a predicted nuclear localization
domain. In Arabidopsis, however, this domain is dispensable
for AtBASL function,2 and it has been secondarily lost in le-
gumes, such as Medicago truncatula (Figures 1E and S1C).

BASLs, but not BSLLs, polarize in developing leaves

BSLL genes have not been characterized in any species. In Ara-
bidopsis single-cell RNA sequencing (RNA-seq) profiles,16
BSLL1 is limited to young shoot tissue, whereas BSLL2 is
more broadly distributed, but their peak expression differs
from BASL and from each other (Figure S2A). Outside of Arabi-
dopsis, however, BSLL proteins could be alternatives to BASL.
In fact, BSLL gene expression is enriched in the stomatal
precursor zone at the base of leaves of rice and maize,17 two
species lacking BASL. Therefore, to characterize BASL and
BSLL homologs, we began by assaying the feature that best
defines BASL—its polarized subcellular localization, which can
be replicated in non-native contexts.2,3,13 We expressed
BASL and/or BSLL coding sequences from Arabidopsis thali-
ana, Solanum lycopersicum, Aquilegia coerulea, and the mono-
cot outgroup Brachypodium distachyon in developing Nicotiana
benthamiana leaves (Figures S2B and S2C). We found that pro-
teins encoded by putative BASL orthologs from tomato and
Aquilegia localized to a polar crescent at the edge of pavement
Figure 2. BASLs, but not BSLLs, polarize and rescue the atbasl cell lobes in N. benthamiana, much like AtBASL, although only
mutant AtBASL accumulated in the nucleus (Figure S2B). In contrast,
(A–D) Confocal images of BASL and BSLL translational reporters (yellow) in
all BSLL candidates exhibited diffuse cortical localization with
abaxial epidermis of 4 dpg atbasl cotyledons. Cell outlines (magenta) visual-
ized by ML1pro:mCherry-RCI2A are shown. White arrowheads mark cell no visible polarized domain (Figure S2C).
enlarged in inset to highlight reporter distribution during ACD. Scale bars, Based on these data, we selected three candidates for more
30 mm. Cells were hand outlined in inset (C) for clarity. extensive functional analysis: the tomato protein SlBASL (Sol-
(E) Quantification of stomatal clustering phenotypes in atbasl as rescued by yc3g114770), which conserves all three major domains but dis-
reporters noted on x axis. For SlBASL, AqBASL, and BdBSLL constructs, plays modest overall sequence conservation (23% AA identity
results from two independent lines are shown. n = 120 stomata in each of 8–20
and 50% AA similarity); the Aquilegia protein AqBASL (Aq-
leaves. For letters above each sample, see STAR Methods.
(F) Quantification of the origin of stomatal pairs in atbasl and the atbasl; SlBASL coe7g067300), which conserves only D2 and D3 domains; and
rescue line. n, all trackable pairs in each of 4 leaves. the Brachypodium protein BdBSLL1 (Bradi3g47127), which is
Numerical data in (E) and (F) are represented as mean ± 95% confidence in- the protein most similar to AtBASL in that genome but whose
terval. Bonferroni-corrected p values from Mann-Whitney U test are shown. similarity is restricted to the D3 domain (see Method details for
See also Figure S2. gene names and gene codes used in this paper).
We expressed these candidates in Arabidopsis as fluorescently
S1B; Table S1). BASL candidates in this group also show tagged fusion proteins under control of the native AtBASL pro-
conserved splice junctions, a shared profile of ordered and moter. Both SlBASL (AtBASLpro:VENUS-SlBASL) and AqBASL
intrinsically disordered regions, and generally concordant (AtBASLpro:VENUS-AqBASL) reporters exhibited robust polariza-
secondary structure predictions at predicted ordered sites (Fig- tion, with the polar domain consistently located in the larger
ure S1C). A second group of sequences shows strong conser- daughter cell post-division, similar to a native AtBASL reporter
vation surrounding a previously identified MAPK docking site (Figures 2A–2C). In contrast, the BdBSLL1 reporter (AtBASLpro:
(FxFP or DEF site)15 located in the D3 domain3 but are not VENUS-BdBSLL1) was cortically enriched but failed to polarize
otherwise similar to AtBASL. These BASL-like (BSLL) se- and was inherited symmetrically by both daughters following divi-
quences also share a unique N-terminal domain (termed N; sion (Figure 2D).

Current Biology 32, 1–9, January 24, 2022 3

 Please cite this article in press as: Nir et al., Evolution of polarity protein BASL and the capacity for stomatal lineage asymmetric divisions, Current
Biology (2021), [Link]

ll
OPEN ACCESS Article

The terminal phenotype of Arabidopsis BASL (atbasl) mutants SlBASLpro:VENUS-SlBASL dynamics during a single cell division
is clustered stomata, which can originate from two distinct er- cycle, we used time-lapse imaging, collecting images at 30-min
rors: misoriented spacing divisions or failures to differentiate intervals from 3 dpg abaxial cotyledons. As shown for two repre-
cell fates after ACD.18 We measured the ability of BASL and sentative cells in Figure 3C (n = 24 cells tracked), SlBASL first ap-
BSLL reporter constructs to rescue the stomatal clustering peared several hours before division. In some cells, SlBASL was
phenotype of atbasl mutants and observed a graded response: polarized before division, but in all cells, the polar signal intensi-
whereas an AtBASL construct nearly perfectly rescued the fied post-division (Figure 3C, white arrowheads). Given SlBASl’s
mutant phenotype (99% rescue capacity; details in STAR polar localization and its ability to complement atbasl, we hy-
Methods), rescue was partial with SlBASL (87%) and modest pothesized that it would be required for stomatal patterning in to-
with AqBASL (50%) constructs (Figure 2E). As expected from mato. We targeted the SlBASL locus for CRISPR-Cas9 muta-
its lack of polarization, BdBSLL1 had no significant capacity to genesis using multiplexed guides at the 5’ UTR and exons 2, 3,
correct stomatal clustering (Figure 2E). Finer dissection of and 5 and obtained three independent lines bearing mutations
SlBASL rescue function through lineage tracing showed that at the SlBASL locus (slbasl cr#2, cr#4, cr#6; Figures 3D and
SlBASL nearly completely rescued stomatal pairs that arose S3B). In the T2 generation, plants bearing these slbasl mutations
from fate errors but was only moderately effective at correcting were not noticeably different from control M82 plants in overall
spacing errors (Figure 2F). size, growth habit, or fertility, but each line displayed stomatal
Together, these data suggest that, among dicots, there are true clusters on the epidermis, suggesting that SlBASL function
BASL orthologs that retain polarization capacity and the ability to was disrupted (Figures 3A and S3B). For detailed phenotypic
regulate division plane orientation and fate asymmetry during and quantitative characterization, we selected the slbasl-cr#4
ACDs. BSLLs, as exemplified by BdBSLL1, do not. The apparent allele, where a 1-bp deletion in exon 2 is predicted to cause a
lack of functional BASL orthologs in the grasses may be related to frameshift and premature stop codon after 63 amino acids
the differences in ontogeny of grass stomata, where stomatal (shortly after domain D1; Figures 3D, S3C, and S3D).
guard cell formation is preceded by a single ACD that is invariantly We imaged wild-type (M82) and slbasl-cr#4 soil-grown cotyle-
oriented relative to the overall leaf axis.19 Interestingly, we found dons representing early (0 days post-emergence [dpe]), young (2
that an AtBASL reporter expressed in leaves of the pooid grass dpe), and mature (7 dpe) stages of epidermal development. At
Brachypodium distachyon polarly localized in crescents oriented early stages, many small, box-like cells and physically asym-
toward the base of the leaf and was preferentially expressed in the metric divisions (Figure 3A, orange shading) could be observed
larger daughter cells resulting from ACDs (Figure S2D). In newly in both M82 and slbasl-cr#4. At 2 dpe, lobed pavement cells
formed stomatal complexes, AtBASL also localized to the junction and all classes of stomatal lineage cells—meristemoids, SLGCs,
between guard cells and subsidiary cells (Figure S2D). These be- GMCs, and mature guard cells—could be identified in both ge-
haviors indicate that BASL can recognize tissue-wide polarity in- notypes, but slbasl-cr#4 also exhibited occasional stomatal pairs
formation created through other, more ancient polarity networks, (Figure 3A, purple shading). At maturity (7 dpe), the abaxial coty-
even if it is not a functional component of those networks itself. ledon and true leaf epidermis of slbasl-cr#4 plants exhibited
many clustered stomata relative to wild-type plants (Figures 3A
SlBASL is polarized and involved in stomatal patterning and S3A).
in tomato Although loss of SlBASL resulted in stomatal clusters in all
If proteins sharing AtBASL’s polar localization exist outside of scored cotyledons (Figure 3A), the phenotype in tomato was
Brassicaceae and can substitute for AtBASL in ACDs of the much milder than that generated by loss of AtBASL in Arabidop-
Arabidopsis stomatal lineage, what is their role in their native spe- sis (Figure 3E). Because we had identified multiple mutant alleles
cies? To address this, we generated reporters and CRISPR- of SlBASL (Figure S3B) and because we found no evidence for
Cas9-induced mutation lines to test localization and function of sequences that could encode redundant SlBASL genes (Method
BASL in another dicot. We chose Solanum lycopersicum (tomato) details), we hypothesized that differences in severity of basl phe-
for these analyses because of its phylogenetic position among di- notypes were not due to incomplete loss of BASL activity but
cots, efficient transformation protocols, and the rich history of rather might reflect different strategies for stomatal spacing be-
developmental and physiological studies on tomato leaves and tween these two species.
stomata.20–22 To track stomatal development over time, and to identify the
Stomata on the M82 tomato cotyledon and true leaf are origin of the stomatal pairs in slbasl mutants, we used a long-
spaced to avoid direct contact, and mature organs feature sto- term lineage-tracing strategy similar to Gong et al.,18 where
mata distributed among lobed pavement cells in a pattern daughters of each ACD were following through subsequent divi-
resembling that found in mature Arabidopsis leaves (Figures 3A sions and differentiation to terminal cell fates. We adapted this
and S3A). Earlier, during cotyledon development (3 days post- time course and lineage-tracing method for tomato by creating
germination [dpg] on MS-agar plates), when small epidermal a live-cell marker for epidermal cell outlines (ML1pro:RCI2A-
cells with the morphological characteristics of meristemoids mNeonGreen) and following epidermal development in soil-
are abundant, we begin to see expression of our SlBASL trans- grown plants starting at 1 dpe to capture the widest variety of
lational reporter (SlBASLpro:VENUS-SlBASL; Figure 3B). In still division competent cell types (e.g., Figures 4A and 4B).
images, SlBASL appeared in a polarized cortical crescent When cells were tracked between 1 dpe and 3 dpe time points,
consistently associated with the larger daughter cell after ACD we readily observed symmetric GMC divisions and asymmetric
but lacked the symmetrically inherited nuclear localization divisions of meristemoids (amplifying divisions; Figure 4A). How-
typical of AtBASL (Figures 2B and 3B). To monitor ever, asymmetric divisions of SLGCs (spacing divisions) were

