THE ART OF

MICROBIOLOGY
A LABORATORY MANUAL

J. Jeffrey Morris and Sarah J. Adkins

Copyright 2017

NAME:
TABLE OF CONTENTS
CH 1. INTRODUCTION: THE ART OF MICROBIOLOGY ........................ 1
CH 2. BIOSAFETY .............................................................................. 5
CH 3. TOOLS OF THE TRADE ............................................................ 10
CH 4. BACTERIAL ISOLATION .......................................................... 24
CH 5. MICROBIAL GROWTH ............................................................. 34
CH 6. AGAR ART .............................................................................. 43
CH 7. MOLECULAR IDENTIFICATION ............................................... 49
CH 8. CLASSICAL IDENTIFICATION ................................................. 62
CH 9. ANTIMICROBIALS .................................................................. 94
CH 10. STRESS TOLERANCE ............................................................. 99
CH 11. MICROBIAL COMPETITION ................................................. 109
CH 12. HYPOTHESIS TESTING ....................................................... 114

Appendices

A1. CALCULATING DILUTION FACTOR ........................................... 117

A2. CALCULATING CONFIDENCE INTERVALS ................................. 119
A3. THE T-TEST ............................................................................. 122
A4. CORRELATION ANALYSIS ........................................................ 126
A5. LINEAR REGRESSION .............................................................. 127
A6. THE CHI-SQUARED TEST ......................................................... 131
A7. CHOOSING THE RIGHT STATISTICAL TEST .............................. 134
A8. MEDIA RECIPES ...................................................................... 135

REFERENCES ................................................................................. 137

Chapter 1
Introduction
AN AESTHETIC EXPLORATION OF MICROBIAL
ECOLOGY
Much of the time when we talk about bacteria, we talk about how they
behave in pure cultures, or in conspicuous single-organism infections. For
instance, we might talk about what an Escherichia coli growth curve looks
like, or what a patient's prognosis is during a Clostridium tetani infection.
However, in the real world, bacteria live as members of communities
comprised of other bacteria, viruses, archaea, eukaryotic microbes, plants,
and animals. The behavior of organisms in complex communities is often
very different than their behavior in simpler laboratory environments, or in
"monocultures" like those experienced during active infections. This is
because in communities, organisms respond to each other's presence and
the effects that other species have on the environment.

MICROBIAL ECOLOGY

The study of microbes in their natural environments is called microbial

ecology and is an important facet in understanding how microbes fit into
our world. The activities of natural microbial communities control Earth's
atmosphere and climate, the growth of crops and other plants, the
productivity of the oceans, and can enhance or destroy the health of humans
and other animals. In this course, we will practice the basic skills of
microbiology while working to make new discoveries in microbial
ecology. Working in teams of 2 or 3 classmates, you will isolate unknown
bacteria from environmental samples and use a combination of molecular
methods, biochemical tests, and artistic visualization to learn about the
ecologies of your organisms.

Microbial ecology has a long history, and a number of influential early

microbiologists such as Sergei Winogradsky and Martinus Beijerinck worked
with complex environmental samples. However, in the century following the
acceptance of the germ theory of disease (largely driven by the work of
Robert Koch and Louis Pasteur), most microbiological research was done on
pure cultures of organisms known to cause illness. This focus on pure
culture was partly historical -- it just happened to be the way that famous
scientists like Koch and Pasteur preferred to work -- but it was also
technological. Prior to the 1990s there simply weren't many good ways to

1
understand what was going on in complex microbial communities.
Winogradsky was able to detect certain metabolisms in mixed cultures -- for
instance, by observing the production of methane or hydrogen gas -- but he
was unable to determine which of the many microbes in his samples was
responsible. Microbiologists knew that complex communities were
responsible for many important environmental functions, and they suspected
that the complex "natural flora" of the human body was important for
human health, but they had very little success in understanding what these
mixed groups were doing metabolically. Therefore, they focused on what
they could study, which was pure cultures.

POLYMERASE CHAIN REACTION (PCR) AND THE

MICROBIOME

This all changed in the 1990s, when the development of the polymerase
chain reaction (PCR), DNA sequencing technology, and the unraveling of
the structure of the ribosome yielded a new way to study microbes. Different
species of microbes can be identified by the unique DNA "barcodes"
contained in their ribosomal RNA gene sequences, and these barcodes can
be detected in complex natural samples and used to determine "who's there"
and in some cases also "what they are doing". The efficiency of DNA
sequencing has improved exponentially since the adoption of "next
generation" sequencing technologies in about 2006, and now scientists are
able to routinely count millions of individual cells of all species in natural
communities. The science of molecular microbial ecology remains in its
infancy, but it has already revolutionized our understanding of the human
microbiome and its role in both health and disease. It is certain that these
new technologies will filter down into patient-level medical practice in the
near future, and as a consequence tomorrow's medical professionals will
have a need to understand ecological principles their predecessors were able
to ignore.

PETRI DISH ART AND SCIENTIFIC INQUIRY

In this course, you will use a combination of pure culture and simple mixed-
culture methods to learn something about the ecologies of bacteria that
have been freshly isolated from natural samples. Based on their
identification barcodes and a suite of experiments related to their metabolic
and physiological abilities, you will construct a hypothesis about the
ecological roles of your isolates, and then you will test this hypothesis using
experiments of your own design. Your reports, your data, and your
isolates will be available for future research by other students
and/or professional scientists. Our goal here is to learn something both
new and interesting about your samples, and your ultimate goal should be to

2
generate at least one dataset of professional, publishable quality.
There is a non-zero possibility that the work you generate in this course
could lead to a professional publication, with you and your teammates as co-
authors!

“The work you generate in this course could

lead to professional publication.”
In addition to standard pure-culture experiments, you will also be
undertaking an unusual activity: painting with bacteria. Many bacteria
produce exotic shapes and colors when growing in petri dishes, and you will
use this fact to create living artworks based on your own personal designs.
These paintings are simple mixed-culture experiments and you will
use them to provide ecological depth to the observations you make in your
pure-culture experiments. It's also like painting with invisible ink, so have
fun, be creative, and worry about the science part later!

This course is going to be a lot different than other laboratory courses you've
taken. There are no pre-planned demonstrations; everything you are going
to do is new research. Nobody knows the answers; not you, not your TAs,
not your professors. Some things will be easy, others will be frustrating and
require you to troubleshoot and "think outside of the box" to figure out
solutions. There's no way to get data from other people or "coast" through
difficult problems -- you have to get results to get credit for this
course. Sure, it sounds a little intimidating, but we're all here to help each
other out, and at least it will be interesting!

One key to success (and low stress) in this course is to keep a firm eye on
where each day's work falls in the "grand scheme" of the semester. The
flow chart in Figure 1.1 shows how the different chapters in this lab manual
fit together. There are 5 worksheets that you will turn in: each of these will
ask you to summarize and explain several experiments in a way that begins
to tell a “story” about your microbes. Each worksheet will also give you
some practice writing like a professional scientist. All of this will lead up to a
final report that will be entirely based on your own work. You’ll take the
observations from the semester and synthesize them into a novel hypothesis
about your microbes and how they interact with their environment and each
other – and you’ll actually do the experiments to test this hypothesis,
possibly making discoveries entirely new to science.

The point of this course is to let you experience what it's like to do "real
science", and to learn some microbiology in the process. Stay focused on
the central goals -- developing real world skills and creating new knowledge
about the natural world -- and try to enjoy yourself!

3
Figure 1.1. Outline for the reports and techniques you will be doing in the
Biology of Microorganisms Laboratory class.

4
Chapter 2
BIOSAFETY

5
AMERICAN SOCIETY FOR MICROBIOLOGY

Guidelines for
Biosafety in
Teaching
Laboratories

2012

6
 CONTRIBUTING AUTHORS

ASM Task Committee on Laboratory Biosafety

Elizabeth A. B. Emmert, Chair Diane Hartman Ex Officio
Department of Biological Department of Biology
Sciences Baylor University Ron Atlas, Co-Chair, ASM
Salisbury University Committee on Biodefense,
Amy White Public and Scientific Affairs
Jeffrey Byrd Department of Biology University of Louisville
Department of Biology Virginia Western Community
St. Mary's College of Maryland College Neil Baker, Chair, ASM
Education Board
Ruth A. Gyure The Ohio State University
Department of Biological and (Professor Emeritus)
Environmental Sciences
Western Connecticut State Amy Chang, Director, ASM
University Education

Ad Hoc Reviewers
Cristina Bressler Gary E. Kaiser Susan Merkel
Centers for Disease Control The Community College of Cornell University
and Prevention Baltimore County
Melanie Popa
Diane O. Fleming Sue Katz University of Pittsburgh
Biological Safety Professions Roger State University
Robert J. Wolff
Roxana B. Hughes Donald Lehman South University
University of North Texas University of Delaware
Christopher Woolverton
Kai Hung Tracey Meilander Kent State University
Eastern Illinois University Notre Dame College

Michael J. Imperiale Paul Meechan

University of Michigan Centers for Disease Control
and Prevention

© 2012
American Society for Microbiology

7
Biosafety level 2 (BSL2) guidelines for teaching laboratories.

Preamble: Educators need to be aware of the risks inherent in using microorganisms in the laboratory
and must use best practices to minimize the risk to themselves, students, and the community. The
following guidelines are designed to encourage awareness of the risks, uniformity in best teaching
practices, and safety of the students. These guidelines are not mandatory, but are designed to promote
best practices in the teaching laboratory. Use of organisms that require BSL2 facilities is not
recommended for typical K-12 settings unless these facilities are available. BSL2 is suitable for
organisms that pose moderate individual risk and low community risk for infection. When good
microbiological techniques are used, these organisms rarely cause serious disease, and effective
treatment for laboratory-acquired infections is available. Best practices must be adopted to minimize the
risk of laboratory-acquired infections and to train students in the proper handling of organisms that require
BSL2 procedures. Students should always demonstrate proficiency in laboratory techniques using
organisms that require BSL1 practices before being allowed to handle organisms that require BSL2
practices. The practices set forth in these guidelines fall into six major categories: personal protection,
laboratory physical space, stock cultures, standard laboratory practices, training, and documents. For
ease of use, the requirements and practices are brief. Explanatory notes, sample documents, and
additional resources can be found in the appendix.

Personal Protection Requirements

 Wear safety goggles or safety glasses for normal laboratory procedures involving liquid cultures that do not
generate a splash hazard (e.g., proper pipetting, spread plates, etc.). Use safety goggles and face shields
or safety goggles and masks when performing procedures that may create a splash hazard. If work is
performed in a biological safety cabinet, goggles and face shields/masks do not need to be worn.
 Wear closed-toe shoes that cover the top of the foot.
 Wear gloves when handling microorganisms or hazardous chemicals.
 Wear laboratory coats.

Laboratory Physical Space Requirements

 Require all laboratory space to include:
o Nonporous floor, bench tops, chairs, and stools.
o Sink for hand washing.
o Eyewash station.
o Lockable door to the room.
 Follow proper pest control practices.
 Keep the storage area for personal belongings separate from work area.
 Keep a working and validated autoclave in the building or arrange for licensed waste removal
according to local, state, and federal regulations..
 Post biohazard signage
o wherever cultures are used and stored.
o on the door to the room.
o on any containers used to transport cultures.
 Recommended: Have a biological safety cabinet. The biological safety cabinet is required when large
volumes of culture are used or when a procedure will create aerosols.

Stock Culture Requirements

 Only use cultures from authorized, commercial, or reputable sources (e.g., an academic laboratory or
state health department). Maintain documents about stock organisms, sources, and handling of stock
cultures.
 Obtain fresh stock cultures of microorganisms annually (e.g., purchased, revived from frozen stock
cultures, etc.) to be certain of the source culture, minimize spontaneous mutations, and reduce
contamination.
 Keep stock cultures in a secure area.

Standard Laboratory Practices

 Wash hands after entering and before exiting the laboratory.
 Tie back long hair.
 Do not wear dangling jewelry.

Guidelines for Biosafety in Teaching Laboratories Page 3

8
 Disinfect bench before and after the laboratory session with a disinfectant known to kill the organisms
handled.
 Use disinfectants according to manufacturer instructions.
 Do not bring food, gum, drinks (including water), or water bottles into the laboratory.
 Do not touch the face, apply cosmetics, adjust contact lenses, or bite nails.
 Do not handle personal items (cosmetics, cell phones, calculators, pens, pencils, etc.) while in the
laboratory.
 Do not mouth pipette.
 Label all containers clearly.
 Keep door closed while the laboratory is in session. Laboratory director or instructor approves all
personnel entering the laboratory.
 Minimize the use of sharps. Use needles and scalpels according to appropriate guidelines and
precautions.
 Use proper transport vessels (test tube racks) for moving cultures in the laboratory and store vessels
containing cultures in a leak-proof container when work with them is complete.
 Use leak-proof containers for storage and transport of infectious materials.
 Use microincinerators or disposable loops rather than Bunsen burners.
 Arrange for proper (safe) decontamination and disposal of contaminated material (e.g., in a properly
maintained and validated autoclave) or arrange for licensed waste removal according to local, state,
and federal regulations.
 Do not handle broken glass with fingers; use a dustpan and broom.
 Notify instructor of all spills or injuries.
 Document all injuries according to university or college policy.
 Keep note-taking and discussion practices separate from work with hazardous or infectious material.
 Use only institution-provided marking pens and writing instruments.
 Teach, practice, and enforce the proper wearing and use of gloves.
 Advise immune-compromised students (including those who are pregnant or may become pregnant)
and students living with or caring for an immune-compromised individual to consult physicians to
determine the appropriate level of participation in the laboratory.

Training Practices
 Be aware that student assistants may be employees of the institution and subject to OSHA, state,
and/or institutional regulations.
 Conduct extensive initial training for instructors and student assistants to cover the safety hazards of
each laboratory. The institution’s biosafety officer or microbiologist in charge of the laboratories should
conduct the training.
 Conduct training for instructors whenever a new procedural change is required.
 Conduct training for student assistants annually.
 Require students and instructors to handle microorganisms safely and responsibly.
 Require students to demonstrate competency at BSL1 before working in a BSL2 laboratory.
 Inform students of safety precautions relevant to each exercise before beginning the exercise.
 Emphasize to students the importance of reporting accidental spills and exposures.

Document Practices
 Require students to sign safety agreements explaining that they have been informed about safety
precautions and the hazardous nature of the organisms they will handle throughout the course.
 Maintain student-signed safety agreements at the institution.
 Prepare, maintain, and post proper signage.
 Document all injuries and spills; follow university policy, if available.
 Make Material Safety Data Sheets (MSDS) available at all times; follow institutional documentation
guidelines regarding number of copies, availability via print or electronic form, etc.
 Post emergency procedures and updated contact information in the laboratory.
 Maintain and make available (e.g., in a syllabus, in a laboratory manual, or online) to all students a list
of all cultures (and their sources) used in the course.
 Keep a biosafety manual specific to the laboratory and/or course in the laboratory.
 Keep a copy of the current version of Biosafety in Microbiological and Biomedical Laboratories (BMBL)
in the laboratory.

Guidelines for Biosafety in Teaching Laboratories Page 4

9
Chapter 3
TOOLS OF THE TRADE

Microbiologists use a number of specialized tools to do their work. Probably

the first one you think about is the microscope -- but, perhaps surprisingly,
it doesn't play a big role in day-to-day microbiology. We'll be using
microscopes later on in this course, but in this exercise we will be learning
about the tools we use to manipulate bacterial cultures. We will also learn
perhaps the most important lesson of all -- how to perform aseptic
technique, or how to work with bacteria without either contaminating your
cultures or exposing yourself to the organisms.

First, lets look at the different tools.

a) Autoclave. Most of the special

techniques used by microbiologists
involve trying to create pure
cultures of microbes -- or at least
cultures where the only microbes
present are the ones we want to
study. This is always a problem
because there are microbes
everywhere in the world, on every
surface as well as floating around
in the air. The first trick to
working with pure cultures is to
start with sterile conditions --
media (the stuff we grow bacteria
in) and glassware where all the
microbes have been killed, and
that have been sealed up to
prevent new bacteria from getting
in. The primary way we sterilize
things is with the autoclave, which
is essentially a big pressure
cooker. By using steam under
pressure, the autoclave can kill
every microbe -- including their Figure 3.1 An Autoclave.
resistant spores -- leaving media
and glassware sterile.

10
b) Broth culture media. One of the two major types of bacterial growth
medium is the broth culture. Broth media are basically water with
various dissolved nutrients that bacteria can use. Broth media is usually
autoclaved in 1L or larger bottles and then distributed to empty test tubes
that were autoclaved separately.

c) Agar plates. The other major kind of medium is the agar plate (Fig
3.2). Plates and broth are pretty much the same, except that plates are
solidified using agar agar, which is an extract from red algal seaweeds
from the genus Gelidium. To make plates, you first mix up a batch of
broth medium, and then add some amount of granulated agar (usually to
1.5% concentration). The agar doesn't dissolve until the medium goes
through the autoclave, where the heat melts it. After autoclaving, the hot
agar is poured into pre-sterilized plastic petri dishes, where it solidifies
when it cools to about 40º C.

d) Bunsen burner. When working on an open lab bench, microbiologists

use a Bunsen burner to stay clean (Fig. 3.2). It serves two purposes.
First, you can use it to sterilize spreaders and loops (see below) by
directly heating them. Second, it creates convective air currents that
keep dust (and microbes) from settling on anything near the flame, giving
you a "force field" around your work area.

e) Inoculating loop. This is a thin piece of wire filament on the end of a

heat-shielded handle, twisted around into a small loop at the "business
end" (Figure 3.2). The wire can be rapidly heated red-hot in the Bunsen
burner flame, completely sterilizing it. It can then be used to collect and
transfer bacteria from one culture to another. There are a number of
similar tools, including inoculating needles (like a loop but without the
loop) and sterilized wooden dowels or toothpicks.

f) Cell spreader. This bent glass rod -- often called a "hockey stick"
because of its shape (Figure 3.2) -- is used to spread bacteria across the
surface of an agar plate. It is first dipped in ethanol, which is then lit on
fire in the Bunsen burner to kill off any microbes.

g) Disinfectant. Always keep a spray bottle of disinfectant around. You

should wipe down your work bench before and after every work session,
and you can also use the disinfectant to take care of small culture spills.
Common disinfectants include ethanol and quaternary ammonium
compounds.

h) Micropipette. This device (Figure 3.2) is used for moving small, very
precise volumes of fluid around. Usually, they move "microliters" of fluid

11
 -- one microliter (µL) is 1/1,000,000 of a liter, or a 1/1000 of a milliliter,
so 1000 µL = 1 mL. The micropipette uses disposable plastic tips that are
autoclaved in sealed boxes, preventing cross-contamination between
samples as well as contamination from the environment. You will use
three types of micropipette in this class -- the P1000, P200, and P20.
They differ in the range of volumes they can move.

i) Vortex mixer. This device is used to rapidly and thoroughly mix the
contents of a test tube. You just gently press the bottom of a test tub
into it and it shakes it in tight circles, creating a spinning vortex that
quickly mixes up the contents.

OK, that's who the players are. Now let's see how they work.

Figure 3.2. A typical workspace setup. From left to right: Bunsen

burner, agar plate, box of micropipette tips, inoculating loop, P200
micropipette, and a beaker of ethanol containing a cell spreader.

12
Exercise A.
PIPETTING (WITH A SIDE OF STATISTICS)
The micropipette has four important parts. The sterile disposable tip is the
only part that actually comes into contact with a sample. The plunger is
how you make it pick stuff up into the tip and push it back out again -- push
the plunger down to expel the contents of the tip, and release the plunger to
pull stuff up into the tip. The micrometer shows you how many microliters
the micropipette is set to pick up when you release the plunger; you can
change the setting by turning the plunger. Finally, the ejector lets you get
rid of a disposable tip when you're done with it.

Some things to keep in mind:

1. The plunger has two different down positions -- if you push it down,
you can feel the first "stop" as a small amount of resistance just before
the plunger is pushed all the way down. When you go to pick up
sample, only push the plunger down to that first "stop". When
you push out sample, go down to the second "stop" in order to get
all of the sample out.
2. There are three different types of micropipette that have different
ranges of volumes they can work with. On or near the plunger, there
should be a label showing the range of volumes that particular
micropipette can handle. DO NOT EVER TRY TO SET THE
MICROMETER OUTSIDE OF THIS RANGE! For instance, if the label
says "20-200 µL", never set the micrometer to less than 20 or more
than 200. If you do, you can break the pipet, and they cost several
hundred dollars to replace.
3. Micropipettes designed for smaller volumes often have micrometers
that have resolution to the first or second decimal point. Values after
the decimal point are usually shown in red numbers, or sometimes
there is a black bar where the decimal point should be.
4. Don't push the plunger down too fast -- if you do you could
"aerosolize" your sample, splashing droplets of it up into the air and
potentially contaminating other samples or even your own body.
5. The vortex mixer is another major potential source of spills and
aerosolized particles. Before using it, make sure that the cap of your
test tube is securely fastened. Remember, if you make a spill, tell
your TA immediately.

13
Basic micropipette procedure to move liquid from one solution to another:

1. Set the micrometer to the volume you intend to move.

2. Seat a fresh, sterile tip on the end of your pipette.
3. Push the plunger down to the first stop.
4. Insert the tip just beneath the surface of the fluid you want to
move.
5. Slowly release the plunger. Keep your eye on the sample to make
sure it is collected into the tip without any air bubbles.
6. Insert the tip just above the surface of the fluid you want to pipet
into.
7. Slowly push the plunger down to the second stop. Keeping the
plunger pushed down all the way, remove the tip from the fluid.
8. Eject the used tip into a waste container.
9. Use the vortex mixer to mix the contents of the tube you just added
liquid to.