4 Current Biology 32, 1–9, January 24, 2022

 Please cite this article in press as: Nir et al., Evolution of polarity protein BASL and the capacity for stomatal lineage asymmetric divisions, Current
Biology (2021), [Link]

ll
Article OPEN ACCESS

Figure 3. SlBASL is polarized and required

for proper stomatal patterning in tomato
(A) Confocal images of the abaxial epidermis of
M82 and slbasl-cr#4 cotyledons at indicated ages.
Cell outlines visualized by FM4-64 staining are
shown. Example ACDs are false colored in orange
and stomatal pairs in purple. Scale bar, 30 mm.
(B) Confocal image of SlBASLpro:Venus-SlBASL
(yellow) expression in abaxial epidermis of 3-dpg
cotyledon. Cell outlines (magenta) visualized by
propidium iodide (PI) staining are shown. Scale
bar, 30 mm.
(C) Time lapse of SlBASL reporter localization in
two representative cells undergoing ACDs. Cell
outlines (magenta) visualized by FM4-64. Arrow-
heads indicate polarized SlBASL. Time is shown
as hours:minutes. Scale bar, 5 mm.
(D) Schematic of slbasl-cr#4 allele. Black and red
bars indicate the positions of gRNAs along the
transcript. In red, a 1-bp deletion leads to a pre-
mature stop codon after 63 amino acids. WT and
mutant protein sequences surrounding this
frameshift are shown below.
(E) Quantification of stomatal clustering in the
abaxial epidermis of WT and basl mutants of
Arabidopsis (14 dpg) and tomato (10 dpe). n = 14–
24 fields from four cotyledons, each containing
60 stomata. Clusters are reported as the fraction
of stomata in direct contact with other stomata/
total stomata in mature cotyledons. Data are rep-
resented as mean ± 95% confidence interval.
Bonferroni-corrected p values from Mann-Whit-
ney U test are shown. n.s., not significant.
(F) Confocal image of stomatal clusters (purple) in
atbasl mutant epidermis (14 dpg). Scale bar, 30 mm.
See also Figure S3.

that may drive expression during ACDs

(Figure S2F), the exclusion of SlBASL
from this first ring of cells likely results
from changes to the developmental sys-
tem upstream of SlBASL. Interestingly,
although asymmetric spacing divisions
nearly undetectable (Figures 4A and 4D). As spacing divisions were reduced, there were still many physically asymmetric divi-
are common in Arabidopsis leaves (Figure 4D and sions in the tomato epidermis (Figure 4A, orange). Unexpectedly,
S3EFigures 4D and S3E) and misoriented spacing divisions are many resolved symmetrically as pairs of pavement cells (Figures
major contributors to pattern defects in atbasl mutants,18 this 4A and 4E), a phenomenon not observed in wild-type Arabidop-
suggested a reason for the mild slbasl phenotype in tomato. sis. We termed this novel fate transition ‘‘meristemoid drop-out’’
Indeed, seven out of eight lineage-tracked stomatal pairs in (Figure 4F) due to the loss of stomatal precursors from the line-
slbasl-cr#4 arose from a fate defect (Figures S3F and S3G). age. Considered together, the relationships between morpho-
If spacing divisions are not major contributors to epidermal logically asymmetric divisions and the resultant daughter cell
pattern in tomato, then other patterning mechanisms may fates and behaviors point to remarkably divergent develop-
enforce 1-cell spacing. We therefore returned to the time course mental trajectories converging on similar final epidermal patterns
images, focusing on outcomes of asymmetric divisions and on in Arabidopsis and tomato (Figure 4F).
the behaviors of cells surrounding young stomata. We found
that spacing (and all other) divisions were suppressed in the first DISCUSSION
ring of cells around a stoma (Figures 4B and 4C), as was SlBASL
expression (Figure 4C). In contrast, AtBASL expression in Arabi- Our data suggest that BASL is a recently evolved eudicot-spe-
dopsis, where spacing divisions are common, was not excluded cific plant polarity protein that has been co-opted into more
from ring 1 (Figure 4C). Because the SlBASL promoter can drive ancient programs of asymmetric divisions in stomatal develop-
expression during spacing divisions in transgenic Arabidopsis ment. Comparison of BASL expression and function in Arabidop-
plants (Figure S2E) and conserves several SPCH binding motifs sis and tomato, however, revealed that, even among eudicots,

Current Biology 32, 1–9, January 24, 2022 5

 Please cite this article in press as: Nir et al., Evolution of polarity protein BASL and the capacity for stomatal lineage asymmetric divisions, Current
Biology (2021), [Link]

ll
OPEN ACCESS Article

Figure 4. Rewired fate transitions in tomato stomatal development

(A) Confocal images of developmental time course of abaxial cotyledon epidermis. Cell outlines visualized by ML1pro:RCI2A-NeonGreen are shown. White ar-
rowheads mark division and differentiation events (a–c) shown below. Cell types are false colored as indicated in key. Scale bars, 50 mm.
(B) Image to illustrate typical spatial organization of cells surrounding a stoma (purple) at 4 dpe, including cells immediately adjacent (ring 1, green) and one cell
removed (ring 2, blue and orange). Scale bar, 30 mm.
(C) Percentage of cells expressing BASL in successive rings surrounding a stoma. n = 250 cells in each of 6 leaves.
(D) Percentage of ACDs that underwent additional amplifying or spacing divisions. ACDs displaying both amplifying and spacing divisions in our imaging window
(2 days) are counted once for each class of division. n = 45 ACDs in each of 6 imaging fields.
(E) Percentage of ACDs that resolve into asymmetric (one stoma and one pavement cell) or symmetric (two pavement cells) cell fates. n = 45 ACDs in each of 6
imaging fields (0.125 mm2 at 1 dpe; 0.3 mm2 at 3 dpe).
(F) Model of symmetric and asymmetric division types that contribute to stomatal fate and pattern featured in Arabidopsis and tomato stomatal lineages, with
shifts in predominant types between the species summarized to the right.
Numerical data in (C)–(E) are represented as mean ± 95% confidence interval. Bonferroni-corrected p values from Mann-Whitney U test are shown.

6 Current Biology 32, 1–9, January 24, 2022

 Please cite this article in press as: Nir et al., Evolution of polarity protein BASL and the capacity for stomatal lineage asymmetric divisions, Current
Biology (2021), [Link]

ll
Article OPEN ACCESS

the way polarity and ACDs are employed during stomatal devel- sequestration or other ways of downregulating BASL function
opment can be quite different (Figure 4F). In tomato cotyledons, (such as posttranslational modifications) feature in plants
there is a near-complete lack of spacing divisions and divisions outside of Arabidopsis remains to be shown, though interest-
surrounding young and mature stomata, but in Arabidopsis, ingly, the MAPK target sites are not conserved between
ACDs adjacent to stomata are common, and their occurrence AtBASL and SlBASL.
and orientation must be carefully regulated to avoid stomatal Among these domains, D3 is most highly conserved and pre-
clustering. This regulation is disrupted in the atbasl mutant, where sent in BSLLs, an ancient clade of proteins that do not polarize.
30% of stomatal clusters arise through defects in division orien- This domain overlaps several residues where MAPKs phosphor-
tation.18 In contrast, stomatal development in tomato employs ylate AtBASL3 and a conserved specialized MAPK docking motif
quiescence of both sister and non-sister cells surrounding sto- (FxFP) that, although phylogenetically widespread, occurs in
mata to create a pavement cell ‘‘buffer zone’’ (Figure 4B) that en- only a modest number of proteins in each species.26 We specu-
sures a degree of stomatal spacing, even in the slbasl mutant. late that D3-containing BSLL genes in early diverging angio-
Additionally, in tomato, approximately 30% of physically asym- sperms may have provided a MAPK-interacting ‘‘chassis’’ to
metric divisions undergo ‘‘meristemoid drop-out’’ and resolve which a polarity module was linked in eudicots, and the resultant
as pairs of pavement cells (Figure 4E). While such divisions are protein became useful to enforce cell fate segregation during
absent in wild-type Arabidopsis development, similar pheno- stomatal lineage ACDs.
types have been described in myoxi-i mutants, where nuclear BASL’s ability to polarize also requires information encoded
migration and division plane defects accompany differentiation in the D2 domain. This domain overlaps a region of AtBASL
of both daughters into pavement cells.23 Similarly, late depletion shown to interact with BREVIS RADIX (BRX) family proteins,9
of the transcription factor SPEECHLESS can ‘‘divert’’ meriste- which exhibit mutual dependency with BASL for polarization
moids or GMCs toward pavement cell fate.16 In tomato, such de- and function in the Arabidopsis stomatal lineage. In turn, BRX
coupling of physical and fate asymmetry can be used to populate interacts with BASL through a pair of conserved BRX do-
the developing epidermis with additional pavement cells and pro- mains,9 which are also found in other proteins, such as PRAFs
mote proper spacing of stomata. (plextrin, regulator of chromatin condensation and FYVE
Different strategies for spacing stomata apart may incur domain).27 Interestingly, BASL may interact with the BRX
different costs. As spacing divisions allow Arabidopsis to domain through a pair of well-conserved b strands in the D2
generate additional meristemoids under favorable environ- domain, which bear similarity in structure, but not sequence,
mental conditions,24,25 their absence in tomato may represent to the BRX-interacting domain of LAZY3, a known PRAF bind-
a constraint on the plasticity of stomatal development. Plasticity ing partner.28 These data suggest possible convergence of a
could be restored, however, by regulating flux along other paths BRX interaction fold across two plant-specific polar protein
in the lineage, such as in the number of entry divisions, or by con- families: BASLs and LAZYs. Convergent evolution of protein-
verting ‘‘drop-outs’’ into meristemoids (Figure 4F). Alternatively, protein interaction folds among polar proteins has also been
a latent spacing division capacity may be activated under appro- described for DIX (Dishevelled and Axin) domains, found in
priate environmental conditions not tested in our assays, as the the animal proteins for which they were named, and in plant
SlBASL promoter appears to contain the necessary cis-regulato- SOSEKI proteins.29
ry information to operate in spacing divisions when expressed in Regardless of how BASL homologs are refined for partic-
Arabidopsis. ipation in different types of ACDs, we are still left with the
The paucity of spacing divisions in tomato may have relaxed conundrum of how non-eudicots coordinate ACDs without
selection on SlBASL protein activity, an idea supported by its BASL. Stomatal development has been extensively studied
effective rescue of atbasl stomatal pairs originating from fate in grasses, such as maize, rice, and Brachypodium dis-
defects but only modest rescue of pairs originating from tachyon, where meristemoids typically undergo a single, uni-
spacing divisions (Figure 2F). When considering sources of formly oriented asymmetric division before terminal differen-
specificity, it is notable that, although highly diverged, BASL tiation.19 This mode contrasts with the flexible program
orthologs from eudicots conserve three distinct protein do- exhibited by many eudicots, including Arabidopsis and to-
mains, including a previously described MAPK docking site mato, where the number and orientation of asymmetric divi-
at the C terminus7 and two newly identified domains at D1 sions is variable and responsive to a variety of internal and
and D2 positions. Consistent with previous dissections of At- external inputs. It is tempting to speculate that BASL may
BASL domain structure,2 BASL orthologs conserving only D2 have been co-opted in eudicots to coordinate some aspect
and D3 domains (as exemplified by AqBASL) appear to be suf- of this flexible developmental program that is dispensable in
ficient for substantial rescue of the atbasl phenotype, despite grasses. Alternatively, BASL functions in non-eudicots may
broad divergence elsewhere in the peptide sequence. Arabi- be performed by an unrelated protein family, such as BRX
dopsis D1 contains sequences directing nuclear import and family proteins, which polarize alongside BASL in the Arabi-
export,7 but no positive role for AtBASL in the nucleus has dopsis stomatal lineage and appear to be deeply conserved
been identified. Instead, current models suggest that nuclear across land plants.9,27,30 Recent work30 to reconstruct the
localization may sequester AtBASL away from its site of action long-term evolutionary history of Arabidopsis proteins, com-
at the cell cortex because variants missing D1 are hyperac- bined with studies of protein function in their native con-
tive.2,7 SlBASL’s capacity to function in cell polarity, without texts, may shed light on the genetic toolkit and behaviors
detectable nuclear accumulation, further suggests that positive available to ancient and modern stem cells as they progress
BASL functions are at the plasma membrane. Whether through development.