We will be using micropipettes A LOT in this course, so let's get comfortable

with them early on. We will also be doing a good bit of statistical analysis of
real data, which students often get really anxious about, so let's go ahead
and get some of that out of the way early on as well. Here, you will practice
using your micropipettes, and you will use a very basic statistical method
called a t-test (Appendix 3) to see how good you are with the micropipette,
and to try to determine if two solutions are actually different from each
other. Check out this video for some useful pointers for this procedure:
https://www.youtube.com/watch?v=REViP2qinqQ&list=PLqTuWB3uliCzKB5aEaTePYq2ZL7E7tShu&index=2

YOUR TEAM NEEDS:

P1000, P200, and P20 micropipettes and tips

Vortex mixer
1 tube of 1% methylene blue
3 tubes of 10 mL water
2 tubes of "unknown solutions"
Mini-scale
1 weigh boat per team member
Dry erase board
Lab laptop computer

14
1. First, each team member should practice using a micropipette. One
team member should transfer 15 µL of methylene blue solution into a
tube of water using the P20 micropipette. Another team member
should transfer 150 µL of methylene blue to another water tube with
the P200, and the third member should place 750 µL of methylene
blue into water with the P1000. Use the vortex mixer to blend each
of the three tubes. Look at the four tubes and describe them to your
teammates -- they represent a dilution series of the blue liquid.
You will often make similar dilutions of bacterial cultures in this class.
2. Now, open Microsoft Excel on your laptop. One team member will
pipet while another records data.
3. Place a weigh boat onto the scale and hit the "Tare" button.
4. Pipet 200 µL of unknown solution 1 into the weigh boat and record the
mass.
5. Hit the tare button and repeat. Do this for 5 separate measurements.
6. Repeat for 5 measurements of unknown solution 2. Make sure to
record the measurements of the different solutions in different
columns.
7. Switch roles -- let the next team member do 5 replicate
measurements of each solution. If your team has three members,
make sure everyone does a set of measurements
8. Use the following video to help with the next three questions:
https://www.youtube.com/watch?v=xCYO1u7G6vQ&list=PLqTuWB3uli
CzKB5aEaTePYq2ZL7E7tShu&index=4. You will also find detailed
explanations in Appendix 2 and Appendix 3.
9. Use Excel to calculate the means and 95% confidence intervals of
your measurements for each solution (see Appendix 2). Compile all
the measurements of a solution together, regardless of who did the
pipetting.
10. Make a bar graph with error bars representing the data.
11. Write the “mean +/- 95% CI” for both samples on your dry erase
board. Also on your board, write your guess as to whether your two
unknown samples are the same or different.
12. Look at everybody's measurements. Which team has the most
precise pipetters?
13. Now use Excel to conduct an unpaired t-test (see Appendix 3) on
your two sets of measurements. Write the resulting p-value on your
dry erase board and explain to the class what your conclusion is
regarding your two samples.

15
Exercise B. ASEPTIC TECHNIQUE: Protecting your
cultures from you, and you from your cultures
Aseptic technique is the art and science of keeping microbes where you want
them. As a microbiologist, this is the most fundamental skill you have to
develop. However, it's relevant to many other professions as well. For
instance, as a health care professional, knowing how to avoid contaminating
samples -- or worse yet, patients -- is probably a good thing. Here we will
walk through the basics of setting up an aseptic work environment and
performing four common culturing procedures: i) inoculating (putting
bacteria into) a broth culture from a bacterial colony growing on an agar
plate, ii) inoculating a broth culture from another broth culture, iii) streaking
an agar plate to obtain isolated colonies, and iv) diluting a broth culture and
spreading it onto an agar plate to obtain isolated colonies.

YOUR TEAM NEEDS:

Disinfectant
P20 and P200 micropipettes and tips
Inoculating loop
Cell spreader
Beaker of ethanol
Vortex mixer
Overnight broth culture of Serratia marcescens
Streaked BHI plate of Serratia marcescens
Per team member:
2 tubes of BHI broth
4 BHI plates
3 x 9.9 mL saline dilution blanks

MAKE SURE EACH TEAM MEMBER PRACTICES EACH OF THESE

PROCEDURES!

DEMONSTRATION VIDEOS ARE AVAILABLE ON YOUTUBE FOR EACH

PROCEDURE:

Streaking plates:
https://www.youtube.com/watch?v=xGGmCWHIl84&list=PLqTuWB3uliCzKB5aEaTePYq2ZL7E7tShu&index=2&t=1s

Inoculating broths:

https://www.youtube.com/watch?v=x65q24VSW-g&list=PLqTuWB3uliCzKB5aEaTePYq2ZL7E7tShu&index=3

16
i. SETTING UP THE WORKSPACE: THE BASICS (see Figure 3.2)

a. Squirt some disinfectant across your work surface and wipe it down
with a paper towel.
b. Light your Bunsen burner. It should be on the side opposite your
primary hand. So, if you are right-handed, your burner should be on
the left side of your workspace. Note: the remaining instructions
assume you are right-handed; if you are left-handed switch everything
around.
c. Look at the flame -- imagine a magical bacteria-proof "force field"
radiating out from it about a foot in every direction. Keep anything
you want to be sterile within this force field.
d. If you have a paper protocol or a laptop you are working from, place it
well to the right and back of your workspace. Make sure it is not close
to the flame and not in a place where it will interfere with the
movement of your hands.
e. Arrange whatever tools you will need -- micropipette, inoculating loop,
cell spreader, etc. -- to the right of your workspace. Think about
setting a place at a table -- these are your fork and spoon.
f. If you are using ethanol, put it on the right side of your workspace,
behind the rest of your tools and well away from the flame.
g. If you are using a micropipette, make sure you've got a waste
container for spent tips.
h. If you need them, put your box of pipet tips directly in front of you,
just to the right of the flame. Never open the tip box unless it is close
to the flame -- within its "force field".
i. If you need one, put your vortex mixer to your right. You don't want
to have to reach over the flame to vortex a tube.
j. Put your "work" -- agar plates, test tube rack, or whatever -- directly
in front of you. Put it as close to the flame as you can comfortably
work. Never open a plate or a tube unless it is within the force field,
and never leave it open any longer than you have to.
k. Do your work.
l. When you're done, turn off the flame and wipe down the work surface
again with disinfectant.

17
ii. INOCULATING BROTH FROM A COLONY

a. Prepare a workspace with a loop and test tube rack as described

above.
b. You will need an agar plate with the bacterium you want to inoculate.
You can use any bacterial growth but it is best to start from an isolated
colony, because (theoretically) a colony grew from a single isolated
bacterial cell, so that you can be much more certain you're growing a
pure culture.
c. Place the agar plate in front of the burner, to the left of the rack of
tubes.
d. Loosen the cap of the test tube so that you can easily lift it off with
one hand. Don't open it yet.
e. Hold your inoculating loop near the end of the handle and hold it at a
45º downward angle over the burner, with as much of the wire as
possible in the flame. Hold it there until the loop is visibly red.
f. Remove the wire from the flame and count 10 seconds.
g. Moving quickly, lift up the lid of the petri dish with your left hand and
lightly touch the loop to a single bacterial colony. YOU DON'T NEED
MUCH MATERIAL so a light touch is sufficient.
h. Immediately after you have touched the colony with the loop, replace
the lid of the petri dish. NEVER LEAVE THE PLATE OPEN even within
the force field.
i. Grasp the cap of the tube between your middle and pointer fingers and
lift it off. Grab the tube with your thumb and remaining fingers and
pick it up.
j. CAREFULLY pass the mouth of the tube through the flame. Make sure
not to set yourself on fire!
k. Hold the tube at a 45º angle facing toward your right side. It should
be at about the same level as the flame and as close to the flame as
you can comfortably get.
l. Insert the loop into the liquid, jiggle it a little bit, and remove it.
m. Pass the mouth of the tube through the flame again and replace it in
the test tube rack. Put the cap back on as quickly as possible.
n. Flame the loop again. Place the tube into an appropriate incubator.

18
iii. INOCULATING A BROTH CULTURE FROM ANOTHER BROTH
CULTURE
a. Prepare a workspace as described above with a test tube rack, a box
of pipet tips, and a micropipette.
b. You will need two test tubes -- one with sterile broth and one with the
"parent" culture you want to use to inoculate the sterile broth. Loosen
both caps (but don't open either yet.
c. Set your micropipette to the volume you want to inoculate with. 100
µL is standard -- this is an approximately 100-fold dilution if you
inoculate 10 mL of sterile broth.
d. Open the box of tips -- make sure it's accessible and inside the force
field.
e. Flame the mouth of the parent culture tube as described above. Hold
the tube at a 45º angle near the flame.
f. Being careful not to move the tube, seat a fresh tip onto your
micropipette. Use the micropipette to collect the appropriate volume
of the parent culture.
g. Remove the micropipette from the parent culture tube and hold it at a
45º downward angle inside the force field while you flame and re-cap
the parent culture tube.
h. ALWAYS PAY ATTENTION TO WHAT YOUR OFF-HAND IS DOING! While
you're flaming the tube, be aware of where the micropipette is -- while
you're getting a fresh tip, be aware of where the test tube is.
i. Now open and flame the fresh tube, again being careful not to move
the micropipette tip outside of the force field.
j. Holding the fresh tube at a 45º angle, insert the micropipette just
beneath the level of the medium and inoculate the culture.
k. Flame and cap the fresh tube.
l. Eject the tip in to the waste container. Place the new tube into an
appropriate incubator.

19
iv. STREAKING AN AGAR PLATE FOR ISOLATED COLONIES.
a. Set up a workspace as described above. You will need a loop, a fresh
agar plate, and an agar plate or broth culture to inoculate from.
b. Using a sharpie, draw a capital "K" across the bottom of an agar plate.
NOTE -- all writing should be done on the BOTTOM of a petri dish -- the
part with the agar in it. It's possible to get lids switched up, but if the
labels are on the bottom they will always be in the same place as the
bacteria they represent.
c. Put the fresh plate directly in front of you and the parent culture to your
left directly in front of the flame.
d. Flame your loop as described above.
e. If you are inoculating from an agar plate, collect some material from a
colony as described above.
f. If you are inoculating from a broth culture, open and flame the tube, hold
it at a 45º angle, and insert your loop just below the surface of the
culture. Flame and cap the tube, and put it back in the rack.
g. Turn the fresh plate over. You should still be able to see the "K" through
the agar -- turn it so the "K" is right-side-up.
h. Making sure it's in the force field, remove the lid from the fresh plate and
place it to the left of the burner -- inside the force field -- face down.
i. Pick up the plate and hold it facing toward you near the flame. With your
loop, "color in" or "streak" the box to the left of the "K".
j. Flame the loop and let it cool for 10 seconds.
k. Set the plate down and rotate it about 45º. Pick it back up and trace the
loop lightly and ONLY ONCE through the first streak, to the right and into
the box formed at the top of the "K". "Color in" this box as well.
l. Flame the loop again and repeat the last step, streaking from the top of
the "K" into the box to the right of the K.
m. Flame the loop one more time and streak from the right of the K into the
box at the bottom of the K.
n. Flame the loop once more and set it down. Put the lid back on the fresh
agar plate.
o. Invert the plate by placing it lid-side down inside an appropriate
incubator. Unless otherwise noted, agar plates should always be
incubated inverted. This way, if condensation forms (as it often does), it
will collect in the lid instead of on the surface of the agar where it would
distort the growth of colonies.

20
v. SPREAD PLATING FOR ISOLATED COLONIES

This is perhaps the most challenging technique. Sometimes called "viable

count plating", the goal is to take a dense broth culture of bacteria and
dilute it until you reach a point where only a few cells per milliliter are left.
Then, when you spread that dilute culture across an agar plate, only
individual colonies form. If you count those colonies, as long as you know
exactly how you diluted the original culture, you can back-calculate how
dense the cells were in the original culture (see Appendix 1) -- or how many
"Colony Forming Units" or "CFUs" were in every milliliter of the original
culture.

In this exercise, we are going to perform a viable count on a dense

overnight culture of Serratia marcescens. As a rule of thumb, if a
bacterial culture is so dense you can't see light through it anymore,
it has somewhere between 108 and 1010 CFU/mL.

a. Set up a workspace as described above with a P200 and a P20

micropipette, a box of tips for each, a cell spreader, a beaker of ethanol,
a test tube rack with your parent culture and three 9.9 mL tubes of sterile
saline ("dilution blanks"), and three fresh agar plates. Label the plates 1,
2, and 3.
b. Start with the rack of tubes directly in front of you. Position them left to
right, with the parent tube on the left. Loosen all the caps. Position and
open the box of P200 tips.
c. Using your micropipette as you would to inoculate a fresh broth culture
(see above), transfer 100 µL from the parent culture into the first dilution
blank. Close the blank well and vortex to mix.
d. Repeat, transferring 100 µL from the first blank into the second blank.
Again, vortex.
e. Repeat one last time, transferring 100 µL from the second blank into the
third. Vortex.
f. Move the rack of tubes to the left, in front of the burner. Place the agar
plate labeled 3 in front of you. Exchange the P200 tips for P20 tips.
g. Use the P20 micropipette to collect 10 µL from the third dilution blank
using proper aseptic technique.
h. Carefully lift the lid of plate #3. Lightly touch the pipet tip to the surface
of the agar at an angle and slowly push the plunger down, leaving the 10
µL in the middle of the plate. DO NOT go down to the second plunger
"stop", as this would disrupt the droplet of media on the agar surface.

21
i. Replace the petri dish lid and put down your micropipette. Insert the cell
spreader into the beaker of ethanol and then place it at a 45º downward
angle into the flame just long enough to ignite the ethanol.
j. Let the ethanol burn off and let the spreader cool for a count of ten.
k. Lift off the agar plate lid and set it aside, face down, inside the force field.
Touch the cell spreader to the droplet of liquid in the center of the plate
and slide the spreader back and forth. While doing this, use your left
hand to rotate the plate. Try to cover the entire surface of the plate with
the cell spreader.
l. Replace the petri dish lid and put the spreader back in the ethanol
beaker.
m. Repeat steps h-l, but this time using 100 µL from the third dilution blank
on plate #2.
n. Repeat steps h-l, using 10 µL from the second dilution blank on plate #1.
o. Invert the plates as described above and place them in the appropriate
incubator.
p. After the plates have grown, have a look at them. At least one of them
will have an undifferentiated mass of bacterial growth -- called a lawn --
which is not useful to us because it doesn't have individual colonies.
Discard any such plates. It is possible that one plate will also have very
few colonies; discard this one as well. Select only ONE plate of the three,
ideally with between 50-300 colonies. Count these colonies by marking
each with a sharpie while keeping count on a handheld "clicker".
q. Using the instructions in Appendix 1, determine the dilution factor of the
plate you counted, and calculate the CFU/mL in the original culture. This
is the viable count of that culture.

22
WASTE MANAGEMENT

Because we are working with potential hazardous microbes in this lab, it is

important that we dispose of all waste materials appropriately.

1. FIRST, nothing that comes into contact with microbes can leave the lab
without being properly sanitized. This is why you are not allowed to use
your phones or your own computers in lab, and why your lab coat and
glasses have to stay in this room until they can be autoclaved at the end
of the semester.
2. Any disposable plastic waste products that have touched microbes -- used
petri dishes, plastic culture tubes, old tips, etc -- should be placed in one
of the biohazard bags distributed around the lab. These will be sent off-
site for incineration.
3. Any reusable glassware that has touched microbes must be autoclaved
prior to re-use. Your TA will designate an area in each class session
where these items should go.
4. Any disposable or broken glassware -- for instance, microscope slides --
must be sanitized and disposed of separately. Again, your TA will
designate waste containers for this type of item.

If you are in doubt about what to do with any waste item, ask your TA!

23
CHAPTER 4
BACTERIAL ISOLATION

Part A. SOIL COLLECTION

UNEARTHING THE MICROBES IN YOUR
COMMUNITY
You will learn how to sample microbial soil communities from
dynamic ecosystems for isolation. You will begin to understand that
microbes fill many different niches in different ecosystems.
Soil is the organic and inorganic material on Earth’s surface. Microorganisms are
abundant in soil -- in fact there are often more
microbes in a teaspoon of soil than there are
people on Earth. Sampling near a plant will
include microbes that have important
ecological interactions with plants, including
both beneficial symbionts and pathogens. A
sample taken from a small distance away from
the base of the plant will likely have more
diverse microbes because there are more
different kinds of microbial interactions taking
place near farther, younger roots. Leaf litter
(plant matter that has yet to decay) is called
the O horizon. Your sample will come from the
layer below leaf litter where plants grow called the A horizon. The A horizon is
surface soil that is rich with organic compounds. The layer below is the B horizon,
which is full of accumulated minerals. Seated under these minerals is soil forming
bedrock, or the C horizon. The C horizon helps create the hard bedrock below, or
the R layer.

YOUR TEAM WILL NEED

• Soil Collection Kit (sharpie, 1 Ziploc bag,

gloves, 1 trowel)
• Temperature gun
• (Smartphone) camera
• pH probe

24
DIRECTIONS

1. Find a sample site with your teammates.

2. Draw a map in your lab notebook showing where your sample site is.
Also, take a picture of the site, making sure to show the plants growing
nearby.
3. One partner will wear gloves and wipe away leaf litter. With a trowel,
someone should dig into the soil site no more than 6 inches (about the
length of your hand) down into the soil. Another will put a fist-sized
sample of soil into the Ziploc bag. You should avoid surface litter, big
rocks, and visible animals as much as possible. Label the bag with your
names and the date.
4. Measure the temperature and pH at the direct center of your collection
site with the temperature gun and pH probe.
5. Put all used materials aside and cover the area back with leaf litter. Take
your gloves off and bring all materials with you back to the lab.

PART B. DILUTION AND SPREAD

PLATING
Here, you will obtain pure cultures of environmental microbes in order to better
understand their physiology and ecology. The first step in culturing microbes from
environmental samples is to dilute the microbial soil communities in order to get
isolated colonies (each of which arises from a single bacterium).

YOUR TEAM WILL NEED

• Soil sample
• 10mL sterile saline in 15mL Falcon Tube
• (3) 9.9mL saline DTs
• Sharpie
• 10mL pipette and P200 pipette with tips
• (8) R2A plates and (8) BHI plates, both with cycloheximide
• Hockey stick spreader
• 95% ethanol in a beaker

25
DIRECTIONS:
1. Transfer your soil to a tube using the following methods:
a. Label a 15mL Falcon tube with your team's name.
b. Place approximately 1g (roughly the size of a Hershey kiss) of the bagged
soil into the Falcon tube.
c. Pipette sterile saline into the Falcon tube to the 10 mL mark.
d. Vortex the Falcon tube at medium speed for one minute.

2. Wait for the soil to settle (this takes a few minutes).

3. Dilute your soil suspension using the following methods
a. Label three 9.9mL saline blanks “DT 1”, "DT 2", and "DT 3".
b. Aseptically, transfer 100uL of soil suspension into DT 1 and mix by briefly
vortexing.
c. Aseptically, transfer 100uL from DT 1 into DT 2 and mix by briefly vortexing.
d. Aseptically, transfer 100uL from DT 2 into DT 3 and vortex DT 3.
5. You should now have 3 finished DTs + your soil collection Falcon tube. Put your
bagged soil in a dark area at room temperature.

At this stage you will use the spread plate method to grow your dilutions on
agar media. You will use different media and different cultivation
temperatures in order to isolate a wider variety of bacteria with a wider
assortment of metabolic attributes. R2A is a relatively low-nutrient medium
that contains yeast extract (amino acids, vitamins, coenzymes, growth
factors, trace minerals), peptone (nitrogen, sulfur, carbon, energy), and has
other organic compounds that help organisms with specific nutritional
requirements grow (Casamino acids, glucose, pyruvate). BHI (brain-heart
infusion) is a much simpler, high-nutrient medium that contains meat
extracts. Both types of media also contain the antibiotic cycloheximide
which kills fungi, greatly increasing the chances that you will isolate bacteria
and not pesky eukaryotes.

SAFETY NOTICE: YOU ARE ALSO A EUKARYOTE, so cycloheximide is

just as toxic to you as it is to soil fungi! Exercise caution when
working with these plates, and always wear gloves.

26
1. Label the bottom (media side) of an R2A plate with
“20 uL DT 1 RT” and your initials. "RT" stands for
"room temperature"

2. Aseptically transfer 20 uL from DT 1 to the center of

the R2A plate and spread using a flame-sterilized
spreader.

3. Invert the plate and set it aside.

4. Label the bottom of additional R2A plates with “200uL

DT 1 RT”, "20 µL DT 2 RT", and "200 µL DT 2 RT" and
your initials. Repeat steps 2 through 6 for each of
these plates, using the appropriate DT and plating
volume for each.

5. Now repeat with the same volumes and DTs for 4 BHI
plates.

6. Repeat these steps for the remaining R2A and

nutrient agar plates, replacing "RT" with "37C".

7. Place all 8 RT plates inverted in the dark at room

temperature. Place all 37C plates in the 37C
incubator. Let them all incubate INVERTED (lid down)
for at least 48 hours. Clean up your area as per your
TA's instruction.

27
PART C. SOIL CHARACTERIZATION
At this stage you will also measure key chemical parameters of the soil
environment. Organic matter and fertilizers are rich in Nitrogen, Phosphorus, and
Potassium (“N-P-K”) which are important for plant growth, and natural soils have
widely varying levels of these key elements. Soil pH affects how easily surrounding
plants take up nutrients from the soil and also has major effects on how microbes
get energy and nutrients from their environment.

You will also quantify the moisture and organic matter content of the soil using a
method called “Ash-Free Dry Mass”. Here, you will weigh a soil sample while it is
fresh, after it has been heated to 100C overnight to remove all water, and again
after it has been “ashed” at 400C to oxidize all organic carbon to CO2. Differing
levels of water and organic matter content favor different kinds of microbial
activity.

YOUR TEAM WILL NEED

• Soil sample
• 4 sterile saline dilution blanks
• N, P, K, and pH soil test reagent capsules
• N, P, K, and pH result color guides
• Foil packet
• Scale
• Sharpie

DIRECTIONS:
1. For the NPK and pH samples, place approximately 1 g of soil into each of the 4
saline dilution blanks. Label the tubes “N”, “P”, “K”, and “pH”, and add the
contents of the appropriate test capsule to each.
2. Vortex the tubes on medium-high speed for 30 seconds each. Place in a test
tube rack and allow the soil to settle out.
3. Compare the color of the liquid after the soil has settled to the appropriate color
guide and record your conclusions in your lab notebook.
4. For Ash-free Dry Mass, carefully weigh your empty foil packet and record this
weight in your lab notebook.
5. Place about 10 g of soil into the packet (about the size of an Oreo cookie). Seal
the packet and carefully weigh it again.
6. Label the packet by using the sharpie cap to make an indention in the foil with a
number you will recognize later. Note: you can’t use ink to label, because it will
be destroyed by the ashing process!
7. Place the foil packet in the 100C drying oven overnight.