Current Biology 32, 1–9, January 24, 2022 7

 Please cite this article in press as: Nir et al., Evolution of polarity protein BASL and the capacity for stomatal lineage asymmetric divisions, Current
Biology (2021), [Link]

ll
OPEN ACCESS Article

STAR+METHODS 3. Zhang, Y., Wang, P., Shao, W., Zhu, J.-K., and Dong, J. (2015). The BASL
polarity protein controls a MAPK signaling feedback loop in asymmetric
cell division. Dev. Cell 33, 136–149.
Detailed methods are provided in the online version of this paper
and include the following: 4. Zhang, Y., Guo, X., and Dong, J. (2016). Phosphorylation of the polarity
protein BASL differentiates asymmetric cell fate through MAPKs and
d KEY RESOURCES TABLE SPCH. Curr. Biol. 26, 2957–2965.
d RESOURCE AVAILABILITY 5. Robinson, S., Barbier de Reuille, P., Chan, J., Bergmann, D.,
B Lead contact Prusinkiewicz, P., and Coen, E. (2011). Generation of spatial patterns
through cell polarity switching. Science 333, 1436–1440.
B Materials availability
B Data and code availability 6. Geisler, M., Nadeau, J., and Sack, F.D. (2000). Oriented asymmetric divi-
sions that generate the stomatal spacing pattern in arabidopsis are disrup-
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
ted by the too many mouths mutation. Plant Cell 12, 2075–2086.
B Arabidopsis growth conditions
7. Zhang, Y., Bergmann, D.C., and Dong, J. (2016). Fine-scale dissection of
B Brachypodium growth conditions
the subdomains of polarity protein BASL in stomatal asymmetric cell divi-
B Tomato growth conditions
sion. J. Exp. Bot. 67, 5093–5103.
B Nicotiana benthamiana growth conditions
8. Guo, X., Park, C.H., Wang, Z.-Y., Nickels, B.E., and Dong, J. (2021). A
d METHOD DETAILS spatiotemporal molecular switch governs plant asymmetric cell division.
B Identification of BASL and BSLL sequences Nat. Plants 7, 667–680.
B Identification of BASL pseudogenes in tomato 9. Rowe, M.H., Dong, J., Weimer, A.K., and Bergmann, D.C. (2019). A plant-
B Gene names used in this paper specific polarity module establishes cell fate asymmetry in the Arabidopsis
B Arabidopsis and Nicotiana transformations stomatal lineage. bioRxiv. [Link]
B Tomato transformations 10. Houbaert, A., Zhang, C., Tiwari, M., Wang, K., de Marcos Serrano, A.,
B Brachypodium transformations Savatin, D.V., Urs, M.J., Zhiponova, M.K., Gudesblat, G.E., Vanhoutte,
B Tomato CRISPR mutagenesis I., et al. (2018). POLAR-guided signalling complex assembly and localiza-
B Microscopy, image analysis and processing tion drive asymmetric cell division. Nature 563, 574–578.

d QUANTIFICATION AND STATISTICAL ANALYSIS 11. Pillitteri, L.J., Peterson, K.M., Horst, R.J., and Torii, K.U. (2011). Molecular
profiling of stomatal meristemoids reveals new component of asymmetric
cell division and commonalities among stem cell populations in
SUPPLEMENTAL INFORMATION
Arabidopsis. Plant Cell 23, 3260–3275.
Supplemental information can be found online at [Link] 12. Rudall, P.J., Hilton, J., and Bateman, R.M. (2013). Several developmental
cub.2021.11.013. and morphogenetic factors govern the evolution of stomatal patterning in
land plants. New Phytol. 200, 598–614.
ACKNOWLEDGMENTS 13. Chan, J., Mansfield, C., Clouet, F., Dorussen, D., and Coen, E. (2020).
Intrinsic cell polarity coupled to growth axis formation in tobacco BY-2
We thank Prof. Jose Dinneny for imaging resources and members of the lab for cells. Curr. Biol. 30, 4999–5006.e3.
insightful comments on the draft and for tomato farming. I.N. is currently a Ko- n, A., and Bergmann, D.C. (2012). Mechanisms of stomatal develop-
14. Vate
ret fellow and was previously supported by United States - Israel Binational ment: an evolutionary view. Evodevo 3, 11.
Agricultural Research and Development Fund (BARD) Fellowship no. FI-583-
2019. G.A. is supported by funds from the National Institutes of Health (T32 15. Jacobs, D., Glossip, D., Xing, H., Muslin, A.J., and Kornfeld, K. (1999).
5T32GM007790), the National Science Foundation (DGE-1656518), and a Multiple docking sites on substrate proteins form a modular system that
Stanford Graduate Fellowship. D.C.B. is an investigator of the Howard Hughes mediates recognition by ERK MAP kinase. Genes Dev. 13, 163–175.
Medical Institute. 16. Lopez-Anido, C.B., Vate n, A., Smoot, N.K., Sharma, N., Guo, V., Gong, Y.,
Anleu Gil, M.X., Weimer, A.K., and Bergmann, D.C. (2021). Single-cell res-
AUTHOR CONTRIBUTIONS olution of lineage trajectories in the Arabidopsis stomatal lineage and
developing leaf. Dev. Cell 56, 1043–1055.e4.
Conceptualization, I.N., G.A., and D.C.B.; methodology, I.N., G.A., and Y.G.; 17. Wang, L., Czedik-Eysenberg, A., Mertz, R.A., Si, Y., Tohge, T., Nunes-
investigation, I.N., G.A., Y.G., N.K.S., L.C., and H.S.; writing – original draft, Nesi, A., Arrivault, S., Dedow, L.K., Bryant, D.W., Zhou, W., et al. (2014).
I.N., G.A., and D.C.B.; writing – review & editing, I.N., G.A., and D.C.B.; funding Comparative analyses of C4 and C3 photosynthesis in developing leaves
acquisition, I.N., G.A., and D.C.B.; resources, D.C.B.; supervision, D.C.B. of maize and rice. Nat. Biotechnol. 32, 1158–1165.
18. Gong, Y., Alassimone, J., Muroyama, A., Amador, G., Varnau, R., Liu, A.,
DECLARATION OF INTERESTS and Bergmann, D.C. (2021). The Arabidopsis stomatal polarity protein
BASL mediates distinct processes before and after cell division to coordi-
The authors declare no competing interests. nate cell size and fate asymmetries. Development 148, dev199919.
19. McKown, K.H., and Bergmann, D.C. (2020). Stomatal development in the
Received: August 9, 2021
grasses: lessons from models and crops (and crop models). New Phytol.
Revised: October 8, 2021
227, 1636–1648.
Accepted: November 3, 2021
Published: November 29, 2021 20. Goliber, T., Kessler, S., Chen, J.-J., Bharathan, G., and Sinha, N. (1999).
Genetic, molecular, and morphological analysis of compound leaf devel-
REFERENCES opment. Curr. Top. Dev. Biol. 43, 259–290.
21. Ichihashi, Y., Aguilar-Martı́nez, J.A., Farhi, M., Chitwood, D.H., Kumar, R.,
1. Lee, L.R., and Bergmann, D.C. (2019). The plant stomatal lineage at a Millon, L.V., Peng, J., Maloof, J.N., and Sinha, N.R. (2014). Evolutionary
glance. J. Cell Sci. 132, jcs228551. developmental transcriptomics reveals a gene network module regulating
2. Dong, J., MacAlister, C.A., and Bergmann, D.C. (2009). BASL controls interspecific diversity in plant leaf shape. Proc. Natl. Acad. Sci. USA 111,
asymmetric cell division in Arabidopsis. Cell 137, 1320–1330. E2616–E2621.

8 Current Biology 32, 1–9, January 24, 2022

 Please cite this article in press as: Nir et al., Evolution of polarity protein BASL and the capacity for stomatal lineage asymmetric divisions, Current
Biology (2021), [Link]

ll
Article OPEN ACCESS

22. Nir, I., Shohat, H., Panizel, I., Olszewski, N., Aharoni, A., and Weiss, D. 37. Omary, M., Gil-Yarom, N., Yahav, C., Steiner, E., and Efroni, I. (2020). A
(2017). The tomato DELLA protein PROCERA acts in guard cells to pro- conserved superlocus regulates above-and belowground root initiation.
mote stomatal closure. Plant Cell 29, 3186–3197. bioRxiv. [Link]
23. Muroyama, A., Gong, Y., and Bergmann, D.C. (2020). Opposing, polarity- 38. Finn, R.D., Clements, J., and Eddy, S.R. (2011). HMMER web server: inter-
driven nuclear migrations underpin asymmetric divisions to pattern active sequence similarity searching. Nucleic Acids Res. 39, W29–W37.
Arabidopsis stomata. Curr. Biol. 30, 4467–4475.e4. 39. Potter, S.C., Luciani, A., Eddy, S.R., Park, Y., Lopez, R., and Finn, R.D.
24. Vaten, A., Soyars, C.L., Tarr, P.T., Nimchuk, Z.L., and Bergmann, D.C. (2018). HMMER web server: 2018 update. Nucleic Acids Res. 46 (W1),
(2018). Modulation of asymmetric division diversity through cytokinin W200–W204.
and SPEECHLESS regulatory interactions in the Arabidopsis stomatal 40. Edgar, R.C. (2004). MUSCLE: multiple sequence alignment with high ac-
lineage. Dev. Cell 47, 53–66.e5. curacy and high throughput. Nucleic Acids Res. 32, 1792–1797.
25. Gong, Y., Alassimone, J., Varnau, R., Sharma, N., Cheung, L.S., and 41. Katoh, K., and Standley, D.M. (2013). MAFFT multiple sequence alignment
Bergmann, D.C. (2021). Tuning self-renewal in the Arabidopsis stomatal software version 7: improvements in performance and usability. Mol. Biol.
lineage by hormone and nutrient regulation of asymmetric cell division. Evol. 30, 772–780.
eLife 10, e63335.
42. Jones, D.T., and Cozzetto, D. (2015). DISOPRED3: precise disordered re-
26. Fernandes, N., and Allbritton, N.L. (2009). Effect of the DEF motif on phos- gion predictions with annotated protein-binding activity. Bioinformatics
phorylation of peptide substrates by ERK. Biochem. Biophys. Res. 31, 857–863.
Commun. 387, 414–418.
43. Jones, D.T. (1999). Protein secondary structure prediction based on posi-
27. Briggs, G.C., Mouchel, C.F., and Hardtke, C.S. (2006). Characterization of tion-specific scoring matrices. J. Mol. Biol. 292, 195–202.
the plant-specific BREVIS RADIX gene family reveals limited genetic
44. Goodstein, D.M., Shu, S., Howson, R., Neupane, R., Hayes, R.D., Fazo, J.,
redundancy despite high sequence conservation. Plant Physiol. 140,
Mitros, T., Dirks, W., Hellsten, U., Putnam, N., and Rokhsar, D.S. (2012).
1306–1316.
Phytozome: a comparative platform for green plant genomics. Nucleic
28. Furutani, M., Hirano, Y., Nishimura, T., Nakamura, M., Taniguchi, M., Acids Res. 40, D1178–D1186.
Suzuki, K., Oshida, R., Kondo, C., Sun, S., Kato, K., et al. (2020). Polar
45. Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M.,
recruitment of RLD by LAZY1-like protein during gravity signaling in root
Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., et al.
branch angle control. Nat. Commun. 11, 76.
(2012). Fiji: an open-source platform for biological-image analysis. Nat.
29. van Dop, M., Fiedler, M., Mutte, S., de Keijzer, J., Olijslager, L., Albrecht,
Methods 9, 676–682.
C., Liao, C.-Y., Janson, M.E., Bienz, M., and Weijers, D. (2020). DIX domain
46. Parslow, A., Cardona, A., and Bryson-Richardson, R.J. (2014). Sample
polymerization drives assembly of plant cell polarity complexes. Cell 180,
drift correction following 4D confocal time-lapse imaging. J. Vis. Exp.
427–439.e12.
86, 51086.
30. Ramalho, J.J., Jones, V.A.S., Mutte, S., and Weijers, D. (2021). Pole posi-
tion: how plant cells polarize along the axes. The Plant Cell. Published on- 47. R Development Core Team (2020). RStudio: Integrated Development for R
line August 2, 2021. [Link] (R Foundation for Statistical Computing).

31. Koncz, C., and Schell, J. (1986). The promoter of TL-DNA gene 5 controls 48. Kassambara, A. (2021). rstatix: pipe-friendly framework for basic statisti-
the tissue-specific expression of chimaeric genes carried by a novel type cal tests, version 0.7.0. [Link]
of Agrobacterium binary vector. Molec. Gen. Genet. 204, 383–396. 49. Clough, S.J., and Bent, A.F. (1998). Floral dip: a simplified method for
32. Bragg, J.N., Anderton, A., Nieu, R., and Vogel, J.P. (2015). Brachypodium Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J.
distachyon. In Agrobacterium Protocols, K. Wang, ed. (Springer), 16, 735–743.
pp. 17–33. 50. McCormick, S. (1991). Transformation of tomato with Agrobacterium tu-
33. Raissig, M.T., Abrash, E., Bettadapur, A., Vogel, J.P., and Bergmann, D.C. mefaciens. In Plant Tissue Culture Manual, K. Lindsey, ed. (Springer),
(2016). Grasses use an alternatively wired bHLH transcription factor pp. 311–319.
network to establish stomatal identity. Proc. Natl. Acad. Sci. USA 113, 51. Himmelbach, A., Zierold, U., Hensel, G., Riechen, J., Douchkov, D.,
8326–8331. Schweizer, P., and Kumlehn, J. (2007). A set of modular binary vectors
34. Kubo, M., Udagawa, M., Nishikubo, N., Horiguchi, G., Yamaguchi, M., Ito, for transformation of cereals. Plant Physiol. 145, 1192–1200.
J., Mimura, T., Fukuda, H., and Demura, T. (2005). Transcription switches 52. Abrash, E., Anleu Gil, M.X., Matos, J.L., and Bergmann, D.C. (2018).
for protoxylem and metaxylem vessel formation. Genes Dev. 19, 1855– Conservation and divergence of YODA MAPKKK function in regulation
1860. of grass epidermal patterning. Development 145, dev165860.
35. Weber, E., Engler, C., Gruetzner, R., Werner, S., and Marillonnet, S. (2011). 53. Lei, Y., Lu, L., Liu, H.-Y., Li, S., Xing, F., and Chen, L.-L. (2014). CRISPR-P:
A modular cloning system for standardized assembly of multigene con- a web tool for synthetic single-guide RNA design of CRISPR-system in
structs. PLoS ONE 6, e16765. plants. Mol. Plant 7, 1494–1496.
36. Belhaj, K., Chaparro-Garcia, A., Kamoun, S., and Nekrasov, V. (2013). 54. Davies, K.A., and Bergmann, D.C. (2014). Functional specialization of sto-
Plant genome editing made easy: targeted mutagenesis in model and matal bHLHs through modification of DNA-binding and phosphoregula-
crop plants using the CRISPR/Cas system. Plant Methods 9, 39. tion potential. Proc. Natl. Acad. Sci. USA 111, 15585–15590.

Current Biology 32, 1–9, January 24, 2022 9

 Please cite this article in press as: Nir et al., Evolution of polarity protein BASL and the capacity for stomatal lineage asymmetric divisions, Current
Biology (2021), [Link]