28
8. In the next lab session, re-weigh the packet and record the dry mass of the soil.
9. After lab, your TA will place your foil packet into a muffle furnace which will
heat the soil to approximately 400 C for at least 3 hours. At this temperature,
all organic matter is converted to CO2 and "cooked out" of the sample, leaving
behind only the inorganic (ash) portion of the soil.
10.In the next lab session, weigh the "ashed" packet and record this value in your
notebook.
11.Calculate the percent moisture as dry mass divided by fresh mass.
12.Calculate the percent organic content as ashed mass divided by dry mass.

Part D. CLONAL ISOLATION

CHOOSING YOUR BACTERIAL FRIENDS
You will observe your plates to see their phenotypic diversity and observe
patterns of microbial interaction. Based on your own aesthetic sensibilities,
you will select isolates to work with for the remainder of the semester.

We often think of bacteria as extremely simple organisms, and in some ways they
are. However, in other ways they are startlingly complex, and one of the ways this
complexity manifests is in the way they grow in biofilms that become visible to the
naked eye. Bacteria growing on agar surfaces can form many diverse colony
morphologies; exhibit "helping" and "harming" interactions with other colonies;
move around on the agar by swimming, sliding, or swarming; and make colorful
pigments that serve a variety of purposes.

Here, you will pick isolates to work with for the remainder of the semester. You will
make this selection based on your wild guess about which ones will be most fun to
study. Look for organisms doing strange things on the plates, or that make funny
shaped colonies. Definitely pick that funky pink thing that seems to have killed off
everything around it. Or the green colony that might have been swimming away
from the white cloudy patch. Anything that catches your eye probably did so for a
reason.

Of particular interest here are bacteria that make pigments, since one of the
activities we'll be doing is to make a painting with our isolates. Bacteria may create
pigments for a variety of reasons, such as phototsynthesis, UV protection, antibiotic
chemical warfare, storage of energy, stress resistance, virulence, and anti-freeze
protection. Keep in mind that they cannot see their pigmentation (i.e., they cannot
discern visual hues like our eyes can), and these pigments evolved long before
anything on Earth had eyes -- meaning that the production of their pigmentation
has evolved for non-visual purposes. Nevertheless, they look pretty neat to us, so if
you see something brightly colored, by all means, pick it!

29
YOUR TEAM WILL NEED

• (4) R2A or BHI plates

• 4 x 5 mL tubes of R2A or BHI broth
• Dilution plates
• Camera
• Colored pencils
• Inoculating loop
• Parafilm

DIRECTIONS

1. Observe your plates. First, identify plates where you can see isolated
colonies. There should be at least one from each of your 4 sets of plates.
In your notebook, sketch the overall plate, noting large-scale patterns
where different kinds of growth interact with each other.
2. Next, as a team choose four particularly interesting colonies and mark
their location on the back of the plate with a sharpie. Try to pick colonies
without thinking too much about their "scientific"
qualities -- just look for something weird, cool,
pretty, or otherwise interesting to you.
3. Draw each of these four colonies in greater detail.
Pay special attention to the edges of the colonies
and their 3D textures. Make notes of the color and
texture and label where each color came from (i.e.
“small goopy purple: DT 1 200µL BHI 37ºC”).
Small goopy purple
4. Now take photographs of the plates you sampled
from. Make sure you can associate each photograph DT 1 200uL BHI 37ºC
with the media type and temperature it was isolated
from.
5. Seal the plates with parafilm and store them in the
dark at room temperature alongside your soil sample.
6. Aseptically, use your inoculating loop to streak-isolate each of your
chosen colonies onto fresh R2A plates (or BHI if that is what you isolated
them from). Incubate your streak isolates at the same temperature that
their original plate was incubated at (write “RT” or “37ºC” on the
appropriate plates).
7. Also, use your loop to inoculate one tube of R2A/BHI broth for each
organism. Incubate these at the appropriate temperature as well.
8. In the following class, look at your clonally isolated bacteria and pick 2
that you like the most. While you should prioritize “cool looking”
microbes, make sure that the ones you pick grew well and appear to be
“manageable” experimentally. Make sure to note whether or not your
organisms grew well in the broth culture – some organisms don’t like

30
 growing in liquid culture because they are adapted so specifically to
biofilm conditions.
9. Name your two isolates and re-streak them onto fresh plates. Give them
fun names that you will remember. THESE ARE THE ISOLATES YOU
WILL WORK WITH FOR THE REST OF THE SEMESTER, so you're
going to need to be friendly with them!
10. Parafilm all four of the streak isolation plates and store them with
your soil plates and soil sample, just in case you need to go back to them
later in the semester.
11. Your TA will cryopreserve your broth cultures by mixing them with
glycerol (which prevents them from freezing solid) and placing them in a
-80º C freezer. This will allow us to bring them back to life to do more
experiments in the future if your work this semester discovers something
new.

Part E. MAINTAINING YOUR

ISOLATES
CARE AND FEEDING OF YOUR BACTERIAL
FRIENDS
YOUR TEAM WILL NEED

• (2) R2A/BHI plates

• 2 x 5 mL tubes of R2A/BHI broth
• Inoculating loop
• P200 pipette and tips
• Parafilm

DIRECTIONS

1. The following procedures need to be performed ONCE PER WEEK

throughout the semester in order to maintain your cultures.
2. Inspect the previous week’s broth and plate cultures of your isolates.
Compare them to your notes about how they are supposed to look, and
to the appearance of the previous week’s cultures. If they look at all
different, if you suspect contamination, or if they did not grow, tell your
TA immediately.

31
3. Otherwise, streak each of your isolates for isolation on fresh R2A or BHI
plates, and prepare new broth cultures by transferring 100 uL from the
old culture into fresh broth.
4. Dispose of the old broth cultures.
5. Parafilm the old plates. Dispose of the previous week’s streak plates and
store the newer ones with your soil samples.
6. Incubate your cultures at the temperature they were isolated from.
NOTE: after performing the Reaction Norms experiments later, you may
discover that your organisms actually “prefer” a different temperature or
medium than the one from which they were originally obtained. Always
keep them maintained in their OPTIMUM environment, regardless of how
they were isolated.

Note: in the subsequent experiments, team supply lists

often mention “R2A/BHI” plates or broth. Experiments
should be performed in the medium the organism grows
most reliably in. Instructors should keep a tally of how
many of each kind they need on a weekly basis and let
laboratory prep staff know.

32
LAB WORKSHEET #1
“Isolation”

Your first experiments found you isolating bacteria from soil and characterizing their natural
habitat. Use the data and observations you collected to complete this worksheet.

1. Provide a photograph of the environment surrounding the spot from which your soil was
sampled.

2. Describe the plant life nearby – is it mostly grass, bare soil, are their herbs or trees, is it
tended or long and wild, is it actively growing or dormant for the winter, etc.

3. What are the environmental characteristics of the soil environment from which you isolated
your organism? Give temperature, pH, NPK levels, moisture content, and organic carbon
content. For soils, moisture contents < 10% are low/dry and >40% are high/wet; for organic
matter, <5% is low/C-poor and >20% is high/C-rich.

4. Provide pictures of the agar plates from which you isolated your organisms. Circle the
colonies that were isolated. Indicate what type of medium and what temperature were used
for each.

5. Comment on the diversity of microbes you observed on each medium and at each incubation
temperature. Use the following rules of thumb:

Low Diversity 90% of colonies look the same

Medium Diversity One type of colony is 30%+ of the total
High Diversity No colony type is more than ~10% of the total

Do you think the medium/incubation conditions influenced the diversity of cultured

microbes? Why or why not?

6. Think about the colonies you isolated. Did you see colonies with similar appearances on
other plates? Were they only on one type of medium, or found at one of the temperatures?
Or were they found on most of the plates? State a hypothesis about at least one of your
isolates that seeks an explanation for the pattern you observed.

7. Assume that you are writing a paper that involves the work you did in Chapter 4. Write the
“Introduction” section for that paper.

33
Chapter 5
MICROBIAL GROWTH

MEASURING THE LIVES OF BACTERIA

In this chapter, you will learn how to use a spectrophotometer to
estimate cell density of bacterial cultures, how to use spread plates
to directly count bacteria in a culture, and how to use a “standard
curve” to relate one type of measurement to the other. You will also
use the growth rates of colonies on agar in different environments to
construct “reaction norms” that describe the “niches” that microbes
are adapted to live within.
Bacteria and mammals have very different modes of reproduction. Humans, for
instance, grow to adult size and then reproduce sporadically over several decades.
Bacteria, on the other hand, continually grow in size and periodically split in half
when they become large enough in a process called binary fission. If you were to
follow the fate of a single individual human and a single individual bacterium, these
differences would be very apparent. For example, the long maturation time for
humans means that reproduction is staggered into discrete generations, whereas
bacteria grow and divide at a steady rate. Despite these differences, though, if we
"zoom out" and look at millions of individuals at once, we see that both bacteria
and humans (and everything else that grows) have similar growth dynamics. When
resources are plentiful, population size increases exponentially. We can see this by
plotting the logarithm of population size vs. time, which is a straight line. When
resources start to dwindle, growth rate tapers off, eventually stagnating when
resources are exhausted.

When we grow microorganisms in batch cultures, we can see all of these

processes occurring (Fig. 5.1). When a culture is first inoculated, there is no
growth for a certain amount of time. This is because the organisms are
acclimating to their new environment by synthesizing new proteins. This period of
no growth is called lag phase. Eventually, the organisms start to divide by binary
fission. When they first start to do this, nutrients are plentiful and cells are few, so
each generation of fission depletes the nutrients by only a small amount. Thus,
over this time, the growth rate is fairly constant and the density of cells increases
exponentially with time. We call this exponential phase or sometimes log phase
because a plot of the logarithm of cell density vs. time is a straight line during this
phase (between points B and C in Fig 5.1).

34
As cells become more concentrated and nutrients start to dwindle, the growth rate
decreases, leading to a tapering-off of growth rate and eventually to a cessation of
growth. This starvation period is called stationary phase and can last for hours to
weeks depending on the type of bacteria and the medium in which they grow. After
some amount of time, the cells will start to die, leading to a death phase that is
initially rapid but, for many species, slows down after some period of time.
Following the death phase, some cells can remain alive for weeks, months, or even
years, and during this time a succession of mutants with a Growth Advantage in
Stationary Phase (GASP) phenotype periodically "bloom" and grow by cannibalizing
the cells that perished during the death phase.

There are several

different ways to
measure microbial
growth. Direct counts
actually look at
individual cells and are
usually the most
accurate measures of
growth. However,
direct counts either
require specialized,
expensive equipment
such as flow cytometers
or time-consuming,
Figure 5.1. Example of a batch culture growth curve. A, laborious microscopic
lag phase; B-C, log phase; D, stationary phase; E, counts. Therefore we
death phase; F, "GASP" phase usually use indirect
counts. The easiest
type of indirect count uses the optical density or cloudiness of a culture to
measure growth. The more bacteria there are in a liquid culture, the harder it is for
light to get through the liquid without being absorbed by a bacterial cell, so we can
use a spectrophotometer to measure the ability of a culture to absorb light to get
a relative measure of growth. We can also use other methods, like the size of
colonies on agar plates or the production of key, easily detected molecules such as
chlorophyll.

A somewhat more involved method for counting cells is the viable count method,
where we dilute and spread-plate a culture (similar to what we did with soil
suspensions back in Chapter 4). By counting the colonies on the spread plate and
back-calculating based on the dilution factor of the plate (see Appendix 1) we can
determine how many living cells (or clusters of cells in some cases) were present in
the undiluted culture. If we also took indirect measurements of the same cultures,
we can produce a standard curve for predicting actual cell counts from optical
density data (see Appendix 5).

35
EXPERIMENT A: GROWTH
MEASUREMENTS AND STANDARD
CURVES
YOUR TEAM WILL NEED

• Spectrophotometer
• 2 cuvettes
• Waste container
• R2A/BHI plates, 15
• 9.9mL sterile saline dilution tubes, 30
• P200 pipetters and tips
• Sterile 1 mL disposable transfer pipets
• Overnight cultures of your isolates in 3 mL R2A broth
• 3 mL R2A/BHI blank
• R2A/BHI dilution tubes (2 each): 4 mL, 5 mL, 6 mL, and 7 mL
• 5 mL serological pipettes (x2)
• Pipet bulbs
• Clicker
• Sharpie

DIRECTIONS (DAY 1):

1. Place 3 mL of sterile R2A/BHI broth into a cuvette. Record the optical

density at 660 nm. This is your blank.
2. As described in the table to the right, prepare a series of dilutions of each
of your unknowns in sterile broth. Tubes
with the indicated amount of broth have Dilution R2A Culture
been prepared for you. Vortex the 1/2 4 mL 4 mL
overnight cultures before making these 3/8 5 mL 3 mL
dilutions, and vortex the dilution tubes after 1/4 6 mL 2 mL
preparing them. 1/8 7 mL 1 mL
3. Using a clean 5 mL serological pipette, transfer 3 mL of the 1/8 dilution of
one of your isolates to a cuvette using a transfer pipette. Wipe down the
sides of the cuvette and measure optical density at 660 nm. Record this
value, then pour the culture into the waste container.
4. Repeat with another 3 mL of the same dilution. This is a technical
replicate which helps minimize the influence of measurement error on
your standard curve.
5. Measure the remaining dilutions of that isolate, moving to increasingly
less dilute cultures. Always record each dilution's optical density using

36
 two technical replicates (i.e., don't just read the same cuvette twice,
get two different 3 mL samples).
6. Dispose of the serological pipette in the biohazard waste.
7. Use a new clean serological pipette to repeat steps 3-6 with the second
isolate.
8. Pipet 100 µL of the original overnight culture as well as each diluted
culture (1/2 through 1/8, for each isolate) into a 9.9 mL dilution tube.
Vortex, then transfer 100 µL of this dilution tube to another 9.9 mL
dilution tube. Vortex, and repeat with a third tube. Vortex the last tube.
This should result in 5 sets of 3 tubes for each isolate.
9. Pipet 50 µL of the 3rd dilution tube, 5 µL of the 2nd dilution tube, and 50
µL of the 2nd dilution tube onto separate agar plates (make sure the
plates are properly labeled ahead of time). Spread with a flame-sterilized
cell spreader. Invert the plates and incubate at whatever temperature
you normally incubate your isolates until the next class period. This
should result in 15 plates.

DIRECTIONS (DAY 2):

1. Take your viable count plates from day 1. For each time point, only one
or two of the three will be countable, while the others will either be empty
or covered in an uncountable mess of colonies.
2. Count the colonies on the best plate only (i.e., one with between 20-300
clearly separated colonies). Use a sharpie to mark each colony as you
count it, and use a tally count "clicker" to keep up with the count. When
you are done, write the number of colonies you counted on the plate.
3. Repeat with the "best" plate for each dilution of each isolate. Record this
count, and the dilution factor of the plate (see Appendix 1 for how to
calculate this value), in your lab notebook next to the measurement of
OD from the culture the plate was made from.
4. Compute the viable concentration of bacteria in CFU/mL by dividing the
colony count by the dilution factor for each plate and record this value in
your lab notebook, again next to the original OD measurement and
colony count.
5. Make a plot in Excel of CFU/mL (Y-axis) vs. Optical Density (X-axis).
There should be a set of dilutions where this plot is a straight line -- use
ONLY THESE POINTS in step 7.
6. Use linear regression (Appendix 5) of CFU/mL (Y-axis) vs. Optical
Density (X-axis) for the points that are in a straight line in your plot to
create your standard curve. Write the slope and intercept of this
regression down in your lab notebook where you will be able to
find it later -- this will let you calculate CFU/mL based on a quick OD
measurement for future experiments.

37
EXPERIMENT B. REACTION NORMS
You will test your environmental isolates to try to estimate their
response curves to the key environmental parameters temperature,
pH, and salinity. Additionally, you will determine whether or not they
are able to grow in the absence of oxygen.

Microbes inhabit virtually every surface on earth. They can be found in brine
channels between ice crystals at the South Pole, growing (slowly) at
temperatures below -20º C in liquid 10 times saltier than the ocean and with
a pH as low as battery acid. Other microbes can be found at hydrothermal
vents, growing happily at temperatures greater than 120º C under millions
of pounds per square inch of pressure, eating methane and breathing iron.
Some microbes live deep beneath the earth, using radioactive decay as a
source of energy in isolated communities, and others have survived months
of exposure to the vacuum and radiation of outer space. Microbes also
flourish in between these extremes as well.

A variety of adaptations are available to microbes (and other types of

organisms) that allow growth in different environments. Some, like elevated
GC content in DNA as a response to high temperature or compatible solute
synthesis as a response to high salt, can fine-tune the cell to a particular
type of environmental condition and help to define the optimum condition
for the organism, or the environment where they are "happiest". Other
adaptations increase stress tolerance, thus helping organisms tolerate a
wider range of conditions. Together, these adaptations determine an
organism's reaction norm to changes in a given environmental parameter
(Fig. 5.2). The combination of Range
reaction norms to many different
Optimum
environmental parameters is a
major determinant of an
organism's fundamental niche,
or the range of environments
where an organism is capable of
growing. In practice, however,
there are many combinations of
parameters where any given
organism is capable of growth,
but does so at such low growth
rates that it will be outcompeted
by better adapted organisms,
limiting its realized niche. Figure 5.2. Reaction norm of an organism to
changes in temperature.

38
Additionally, you will be using an
anaerobe jar (Fig. 5.3) to see how
your isolates respond to changes in
oxygen levels. This device has an
airtight seal, allowing you to
manipulate the internal
atmosphere. In one jar, you will
include a packet containing a
palladium catalyst that, when
activated, will react with
atmospheric oxygen to convert it
into water, resulting in an anaerobic
environment inside the jar. In
another jar, you will place a small
candle that will burn until the
oxygen is very low, producing a
microaerophilic environment.

Additionally, you will put an

indicator strip into the anaerobic jar
that changes color based on the Figure 5.3. A GasPak Anaerobe Jar system. The
presence or absence of oxygen, packet releases H2 gas into the airtight jar, which
reacts with O2 in the presence of a palladium
which will let us know whether or catalyst to yield water, producing an anaerobic
not the packet was effective in environment.
eliminating oxygen from the jar.

YOUR TEAM WILL NEED

• Unknown isolates growing on R2A or BHI plates

• 2 plates each of R2A/BHI set to pH 3, pH 5, pH 7, and pH 9
• 2 R2A/BHI plates each at 0.5%, 3.5%, 10%, or 15% NaCl
concentration
• 20 R2A/BHI plates
• 2 1/10 R2A plates
• 2 R2A/BHI plates (whatever the opposite is of what is usually used)
• 2 Ziploc bags and parafilm
• Digital calipers
• Anaerobe jar (x2)
• GasPak
• Tealight candle

39
DIRECTIONS (DAY 1):
1. Label each pH plate with its pH value and one of your isolates’ names.
2. Label each NaCl plate with its NaCl concentration and one of your isolates’
names.
3. Label 2 R2A/BHI plates each either 4C, 15C, RT, 30C, 37C, 42C, or 55C and
one of your isolates’ names.
4. Label 2 R2A/BHI plates “Anaerobic” along with your isolates’ names. Label 2
other plates “Microaerophilic” along with your isolates’ names.
5. If you normally use R2A, label 2 BHI plates “High nutrient”. If you normally
use BHI, label two R2A plates “Med. Nutrient”. Label 2 1/10 R2A plates “Low
Nutrient”.
6. If you haven’t already re-streaked your isolates this week, do it now, and work
from the old plate today.
7. Streak each plate for isolated colonies using the appropriate organism. Be very
careful not to streak with too hot of a loop.
8. Incubate pH and salt plates at whatever temperature you normally incubate
your unknowns.
9. Place the anaerobe plates and microaerophilic plates in separate anaerobe jars
that will be incubated at an appropriate temperature. Your TA will prepare the
GasPak and candle for you.
10. Incubate temperature plates in the appropriate incubator. Plates to be
incubated at 42C or 55C must be wrapped in parafilm and sealed in Ziploc bags
to avoid drying out.

DIRECTIONS (DAYS 2-4):

11. During the following lab session, check the plates. Separate plates with visible
growth from those without, and return the plates without growth to the
appropriate incubator. Make sure that high temperature plates go back in their
Ziploc bags!
12. If you see evidence of contamination, or if a plate in the middle of a growth
series didn’t grow (e.g., 15C and 30C grew but RT didn’t), restreak a new plate
to replace the bad one(s).
13. For the plates with detectable growth, use your digital calipers to measure the
diameter of 10 colonies. Record these values in your notebook.
14. Make notes of any phenotypic differences you observe and then dispose of the
plates.
15. Repeat 10-13 in lab periods 3 and 4 for a total of 2 weeks of observations. If
no growth is observed on the 4th day of observation, record a value of “0” for
the plate.

40
ANALYSIS:

1. Transcribe your data into Excel in a spreadsheet with five columns: “Organism”,
“Condition”, “Days”, “Diameter”, and “Growth Rate”.
a. Each row in the spreadsheet will record ONE SINGLE COLONY
MEASUREMENT. You will have very many rows.
b. “Organism” is the name of the organism whose colony you measured.
c. You should have the following conditions: Temperature (4C, 15C, 23C, 30C,
37C, 42C, 55C), pH (3, 5, 7, 9), Salt (0, 0.5, 5, 10, 15), Oxygen (high, low,
none), and Nutrients (low, medium, high).
d. “Days” is the number of days between when you streaked the plate and
when you measured the colony. So if you streaked on Monday and
measured the following Monday, put “7” in the “Days” column.
e. “Diameter” is the measurement of ONE SINGLE COLONY. Thus, you should
have 10 rows for each condition.
f. Note that some different conditions are filled in using the same set of
measurements. For instance, if you normally incubate your organism on
BHI agar at 37C, then your “0 Salt” plate is the same as your 37C plate.
Make sure to fill in data for all conditions!
2. Calculate the growth rate in the last column as “Diameter” divided by “Days”.
The units for this growth rate are “mm per day”. Importantly, this is different
from the exponential growth rate you will learn to calculate in lecture, but it
is a useful, experimentally viable measurement for us to use here.
3. Calculate the MEAN and 95% Confidence Interval for each organism under
each condition (see Appendix 2).
4. Use your calculations to plot reaction norms for pH, salinity, and temperature
for each of your unknowns as bar graphs with error bars showing the 95%
Confidence Interval.
5. For each environmental condition (pH, salinity, temperature, oxygen, nutrient),
predict the optimal condition and range and classify the organism
appropriately (e.g. thermophile, neutrophile, halophile, facultative anaerobe,
oligotroph/copiotroph, etc).