ll
OPEN ACCESS Article

STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Bacterial and virus strains
TOP10 Competent cells N/A N/A
Agrobacterium tumefaciens, GV3101 cells Koncz and Schell31 N/A
Agrobacterium tumefaciens, AGL1 cells Bragg et al.32 N/A
Chemicals, peptides, and recombinant proteins
Propidium iodide Life Technologies/Thermo P3566
Fisher Scientific
FM 4-64 Life Technologies/Thermo T3166
Fisher Scientific
Nitsch media for Tomato Caisson labs NNP03-50LT
MS media for Arabidopsis Caisson labs MSP01-50LT
Micropropagation Agar-Type 1 Caisson labs A038
Experimental models: Organisms/strains
Arabidopsis thaliana ecotype Col-0 Arabidopsis Biological CS60000
Resources Center
Tomato (Solanum lycopersicum cv. M82) Nir et al.22 N/A
Nicotiana benthamiana N/A N/A
Brachypodium distachyon Bd21-3 Raissig et al.33 N/A
Arabidopsis: basl-2 AtML1pro:mCherry-RCI2A Gong et al.18 N/A
Arabidopsis: basl-2 AtML1pro:mCherry-RCI2A, Gong et al.18 N/A
AtBASLpro:Venus-mDBox-AtBASL
Arabidopsis: basl-2 AtML1pro:mCherry-RCI2A, This paper N/A
AtBASLpro:Venus-SlBASL
Arabidopsis: basl-2 AtML1pro:mCherry-RCI2A, This paper N/A
SlBASLpro:Venus-SlBASL
Arabidopsis: basl-2 AtML1pro:mCherry-RCI2A, This paper N/A
AtBASLpro:Venus-mDBox-AqBASL
Arabidopsis: basl-2 AtML1pro:mCherry-RCI2A, This paper N/A
AtBASLpro:Venus-mDBox-BdBSLL1
Brachyopodium: Ubpro:YFP-AtBASL This paper N/A
Tomato: SlBASLpro:Venus-SlBASL This paper N/A
Tomato: AtML1pro:RCI2A-mNeonGreen This paper N/A
Tomato: slbasl-cr#4 This paper N/A
Tomato: slbasl-cr#2 This paper N/A
Tomato: slbasl-cr#6 This paper N/A
Oligonucleotides
Promoter cloning, SlBASLpro_F1: GGCA This paper N/A
TTCGTTTGTATAAAAGTGTAG
Promoter cloning, SlBASLpro-mid_F: TTA This paper N/A
CAcTCTTCTATGCACATACCATTTACAC
Promoter cloning, SlBASLpro-mid_R: GTAAA This paper N/A
GTCTACTTAGGTAACCATTTATTCACAC
Promoter cloning, SlBASLpro_R: TCTTATT This paper N/A
CAATTAACAACAGAGAAATACAAGGGAA
Genotyping PCR, SlBASL476_up_F: TTGA This paper N/A
AAGAAGTGAAACTCAACACC
(Continued on next page)

e1 Current Biology 32, 1–9.e1–e5, January 24, 2022

 Please cite this article in press as: Nir et al., Evolution of polarity protein BASL and the capacity for stomatal lineage asymmetric divisions, Current
Biology (2021), [Link]

ll
Article OPEN ACCESS

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
Genotyping PCR, SlBASl423_dow_R: GCAT This paper N/A
CTTTCTCCGAAGCTGC
Genotyping sequence, SlBASL42_R: GCCAT This paper N/A
CTAACAAGCTTGGTTACTG
Genotyping sequence, SlBASL413_R: TCCTC This paper N/A
CATCGTCTTCAAAGCA
Genotyping sequence, SlBASL_ex4_R1: AAGG This paper N/A
CAAAGGAACCAGTGCT
Genotyping sequence, SlBASL285dowR: TGGT This paper N/A
GACAGTAAATTCCTCAAGCA
Recombinant DNA
pH35GY Kubo et al.34 N/A
MoClo Toolkit Weber et al.35 Addgene #1000000044
pH35GY 35Spro:AtBASL-YFP This paper N/A
pH35GY 35Spro:AtBSLL1-YFP This paper N/A
pICH47742 35Sx2pro:Venus-SlBASL This paper N/A
pH35GY 35Spro:SlBSLL1-YFP This paper N/A
pICH47742 35Sx2pro:Venus-AqBASL This paper N/A
pH35GY 35Spro:AqBSLL1-YFP This paper N/A
pICH47742 35Sx2pro:Venus-BdBSLL1 This paper N/A
pK7m34GW AtBASLpro:Venus-mDBox-AtBASL Gong et al.18 N/A
pICAGM4723 AtBASLpro:Venus-SlBASL This paper N/A
pICAGM4723 AtBASLpro:Venus-AqBASL This paper N/A
pICAGM4723 AtBASLpro:Venus-BdBSLL1 This paper N/A
pAGM4723 SlBASLpro:Venus-SlBASL This paper N/A
pICH47732 NOSpro:NPTII Belhaj et al.36 Addgene #51144
pICH4772 SlUBQ10pro:zCas9 Omary et al.37 N/A
pAGM4723 AtML1pro:RCI2A-mNeonGreen This paper N/A
Software and algorithms
Jackhmmer (HmmerWeb version 2.41.2) Finn et al.38 and Potter et al.39 [Link]
jackhmmer
MUSCLE, via Geneious (version 3.8.425) Edgar40 [Link]
MAFFT, via Geneious (version 7.388) Katoh and Standley41 [Link]
DISOPRED3, via the PSIPRED Workbench Jones and Cozzetto42 [Link]
43
PSIPRED 4.0, via the PSIPRED Workbench Jones [Link]
Phytozome v12 Goodstein et al.44 [Link]
Fiji 2.1.0/1.53c Schindelin et al.45 [Link]
Correct 3D Drift plugin 1.0.6 Parslow et al.46 [Link]
RStudio 1.1.423 R Development Core Team47 [Link]
rstatix 0.7.0 Kassambara48 [Link]
[Link]
Other
Alignments and reconstructed phylogeny of BASL This paper [Link]
and BSLL genes

RESOURCE AVAILABILITY

Lead contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Dominique
Bergmann (dbergmann@[Link]).

Current Biology 32, 1–9.e1–e5, January 24, 2022 e2

 Please cite this article in press as: Nir et al., Evolution of polarity protein BASL and the capacity for stomatal lineage asymmetric divisions, Current
Biology (2021), [Link]

ll
OPEN ACCESS Article

Materials availability
All unique/stable reagents generated in this study are available from the Lead Contact without restriction.

Data and code availability

d Multiple sequence alignments and Newick tree files are at [Link]

d This paper does not report original code.
d Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Arabidopsis growth conditions

Arabidopsis thaliana Col-0 seeds were surface-sterilized with 75% ethanol, rinsed twice with distilled water and stratified for 2 days.
After stratification, seedlings were grown on ½ strength Murashige and Skoog (MS) media (Casson Labs) with 1% agar for 3 – 14 days
under long-day conditions (16 hr light/8 hr dark at 110 mmol m2 s-1 and 22 C) in a Percival growth chamber, model CU36L5.

Brachypodium growth conditions

Brachypodium distachyon Bd21-3 seeds were stratified for 2 – 8 days. After stratification, seedlings were grown on agar-solidified ½
MS media at 22-26 C, at 80 mmol m2 s-1 and 16 hr light/8 hr dark cycles in a Percival growth chamber, model CU36L5. For propa-
gation, plants were transferred to soil in a greenhouse (20 hr light/4 hr dark, 250-300 mmol m2 s-1; day temperature: 28 C; night tem-
perature: 18 C).

Tomato growth conditions

Tomato plants (Solanum lycopersicum cv. M82) were grown in a Percival growth chamber, model CU22L, or Percival growth room,
model AR-1015L3, set to a photoperiod of 16 hr light/8 hr dark, light intensity of approximately 250 mmol m2 s-1 and 26 C. For prop-
agation, plants were grown in a greenhouse under natural day length conditions, at 700–1200 mmol m2 s-1 and 18 – 29 C.

Nicotiana benthamiana growth conditions

Nicotiana benthamiana plants were grown in Percival AR66 growth chambers set a photoperiod of 16 hrlight/8 hr dark, light intensity
of approximately 110 mmol m2 s-1, and 23 C day/22 C night. Plants were infiltrated with Agrobacterium at least six weeks after
germination.

METHOD DETAILS

Identification of BASL and BSLL sequences

BASL sequences from 9 Brassicaceae species were aligned with MUSCLE40 and used to query the Viridiplantae section of the Uni-
ProtKB protein sequence database with jackhmmer.38,39 Candidate homologs from 33 land plant species with e-values below 0.01
were selected for alignment and manual inspection. After removing exact and near duplicates (> 95% identity), sequences were
aligned using MAFFT41 and sites with > 80% coverage were used to estimate the phylogeny with the neighbor-joining algorithm
as implemented on Geneious Prime 2.3. The tree shown in Figure 1C is trimmed to remove several clades of highly diverged, likely
spurious orthologs.
In several cases, BASL orthologs appeared to be missing in eudicot proteomes as annotated on UniProtKB but could always be
found in other proteome or genome annotations (Table S1). Similarly, parts of conserved domains at the extreme N- and C-termini
that appeared to be missing in protein models could often be found in-frame in the corresponding DNA sequence; protein sequences
were manually corrected to include such domains in Figure S1C. For that figure, intrinsic disorder predictions were derived from
DISOPRED3.42 Secondary structure predictions were derived from PSIPRED 4.043 and the confidence score of the prediction is
used to color the alignment. The location of splice junctions was derived from the primary transcript annotated on Phytozome
v1244 and exons were then shaded in alternating colors. Measurements are displayed for the following proteins: Arabidopsis thaliana
AT5G60880, Medicago truncatula Medtr2g461550.1, Populus trichocarpa Potri.015G048600.1, Solanum lycopersicum Solyc03
g114770.2.1, Erythranthe guttata (previously Mimulus guttatus) XP_012853883.1, Daucus carota DCAR_023155 and Aquilegia
coerulea Aqcoe7G067300.1.

Identification of BASL pseudogenes in tomato

A single BASL ortholog and three clearly distinguishable BSLL proteins were found in the Solanum lycopersicum iTAG2.4 proteome.
In the iTAG2.4 genome, one additional short ORF located within an intron of Solyc01 g009450.2.1 could be recognized. Sequence
inspection showed remnants of conserved D1 and D2 domains, suggesting orthology to SlBASL; however, several early stop codons
and a frameshifting indel are predicted to produce a severely truncated 20 amino acid polypeptide from this locus.

e3 Current Biology 32, 1–9.e1–e5, January 24, 2022

 Please cite this article in press as: Nir et al., Evolution of polarity protein BASL and the capacity for stomatal lineage asymmetric divisions, Current
Biology (2021), [Link]

ll
Article OPEN ACCESS

Gene names used in this paper

Named genes in this paper correspond to the following proteins and genes (listed as gene name, UniProt ID, locus ID): AtBASL
Q5BPF3 AT5G60880, AtBSLL1 Q9LMY2 AT1G13650, AtBSLL2 F4ITB8 AT2G03810, SlBASL A0A3Q7GGD1 Solyc03 g114770.2.1,
SlBSLL1 A0A3Q7FSN7 Solyc03 g114750.2.1, AqBASL Aqcoe7G067300.1, AqBSLL1 A0A2G5F5L9 Aqcoe3G377700.1 and BdBSLL1
I1IAZ5 Bradi3g47127. Note that AqBASL has not been assigned a UniProt ID.

Arabidopsis and Nicotiana transformations

BSLL candidates from tomato, Aquilegia coerulea and Brachypodium distachyon and BASL candidates from Aquilegia coerulea and
Brachypodium distachyon were synthesized in vitro following the primary annotated CDS from Phytozome v12. For transient expres-
sion in Nicotiana benthamiana, 35Spro:AtBASL-YFP, 35Spro:AtBSLL1-YFP, 35Spro:SlBSLL1-YFP, and 35Spro:AqBSLL1-YFP, were
cloned using the binary vector pH35YG,34 and 35Sx2pro:Venus-SlBASL, 35Sx2pro:Venus-AqBASL and 35Sx2pro:Venus-BdBSLL1
cloned using the Golden Gate system35 into the binary vector pICH47742 with NOS terminator. The binary vectors were introduced
into Agrobacterium tumefaciens strain GV3101 and infiltrated into mature tobacco leaves as described in Zhang et al.3 For stable
expression in Arabidopsis, AtBASLpro:Venus-SlBASL, AtBASLpro:Venus-AqBASL and AtBASLpro:Venus-BdBSLL1 were cloned us-
ing the Golden Gate system into the binary vector pAGM4723 with NOS terminator. The constructs were introduced into
A. tumefaciens as above and transferred to Arabidopsis by floral dipping.49 Transgenic founder plants were identified by kanamycin
resistance. All analyses were performed on homozygous T3 plants.

Tomato transformations
For tomato BASL marker lines, the SlBASL promoter and CDS were cloned into a level 0 MoClo part using the Golden Gate cloning
system35 and then fused to Venus and a NOS terminator to form a level 1 construct. The level 1 was transferred to a level 2, together
with a kanamycin resistance cassette. For primers used in cloning see Key resources table. The constructs were sub-cloned into the
pAGM4723 binary vector and were introduced into A. tumefaciens strain GV3101 by electroporation. The constructs were transferred
to M82 cotyledons, using transformation and regeneration methods from McCormick.50 Kanamycin-resistant T0 plants were grown
and at least four independent transgenic lines were selected and self-pollinated to generate homozygous transgenic lines.

Brachypodium transformations
For expression of AtBASL in Brachypodium distachyon strain Bd21-3, a Gateway pENTR plasmid encoding a fusion of YFP with the
coding region of BASL2 was recombined into the monocot transformation pIPKb002 that drives expression of inserts with the maize
Ubiquitin promoter51 following standard Gateway protocols.32 Brachypodium calli were transformed with A. tumefaciens strain
AGL1, selected and regenerated according to standard protocols.32 Expression of the transgene was monitored in the development
zone at the base of leaves from 22 dpg T1 plants as described in Abrash et al.52

Tomato CRISPR mutagenesis

Four single-guide RNAs (sgRNAs) were designed using the CRISPR-P tool.53 The gRNAs and promoter were assembled using the
Golden Gate cloning system as described in Weber et al.35 The final binary vector including zCas9, the gRNAs and NPTII, assembled
in pAGM4723, was introduced into Agrobacterium tumefaciens strain GV3101 by electroporation. The construct was transferred into
M82 cotyledons using transformation and regeneration methods described by McCormick.50 T0 transgenic plants resistant to Kana-
mycin were grown and independent lines were selected and self-pollinated to generate homozygous lines. For genotyping of the
transgenic lines, genomic DNA was extracted, and each plant was genotyped by PCR for the presence of the zCas9. The positive
lines for the zCas9 were further genotyped for mutations in SlBASL (Solyc03 g114770) using a forward primer 400bp upstream to
the ATG and a reverse primer 200 bp downstream to the stop codon, these pair primers cover the 4 gRNAs.

Microscopy, image analysis and processing

All fluorescence imaging experiments on Arabidopsis plants were performed on a Leica SP5 confocal microscope with HyD detec-
tors using 40x NA1.1 water objective with image size 1024*1024 and digital zoom from 1x to 2x. To quantify rescue of the atbasl sto-
matal clustering phenotype, 14 dpg cotyledons were imaged and the fraction of stomata in clusters of size two or larger was
computed from regions containing 120 stomata (approximately 0.5 – 1.5 mm2 in size). Normalized rescue capacity was calculated
as 1 – (% pairs in rescue - % pairs in WT) / (% pairs in atbasl - % pairs in WT). Still or time-course images of SlBASLpro:VENUS-
SlBASL, ML1pro:RCI2A-NeonGreen, propidium iodide (PI), and FM4-64 fluorescence in tomato were obtained from a Leica SP8
confocal microscope with HyD detectors using 20x oil objective with image size 1024*1024 and digital zoom from 1x to 2x. For
time-course experiments on tomato, cotyledons of 1 dpe soil-grown seedlings were mounted with abaxial side toward coverslip,
and 0.15% agarose was added to prevent root drying. Seedlings were carefully unmounted after imaging and returned to the soil
until the next image acquisition. Time-lapse experiments of SlBASL in tomato were performed on a Leica SP5 confocal microscope
with HyD detectors using 25x NA0.95 and 40x NA1.1 water objectives. Seedlings were mounted on a customized flow-through
chamber54 and images were acquired at 30 min. Imaging data was analyzed on Fiji.45 All raw fluorescence image Z stacks were pro-
jected with SUM (Arabidopsis stills) or STD (tomato stills and time-lapse) slices. STD was found empirically to generate clearer im-
ages from tomato cells than other image processing tools, likely due to the high levels of autofluorescence in tomato cells. For all
time-lapse images, drift was corrected after projection using the Correct 3D Drift plugin46 prior to any further analysis.