41
LAB WORKSHEET #2
“Adaptation”

Using the results of these experiments, compare the environmental conditions of the soil from which you
isolated your organisms to their actual reaction norms to predict if each is well-adapted to its
environment. Use the data you have collected to complete this worksheet.

1. Provide reaction norms for temperature, pH, salinity, nutrient concentration, and O2
availability for each of your isolates. Do this by plotting your calculate growth rates for each
environmental series as bar graphs with error bars representing the 95% confidence intervals.
For each parameter, indicate the optimum and range. Make sure to include all of the
following conditions:
a. Temperature: 4C, 15C, 23C (RT), 30C, 37C, 42C, 55C
b. pH: 3, 5, 7, 9
c. Salinity: 0%, 0.5%, 3.5%, 10%, 15%
d. Nutrients: Low (1/10 R2A), Medium (R2A), High (BHI)
e. O2: None (anaerobe jar), Low (candle jar), High (atmospheric growth)

2. Use one or more of the following terms to describe each of your isolates: psychrophile,
mesophile, thermophile, hyperacidophile, acidophile, neutrophile, alkaliphile, halophile,
extreme halophile, oligotroph, copiotroph, obligate anaerobe, facultative anaerobe,
microaerophile, aerobe

3. Compare your isolates' optimum environment to the actual environment. If they are
different, estimate how much slower your organism would grow in the soil than in its
optimum environment.

4. At the actual conditions of their environment, do either of your isolates have significantly
different growth rates? (use one or more unpaired t-tests to answer this question)

5. Are your isolates well-adapted to their environment? If not, why do you think their optimal
environment is different than the one in which you found them?

6. State a hypothesis about the ecology of your two isolates. They were both found growing
in the same small amount of soil. What prevents one of them outcompeting the other and
driving it to extinction?

7. Assume that you are writing a manuscript that uses these experiments. Write the “Results”
section of that manuscript.

42
Chapter 6
AGAR ART
Since at least the early 20th century, microbiologists have enjoyed the
unusual pastime of "painting" with bacteria. Alexander Fleming, the
discoverer of penicillin, was also an accomplished microbial artist, and it's
plausible that his artistic efforts led to his fortuitous discovery. Later,
Selman Waksman used art-like "streak plates" to systematically search for
antibiotic-producing soil bacteria, leading to the discovery of streptomycin
and other drugs (you will try these in a subsequent exercise). For the past
few years, the American Society for Microbiology has sponsored an
international Agar Art competition, and every year the entries become more
numerous and more ambitious.
Here, you'll follow in
these illustrious footsteps
to create your own
microbial masterpiece.
On the one hand, you
should have fun and try
to make something
personal and striking that
you can show off to your
friends and family. On
the other hand, you'll get
to see your isolates
interacting with each
other, and with other
pigmented bacteria, in
unique, unplanned
settings, and you might
learn something about
their ecological
relationships in the
process.

43
PART A. TEMPLATE DESIGN
CREATING A PERSONALIZED DESIGN
The internet is exploding with colorful works of agar art from the ASM Agar
Art contest, many of which began with simple sketches. We have made
sketches very similar to what some of the ASM Agar Art winners would have
used for their winning designs.

We know that agar art calls upon

contemporary tools, but due to the
circular constraints, also pays homage to
Mandalas. Mandala means “circle” in
Sanskrit, an ancient language in India.
People across African, Aztec, Chinese,
Indian, Japanese, Tibetan and other
cultures use mandalas for meditation
and expression, using radial symmetry
to balance the artwork and represent
their place in the universe. Mandalas
(top left) may be an option for you if you
want to play around with overlapping
shapes rather than a figurative image.

YOU WILL NEED

• 1 blank template; Glue; Scissors;
Pencil, Colored pencils; 1 empty
petri dish
DIRECTIONS
1. Design images on your blank templates. Ensure there are places
in your design where lines cross, because those are the
places where microbial interactions will occur. Fill up one
sheet with different designs (up to six designs).
2. Cut out your one favorite circle design. Either take a photo of it or
scan it.
3. Take the lid of an empty petri dish and place the lid so its surface
area is on the table. Glue/Tape your template on the inside of a
blank empty petri dish lid, facing upwards. This lid with template
inside can now be used again and again!

44
PART B. AGAR ART
CREATING A MICROBIAL MASTERPIECE
You will observe your plates to see phenotypic variation based on the
abiotic (temperature/media) and biotic (other organisms) environment.
You will then combine the techniques of plating bacteria with the art of
drawing. Painting with the bacteria or “invisible ink” will show you the role
materials have in guiding artistic processes.

Here you will use your named isolates as well as 2 previously cultured colored
microbes to translate your mandala into an actual living painting. You're going to
replicate the same painting, with the same microbes in the same patterns, on 3
different petri dishes. You have a choice: either use 3 different types of media at
the same temperature, or the same type of medium (R2A) at 3 different
temperatures. Use your observations from your original isolation plates to decide
which environmental changes make the biggest differences in the phenotypes you
think are most interesting.

The 3 media choices differ from each other in the amount of nutrition they provide.
As we've discussed earlier R2A is a relatively low-nutrient medium. It is particularly
useful for growing environmental bacteria because they are used to low nutrient
concentrations in their native environment, and can suffer oxidative stress due to
imbalanced metabolism when transferred to rich media. R2A also contains
pyruvate, which eliminates hydrogen peroxide from the medium and provides
additional protection from oxidative stress. "Brain-Heart Infusion" or BHI medium is
an even higher nutrient medium, known to maximize growth rates and biomass
yields for many types of bacteria, but can be difficult for slower growing
environmental bacteria to tolerate. PLAG medium is a defined medium that
contains only inorganic salts and four commonly-used carbon substrates --
pyruvate, lactate, acetate, and glycerol. It is the least nutritious of the three
options.

If you choose temperature, you can opt for 4º C (a refrigerator), 15º C (similar to
the native soil temperature, probably), room temperature (about 23º C), 30º C (a
warm summer day), or 37º C (human body temperature). Microbes tend to grow
faster at higher temperatures, but at some point the temperature starts to stress
them out and will eventually kill them. Stress also happens at low temperature,
but generally it is a gradual effect, whereas at high temperature cells often go
quickly from "happily growing" to "stone dead" over a few degrees.

So, both medium composition and temperature are capable of increasing growth
rate, but also causing stress. Both of these conditions are likely to influence the
phenotypes and interactions of the organisms you use to make your artwork, and
will help you gain insights into "who your isolates are".

45
EACH STUDENT WILL NEED

• Streak isolation plates for both isolates

• Additional colored bacteria
• Template dish
• Glue
• Camera
• Pencil, Colored pencils
• Sterile wooden sticks
• Parafilm and scissors
• EITHER:
o 1 each R2A, PLAG, and BHI plate, or
o 3 R2A plates

DIRECTIONS

1. First, re-streak your isolates onto fresh agar plates and return the new
plates to the incubator.
2. Take a couple of minutes to look at your classmates' isolates and show
them yours. Get to know their names, their colors and shapes, and any
weird quirks they exhibit.
3. You will create art using BOTH of your team's isolates. Also, you will
select two other isolates to use, choosing either from the pigmented
bacteria provided by your TA or from other isolates obtained by your
classmates (make sure to ask first!)
4. Fit your first media plate snuggly into your template lid on the bottom
(keep the media lid on). Draw a “registration mark” on your template and
on the media plate to account for any wiggle.
5. You used four different colors in your mandala templates. To make your
art, each color in your template must correspond to one of your bacterial
isolates. The color in the mandala doesn't need to resemble the color of
the bacteria. Assign a color to each bacterium and write it down in your
notebook so you don't forget. Also number the isolates 1-4.
6. Aseptically, take the top empty lid off. Dab a colony from Isolate 1 with a
stick and carefully trace all the respective colored lines in your mandala
onto your agar, starting in the upper left corner. Make sure the
registration mark on your plate and the template plate stay lined up.
7. Throw away the stick. Use a new stick to apply Isolate 2. Make sure to
NEVER touch the original isolation plate with a stick after the stick has
touched your artwork -- always use a fresh stick.
8. Continue with Isolates 3 and 4 until all lines have been traced.
9. To make sure all the lines get covered, rotate your plate 180º and repeat
steps 6-8.

46
10. Repeat steps 4-9 with your other 2 art plates.
11. Seal the art plates with Parafilm and place them INVERTED in the
appropriate temperature condition.
12. After 1 week of incubation, photograph all of your plates.

NOTE: It's perfectly acceptable to experiment with other painting techniques. For
instance, you could use an inoculating loop or needle instead of the wooden sticks;
you could experiment with burning/melting the agar with a hot loop; or even
carving into the agar using a sterilized instrument.

47
LAB WORKSHEET #3
“Interactions” (Chapter 6)

You have now become an agar artist. Use your observations of your artwork to answer the
following questions.

1. Attach a picture of your template. Directly beneath it, attach pictures of your actual artwork.
Also attach pictures of your teammates’ art plates and, if any other teams used your isolates
in their art, attach pictures of those plates as well. Indicate which medium and what
temperature were used for each plate.

2. List three things that are different in your artwork than you expected.

3. List at least two things that are different between your two replicate paintings. Do you see
similar differences when you compare your paintings to your teammate’s paintings (or other
teams’ paintings) who used the same isolates? Are any of the differences associated with
differences in growth conditions?

4. State a hypothesis about why your two paintings look different from each other, and why
both look different than your intention. Try to take your findings from Worksheets 1 and 2
into consideration.

5. Assume you are writing a professional manuscript that focuses on this art project. Write an
Abstract that includes your motivation to make the design you chose, the results you
observed, and your conclusions/hypotheses about why your plates looked the way they did.
DO NOT EXCEED 200 WORDS.

48
Chapter 7
MOLECULAR IDENTIFICATION
Part A. 16S PCR
AMPLIFICATION OF SMALL SUBUNIT
RIBOSOMAL RNA GENE
Traditionally, microbes were identified based on observable phenotypes and
physiological characteristics. For instance, gram-negative rods that can't grow on
lactose were considered to be "a thing". In some cases, this was useful -- for
instance, many important human pathogens such as Shigella and Escherichia coli
are lactose-negative gram-negative rods. However, there are thousands of other
lactose-negative gram-negative rods in nature that have no close relationship to E.
coli. Indeed, when scientists first started trying to classify bacteria along the same
lines as macroscopic organisms, they were prone to throwing up their hands in
defeat because there seemed to be no rhyme or reason to the evolutionary
relationships between bacteria. Carl Linnaeus, the Swedish biologist who invented
the genus/species Latin binomial naming system used for all organisms today,
lumped all microbes into a group called "Chaos" and essentially washed his hands
of classifying them.

Fast-forward 2 centuries to the 1980's and the lab of Carl Woese at the University
of Illinois Champaign. Woese studied the structure of the ribosome, and was one of
the first to sequence the DNA that encoded ribosomal RNA. He discovered that
there were parts of the sequence that were nearly identical across all organism he
looked at, from bacteria to humans to oak trees, but in between these "highly
conserved" regions other regions were quite variable. Woese proposed that you
could determine evolutionary relationships between organisms based on the
sequences of these variable regions, and he and his graduate students proceeded
to re-classify the microbial world based on the sequence of the small subunit, or
16S, rRNA. Today 16S and other DNA sequences are the primary way that
researchers classify microbes and understand the relationships between different
groups.

In this lab, you will use the polymerase chain reaction (PCR) to amplify a portion of
the 16S gene that is about 1100 base pairs long and sits in between 2 sequences
that are almost universally conserved in bacteria. Those conserved regions are
complementary to two "universal primers" which are short pieces of single-strand
DNA you will add to your PCR mixture that will target the 16S gene for
amplification. You will also add a "template" to your mixture, which is the DNA you

49
want to amplify. In this experiment, that template will come from a portion of a
bacterial colony suspended in sterile water.

After the PCR runs, you will look at the product to make sure it worked right using
gel electrophoresis. Once you have pure DNA, you will quantify how much DNA
you have using spectrophotometry. DNA absorbs UV light at 260 nm, and you
can estimate how much DNA you have in a sample by how strongly the sample
absorbs light at that wavelength.

Finally, you will send your purified DNA, along with a small amount of primer, to the
UAB DNA sequencing facility, where it will be sequenced using the Sanger method.
Shortly after, we'll learn how to analyze that sequence data and use it to identify
your microbial isolates.

YOUR TEAM WILL NEED

• A PCR rack
• 6 sterile PCR tubes
• 1 tube of GoTaq Master Mix (232.5 µL)
• 1 tube of Primers U341F and UA1406R (10 µM e., 15 µL)
• 1 positive control tube of purified E. coli DNA (5 µL)
• 1 negative control tube of sterile deionized water (5 µL)
• 1 box each of P20 and P200 pipet tips
• A P20 and a P200 pipetter
• A sharpie
• Some sterile toothpicks
• Bucket of ice
• Plates with your unknowns, streaked for isolation

DIRECTIONS
1. Keep your reagents on ice until you're ready to use them.
2. Put your PCR tubes in the PCR rack. Label them with a sharpie: 1, 2, 1C, 2C,
pos, and neg.
3. Pipet 50 µL of sterile water into tubes 1C and 2C.
4. Using a sterile toothpick, aseptically collect some material from a colony of
unknown isolate #1 and suspend it in the water in tube 1C by swirling the
toothpick around in the water. Make sure to get enough material that the
water looks somewhat cloudy. Repeat with unknown #2 in tube 2C.
5. Add 12.5 µL of primers to your GoTaq master mix. Mix by vortexing.
6. Add 49 µL of master mix + primers to each of the tubes 1, 2, pos, and neg.
7. Add 1 µl of tube 1C to tube 1. Repeat with tube 2C and tube 2.
8. Add 1 µL of E. coli DNA to tube "pos". This is your positive control; if it fails to
amplify something is wrong with your reagent or your technique.
9. Add 1 µL of sterile water to tube "neg". This is your negative control; if it
amplifies, you contaminated your master mix somehow.
10. Put your PCR rack on ice and tell your TA you're done.

50
11. When everyone finishes their tubes, they will place them all into a thermal
cycler, which will subject them to the following program:
a. 10 minutes at 95º C -- this lyses the resuspended cells.
b. 30 seconds at 95º C -- this denatures the DNA, causing the strands to
separate.
c. 30 seconds at 50º C -- this temperature is low enough to allow the primers
to anneal to the single-stranded DNA, but high enough that they can only
bind to exact sequence matches.
d. 90 seconds at 72º C -- this is the optimal temperature for Taq DNA
polymerase, which means it makes new double-stranded DNA fastest at
this temperature. During this step, DNA is elongated from the primers,
amplifying the target V4 region.
e. Go back to step b 34 more times -- steps b, c, and d are cycled 35 times,
resulting (ideally) in an increase in copy number of the target region of 235
(or 2.4 x 1010) times.
12. The PCR will run overnight. Your TA will put your plate in the fridge tomorrow
morning.

Part B. GEL ELECTROPHORESIS

SEPARATION OF MACROMOLECULES (DNA)
You will separate any DNA molecules in the PCR tube based on their size (in
base pairs) using gel electrophoresis. Electrophoresis is the movement of
charged particles suspended in a gel exposed to an electric current. Because
larger molecules move slower through the gel, electrophoresis can be used
to estimate the size of DNA. You will add a dye solution to your sample that
will cause the DNA to become fluorescent, letting you see any bands by
shining an ultraviolet light on the gel. If your PCR worked correctly, you will
then purify the products to remove the PCR enzymes, unused primer DNA,
and salts. To do this you will use a resin column that binds DNA but lets
everything else pass through.

YOUR TEAM WILL NEED

• Ice bucket
• PCR products from previous experiment
• Gel
• 1X TAE Buffer
• Parafilm
• 6X GelRed solution
• DNA ladder
• Electrophoresis chamber and power supply (at your bench)

51
DIRECTIONS

1. Keep your reagents on ice until you're ready to use them. Place your gel
into your electrophoresis chamber. The wells need to be closest to the
black (negative) terminal since DNA will move toward the red (positive)
terminal.
2. Add TAE buffer to the electrophoresis chamber until it is JUST above the
level of the gel.
3. On a small piece of parafilm, pipet 5 x 2 uL “spots” of 6X GelRed solution.
This is the fluorescent dye that will make your sample visible.
4. Carefully pipet 10 µL of DNA ladder onto one of the GelRed spots. ONLY
GO DOWN TO THE FIRST STOP on the pipet plunger; pipet up and down
to mix. Using the same pipet tip, move the mixture to the first well of
your gel.
5. Repeat with each of your PCR products and your positive and negative
controls, putting each product in a separate well. Use a different pipet tip
for each product. MAKE SURE TO RECORD WHAT SAMPLE YOU PUT IN
EACH WELL in your lab notebook!
6. Put the lid on the chamber and hook the electrodes up to your power
supply. Make sure the black wire goes to the black electrode and the red
wire goes to the red electrode!
7. Turn the power supply on. Set to "constant voltage" and dial in to 100 V.
You should see bubbles rising through the buffer at the ends of the
electrophoresis chamber.
8. You should see two colored bands moving across the gel, one yellow and
one blue. The yellow band corresponds to a product of about 10 bp in
size and the blue band to a product about 1000 bp in size (about the size
of your product). Run the gel until the yellow band is about 3/4 of the
way down the length of the gel (between 15 and 30 minutes)
9. When the gel has finished running, turn off the power supply, open the
chamber, and take out the gel. Place the gel on the transilluminator to
visualize the bands. MAKE SURE TO PROTECT YOUR EYES.
10. Take a picture of your gel and/or record the position of each band
(and any lanes that don't have bands) in your notebook.
11. Assuming your results resemble the output in Figure 7.1, proceed to the
next step. Otherwise, you may need to re-do one or more of the
reactions; consult your TA.

52
 Figure 7.1. If your reactions
worked, your gel should look
about like this.

• The molecular weight marker

ladder is on the left side (M).
• The negative control (-)
shows no product
• The positive control (+) and
both unknowns show
products of about the same
size.
• The different brightness of
the unknowns indicates that
one started out with more
DNA than the other.
• The hazy bands at the
bottom of the gel are
unreacted primers.
Remember that smaller
fragments move faster than
larger ones!

Part C. PURIFICATION AND

QUANTIFICATION
SPECTROPHOTOMETRY AND
SPECTROPHOTOMETRIC QUANTIFICATION
One way of studying substances suspended or dissolved in water is to see how
strongly they absorb light at various wavelengths, a technique called
"spectrophotometry". When you shine a light through a liquid sample, the farther it
goes through the sample, the more it interacts with whatever is in the liquid. Every
compound has a particular spectrum: in other words each compound absorbs light
at different wavelengths with a unique pattern. DNA's spectrum is shown in Figure
7.2 (below).

53
 You can tell that there's a peak in
absorbance at 260 nm, and it's almost
non-existent at 230 nm. That means if
you shine a light through a DNA solution,
it will come out the other end relatively
depleted in photons with wavelengths of
260 nm, changing the light's color. The
more of a substance is in a solution, the
stronger the absorbance of light
becomes. If we know how much of a
given wavelength is absorbed per mole
of the compound (the "molar extinction
Figure 7.2. Ideal spectrophotometric coefficient" or ε) and how far the light
scan profile for purified DNA. Notice has to travel through the solution (the
the large peak at 260nm. path length or l), we can use the
difference in intensity of light at that
wavelength between the light's source and a detector on the opposite side of the
sample (the absorbance, A) to calculate the concentration c of the compound in the
solution. This is the Beer-Lambert Law:

The value of ε for double-stranded DNA is 0.02 (ng/µL)-1 cm-1. So, if you
measured A = 0.2, DNA concentration would be calculated as 100 ng/µL.

Protein has a peak absorptivity at 280 nm, and any amount of protein
contamination can result in overestimates of DNA concentration. Completely pure
DNA should have a ratio of A260:A280 of about 1.8, if this is lower, it indicates
protein contamination and means that the concentration estimate is probably high.

In this exercise, you will use a spin column kit that will allow you to separate your
DNA from proteins, salts, and primers in your PCR mix, resulting in a pure double-
stranded DNA mixture. You will then use spectrophotometry to quantify the
concentration and purity of your DNA sample.

YOUR TEAM WILL NEED

• 2 PCR purification spin columns

• PCR products from your 2 unknowns
• 1 tube each of column binding (Buffer PB), column wash (Buffer PE),
and elution (Buffer EB) solutions
• 5 sterile eppendorf tubes
• P200 and P1000 pipetters and tips
• A microcentrifuge
• Take 3 DNA Quantification Plate or NanoDrop

54
DIRECTIONS

1. Label 2 eppendorf tubes each with the names of your unknowns. Also
label your spin columns.
2. Add 250 µL Buffer PB to 1 eppendorf tube per organism.
3. Add your PCR products to the PB. Pipet up and down to mix.
4. Pipet the PB/DNA mixture into the spin column. Centrifuge at 14,000 g
for 1 minute. MAKE SURE THE CENTRIFUGE IS BALANCED AND THE LID
IS ON!
5. Pour off the liquid in the collection tube. Add 750 µL Buffer PE to the
spin column. Spin at 14,000 g for 1 minute.
6. Pour off liquid in collection tube and centrifuge again (dry) for 1 minute.
7. Carefully remove the spin column and put in the clean eppendorf tube.
8. Add 30 µL Buffer EB to the center of the resin at the bottom of the spin
column, wait 1 minute, then spin at 14,000 g for 1 minute.
9. Discard spin column. Centrifuge remaining product for 5 min at 14,000
g.
10. Being careful not to agitate the tube or contact the bottom of the tube
with the pipet tip, remove 25 µL of liquid to a clean eppendorf tube.
11. Label this tube with your team name/number and isolate name/number.
12. After everyone in the class has finished purifying their products, each
team will pipet 2 uL of each DNA prep onto one of the spots on the
BioTek Take 3 quartz slide at the front of the class.
13. Your TA will pipet a 2 µL spot of very pure water as a Blank control onto
a free spot on the slide.
14. Your TA will analyze the sample using a BioTek plate reader.
15. Alternative: a NanoDrop spectrophotometer can also be used if available.
16. Your TA will send you the quantification information and 260/280 ratio,
as well as the spectrophotometric profile (as in Figure 7.2) from your
isolates.
17. Make sure your DNA is clearly labeled and place it in the box for freezing.
Your TA will send it to the sequencing facility, where it will be sequenced
by the Sanger method using an AB1 sequencer.

55
Part D. BIOINFORMATIC
IDENTIFICATION
BACTERIAL IDENTIFICATION AND ANALYSIS
You have amplified the 16S rRNA gene from your two environmental
isolates and sent the PCR products off to be sequenced. Today,
you're getting those sequences back. However, you can't do much
with the raw data -- we have to process it in a number of ways prior
to analysis. Here, we'll walk through the steps required to make
sense of your sequence data. First you'll quality control the raw
read information, then we'll align it using information from the
thousands of other 16S rRNA sequences stored in online databases.
With the alignment, you can identify your microbes.

Step 1: Quality Control. You'll recall that we used the Sanger method to
sequence your PCR products. Sanger sequencing takes a DNA template and
extends it from a single primer (your forward PCR primer) with Taq
polymerase using cycling conditions similar to PCR. However, in addition to
the standard dNTPs, a Sanger sequencing mix includes 4 dideoxy NTPs as
well. These ddNTPs are missing the crucial O atom necessary to form the
next phosphodiester bond and so they terminate the extension of the DNA
molecule whenever they are incorporated. Therefore, a Sanger mixture will
include many fragments of different lengths, each terminated wherever a
ddNTP was incorporated. Modern Sanger sequencing uses ddNTPs that are
labeled with fluorescent molecules, such that molecules ending in an A glow
one color, those ending in a C glow a different color, and so on for G and T
as well. We separate these fragments by size on an acrylamide gel and
detect fluorescence as the various fragments pass the end of the gel,
starting with the smallest fragments (the 5' end of the product being

Fig. 7.3. A chromatogram. The ddCTPs were labeled blue, ddGTPs were yellow, ddTTPs
were green, and ddATPs were red.

56
sequenced) and ending with the largest fragments (the 3' end of the product
being sequenced).

However, interpretation of a Sanger reaction isn't THAT straightforward --

you don't necessarily get an unambiguous sequence. What you actually get
is a chromatogram, or a graph with 4 separate "traces" showing light
intensity at the 4 wavelengths emitted by the different fluorescent ddNTPs
(Fig. 7.3). Ideally, this will result in a pattern of clearly separated "peaks"
cleanly representing fragments of different sizes. However, this isn't always
the case, and often the smallest and largest fragments have overlapping
color traces that make them more or less unreliable. We therefore have to
do a "quality control" step to eliminate the worst offenders in terms of
ambiguous peaks, prior to "calling the base pairs" and outputting a
sequence.

To do this, we will use a program called SeqTrace. SeqTrace lets us

visualize the chromatogram itself, and then apply various quality criteria
used to trim the sequences. The program scans the chromatogram and
makes "base calls" based on detection of peaks in the 4 traces. It then
assigns each call a "quality score" that defines how likely it is that the base
call is correct. A number of factors influence the quality score, including the
width of the peak and the height of the peak relative to the output at that
location from all 3 other traces. The quality score Q is related to the
probability P of a mistaken call by the equation:

𝑄 = −10 log)* 𝑃

Here, we will trim base pairs from the beginning and end of each sequence
by looking for the point when the percentage of base calls exceeding a
critical Q threshold passes a given point.

DIRECTIONS – QUALITY CONTROL

1. Download your organisms’ AB1 files from Canvas onto your lab computer.
2. Find and open SeqTrace on your computer.
3. Click the "sheet" icon (Create New Project) at the top left of the SeqTrace
window.
4. Click "Choose" and then navigate to the folder containing your sequences.
NOTE: select the folder, don't actually go into it by double-clicking.
5. Click "Sequence Processing" and set "Min. confidence score" to 10 and
"Trim until at least 9 out of 10 bases are correctly called". This will cut 5'
and 3' regions where less than 90% of bases are called at a 90%
accuracy level or better.

57
6. Click the "+" icon and select the .ab1 files that correspond to your
isolates. Click "Add".
7. Click "Traces" and "View selected traces" to see what the chromatograms
look like.
8. You'll see four different colored lines representing the 4 different ddNTPs.
Above these traces are the quality scores for each peak. Below the traces
are the "called bases", or which of the 4 colors is highest at a given
position. Note that these bases are not evenly spaced horizontally,
because the space between peaks varies over the length of the
chromatogram.
9. Below the window containing the chromatogram and the called bases are
two sequences. The top one is the "raw sequence" and the bottom one is
the "working sequence", which is what is left over after the quality
controls have been applied. How much of the raw sequence was
eliminated by quality control? Note how many base calls have become
"N"s in the working sequence. Why do you think SeqTrace has done this?
10. When you're done examining your sequence, click "Sequences",
"Generate Finished Sequences", and "For all trace files". SeqTrace will go
through all the files in the project and apply your quality control
parameters to convert trace files to simple sequences of A, C, G, T, and
N.
11. Then click "Sequences", "Export Sequences", and "From all trace files".
Give your file a name and save it to the same folder with your team's AB1
files.

At this point you have generated a "FASTA" file which is a standard "flat
format" text file for saving lists of sequences. Each sequence in a FASTA file
has two lines. The first line starts with a ">" and gives the sequence a name
and can also list attributes of various kinds. The second line is a simple
string of nucleotide letter codes. For instance, here is one possibility:

>Awesomebacterium morrisii, isolated from soil on 3/25/2016

ACTAGCGTACGTGTGGTGCNAACTGGTTAATATAACAGAATCGAGGGGTAC

Let's look at your FASTA file. Open the folder where you saved it, find the
file, and right-click it. Click on "Open with" and navigate to "Notepad" (in
your Windows directory). Because a FASTA file is just a text file, you can
view it in any text editing or word processing software. Scroll down through
the file and note how the sequences are stored, 2 lines each.

58
Step 2: Alignment and Identification Many tools exist to identify
environmental DNA sequences by comparison with online databases. These
databases are truly gargantuan, with hundreds of billions of base pairs
collected from many thousands of samples of all kinds from all over (and
under) the world. One strategy is to just take your string of nucleotides and
find other strings of nucleotides that are most like it. However, given the
vastness of the databases, there is a good chance that even long strings of
nucleotides will find spurious "hits" by random chance. A superior method
for identifying close matches to sequences is to use an evolutionarily-
informed method. However, this requires us to know more than just the
sequence of nucleotides -- we also have to know how the nucleotides from
sequence A match up to those in sequence B. To do this, we can align an
unknown sequence against a group of sequences from well-studied
organisms. You can get a rough idea about how this process works (and
possibly help out medical science!) by playing the game at the following
website:

http://phylo.cs.mcgill.ca

Seriously, go back and click the link. It’s fun and you’ll have a much better
idea of what’s going on in this experiment after you’ve played it for a few
minutes.

Here, we are going to use a very common algorithm called the “Basic Local
Alignment Search Tool” or “BLAST”, operated from the US government’s
NCBI servers.

DIRECTIONS – ALIGNMENT AND IDENTIFICATION

1. Open an internet browser and navigate to
https://blast.ncbi.nlm.nih.gov/Blast.cgi
2. Click "Nucleotide BLAST” on the left side of the screen.
3. Under “Enter Query Sequence”, click “Choose File” and select your FASTA file.
4. Make sure “Standard databases (nr etc)” and “Highly similar sequences
(megablast)” are checked. Also check the box by “Uncultured/environmental
sample sequences” to make sure whatever you get has a name.
5. Click “BLAST” and wait
6. On the Results screen (Figure 7.4) you’ll be able to view the closest matches in
the NCBI database to your organism. The ones at the top of the “Sequences
Producing Significant Alignments” list are the most likely IDs for your organism.
7. Click the “Results for” box to cycle between your two isolates.
8. Note that there are several metrics for the quality of the alignment. For
instance, “Query Coverage” shows how much of your submitted sequence

59
 Figure 7. 4. BLAST Output from the NCBI server
actually aligned to the database sequence. The “E value” is the probability that
a randomly generated sequence could generate an equally good alignment.
The “Per. Ident” is how many base pairs are identical in your organism’s
sequence with the database match. The “Total Score” takes all of these values
plus other information (e.g. the quality of the database sequence) into account.
For the pictured organism, the ID is most likely Enterobacter cloacae.
9. In some cases you can’t distinguish a top match. Even here, it’s not completely
clear that the sequence matches Enterobacter cloacae better than Enterobacter
asburiae. That’s okay – 16S evolves slowly, which makes it a good
phylogenetic marker for separating distantly related organisms, but not so

60
 great for more closely related organisms. Also, the naming customs for
bacterial species have changed often over the years, making it even more
complex. Do your best – do an Internet search for the various organism names
and see if any of them match the other characteristics your organism
expresses.
10. It’s also possible that you won’t get any really strong matches like the one
shown in Figure 7.4. Try to figure out why. Was your PCR product relatively
low quality, resulting in a short sequence? Or is your organism truly different
than things in the database?

61
CHAPTER 8
CLASSICAL IDENTIFICATION
In this chapter you will conduct a suite of experiments with your isolates
that have been used for decades to identify and characterize bacteria. None
of them are as reliable as modern molecular techniques like 16S PCR, but
they are still useful for several reasons. First, they are fast and relatively
cheap, and therefore remain the most common methods for clinical
identification of infectious organisms in hospitals around the world. Second,
they give you important information about the metabolic abilities of your
organisms that you can’t learn from rRNA sequences alone. In some cases,
you may be able to distinguish between closely related bacterial species that
share identical 16S sequences, but have very different characteristics.

62
8A. MICROSCOPY AND GRAM STAIN

63
64
65
66
67
68
69
70
71
72
73
74
75
76
8B. RESPIRATION, CATABOLISM, and
CHEMOTAXIS
In these exercises, you will learn about how your isolates make the energy
they need to grow. You will test whether your isolates express an aerobic
cytochrome oxidase, as well as whether they can anaerobically respire
nitrate (i.e., perform denitrification) or sulfate. Additionally, you will test
whether they can grow on a number of common carbon compounds.
Finally, you will investigate whether your isolates are motile, and if so, if
they are capable of chemotaxis toward simple carbon substrates.

Millions of different carbon compounds exist in nature, and each one is structurally
unique. This presents a challenge to organisms that want to use those compounds
either for energy (catabolism) or to build biomass (anabolism), because enzymes
only recognize particular molecular shapes. Thus, microbes are limited in the range
of compounds they can metabolize by the presence or absence of particular genes
and gene pathways (i.e. operons) in their genomes. Some pathways are quite
common (e.g. glucose utilization) whereas others are rare enough to be useful in
identifying particular taxonomic groups of microbes (e.g. lactose utilization).

Carbon catabolism has three primary steps. First, the compound has to be
transported into the cell by a transmembrane transporter protein. In some cases
(e.g. involving polymeric catabolites such as DNA and protein) this requires the
substrate to first be broken down extracellularly by exoenzymes into its
component parts. Second, the compound has to be chemically converted into a
form (usually glucose) that can be shunted into one of the central carbon
catabolism pathways (such as glycolysis). Finally, the reducing equivalents (e.g.,
NADH) produced by catabolism must be regenerated, either by funneling their
electrons to a terminal electron acceptor (respiration) or by depositing them onto
an intermediate carbon metabolite (fermentation).

In these experiments, we will discover which carbon compounds your organisms

can grow on, what (if any) terminal electron acceptors they can use, and whether
or not they are able to search for growth substrates in their environment through
motility.

77
8.B.i. RESPIRATION and FERMENTATION
The most familiar type of respiration, aerobic respiration, uses oxygen as the
terminal electron acceptor. However, many bacteria are capable of "breathing"
other oxidized inorganic chemicals. Nitrate in particular is commonly used for
respiration, in a process called denitrification which is very important for natural
biogeochemical cycling of nitrogen. Many enteric bacteria such as E. coli are
capable of simply reducing nitrate to nitrite. Other "environmental" organisms are
capable of further reducing nitrite to nitrous oxide and eventually back to dinitrogen
gas. Still other important organisms are capable of reducing sulfate or even
carbon dioxide with very low energy yields – but they are capable of continuing to
grow even in very resource-poor environments.

Respiration generates large amounts of energy via oxidative phosphorylation.

However, terminal electron acceptors aren't always available, and in that case
fermentation is necessary to regenerate NAD+ and keep catabolic processes going.
Like respiration, fermentation also takes several forms. The simplest fermentation
pathway results in the formation of lactic acid. Unfortunately, lactic acid is highly
toxic: because it is a small polar molecule, it doesn't easily escape the cell and
must be transported out of the cell (possibly actively, using ATP) or else the
cytoplasm pH will drop precipitously, causing stress. Additional pathways can
produce a variety of end products in addition to lactic acid, including formate,
succinate, ethanol, and hydrogen gas (mixed acid fermentation) or neutral
carbohydrates (such as acetoin).

YOUR TEAM WILL NEED

• Plates and broth cultures of unknown isolates growing at their
optimum temperature
• 2 tubes of nitrate broth
• Nitrate reagent a (dimethyl-a-naphthylamine)
• Nitrate reagent B (sulfanilic acid)
• Zinc dust
• Oxidase strips (2)
• Sterile petri dish
• Sterile saline
• 2 Peptone Iron deeps
• 4 MRVP tubes
• Methyl red
• V-P reagent 1 (a-naphthol)
• V-P reagent II (40% KOH)
• Sterile toothpicks
• Dropper of 3% hydrogen peroxide
• BHI plate containing isolated colonies of Staphylococcus epidermidis

78
OXIDASE TEST
A cytochrome oxidase is necessary for using oxygen as a terminal
electron acceptor in aerobic respiration. This test identifies the presence
of a cytochrome c oxidase like the one found in eukaryotic mitochondria
as well as many bacteria. Note that some bacteria (particularly the
Enterobacteriaceae) are capable of aerobic growth because they produce
a different cytochrome oxidase (not detected by this test).
Cytochrome oxidase

2 Cytochrome + O2 + 4 H+ 2 Cytochrome+ + 2 H2O

OXIDASE TEST DIRECTIONS

1. Place two oxidase test strips in a sterile petri dish. Moisten each with
water.
2. Using sterile toothpicks, smear several colonies of one isolate onto the
moistened area of one test strip; repeat with the other isolate and the
other test strip.
3. If your isolate makes a hard colony, place as much growth as possible
on the oxidase strip and then add a loopful of sterile saline.
4. If the strip turns blue-black within 30 seconds, it is oxidase positive.

NITRATE REDUCTASE TEST

Nitrate is one of the best alternative electron acceptors for anaerobic respiration
and many microbes will use it first when the oxygen runs out by reducing it to
nitrite. Some microbes are further capable of using nitrite as a terminal electron
acceptor, resulting in the production of nitrous oxide gas, and these gases can
be further reduced to dinitrogen gas. The use of nitrate as a terminal electron
acceptor is called denitrification and is one of the 'legs' of the 'nitrogen triangle'
that controls the cycling of nitrogen in nature. The other two legs are nitrogen
fixation (used for assimilatory nitrogen metabolism) and nitrification (performed
by lithotrophs that use ammonium as an electron donor).

Nitrate reductase

Cytochrome + NO3- Cytochrome+ + NO2- + H2O

Denitrification

NO3- à NO2- à N2O (g) + NO (g) à N2 (g)

79
NITRATE REDUCTASE TEST DIRECTIONS

1. Label each nitrate tube with your organism's name. If your organism
grows well in broth, inoculate the appropriate tube with a single
colony. If not, re-suspend as much growth as you can from a plate
into 100 µL of sterile saline, and use this to inoculate the nitrate broth.
2. Incubate the nitrate tubes at the organism's optimum temperature.
3. As soon as you can see growth in the tubes, add 5 drops of nitrate
reagent A and 5 drops of nitrate reagent B to the tube and shake
gently to mix. If the broth turns red within 30 seconds, this indicates
the presence of nitrite.
4. If no red color develops, carefully (it's toxic!) add a small pinch of zinc
dust. If it turns red after 20-30 seconds, this indicates that nitrate is
still present and that the organism cannot respire nitrate. If no color
forms, this means that the nitrite was further reduced to volatile
nitrous oxide or nitrogen gas (full denitrification).
5. If growth isn't obvious the first-class period after inoculation, keep
incubating the culture for 2 more class periods. At the end of this
period, perform steps 3-4 regardless of whether growth is visible or
not. In this case, you cannot trust negative results (because lack of
nitrate reduction could indicate either that the organism can’t reduce
nitrate, or that it just didn’t grow) but you can trust any positive
result.

THIOSULFATE REDUCTION TEST

Sulfate (including thiosulfate and other oxidized forms of sulfur) can be used by
some sulfur reducing bacteria as a terminal electron acceptor. There are several
pathways through which this can occur; the one used by Desulfovibrio is shown
below. The hydrogen gas is a by-product of fermentation reactions; sulfate
reduction is important because it allows growth to continue in even the most
energy-poor environments.

SO42- + H2 (g) + 8 H+ à H2S (g) + 4 H2O

THIOSULFATE REDUCTION TEST DIRECTIONS

1. Using an inoculating needle, jab one of your isolates into a Peptone
Iron deep. Repeat with the other isolate and the other Peptone Iron
tube.

80
 2. Incubate the Peptone Iron tubes at your isolates' optimum
temperatures.
3. If the medium turns black, this means that hydrogen sulfide was
produced and reacted with the iron to form a black precipitate,
indicating that the organism is a sulfur reducer.
4. If bubbles or cracks appear in the medium, this means that gas was
produced during fermentation. H2 is more disruptive than H2S or CO2,
so this usually indicates the production of hydrogen (common for
sulfur reducers).

METHYL RED/VOGES-PROSKAUER (MRVP)

TEST
As described above, organisms must be able to ferment in order to continue
growing after all terminal electron acceptors are exhausted. While many
different patterns of fermentation exist, they can broadly be classed into
those that produce acidic end products and those that do not. One major
non-acidic fermentative pathway is the 2,3-butanediol pathway, which
produces the compound acetoin (one of the primary flavor molecules in
butter) as a waste product. The MRVP test simultaneously tests for the
presence of low pH (with the indicator methyl red) and acetoin in organisms
that growing on glucose in poorly-buffered media. A positive VP test is a
traditional diagnostic test for Enterobacter species. Along with the Indole
and Citrate tests in the next section, MRVP forms the classical IMViC
diagnostic series.

DIRECTIONS

1. Inoculate two MRVP tubes with each of your unknown organisms.

2. Incubate at each organism's optimum temperature until growth is
observed. If no growth is observed after three class periods, proceed
with the following steps anyway.
3. To one tube of each organism, add 5 drops of methyl red. If the
medium turns red, this indicates that the pH of the medium is < 4.4
and most of the glucose has been converted into acid.
4. To the other set of tubes, add 12 drops of VP reagent I and 3 drops of
VP reagent 2.
5. Cover each tube with a parafilm square and gently mix. Leave open to
the air for 15-30 minutes to oxidize any acetoin present. A positive VP
test will develop a pinkish-red color and indicates that the cells are
converting acidic fermentation products into neutral acetoin.

81
CATALASE TEST
Organisms that are able to tolerate the presence of oxygen have to also be
able to detoxify toxic reactive oxygen species that always form when
oxygen gas is present. One of these toxic compounds is hydrogen peroxide,
and most aerobic organisms produce an enzyme called catalase that
disproportionates peroxide into water and oxygen gas:
Catalase

H2 O 2 H2 O + O 2

Catalase is easily detected because, in the presence of hydrogen peroxide, it

produces vigorous bubbling due to the release of oxygen gas. If you have
ever observed bubbles after applying hydrogen peroxide to a cut, you have
seen catalase (from your red blood cells) at work.

DIRECTIONS

1. To perform the catalase test, place a single drop of hydrogen peroxide

on an isolated colony of Staphylococcus epidermidis. You should see
vigorous production of bubbles as S. epidermidis converts the peroxide
to oxygen gas. This is your positive control – S. epidermidis is a
strong catalase producer.
2. Perform the catalase test on isolated colonies of your unknown
organisms. Record the level of catalase activity as follows:
a. "-" if you haven't seen any bubbles form after 60 seconds
b. "+/-" if you see a very few bubbles after 60 seconds
c. "+" if you see significant bubble formation within 10 seconds
d. "++" if the colony immediately foams up like S. epidermidis.
3. Record the catalase result in your notebook.

82
8.B.ii. CARBON CATABOLISM
YOUR TEAM WILL NEED

• Your unknown organisms growing as lawns on agar plates

o NOTE: these plates must be prepared specially one lab session
before performing this experiment.
• Your original soil sample
• 3 x 9.9 mL sterile saline blank
• 1 Biolog EcoPlate
• P200 and P1000 pipets and tips for each
• Cell spreader and ethanol
• 2 Simmons Citrate slants
• 2 MIO deeps
• Kovacs’ Reagent

The Biolog EcoPlate contains 32 different carbon sources, many of which are
common in natural environments. Each well contains a single carbon source
(see Figure 8.1), inorganic salts and trace metals, and a tetrazolium dye that
will develop a rich purple color if an organism inoculated into the well is able

Figure 8.1. Pattern of carbon substrates on the EcoPlate.

83
to metabolize the carbon source. Each plate has 3 replicate wells of each
carbon substrate; you will inoculate a plate with each of your isolates as well
as a suspension made from the soil you isolated your organism from.

You will also be testing for the ability to use tryptophan and citrate as a sole
carbon source, as these are major diagnostic features for commonly isolated
microorganisms. Simmons citrate agar contains a pH indicator that turns
blue under high pH; metabolism of citrate releases carbonates that alkalinize
the medium. The MIO (Motility/Indole/Ornithine) deep scores three
phenotypes: motility, tryptophan catabolism, and amino acid
decarboxylation. Motility will be observed as growth extending outward from
the stab point. Indole is produced as a byproduct of catabolizing the
aromatic amino acid tryptophan and is detected by a cherry red color after
addition of Kovacs reagent. Ornithine is a simple amino acid, but not one of
the 20 found in organisms. Nevertheless, the same enzymes that catabolize
the carboxyl groups of amino acids can also catabolize ornithine, leaving
putrescine as a by-product. Because putrescine is basic, this causes the pH
of the medium to increase and the pH indicator bromocresol purple turns
purple. Beware! Putrescine smells as bad as you think it would with a name
like that…

DIRECTIONS

1. The lab session prior to performing this experiment, make an extra

agar plate for each of your organisms. These plates should be
streaked as lawns.
a. Using your loop, streak an entire plate with some growth of the
organism
b. Rotating the plate 90 degrees, repeat, streak the entire plate
again with some more growth.
c. Do this two more times, rotating the plate 90 degrees each time.
The goal is to cover the entire plate with growth instead of
selecting for isolated colonies.
2. The day you will perform this experiment, check your lawn plates to
make sure they are free of contamination. If you see any evidence of
multiple organisms on the plate, repeat step 1 and try again next class
period.
3. Place 2 mL of sterile saline from one of the saline tubes directly onto
one of your plates. Using the cell spreader, “scrape” as much growth
as you can off of the agar and into the saline.
4. Using the P1000, remove as much saline + culture as you can back
into the saline tube.
5. Repeat steps 2-4 with the other organism.