Current Biology 32, 1–9.e1–e5, January 24, 2022 e4

 Please cite this article in press as: Nir et al., Evolution of polarity protein BASL and the capacity for stomatal lineage asymmetric divisions, Current
Biology (2021), [Link]

ll
OPEN ACCESS Article

QUANTIFICATION AND STATISTICAL ANALYSIS

All statistical analyses in this manuscript were performed in RStudio.47 Statistical parameters for each analysis are indicated in the
figure legends. For significance testing, unpaired Mann-Whitney U tests were conducted with the wilcox_test function from the rstatix
package.48 Bonferroni corrections were performed when more than 2 pairwise comparisons were conducted, and Bonferroni
corrected p values are indicated in all figures where applicable. For Figure 2E, each letter indicates a group of samples with no sta-
tistically significant difference between their means (Bonferroni corrected p value > 0.05).

e5 Current Biology 32, 1–9.e1–e5, January 24, 2022

Current Biology, Volume 32

Supplemental Information

Evolution of polarity protein BASL and the

capacity for stomatal lineage asymmetric divisions
Ido Nir, Gabriel Amador, Yan Gong, Nicole K. Smoot, Le Cai, Hagai Shohat, and Dominique
C. Bergmann
Figure S1. Additional sequence features of BASL and BSLL proteins, related to Figure 1
(A) Amino acid identity of top BLAST hits for AtBASL in select genomes. Sequences in green represent reciprocal best hits (RBH) when
used to query the Arabidopsis genome. Note that all RBHs are from eudicot genomes, and eudicot RBHs show rapid decay in sequence
identity outside the Brassicaceae (e.g., Carica papaya).
(B) Protein sequence logos of BASL and BSLL domains. In D3, grey boxes highlight a MAPK docking site (DEF) and phosphosite (S5)
functionally characterized in Arabidopsis BASL.S1,S2
(C) Alignment of BASLs overlayed with amino acid similarity, predicted native disorder, predicted secondary structure and position of
intron boundaries. Colors as indicated. In protein structure predictions, two PSIPRED scores are overlayed: α stands for α-helix, β for β-
sheet.
Figure S2. Expression of BASL and BSLL genes, and localization of BASL and BSLL proteins across species, related to Figure 2
(A) Expression of Arabidopsis BASL and BSLL genes in a developing leaf single cell RNA-seq atlas. Data from Lopez Anido et al.S3 is
displayed at resolution 0.1.
(B) Confocal images of BASL candidate reporters polarly localized when transiently expressed in mature N. benthamiana leaves. Dotted
outlines mark one representative cell. Scale bars: 40 µm.
(C) Confocal images of BSLL reporters when transiently expressed in mature N. benthamiana leaves. Scale bars: 40 µm.
(D) Confocal images of ZmUbpro:YFP-AtBASL (yellow) in Brachypodium distachyon leaves. Cell outlines (magenta) visualized by PI
staining. Clockwise from left: expression during generative ACDs, in subsidiary cell progenitors and in a mature stomatal complex. White
arrows indicate polarized localization. Images are oriented with leaf base towards the bottom. Scale bars: 10 µm.
(E) Confocal images of SlBASL translational reporter (yellow) under the control of Arabidopsis or tomato BASL promoters in Arabidopsis
cotyledon epidermis (cell outlines in magenta). Arrowheads mark polarized SlBASL accumulation during a spacing division.
(F) Schematic showing location of SPCH binding motifs (blue and yellow) in the promoters used in (E). AtSPCH ChIP-seq results from
Lau et al.S4 are overlayed on the Arabidopsis promoter, showing binding near the proximal element.
Figure S3. Additional phenotypes and molecular characterization of CRISPR/Cas9-generated SlBASL alleles, related to Figure 3
(A) Confocal images of mature true leaves from M82 and slbasl-cr#4 mutant. Stomata in purple, arrowheads indicate stomatal clusters.
Scale bars: 30 µm.
(B) Confocal images of abaxial cotyledon epidermis from two additional, independently derived slbasl mutant lines. Arrowheads point to
stomatal clusters. Scale bars: 30 µm.
(C) Full characterization of CRISPR/Cas9-induced indels at the 4 gRNA sites in slbasl-cr#4. PAM highlighted in blue, gRNA target
sequences in red. Deletions are marked by dashes; arrowhead marks a large insertion at gRNA4.
(D) Predicted protein sequences of SlBASL and slbasl-cr#4. Major domains of conservation denoted in colors. In the slbasl-cr#4 allele, a
small deletion at gRNA2 is predicted to lead to an early stop codon after 63 amino acids.
(E) Examples of division and differentiation outcomes observed in lineage tracing experiments. At left, cells from three recent asymmetric
divisions are false colored as yellow (meristemoid), green (SLGC) or stoma (purple) (1 – 3 and 4 – 6). At right, outcomes two days later,
showing direct differentiation of meristemoids (1, 3 and 5) amplifying divisions (2 and 6) and direct differentiation of SLGCs (2 – 6) in
both Arabidopsis and tomato. Spacing divisions (1) and meristemoid drop-outs (4) are common in Arabidopsis and tomato, respectively. In
all figures, outcomes are tracked and quantified separately for meristemoids and SLGCs. Only three examples are shown in each panel for
clarity, and several uncolored cells also undergo these types of transitions. Scale bars: 30 µm.
(F) Two examples of stomatal pairs arising from fate errors in slbasl-cr#4; DIC images of same cotyledon at 1 and 3 dpe; stomatal
precursors green, and stomata purple. Scale bars: 30 µm.
(G) Single found example of stomatal pair arising from spacing errors in slbasl-cr#4; DIC images of same cotyledon at 1 and 3 dpe;
stomatal precursors green, and stomata purple. Scale bars: 30 µm.
 Species Clade BASLs BSLLs
Physcomitrella patens Moss 0 2
Selaginella moellendorffii Lycophyte 0 2
Amborella trichopoda Basal angiosperm 0 1
Ananas comosus Monocot 0 1
Brachypodium distachyon Monocot 0 2
Oryza sativa Japonica Group Monocot 0 3
Triticum aestivum Monocot 0 1
Zea mays Monocot 0 6
Zostera marina Monocot 0 2
Aquilegia coerulea Eudicot 1 2
Arabidopsis thaliana Eudicot 1 2
Brassica rapa Eudicot 2 5
Capsella rubella Eudicot 1 2
Capsicum annuum Eudicot 1 4
Citrus clementina Eudicot 1 1
Cucumis melo Eudicot 1 3
Daucus carota subsp. sativus Eudicot 0* 1
Erythranthe guttata Eudicot 0* 1
Glycine max Eudicot 1 5
Gossypium raimondii Eudicot 2 4
Helianthus annuus Eudicot 0* 5
Lactuca sativa Eudicot 1 2
Malus domestica Eudicot 2 4
Manihot esculenta Eudicot 2 4
Medicago truncatula Eudicot 1 2
Nelumbo nucifera Eudicot 1 2
Papaver somniferum Eudicot 2 3
Populus trichocarpa Eudicot 1 3
Prunus persica Eudicot 2 2
Solanum lycopersicum Eudicot 1 3
Theobroma cacao Eudicot 1 2
Trifolium pratense Eudicot 2 1
Vitis vinifera Eudicot 2 3

Table S1. Number of BASL and BSLL proteins displayed in Fig. 1C, related to Figure 1
Asterisks denote BASL orthologues missing in the UniProtKB database but annotated elsewhere. See alignment files for protein codes.
Note that genomes with two BASL homologues are domesticated species where there is evidence of recent genome duplication.
REFERENCES

S1. Zhang, Y., Wang, P., Shao, W., Zhu, J.-K., and Dong, J. (2015). The BASL polarity protein controls a MAPK signaling feedback
loop in asymmetric cell division. Dev. Cell 33, 136-149.
S2. Zhang, Y., Bergmann, D.C., and Dong, J. (2016). Fine-scale dissection of the subdomains of polarity protein BASL in stomatal
asymmetric cell division. J. Exp. Bot. 67, 5093-5103.
S3. Lopez-Anido, C.B., Vatén, A., Smoot, N.K., Sharma, N., Guo, V., Gong, Y., Gil, M.X.A., Weimer, A.K., and Bergmann, D.C.
(2021). Single-cell resolution of lineage trajectories in the Arabidopsis stomatal lineage and developing leaf. [Link] 56, 1043-
1055.
S4. Lau, O.S., Davies, K.A., Chang, J., Adrian, J., Rowe, M.H., Ballenger, C.E., and Bergmann, D.C. (2014). Direct roles of
SPEECHLESS in the specification of stomatal self-renewing cells. Science 345, 1605-1609.