84
6. Place approximately 1 g of soil into the third saline blank. Mix by
vortexing for 1 minute, then allow the soil to settle out of suspension.
7. Using a fresh tip for each well, inoculate wells A1-H4 in your EcoPlate
with 200 µL of the saline suspension for your first isolate. Repeat with
the second isolate in wells A5-H8. Inoculate wells A9-H12 with 100 µL
of your soil suspension.
8. Incubate the EcoPlate at room temperature.
9. Streak each of your organisms on a Simmons citrate slant and
incubate at the organism’s optimum temperature.
10. Use an inoculating needle to inoculate a MIO deep with each of your
organisms by stabbing it deeply into the agar. Incubate at your
organism’s optimum temperature.
11. In the next lab session, examine your Simmons citrate and MIO
tubes. A blue color in the citrate tube indicates use of citrate, and a
purple color in the MIO deep indicates amino acid decarboxylation.
12. Add 4-5 drops of Kovacs’ Reagent to the MIO deep. The formation of
a cherry red color indicates that the culture was able to metabolize
tryptophan and produce indole.
13. Inspect your EcoPlate after 1 week. For each carbon substrate,
classify each isolate (and the complete soil community) as either a
non-user (no color), a slow user (weak purple color) or a strong user
(rich purple color).

85
8.B.iii. MOTILITY and CHEMOTAXIS
Some bacteria sit still and let dinner come to them -- or more precisely, rely
on physical forces like water currents, wind, or the movement of animals to
get them from point A to point B. However, many bacteria are pretty good
at moving around on their own. There are several modes of motility in
nature, although here we are mostly concerned with the fastest: flagellar
swimming (unicellular) and swarming (social). Microbes use their flagella
and sensor proteins in their membranes to navigate chemical gradients,
swimming toward things they like (food, light, relatives) and away from
things they don't like (poisons, high temperatures, competing organisms) in
a process called chemotaxis. At its heart, the genetic and enzymatic
mechanisms of motility are relatively simple, but they can be "tweaked" in
many ways, yielding a bewildering variety of behaviors that are fine-tuned to
the particular organism, its unique metabolic requirements, and its social
relationships to the other members of its community. Here we will look at
the type of motility (if any) that your isolates have as well as whether they
like to swim toward or away from particular carbon sources, and also how
they respond to other organisms in their environment.

YOUR TEAM WILL NEED

• Your unknown organisms growing on plates

• Sterile saline
• Sterile toothpicks
• Sterile filter paper discs
• Sterile empty petri dish
• 2 low-carbon swim agar plates
• 3 R2A or BHI swim agar plates
• Forceps
• Broth cultures or saline suspensions (see previous experiment) of your
isolates
• Eppendorf tubes containing 50 µL each of:
o 1% glucose
o 1% serine
o 1% mannose
o 1% phenol (hazardous, use caution)
• P20 pipetter and tips

86
DIRECTIONS
1. BE CAREFUL WITH THE
SWIM AGAR PLATES! The
agar is very soft and will
break if you jostle the
plates too much. Also, they
cannot be inverted like
normal plates.
2. CAREFULLY divide each Figure 8.2. Inoculation patterns for
plate into quadrants with a swim agar plates.
sharpie. Hold it over your
head and mark on it
without turning it upside down. Label the quadrants 1, 2, 3, and 4.
3. Immerse the tips of your forceps in ethanol and flame them like you
would a cell spreader. Place 14 sterile filter paper disks into the empty
petri dish using the forceps. Make sure they are cleanly separated
from each other.
4. Place 10 µL of glucose directly onto two of these disks. Repeat with
the other carbon substrates and different disks.
5. Flame your forceps again. As shown in Figure 8.2A, place a disk of
glucose near the outer edge of quadrant 1 on one low-carbon plate for
each isolate. Repeat with serine in quadrant 2, mannose in quadrant 3,
and phenol in quadrant 4.
6. Now put 10 µL of each of your isolates onto 4 sterile discs.
7. Flame your forceps, then place one of these discs in the exact center
of the low-carbon plate. Place another in the exact center of an R2A
(or BHI) swim agar plate. Repeat with the other isolate.
8. For the second R2A swim agar plate, place discs of your isolates in
each quadrant as shown in Figure 8.2B (yellow dots indicate isolate
1, red dots indicate isolate 2). Make sure each spot is facing the same
organism in one direction and the opposite organism in the other
direction. The spots should be relatively close to the center of the
plate.
9. Place the plates lid-up and incubate at the optimum temperature for
each isolate. If the two isolates on the mixed plate have different
temperature optima, place the plate at the lower of those two optima.
10.Observe the plates over the next couple of weeks. Record whether
they are motile, and if so, what macroscopic form the motility takes
(see Fig. 8.3 for example).

87
 neighbours36. Mu
comes from stud
powerful model
which have som
phenotypes. It wi
swarming of E. co
of other bacteria.

Future direction
For those who a
is a separate and
remain.What ph
the swarming lag
and, if so, how i
pled to swarmin
connection? How
in multicellular r
swarming profici
ing been bred ou
is the ecologica
Although the pe
plate is never fou
occur on nutrien
soils, plant roots a
enjoy various adv
In addition to
Figure 78.3.
Figure | Colony
Somepattern
patternsformation. Various
of motility colony
on swim patterns
agar. Fromformed
Kearns by 2010,
swarming
Nature
factants are pot
bacteria. Uncolonized
Reviews Microbiology agar is black and bacterial biomass is white. a | A featureless swarming motil
swarm formed by Bacillus subtilis str. 3610. b | The bull’s eye pattern formed by in which the sam
Proteus mirabilis str. PM7002. c | Dendrites formed by Pseudomonas aeruginosa str. PA14. the surface of an
d | A vortex formed by Paenibacillus vortex str. V. e | A non-swarming mutant isolate colonization and
of B. subtilis str. 3610. f | A non-swarming mutant isolate of B. subtilis str. 3610 with a isms. Surfactants
suppressor mutant flare that can be seen above-left of the inoculation site. ecules by increas
the surface hydr
ers123–125. Hydrop
and proteomic changes when they come into contact associated, and
with a surface, but these changes are mostly related to may aid bacteria
metabolism and stationary phase, and the expression Bacterial mov
of flagellar genes is unaffected117–119. Furthermore, cells ogenic species to
do not seem to be developmentally ‘committed’ to the from sites of infe
swarming state and tend to rapidly lose their swarming pathogens from
character when transferred to broth80. The swarm lag shown to have e
indicates that swimming cells must change in order In addition, toxin
to become swarming proficient, but it is not clear that swarming moti
swarm cells constitute a true developmental state. diverse species s
range of antibiot
88 Swimming in two dimensions? Researchers who study nism of generali
swarming are often asked: “How do you know that swarm- unrelated to know
Test Positive Negative
Oxidase Bacillus subtilis Enterobacter aerogenes
Nitrate Enterobacter aerogenes, Lactococcus lactis
Pseudomonas aeruginosa
Peptone Iron (H2S Proteus vulgaris, Enterobacter aerogenes
Production) Escherichia coli
Methyl Red Escherichia coli Enterobacter aerogenes
Voges-Proskauer Enterobacter aerogenes Escherichia coli
Simmons Citrate Citrobacter freundii Escherichia coli
MIO Indole Proteus vulgaris Enterobacter aerogenes
MIO Ornithine Enterobacter aerogenes Proteus vulgaris
Decarboxylase
Swim agar Bacillus subtilis, Staphylococcus aureus
Pseudomonas
aeruginosa, Proteus
vulgaris

Controls: The TA should inoculate these cultures as controls so the students

can see different test results.

Required cultures:

Bacillus subtilis

Citrobacter freundii

Enterobacter aerogenes

Escherichia coli

Proteus vulgaris

Pseudomonas aeruginosa

Lactococcus lactis

Staphylococcus aureus

89
8.C. CLINICAL IDENTIFICATION
For the first two centuries that microbiology was practiced, there were no molecular
methods for identifying microbes. Instead, researchers and clinicians identified
them with a battery of tests that, while not as precise or as phylogenetically broad
as PCR, became extremely useful for differentiating the important pathogens that
infected humans, other animals, and plants. Here you will get a taste for what
clinical microbiologists have done for decades – and still do today in most hospital
labs.

YOUR TEAM WILL NEED

• The collected results from all of the experiments in Chapter 8
• Bergey’s Manual of Determinative Bacteriology, Ninth Edition

DIRECTIONS:
1. Bergey’s Manual is a compendium of most of the well-characterized
prokaryotic taxa that contains the guidelines necessary to distinguish
different groups. Early chapters distinguish between the major divisions
of microbial life. In Chapter IV, Bergey’s presents “The Four Major
Categories of Bacteria” which will be your first decision. The Categories
are:
a. Gram-negative bacteria with cell walls
b. Gram-positive bacteria with cell walls
c. Bacteria without cell walls (the mycoplasmas)
d. Archaea

Based on the methods we used to isolate your organisms, you almost

certainly didn’t isolate a mycoplasma. You probably didn’t isolate an
archaeon, and if you got a positive 16S PCR product, you definitely didn’t
(the primers we used only work on bacteria). Therefore your first division
is based on your Gram stain. Keep in mind, however, that many
organisms are Gram-variable.

2. Chapter V divides these major groups into their many sub-groups based
mostly on their morphology and ability to use/tolerate oxygen. Since we
culture our isolates in normal atmospheric air (with oxygen) and in pure
cultures (i.e. without any eukaryotic host cells), we know you don’t have
any obligately anaerobic bacteria or obligate intracellular parasites, which
eliminates many of these groups (Groups 6-9). Assuming we don’t have
archaea or mycoplasmas, we can also eliminate Groups 30-35. Among
the remaining groups, Groups 1-5 and Groups 10-16 are Gram Negative,

90
and Groups 17-29 are Gram Positive. Read the descriptions (pp 17-20)
to see which group fits your organisms the best, and go to the indicated
page to read more. Some key characteristics that are likely to be
important:
a. Was your organism able to grow in the anaerobe jar? If so you
can exclude Groups 2, 4, 12, 14, 16, and 21.
b. Does your organism produce endospores? Then it is a Gram
Positive bacterium in Group 18 (regardless of what your Gram
stain result told you).
c. What shape does your organism have? Cell shape as well as the
presence of multicellular structures are major keys to the
various Groups.
d. The most common isolates from soil come from Groups 4-5, 17-
18, 20, and 22-29 (the Actinomycetes).
e. In particular, the Actinomycetes are very common in soil, very
diverse, and often hard to diagnose. It’s worth investigating the
chapter on these organisms (p. 605) to see if any of them fit
your isolate, especially if you are having difficulty pinning down
what you have.
3. In the sections corresponding to each group, there are a variety of
charts showing how different genera/species respond to many of the
tests you have done. In some cases (e.g. MRVP, catalase) you have
done the exact test indicated. In others (e.g. your Biolog plates) you
may have done tests that are equivalent; if in doubt ask your TA or
use the Internet. Use your results to find the closest match in
Bergey’s. Does it correspond to your 16S ID?
4. Are there other tests you could do that would possibly differentiate
between multiple groups? It is possible that we have the necessary
reagents – ask your TA!

91
LAB WORKSHEET #4
"Who Am I? Why Am I Here?"

In these experiments, you collected information that allowed you to identify your isolates and
gain some more insight into what ecological niches they occupy in nature. The information you
have is: environmental tolerance ranges and optima (from Worksheet 2); carbon compounds
utilized; motility patterns; respiratory TEAs and fermentation pathways used; and the taxonomic
identification of your organism. Use that information to complete this worksheet.

1. Attach your gel photo. Label the lanes.

2. Report the 260/280 ratio of your purified PCR DNA and use it to estimate how pure your
sample was.

3. How long was your quality-controlled sequence? What was its closest match in the
NCBI Database? Was it unambiguous or were there numerous different species that
couldn’t be distinguished from each other with the information you collected?

4. What carbon compounds can your organisms metabolize? What type of molecules are
these (e.g. lipids, carbohydrates, amino acids, etc)? What are some natural sources of
those carbon compounds? Are you likely to find them in the soil?

5. Attach a photo of your gram-stained organisms. Identify them by their Gram result and
cellular morphology.

6. Attach photos of your swim agar plates. Do your organisms swim, and if so how fast,
and toward (or away from) what? How do you think this might affect their ecological
role in the soil community?

7. What was your organism identified as by 16S? What was the closest match in the
Bergey’s manual? Do they agree? If not, what do you think caused the discrepancy?

8. What are some characteristics of your organism according to Bergey's manual and/or the
Internet?

92
9. What terminal electron acceptors can your organism use? What kind of fermentation (if
any) do they perform? Rank the respiratory and fermentative pathways for metabolizing
glucose available to each isolate from most energy gained to least energy gained per mole
of substrate.

10. Does your organism produce catalase? Does this phenotype fit with your observations of
oxygen preferences from Worksheet 2?

11. Use one or more of the following terms to describe your organisms (mix and match
prefixes and suffixes as needed): heterotroph, phototroph, chemotroph, organotroph,
lithotroph, autotroph, nitrate reducer, sulfate reducer

12. Using as much of the above information as possible as well as information from the
previous Worksheets, state a hypothesis about what your organisms’ niches are. Some
possibilities are things like "plant roots", "dead plant decomposer", "animal guts", "plant
leaves", "human skin", etc etc etc. Explain your choice using the data you have
presented, and suggest an experiment that would allow you to test your hypothesis.

13. Assume that you have prepared a professional manuscript about experiments designed to
test what niche your organisms occupied. Write a “Discussion” section and a conclusion
for that manuscript based on the results described above.

93
CHAPTER 9
ANTIMICROBIALS
Humans use a wide variety of antimicrobial compounds to try to restrict microbial
growth. These range from chemical toxins like bleach and hydrogen peroxide to
complex antibiotics like penicillin. These can all also occur as pollutants from human
activity, and can also be produced by microbes. Overuse of some of these has
been shown to favor the evolution of
resistance in the population, and some
strains are naturally more resistant than
others for a variety of reasons. Here, we will
assess levels of resistance to common and
clinically important antimicrobials in your
isolates using a test called a disk-diffusion
assay (or, in the case of antibiotic disk-
diffusion assays, a Kirby-Bauer test). We
will also measure the resistance of your
isolates to heavy metal solutions, since
organisms that can resist these are also often
resistant to antibiotics. Basically, small
pieces of sterile filter paper are soaked with a
defined concentration solution of the
indicated antimicrobial compound. The disk Figure 9.1. Kirby-Bauer disk
is then placed on an agar plate that has diffusion assay. ZOI indicates Zone
been completely covered with bacteria to of Inhibition.
produce a confluent lawn of growth.
Because the antimicrobial diffuses outward into the agar, the farther away a cell is,
the lower concentration of the compound it encounters, and beyond a certain
distance growth is essentially unaffected. After the bacteria have grown, resistance
is measured by the diameter of this zone of inhibition, where no growth occurred,
around the disk (Figure 9.1). Broader zones of inhibition indicate lower levels of
resistance.

Microbes also produce antimicrobials. Indeed, the source of most of our clinically
useful antibiotics is microbes themselves – especially the soil microbes of the genus
Streptomyces. Selman Waksman, who discovered streptomycin and other
antibiotics, used a technique called “cross-streaking” to determine if one bacterial
strain was able to inhibit the growth of another. You will replicate his method here.

94
i. ANTIMICROBIAL RESISTANCE
YOUR TEAM WILL NEED

1. Fresh plates of your isolates

2. 18 R2A or BHI plates
3. Inoculating loop
4. Forceps
5. Antibiotic disc dispensers
6. Solutions of manganese, lead, and zinc (careful, these are toxic)
7. Sterile filter paper discs
8. Empty, sterile petri dishes
9. Digital caliper

DIRECTIONS:

1. Label agar plates appropriately: 9 plates for each of your isolates. For 3
plates for each isolate, use a sharpie to divide the plate into three sectors
and label these “Zn”, “Mn”, and “Pb”.
2. Using your inoculating loop, completely cover the plates with growth from
one of your isolates. Rotate the plates 90 degrees and repeat. Repeat
twice more, rotating 90 degrees each time.
3. Using ethanol-flamed forceps, place disks containing the 8 antibiotics
(Table 9.1) evenly across the surface of your plates, using 4 disks per
plate. Put replicate disks of the same antibiotic on different plates.
4. Place 6 sterile filter paper discs into a clean petri dish. Place 10 uL of Zn
solution on each, and then place them on the appropriate sectors of your
plates. Repeat with the other metals.
5. Incubate each plate at the appropriate temperature for your isolate.
6. In the following class period, examine your plates. Measure the diameter
of each zone of inhibition using digital calipers and record it in your
notebook.

ANALYSIS:
a. Calculate the mean and 95% confidence interval for the zone of
inhibition of each isolate for each compound.
b. Report these values for your two isolates in a table as mean +/-
confidence interval.
c. Compute unpaired t-tests for each of your isolates vs. each other for
each antimicrobial. Are your isolates significantly different from each
other? Is one conspicuously more resistant than the other?

95
 d. Share your data with the other teams in your section. Are there any
antimicrobials that either of your isolates are conspicuously more
resistant to than the other isolates? If so, why do you think that might
be?
e. Consult the "ZOI" column in Table 1. Use one-sample t-tests to
determine if either of your isolates are clinically resistant to any
antibiotics. If so, look in the literature to see if you can find
information on whether other closely-related organisms are also
resistant. Are your isolates unusual?

Table 9.1. Antibiotics used in this experiment.

Antibiotic Class ZOI (mm)1 Mechanism of

Action
Penicillin b-lactam <28/<14* Cell wall synthesis
Ampicillin b-lactam <13/<28** Cell wall synthesis
Cephalothin Cephalosporin <14 Cell wall synthesis
Chloramphenicol Unique <12 Protein synthesis
Erythromycin Macrolide <13 Protein synthesis
Gentamicin Aminoglycoside <12 Protein synthesis
Streptomycin Aminoglycoside <11 Ribosome
proofreading
Vancomycin Non-ribosomal <9 Cell wall synthesis
peptide
* Staphylococci/all other bacteria; ** Gram negative/Gram positive
1
ZOI means Zone of Inhibition; any ZOI with diameter less than this value in
considered clinically resistant.

96
ii. ANTIMICROBIAL PRODUCTION
YOUR TEAM WILL NEED

1. Fresh plates of your isolates

2. 6 R2A or BHI plates
3. Inoculating loop

DIRECTIONS:

1. You will make cross-streak plates to

test your organisms out against each
other and against the other isolates in
your lab section (see Fig. 9.2). Make
sure to label all plates appropriately.
2. On 3 plates, “paint” one of your Figure 9.2. A streak plate testing
isolates along a single line at the your organism against the isolates
middle of the plate as shown. Repeat from two other teams. Based on
with the other isolate and the these results, your isolate inhibited
remaining 3 plates. Team 1’s isolate 2, and Team 2’s
3. On one plate for each isolate, draw 4 isolate 2 inhibited your organism.
lines of the opposite isolate
perpendicularly across main line as shown. Flame your loop in between
lines.
4. On the second and third plates, have the members of the other groups in
your section draw perpendicular lines with their isolates. Make sure to
record the names of each isolate on the appropriate plate so you know
“who is who”.
5. Incubate at an appropriate temperature (ideally one where all of the
organisms can grow).
6. Inspect the plates the next lab period. Note any zones of clearance
where two streaks interact. Also note any other interesting phenotypic
changes.
7. Obtain the species IDs of any isolates that your organism inhibits, or that
inhibit your organism. Are there any trends? Is your organism easy to
inhibit, or does it inhibit many others?

97
LAB WORKSHEET #5
“Offense and Defense”

In these experiments, you measured your isolates’ resistance to a variety of toxic compound,
including antibiotics and heavy metal ions. Use the data you collected to answer the following
questions. Make sure you also complete either Worksheet 5A (Stress Tolerance) or 5B
(Competition) depending on which other set of experiments you performed.

1. For each antibiotic and toxic metal, make a bar graph comparing the average zone of
inhibition for each of your isolates, with error bars representing the 95% confidence
intervals. For each toxin, indicate if one isolate is significantly more resistant than the
other (use unpaired t-tests to compare replicate measurements of the two isolates).
Place asterisks above pairs that are significantly different: * = p < 0.05, ** = p < 0.01,
*** = p < 0.001.

2. Is one of your isolates generally more resistant to antibiotics than the other? If so, is it
also more resistant to heavy metals? Explain your answer.

3. For each isolate and each antibiotic, use a one-sample t-test (page 117) vs. the
appropriate ZOI value for clinical resistance. Make a table with one row for each
antibiotic and one column for each isolate; fill the cells with the p-values from these tests.
Are any of your isolates clinically resistant to any of the antibiotics? If so, which ones?

4. Make a table with all of the class’ isolates (including yours) in one column and two more
columns with representing your isolates. For each pairwise interaction, indicate “++” if
both organisms grew, “+-” if your isolate inhibited the other isolate, “-+” if the other
isolate inhibited your organism, or “- -” if neither organism grew (they inhibited each
other). In the bottom two rows, enter the total number of organisms that inhibited each of
your isolates, and the total number of organisms each of your isolates inhibited.

Test Streak Isolate 1 Isolate 2

Isolate 1 ++ -+
Isolate 2 +- ++
Other team Isolate 1 +- -+
Other team Isolate 2 +- -+
Other team Isolate 3 ++ -+
# Inhibited 3 0
# Inhibited by 0 4

5. Are either of your isolates antibiotic producers? If so, are they also resistant to antibiotics
produced by other organisms? If in doubt as to which of your classmates’ isolates are
antibiotic producers, ask around.

98
Chapter 10
STRESS TOLERANCE
WHAT CAN YOUR BACTERIA WITHSTAND?
So far, we've put a lot of effort into understanding what your microbes "like" --
their favorite temperature and pH, what they like to eat, whether or not they like
oxygen, and so forth. But like all living things, microbes spend a great deal of their
time in sub-optimal conditions and even in environments so stressful they are
unable to grow and face the real possibility of death. In many ways, microbes are
more vulnerable to stress than larger organisms. For example, their high surface
area to volume ratio means that toxic chemicals diffuse more rapidly from the
environment into their cells; their slow swimming speeds make it hard for them to
get away from adverse environments; and their unicellularity means they don't
have the option to jettison damaged cells via apoptosis the way that multicellular
animals and plants can. On the other hand, microbes also have distinct advantages
that make them much more tolerant of some stresses. For instance, the relative
simplicity of their genetics and metabolism make them less vulnerable to radiation
and other mutagens; their tiny size helps them survive freezing; and their
enormous metabolic flexibility relative to multicellular eukaryotes means that many
microbes can rapidly adapt to radically changed environmental conditions that
would be lethal to nearly all multicellular life.

Abiotic stresses like the above aren’t the only stresses that microbes face – they
also have to deal with other microbes (and macroscopic organisms) in their
environment that want to outcompete them. Sometimes this direct competition
takes the form of the two strains simply trying to grow faster than the other – but it
often occurs that one or both attempt to directly kill the competitor, using
antibiotics or other strategies. In environments where antibiotics are being used,
organisms also often develop resistance adaptations, leading to an evolutionary
arms race between different strains.

As with any other trait, stress tolerance and antibiotic production/resistance varies
between microbial strains. It should not surprise you to learn that more stressful
environments tend to select for organisms with higher stress tolerance. For
instance, cyanobacteria from the ultra-cold and dry Antarctic Dry Valleys have
world-record levels of tolerance to desiccation and freezing. However, it might
surprise you to learn that they also have exceptionally high tolerance to many other
stresses, including oxidative stress and UV radiation, despite these not being
particularly important in their natural habitat. In many cases, resistance to one
type of stress leads to cross-resistance to many other kinds, because the stress
response mechanisms are related. Whether stress comes from heat, cold,
radiation, osmotic shock, or antibiotics, microbial survival is enhanced by very

99
similar adaptations, including antioxidants, chaperone proteins, and DNA repair
machinery.

Understanding microbial stress tolerance and competition is of great importance

both to our understanding of the biogeochemical role of microbes in the
environment and to our engineering of human environments to minimize disease.
How does microbial activity change in frozen lakes, or in globally warming oceans?
How quickly does a germicidal UV lamp sanitize a medical work surface? How much
penicillin does it take to reliably kill a pathogen? These questions will have different
answers for different strains. In these experiments we will see how tough your
isolates are, and consider how that might affect their role and competitive ability in
their natural environment.

NOTE: These experiments require liquid cultures of your isolates. If your

organisms grow poorly in liquid media, you will need to resuspend colonies in saline
to achieve a liquid culture (see experiment 8.B.ii above).

SPOT TITER PLATING

You've done many viable-count
spread plates this semester. Some of
the experiments here will use a
similar technique, but designed to
look at many dilutions on a single
plate. The reason for this is that we
will not have a very good idea how
many living bacteria are in a sample,
because we are actively trying to kill
them off. The "spot titer" plates you
will make here are not as accurate as
full spread plates because you often
can't count individual colonies, but
you can see growth over a much
wider range of dilutions. Whenever an
experiment calls for you to set up a
spot titer plate, use the following
protocol, which is demonstrated Figure 10.1. Spot titer rows.
graphically in Figures 10.1 and 10.2.

DIRECTIONS
1. You can put up to 4 rows of 4 spots each onto a single plate. Each row
represents a single series of 4 dilutions for one culture. See Figure 10.1 for
an example.
2. You will titrate cultures into sterile saline droplets placed inside empty, sterile
petri dishes. For each plate you wish to make, take one petri dish (bottom or

100
 lid) and make 4 rows containing 4 90 uL droplets each of sterile saline. The
droplets will hold together because of surface tension.
3. If you are titrating from a dense overnight culture, you will need to first
dilute the culture by placing 100 uL into a 9.9 mL sterile saline dilution blank
and vortexing (Fig. 10.2A). If you are starting from a non-opaque culture,
you do not need to perform this pre-dilution step.
4. Make sure to label your agar plates such that you know which row
corresponds to which culture/treatment.
5. For the first culture to be diluted, place 10 uL from the culture (or the pre-
dilution tube) into the top left saline droplet (Fig. 10.2B). Only press down to
the first stop on your pipet to avoid splattering liquid. Pipet up and down to
mix.
6. Change tips and then pipet 10 uL from the first droplet to the droplet
immediately to its right (Fig. 10.2C).
7. Repeat step 6 for the final two droplets in the row. Using the last tip and
moving right to left, place 10 uL from each droplet in a row on the agar plate
(Fig. 10.2D). Again, the surface tension should hold the droplets together,
but be careful not to jostle the plate until the drops have absorbed into the
agar.
8. Proceed with the second culture and the second row of droplets; continue
until all four cultures have been diluted and placed on the agar plate. Let the
plate sit lid-up until the droplets absorb into the agar, then invert and place
in the appropriate incubator.

Figure 10.2. Spot titer

plating. A culture is first
diluted 100-fold into sterile
saline (A), then sequentially
diluted 4 times in a 96-well
plate (B and C) before being
"spotted" onto an agar plate
(D).

101
i. HEAT SHOCK

All organisms have an optimal temperature, where growth and metabolism

are maximal and stress is minimal. However, it is common for organisms to
spend some time in environments that deviate from this optimum. When
temperatures change gradually, many organisms can continue to grow
across a very wide range of temperatures. However, sudden shifts in
temperature are much more difficult to accommodate, and this is especially
true for very small organisms whose internal temperatures equilibrate
rapidly with the external environment. As an example of problems that
"heat shock" can cause, E. coli can be transformed with foreign DNA by heat
shocking it, because the sudden temperature change actually causes holes
to open up in its cell membrane! Here, we will test your organisms to see
how tolerant they are to heat shock.

YOUR TEAM WILL NEED

1. Your isolates in sterile saline at approximately 107 CFU/mL

2. P1000, P200, and P20 pipets and tips
3. Thermal cycler
4. Sterile PCR tubes x 8
5. Ice bucket
6. Sterile saline and sterile petri dishes for spot-titering
7. 2 R2A or BHI plates

DIRECTIONS

1. Place 50 µL of each of your isolates into 4 separate sterile PCR tubes.

2. Place 3 of the tubes in the thermal cycler. Put the other tube in an ice
bucket.
3. Set the PCR thermal cycler to run the "heat shock" program. Program it
to use a maximum temperature 10 C warmer than the optimal
temperature for your organism. The program will start with a 15 minute
incubation at 4 C, then rapidly raise the temperature rapidly to the heat
shock temperature and hold it for 3 minutes before returning to 4 C.
4. If necessary, run the cycle separately for your two organisms.
5. After the cycle runs, take all of your tubes and make spot titer plates with
all 3 replicates and the control for one isolate onto a single plate.
6. Incubate the titer plates at the appropriate temperature for your isolate.
7. In the next class period, quantify each dilution series. Pick the most
dilute spot titer that has growth and attempt to count the colonies (best
guess is okay if they are overgrown). Convert each count to CFU/mL.

102
ii. FREEZE/THAW TOLERANCE

Freezing is almost always lethal for multicellular organisms, and even for
larger, eukaryotic microbes. This is because the microscopic structure of ice
works like spears to disrupt membranes, killing cells. In order to survive
freezing temperatures, cells have three options. First, they can depress the
freezing temperature in their local environment, for instance by secreting
solutes -- analogous to how humans salt the roads when it snows. Second,
they can control the structure of the ice, using ice-nucleating proteins to
channel the ice crystals around critical membranes and prevent ice damage.
Bacteria that generate these types of proteins are common in the
atmosphere and in many cases form the core of hailstones. They are also
found growing very slowly in brine channels a mile beneath the surface of
Antarctic glaciers. Here, we will measure your isolates' ability to survive
being frozen.

YOUR TEAM WILL NEED

1. Your isolates in sterile saline at approximately 107 CFU/mL

2. P1000, P200, and P20 pipets and tips
3. Sterile Eppendorf tubes x 8
4. Room temperature water bath
5. Floating tube rack
6. Liquid nitrogen
7. R2A/BHI plates x 4
8. Sterile saline and petri dishes for spot titers

DIRECTIONS

1. Place 100 µL of each of your isolates into four separate sterile Eppendorf
tubes.
2. Place three tubes of each organism in the floating tube rack. Give to your
TA to immerse in liquid nitrogen. Leave the fourth tube on the bench.
3. Remove the tubes from liquid nitrogen and immerse them in room
temperature water to quickly unfreeze them.
4. Do spot titer plates for each tube.
5. Repeat steps 2-4.
6. Incubate the titer plates at the appropriate temperature for your isolate.
7. In the next class period, quantify each dilution series. Pick the most
dilute spot titer that has growth and attempt to count the colonies (best
guess is okay if they are overgrown). Convert each count to CFU/mL.

103
iii. ULTRAVIOLET RESISTANCE

The majority of life on earth depends on light for its existence. Plants,
algae, and photosynthetic bacteria use pigments to extract energy from light
and use it for chemical work, including the fixation of carbon by
photosynthesis. However, the same energetic properties of light that drive
metabolism can also cause cellular damage, and the higher energy, shorter
wavelengths of ultraviolet light are much more destructive than visible light.
UV can cause damage directly, for instance by modifying DNA bases (Figure
10.3). It can also cause indirect damage by photo-oxidizing small carbon
compounds, producing free radicals that can non-specifically attack most
biological molecules.

Microbes (and other living things)

have a number of defenses
against UV damage. First, they
can use pigments and other
antioxidant chemicals to intercept
high-energy photons and trap
their energy in non-reactive
forms. As an example, the
orange pigment b-carotene found
in plants is capable of directly
absorbing UV photons and
dispersing them as harmless
heat, and can also detoxify light-
Figure 10.3. Thymine dimers produced free radicals. Second,
organisms can counter UV
caused by UV radiation damage with general stress
resistance enzymes such as
catalase and chaperones. Third, many organisms express DNA repair
enzymes that specifically target the types of damage caused by UV. A key
example found in many bacteria is photolyase, which uses energy from
visible light to break apart thymine dimers. We will be specifically testing for
the activity of photolyase in this experiment.

104
YOUR TEAM WILL NEED

1. Your isolates in sterile saline at approximately 107 CFU/mL

2. P1000, P200, and P20 pipets and tips
3. Handheld UV lamp
4. Face shield
5. Empty petri dishes x 4
6. Sterile saline and petri dishes for spot titers
7. Aluminum foil
8. 6 R2A/BHI plates

DIRECTIONS

1. Take four sterile, empty petri dishes. Pipet 100 µL of each of your
organisms into well-separated spots in each. The surface tension of the
spot should hold the drops together. Make sure you know which spot
corresponds to which organism.
2. Take a piece of aluminum foil and cover one of the petri dishes as
thoroughly as you can without disturbing the drops.
3. Wearing a face shield and being cautious not to expose any of your
classmates, use the hand-held UV lamp to expose one of the uncovered
dishes to 10 seconds of UV light. Hold the lamp approximately 6 inches
above the plate. Have a teammate time the exposure with a stopwatch.
4. Repeat with one of the covered plates. Immediately replace the
aluminum foil as soon as the exposure is finished.
5. The remaining two plates are light and dark controls; do not expose
them to UV.
6. Make spot-titer plates for each droplet as described above. Do titer rows
for all 4 treatments of the same organism on the same plate.
7. After 10 minutes, repeat steps 3-6 but increase the exposure time to 30
seconds. Make sure to re-expose the SAME two plates, leaving two
unexposed plates as controls, and make sure to replace the foil on the
dark-incubated plates.
8. Repeat once more, increasing exposure time to 90 seconds.
9. Incubate all plates at the appropriate temperature for the isolates.
10. In the next class period, quantify each dilution series. Pick the most
dilute spot titer that has growth and attempt to count the colonies (best
guess is okay if they are overgrown). Convert to CFU/mL.

105
iv. OSMOTIC SHOCK
Like temperature, all organisms that live in liquid environments have an
optimal solute concentration where metabolism and growth are maximal,
and respond to sudden changes in their osmotic environment as stresses.
The media we have been growing your organisms in has a low solute
concentration; we will test how they respond to being suddenly introduced to
either a VERY low solute environment, or a very high solute environment.

YOUR TEAM WILL NEED

1. Your isolates in liquid medium at > 107 CFU/mL

2. P1000, P200, and P20 pipets and tips
3. 2 x 1 mL Eppendorf tubes of sterile R2A, ultra-pure water, artificial
seawater, and 30% NaCl
4. 6 R2A/BHI plates
5. Petri dishes and sterile saline for spot titers

DIRECTIONS

1. Place ~10 µL of each of your organisms into one tube of each salt
concentration. Vortex to mix.
2. Incubate at room temperature for 15 minutes, then perform spot-titers
for each tube, placing all 4 treatments for the same organism on a single
plate.
3. After 45 minutes, do another set of spot-titers.
4. Incubate the titer plates and the tubes at the appropriate temperature
for your isolate.
5. In the following class period, perform a final series of spot-titers for each
tube and incubate the resulting plate at the appropriate temperature.
6. Quantify each dilution series. Pick the most dilute spot titer that has
growth and attempt to count the colonies (best guess is okay if they are
overgrown). Convert to CFU/mL.

106
ANALYSES for experiments i-iv:
1. For UV and osmotic shock experiments:
a. For each of your isolates and each treatment, calculate the slope of the
regression line for log (CFU/mL) vs. time of exposure using the linest
function in Excel (Appendix 5).
b. For each isolate, make a bar graph of UV killing efficiency showing the
negative of the slope for each treatment (light and dark control, light
and dark UV exposure) along with the 95% confidence interval of the
slope as error bars. Are the slopes significantly different (i.e., do the
error bars overlap)? Does UV have an effect on your isolates? Is one
isolate more resistant than the other?
c. For each isolate, make a bar graph of osmotic shock killing efficiency
showing the slope for the control and each salt level along with the
95% confidence interval of the slope as error bars. Are the slopes
significantly different? Is one of your isolates more resistant to
osmotic shock than the other?
d. Use the UV graph to predict whether your isolates express photolyase.
e. Share your data with the other teams in your section. Are either of
your isolates conspicuously resistant in comparison to other groups? If
so, why do you think that is?

2. For heat shock and freeze-thaw experiments:

a. For each replicate of each isolate, calculate survival as the percentage
of CFU/mL in the treatment culture vs. the non-heat shocked control.
Calculate the mean and 95% confidence interval of this value.
b. Plot percent survival for both you isolates as a single bar graph with
error bars.
c. Use t-tests to determine if your isolates are different than each other.
d. Share your data with the other teams in your section. Are your
isolates conspicuously more resistant than other isolates? If so, why
do you think this might be?

107
LAB WORKSHEET #5a
"Anxiety"

In these experiments, you investigated the response of your organisms to two of four different
stress conditions. Use your data to answer the following questions.

1. For the two tests you chose to perform, provide the required graphs and statistical tests
described in the “Analysis” section.

2. Are either of your isolates significantly more resistant to these stresses than the other?
Compare the error bars -- do they overlap? Is the same isolate more resistant to both? Is
there a correlation between stress resistance in these experiments and your isolates’
antibiotic and metal resistance profiles (Worksheet 5)?

3. Based on the stress tolerance and antimicrobial profile of your organism, refine the
hypothesis you stated in Worksheet 4. If either of your isolates is strongly resistant
and/or strongly inhibitory, how does this give them an advantage? If they are generally
susceptible to damage, why do you think they can get away with this? What does this say
about their ecology?

4. Write a “Methods” section for these experiments (both the Antimicrobials and Stress
Tolerance experiments).

108
CHAPTER 11
MICROBIAL COMBAT COMPETITION
Like all organisms, microbes have evolved for billions of years, adapting to
the many physical and chemical
environments offered by planet Earth. In
fact, microbes evolve much more rapidly
than larger organisms because of their short
generation times and vast population sizes.
For this reason, it's a good bet that the most
abundant organisms in an environment --
i.e., the ones you're most likely to isolate --
are very well adapted to that environment.
However, if they are coexisting, it's also a
good bet that they are differentiated
somehow based on their metabolic
requirements. In other words, coexisting
organisms generally occupy different
niches. Traditionally, ecological theory
predicts that only one species can occupy a
single niche in a single place at a time, an
idea called the competitive exclusion
principle.

In this experiment, we'll learn how to measure the fitness of two organisms
using direct head-to-head competitions, which will give us insights into what
niches different organisms occupy. To do this, your team and another team
will choose isolates to "fight" in different environments like microscopic
gladiators.

By now you've done quite a few tests on your two environmental isolates.
You know your isolates’ fundamental niches, and you know how resistant
they are to a variety of stresses and whether or not they You've probably
seen some tests that suggest scenarios where one isolate grows better than
the other in a certain environment. You may have also noticed that other
teams' isolates also have different metabolic abilities and environmental
preferences; some are similar to yours, others are quite different. In other
words, the organisms have different niches, and we can hypothesize that, if
forced to share a niche, one will competitively exclude the other.

In this exercise, you and one other team will pick a pair of isolates to wage
war against each other in two different arenas of your choosing.

109
 MICROBIAL COMPETITION RULES!
1) You must choose isolates that produce colonies that can be clearly distinguished
from each other on agar media. There are two ways to make this happen:
a. Pick isolates that make very different colonies (color, shape, or both) on a
common medium, or
b. Pick isolates that each have a particular type of medium where only one
of them will grow at all.

2) You will pick two environments (or "arenas") for the battle to take place. Each
team gets to pick one environment. You should pick your environment such
that you expect your warrior to "win the battle". Some ideas:
a. Different temperature, pH, or salinity
b. Nutrient broth supplemented with different carbohydrates
c. Anaerobic vs. aerobic growth
d. Solid vs. liquid media
e. Environments exposed or not exposed to some sort of stress, like heat
shock or UV

3) Both arenas have to support the growth of each organism

4) Choose your isolates carefully -- it's okay to play dirty tricks, like picking
antibiotic producers.

Competition Day -1:

DIRECTIONS
1. Decide what arenas you want to perform your competitions in, figure out what
media and resources you will need and how much, and tell your TA.
2. Write down your predictions about which isolates will prevail in each arena.

Competition Day 0:
DIRECTIONS
1. Label 2 tubes (or plates) of each competition medium.
2. Inoculate each competing isolate BY ITSELF into one tube or plate.
3. If isolates are to be grown in broth, inoculate with a single isolated colony.
4. If isolates are to be grown on plates, streak for a confluent lawn.
5. Incubate the organisms under the competition conditions. They will stay there
until you begin the competition. Note that this step is to acclimate the cells to
the competition conditions, so that they start out "on a level playing field"
metabolically.

110
Competition Day 1:
YOUR TEAM WILL NEED

• 3 tubes/plates of each competition medium -- these are the arenas

• 18 quantification plates (probably R2A or BHI, but can vary)
• 12 9.9 mL saline dilution blanks, plus 2 extra for each competition
done on solid media
• Extra sterile saline
• Acclimated unknown cultures
• Sterile Eppendorf tubes

DIRECTIONS

1. Label 3 arenas "Cond1-1" through "Cond1-3" meaning, for instance,

"Condition 1, replicate 1". Label the other 3 arenas "Cond2-1" through
"Cond2-3". Also include your teams' names on your tubes/plates.
2. Label your dilution blanks "C1-1" through "C2-3", #1 and #2. In other
words, 2 dilution blanks per arena.
3. Label quantification plates "C1-1" through "C2-3" #1, #2, and #3. In
other words 3 plates per arena. Also write "Day 1" on each plate.
4. FOR COMPETITIONS DONE IN LIQUID MEDIUM ARENAS:
a. Vortex your acclimated isolates cultures to mix.
b. Add approximately 106 CFU/mL of each isolate to each arena tube.
c. Vortex arena tubes. Pipet 100 µL from each arena tube into the
appropriate #1 dilution blank.
d. Place tubes in appropriate incubation conditions.
5. FOR COMPETITIONS DONE ON SOLID ARENAS:
a. Pipet 1 mL of sterile saline from one dilution blank onto each
acclimated unknown plate.
b. Using a cell spreader, carefully resuspend the bacterial growth from
the unknown plate into the saline. Tilt the plate so that the saline
collects at the bottom, and "wash" the agar surface to get as much
growth as possible into the saline.
c. Pipet as much of the saline as you can off of the plate and into an
eppendorf tube.
d. Label 2 dilution blanks with your organisms' names.
e. Pipet 50 µL of resuspended cells into the appropriate dilution blank
and vortex. Use OD to dilute to approximately 107 CFU/mL
f. Pipet 50 µL of each competitor into the center of each arena plate.
g. For most competitions, you will spread the competitors across the
entire surface of the agar using a flamed spreader.

111
 h. Rarely, you may wish to leave the cells in the center of the plate
(e.g., a motility race). In this case, leave the plates lid-side up until
the 100 µL of saline soaks into the agar.
i. place in appropriate incubation conditions.
j. Pipet 50 µL from each unknown dilution tube into the appropriate
#1 dilution blank.
6. Vortex dilution blanks and pipet 100 µL from each #1 blank into each #2
blank.
7. Vortex #2 blanks.
8. Spread plate 5 µL from #2 blanks onto appropriate #1 plates.
9. Spread plate 50 µL from #2 blanks onto appropriate #2 plates.
10. Spread plate 5 µL from #1 blanks onto appropriate #3 plates.
11. Incubate plates at 30º C.
12. Important: place dilution blanks (and eppendorf tubes) in the
refrigerator until the next class!

Competition Day 2:
YOUR TEAM WILL NEED

• 18 9.9 mL saline dilution blanks

• 18 quantification agar plates
• Sterile Eppendorf tubes

DIRECTIONS

1. First, check your Day 1 plates. There should be at least one plate with
between 20-500 colonies and with both of your competitors represented.
2. If none of your plates have a countable number of colonies, go back to
your saved dilution blanks and plate more or less as necessary to achieve
countable plates. MAKE SURE TO KEEP UP WITH YOUR DILUTION
FACTORS!
3. For today's plating, label dilution blanks "C1-1" through "C2-3", #1
through #3. In other words 3 dilution blanks per competition tube.
4. Label quantification plates "C1-1" through "C2-3" #1, #2, and #3. In
other words 3 plates per arena. Also write "Day 2" on each plate.
5. FOR COMPETITIONS DONE IN LIQUID ARENAS:
a. Vortex arena tubes.
b. Pipet 100 µL from each arena tube into the appropriate #1 dilution
blank.

112
6. FOR COMPETITIONS DONE ON SOLID ARENAS:
a. Pipet 1 mL of sterile saline from one dilution blank onto each
competition plate.
b. Using a cell spreader, carefully resuspend the bacterial growth from
the arena plate into the saline. Tilt the plate so that the saline
collects at the bottom, and "wash" the agar surface to get as much
growth as possible into the saline.
c. Pipet as much of the saline as you can off of the plate and into a
sterile Eppendorf tube.
d. Pipet 100 µL from the Eppendorf tube into the appropriately labeled
dilution blank #1.
7. Vortex dilution blanks and pipet 100 µL from each #1 blank into each #2
blank.
8. Vortex #2 blanks and pipet 100 µL from each #2 blank into each #3
blank.
9. Spread plate 5 µL from #3 blanks onto appropriate #1 plates.
10. Spread plate 50 µL from #3 blanks onto appropriate #2 plates.
11. Spread plate 5 µL from #2 blanks onto appropriate #3 plates.
12. Incubate plates at 30º C.
13. Important: place dilution blanks (and eppendorf tubes) in the
refrigerator until the next class!
14. Count your Day 0 plates. Use red and black sharpies to mark the
different competitors.

Competition Day 3:
DIRECTIONS

1. Count your Day 1 plates. Use red and black sharpies to mark the different
competitors.
2. If none of your Day 1 plates have countable numbers of colonies (20-
500), go back to saved dilution blanks and plate more or less to achieve a
countable number of colonies.

113
LAB WORKSHEET #5b
“Combat”

In these experiments, you pitted one of your isolates against another team’s isolate. Use the data
you collected during this gladiatorial combat to answer the following questions.

1. Describe the arenas that you used. What did you predict the outcomes of your competition
experiments would be? Why?

2. For each time point, calculate CFU/mL using the dilution factor and your colony count. Do
this for each competitor separately. Then, for each competition, calculate the Malthusian
parameter of each competitor in each replicate:
N/
m = ln
N*

3. Express the fitness of each competitor as either the ratio or the difference of the Malthusian
parameters (do this separately for each replicate). Both are legitimate methods for
calculating fitness; only the latter is possible if either of the organisms decreased in
abundance over the course of the experiment.

4. Compute the mean, standard deviation, and 95% confidence intervals of fitness
measurements for each set of replicates. Plot these as a bar graph with error bars showing the
95% confidence interval.

5. Use an unpaired t-test (see Appendix 3) to determine if the difference between the means is
statistically significant.

6. Are the results you observed here consistent with your predictions from before the
competitions were performed? If so, can you think of reasons why your predictions might
have been wrong?

7. Based on the competition results and antimicrobial profile of your organism, refine the
hypothesis you stated in Worksheet 2 – what allows these organisms to coexist when they
are under constant competition? How might their interactions be different in the soil
environment?

8. Write a “Methods” section for these experiments (both the Antimicrobials and Competition
experiments).

114
CHAPTER 12
HYPOTHESIS TESTING
You have now spent weeks getting to know your bacterial isolates. You've
learned their names, what they like to eat, how to make them comfortable,
and what they are afraid of. You've even tried to make them look pretty.
It's like you're best friends! Now it's time to sit down and have a heart-to-
heart discussion with them -- they have all sorts of stuff they'd like to tell
you.

Here, you will design and execute new experiments to learn something
previously unknown about your microbes and how they make a living
together in their natural environment. Use what you've learned in lab as
well as what you've learned in lecture (and anywhere else) to figure out
some aspect of your isolates' biology that 1) you know enough about to ask
meaningful questions about it but 2) raises some kind of question that your
team finds interesting. Make sure you pick something that you are
interested in -- you will need to write about it, and it's a lot easier to write
about something if you're interested in it.

Some guidelines:

1. Start by pulling all of your information together into one place --

environmental tolerances, carbon substrates and terminal electron
acceptors utilized, stress resistance phenotypes, whatever you've
learned based on the identification of your organism. Use your
completed worksheets as a resource.
2. Now look at the photos of your agar art. Pay close attention to how your
isolates interact with each other and with other species. If anybody else
used your isolates, look at their art too. Make a list of strange,
unexpected, or perplexing things they did in the art. Add to this list any
other "weird" observations you've made about how your isolates act --
times they didn't do what they were supposed to do, various ways that
they are finicky to grow, things that affected their appearance or color,
etc.
3. Look at these two lists -- the "objective science" list and the "art and
other weird stuff" list and start thinking about it. Brainstorm out loud.
Do you think any of the things in one list are related to things in the
other? Write down a few possible ideas.
4. Now look at your hypotheses and start thinking of ways they could be
tested using experiments. Settle on one that is both interesting and
"doable" using the resources in the lab.

115
Once you've settled on a hypothesis, it's time to design your experiments.
Here's a checklist to get you started:

1. Make sure that every measurement you make is replicated. Have in

mind what statistics you will use to test your hypothesis before you
collect your data. (Appendix 7 has a useful flow chart for deciding
what statistics are appropriate for different kinds of hypotheses.)
2. Make sure you include controls. When you are thinking about what
controls to use, try to imagine what criticisms a person might raise
about your experimental design, and craft controls to counter those
concerns.
3. Plan to spend several weeks working on your experiments. Plan at
least one follow-up experiment based on the results of your first
experiment. Also be prepared to repeat experiments that don't work
the first time.

Your final paper will be written in style of a professional research paper,

written as a team effort. First, your team should work together to analyze
the data and produce figures, tables, and an abstract. At that point, you
should decide how to divide the labor of writing the final paper. A good
solution is to have different team members write the first draft of each
section, and then get together to edit the finished document. Using Google
Docs is a good way for everyone to work on the final draft together at the
same time.

Try to get as much done as possible before the second-to-last lab period --
we will peer review each other's work at that point and try to sharpen up the
final papers.

You will also make a poster and present it on the last day of lab. These
posters are all eligible to be presented at university undergraduate research
expos, and we would love to help you make that happen if you’re interested!

Last, your data from these experiments might be used by subsequent

students as the basis for their own experiments. We ultimately hope to be
able to turn some of your discoveries into publishable papers, and if that
happens you will have the opportunity to participate in the manuscript
preparation process, and to be a co-author when the paper is finally
published.

So have fun, and do some science!

116
APPENDICES

Appendix 1: Calculating Dilution

Factor
CALCULATING THE DENSITY OF A CULTURE
The viable count plating method works by diluting a culture until plates can
be spread with only about ~100 cells. If we know how much the culture was
diluted prior to plating, we can back-calculate to figure out how dense the
original culture was. The easiest way to do this is with a dilution factor.

To calculate a dilution factor for a simple dilution, divide the volume of the
original solution by the total volume of the diluted solution. For instance, if
you put 100 µL of a culture into 9.9 mL of sterile saline, the dilution factor
0.1 mL
would be =0.01. If you perform multiple sequential dilution steps, you
10 mL
simply multiply each dilution factor to get a final overall dilution factor. So,
if you diluted the culture above into a second 9.9 mL sterile saline blank,
giving a second dilution factor of 0.01, the overall dilution factor would be
0.01 x 0.01 = 0.0001 or 1x 10-4. If you were to then plate 50 µL of this
second dilution, you simply multiply by the volume plated: 0.01 x 0.01 x
0.05 mL = 5 x 10-6 mL. Note that the final value isn't a dilution, so you
don't divide by the final volume like in the previous steps. Also notice that
the final dilution factor for a plating is expressed in milliliters, whereas the
dilution factor for transfer to liquid media doesn't have a unit. One way of
thinking about this, is that plating 50 µL after two 100-fold dilutions is the
same thing as plating 5 x 10-6 mL of the original culture (which of course
would be impossible).

Once you have the total dilution factor, you can calculate CFU/mL (cell
density) given a colony count by dividing the colony count by the dilution
factor. Let's say we do the above dilution scheme and then count 215
colonies. We would calculate CFU/mL like this:

215 colonies ÷ 5 x 1045 mL = 4.3 x 108 colonies(CFU)/mL

117
Practice it:

You dilute a culture twice by placing 20 µL into 9.98 mL of sterile saline, and
then you plate 75 µL onto agar. A day later, you count 97 colonies. What
was the cell density in the original culture?

Solution:

Dilution factor = 0.02 mL/10 mL * 0.02 mL/10 mL * 0.075 mL = 3 x 10-7 mL

97 CFU / 3 x 10-7 mL = 3.23 x 108 CFU/mL

Note: what is a “CFU”? A CFU is a “colony forming unit”. We usually

assume that each colony originated as a single bacterial cell. However, it is
possible that multi-cell structures can initiate colony formation; in fact, in
some bacterial groups such as the Streptomyces this is the norm. Thus, we
use “CFU per mL” instead of “cells per mL” to more accurately reflect what
we are measuring.

Important note: Whenever we do spread-plates, we do multiple dilutions

trying to hit the "sweet spot" where there are enough colonies to count to be
a representative sample, but not so many we can't tell one from another.
You only need to count one plate from each dilution series -- ideally one
with between about 50 and 300 colonies.

118
Appendix 2. Calculating
Confidence Intervals
CONFIDENCE INTERVALS AND THE t
DISTRIBUTION
Why do scientists collect scientific data? It's because we want to test
hypotheses of different kinds. For instance, in the experiments in Chapter 6,
we were interested in testing the hypothesis:

H1: Temperature influences bacterial growth rates.

We made a lot of growth rate measurements for a lot of different isolates at

several temperatures. However, the measurements weren't all the same,
even when we measured the same exact thing multiple times (i.e. we
replicated the measurements). How do we know if two sets of
measurements reveal actual differences between samples, and not just
"random noise" caused by measurement error?

To do this, we use statistics. All of the methods we're going to talk about
here rely on three values. First, there's the mean of a set of
measurements, which is just what we normally think of as the "average".
Second, there's the variance, which is a measure of how much the
individual measurements differ from the mean. Third is the sample size,
usually symbolized by n. The bigger the variance, the bigger the "cloud" of
points surrounding the real value and the larger the sample size needs to be
if we want to be sure differences between the means of two samples are
real. Our measure of variance is the standard deviation, s, which is
obtained with the formula:

∑B>C)(𝑥> − 𝜇)A
𝜎= :
𝑛−1

where n is the sample size, xi is the ith measured value, and µ is the mean of
all the measured values. Of course the easier way to calculate mean and
standard deviation is using a spreadsheet. In Microsoft Excel, you can
compute the mean and standard deviation with the following formulas:

Mean: =average(selected values)

Standard deviation: =stdev(selected values)

119
(stuff in this font is code that can be typed or pasted right into Excel;
stuff in italics indicates information you have to provide, or cells you have to
select)

You can think of these values as representing the confidence you should
have in the predictive power of the dataset. For instance, if
variance/standard deviation is low, then any given measurement is likely to
be pretty close to the "true value" of whatever you're trying to measure. If
variance is high, on the other hand, many measurements are likely to be
very far off from the desired real value. However, as long as the
measurements are equally likely to be high as low, then if you take LOTS of
measurements, you can EVENTUALLY develop a good idea of the real value.
Thus, the higher the variance, the more measurements you need to
make a good prediction about the real value of something you're trying to
study.

Once we know the mean and the standard deviation of a dataset, we can
calculate a 95% confidence interval for the data. We can't be sure that
the mean we measured is the "real" mean of the data, but based on the
variance of our replicate measurements we can give a range of values that
the real mean is 95% likely to be within. This calculation assumes that the
"error" of our measurements is random, but the SIZE of the error is
"normally distributed", meaning values closer to the real mean are more
likely than values farther away. Without going into too much mathy stuff,
the distribution of error probabilities is described by something called a t
distribution, and gets smaller when we have more measurements or when
the measurements have smaller variances. The formula for calculating the
95% confidence interval CI is:
𝜎 𝑡*.*H,B4)
𝐶𝐼 =
√𝑛
where t0.05,n-1 is the value of the t distribution for n-1 "degrees of freedom"
with 95% confidence (1-0.05). You can look that value up in a table or you
can just use Excel:

=tinv(.05,n-1)

Thus the Excel formula for the 95% CI is:

=stdev(selected values)*tinv(.05,n-1)/sqrt(n)

When you make a graph with measured values in it, the 95% CI describes
the error bars that should go on the graph. If you have two samples, and
neither sample's 95% CI overlaps the other sample's mean, then you can
say the two samples are significantly different at a confidence level P of

120
0.05. This latter point forms the basis of the t-test which we'll cover in the
next Appendix.

For visual instructions on how to produce such a graph, see this video:

https://www.youtube.com/watch?v=xCYO1u7G6vQ&list=PLqTuWB3uliCzKB5
aEaTePYq2ZL7E7tShu&index=4

Figure A1. A bar graph with error bars

representing the 95% confidence intervals of
the two mean growth rates depicted. Neither
error bar overlaps the mean of the other bar, so
these two organisms have significantly different
growth rates.

Practice:

You want to know whether two different species of motile bacteria have
significantly different swimming speeds. After inoculating both onto 5
replicate plates each of “swim agar” and incubating them for 2 days, you
measure how far growth has expanded from the point of inoculation. You
get the following data:

Organism 1 (5 replicate plates): 5 mm, 7 mm, 6 mm, 8 mm, 5 mm

Organism 2 (5 replicate plates): 9 mm, 6 mm, 8 mm, 4 mm, 12 mm

Calculate the mean and 95% confidence interval of each organism, then plot
them as bar graphs with error bars. Is one significantly faster than the
other?

Solution: Organism 1: 6.2 +/- 1.6 mm; Organism 2: 7.8 +/- 3.8 mm. The
two are NOT significantly different; Organism 2’s lower error bar overlaps
Organism 1’s mean.

121
Appendix 3. The t-TEST
Calculating confidence intervals is very useful for visually representing the
variance of a data set in a graph, but sometimes we want a more precise
measurement of how confident we are that two sample means are different.
One of the simplest ways to achieve this is with a t-test.

The t-test was developed in the early 20th century by the Guinness Brewery
in Dublin, Ireland, in order to compare different batches of barley used in
the brewing of their famous Irish stout. Afterward, it became a widely used
tool for biologists. The t-test is based on the t distribution described in
Appendix 2, which basically modifies the normal distribution to account for
smaller sample sizes. When n gets very large, the t distribution is the same
as the normal distribution, but when n gets very small, the distribution gets
wider. What this means is that we can't be as confident about a sample with
only a few measurements as we can about a sample with thousands of
measurements.

A t-test typically compares a control sample to an experimental sample

and asks if the mean of some measured value is different between the two
samples. In each test, we first calculate a test statistic called t that we
then compare to a table of values to determine how likely it is that the
means of the two samples are actually different. There are three common
varieties of the t-test, each described in turn below: the one-sample t-test,
the unpaired t-test, and the paired t-test.

A. THE ONE SAMPLE T-TEST

In a one-sample t-test, a dataset is compared to a known standard value.

For instance, in Chapter 9 we measured antibiotic resistance by measuring
the diameter of the zone of inhibition around an antibiotic-containing disc,
and each antibiotic had a target zone diameter that indicated clinical levels
of resistance. If we have a group of n measurements x of zones of inhibition
(with mean 𝑥̅ and standard deviation s) that we want to compare against a
test value V, we can calculate the test statistic t with the formula:

√𝑛(𝑥̅ − 𝑉)
𝑡=
𝜎
Here is the Excel formula:

=tdist(sqrt(n)*(average(measured values)-V)/stdev(measured values),n-

1,2)

which gives a p value, or the probability (from 0 to 1) that the measured

values are actually different than the test value V. By convention, p <

122
0.05 (i.e., 95% confidence) is the cutoff for saying that the
measurements are "significantly" different.

Practice: You read in a paper that E. coli has a growth rate of 0.45 per hour
in LB media at 37 C. When you measure a set of cultures in your lab, you
collect the following growth rates from replicate cultures:

0.53 per hour, 0.61 per hour, 0.46 per hour, 0.51 per hour, 0.48 per hour

Does your strain of E. coli significantly different from the published value?

Solution: The V test value is the published rate of 0.45 per hour. The
average of your cultures is 0.52 per hour, which is higher – in fact all of your
cultures measured higher than the published value. However, there is also
quite high variability between the measurements, so when you plug the
values into the equation above, the p value is only 0.06 – close, but not
statistically significant. However, it is quite close, so you would be advised
to measure growth rates in more replicate cultures to increase your
statistical power to detect a difference between the two.

B. THE UNPAIRED T-TEST

In an unpaired t-test, we are comparing two groups of measurements and

asking if their means are significantly different. We assume that the values
in each group being compared are all repeated measurements of a single
"real" value. These replicates are not paired in any meaningful way, so all
we have to know is the mean and standard deviation of each group in order
to calculate t. For samples 1 and 2 with means 𝑥̅ , standard deviations s, and
sample sizes n:
𝑥̅) − 𝑥̅A
𝑡=
𝜎) A 𝜎A A
M
𝑛) + 𝑛A

Here is the way to do it in Excel:

=t.test(Group 1 values,Group 2 values,2,3)

Practice: Let’s consider the test data from Appendix 2. Remember, based
on our graph of the 95% confidence intervals, we assumed that the two
samples were NOT significantly different. Here, we can plug them into the
t.test function to make sure. When we do that, we get a p value of 0.32,
confirming our initial conclusion.

123
C. THE PAIRED T-TEST

A paired t-test, on the other hand, compares individuals measured once

each under two different conditions, essentially using each individual as their
own control. The paired design is more powerful because it eliminates the
effect of variability between individuals. For example, if you measured
CFU/mL in 8 cultures of different species of bacteria before and after
exposure to UV, you could use a paired t-test to see if the treatment had a
significant effect on the organisms even if the starting CFU/mL was very
different for the different species.

The paired t-test is a special case of the one-sample t-test because it

reduces each pair to a single value -- the difference between the means --
and compares those differences to a test value. Usually, this test value is 0
-- the hypothesis that there is no difference between the two samples.

Calculating t for a paired t-test requires two steps. First, compute the
difference XD for each of n pairs. Note that in some cases it may make more
sense to calculate the absolute difference (i.e., disallowing negative values).
Then calculate the mean 𝑋PQ and standard deviation sD of these differences,
and (assuming the test value is 0) use this formula to calculate t:

𝑋PQ √𝑛
𝑡=
𝜎Q

The p-value for a paired t-test can also be easily calculated in Excel with the
formula:

=t.test(Group 1 values,Group 2 values,2,1)

Make sure that the values are in order such that value 1 in Group 1 is paired
with value 2 in Group 2, and so forth.

Practice: You have isolated 6 different kinds of bacteria and measured their
growth rates at pH 7 and at pH 4. You hypothesize that each will grow
faster at pH 7, but the problem is that they have very different overall
growth rates. Is the difference large enough to be significant, despite the
major differences between species in overall growth rates? You collect the
following data:

pH Isolate 1 Isolate 2 Isolate 3 Isolate 4 Isolate 5 Isolate 6

7 .45 .12 .88 .39 .61 .22
4 .23 .03 .45 .24 .36 .10

Again, make sure that the values are entered into Excel in this order!

124
Solution: The differences for each isolate are as follows: 0.22, 0.09, 0.43,
0.15, 0.25, 0.12. The average difference is thus 0.21. Using the Excel t.test
function, we obtain a p value of 0.009, strongly supporting the hypothesis
that the organisms grow faster at pH 7.

REPORTING AND INTERPRETING T-TEST RESULTS

Note that when reporting the results of a t-test in a manuscript, you should
always indicate the sample size and p value of the test, as well as
whether you used a one-sample, unpaired, or paired t-test. For example,
for the bar graph in Figure A1, you might say:

Escherichia coli grew significantly faster than Salmonella typhi

(unpaired t-test, n = 6, p = 0.003).

This result would be interpreted as: "There is 99.7% chance that E. coli
actually grows faster than S. typhi, and a 0.3% chance that the apparent
difference is just a result of measurement or other experimental errors."

Practice: Express the results from the previous three practice exercises in a
way appropriate for a paper.

Solution:

1. Our E. coli strains had a higher mean growth rate than the published
value (0.52 vs. 0.45), but the result was not significantly different
(one-sample t-test, n=5, p=0.06).
2. Organism 1 and Organism 2 moved 6.2 +/- 1.6 mm and 7.8 +/- 3.8
mm away from the point of inoculation, respectively. These
movement rates were not significantly different. (unpaired t-test, n=5,
p=0.32)
3. Despite widely varied growth rates, the organisms grew significantly
slower at pH 4 than at pH 7 (paired t-test, n=6, p=0.009).

125
Appendix 4. Correlation Analysis
Sometimes we want to know if the value of one parameter is related to
another one. For instance, we might like to know if cultures that have
higher growth rates at 30º C tend to also have higher growth rates at 37º C.
We can do this using a correlation test. This test gives us a value R that is
0 if the two parameters are completely unrelated, 1 if both parameters
increase or decrease together, and -1 if an increase in one parameter is
matched by a decrease in the other.

R isn't hard to calculate, but we're just going to cheat and use Excel to do it
here. If we have two datasets x and y that have paired values, we can use
Excel to calculate the correlation coefficient:

=correl(x,y)

The correlation coefficient needs to be above a certain level before we can

say we've discovered a significant correlation. We'll test that level using the
t distribution (Appendix 2):

𝑛−2
𝑡 = 𝑅:
1 − 𝑅A

You can then use this t statistic to determine a P value for the correlation as
described above, as described in Appendix 3. Here's the complete formula
for Excel:

=tdist(abs(correl(x,y)*sqrt((n-2)/(1- correl(x,y)^2))),n-1,2)

Again, P < 0.05 is generally considered statistically significant.

Practice: You measure the growth rates of 5 organisms at 30 C and again

at 37C. The 30 C rates for organisms 1-5 were 0.3, 0.35, 0.25, 0.4, and
0.5. The 37 C rates were 0.5, 0.4, 0.5, 0.2, and 0.55. What is the
correlation coefficient for these measurements, and is it statistically
significant?

Solution: The correlation coefficient is -0.074, which perhaps unexpectedly

shows a weak negative correlation – as one growth rate increases, the other
(slightly) decreases. A look at the data shows that this is probably because
of organism 4, which unlike the other samples grows slower at 37 C (by
50%). The correlation is therefore not significant (p = 0.9).

126
Appendix 5. LINEAR REGRESSION.
Many scientific arguments revolve around the hypothesis that some
phenomenon influences some other phenomenon. "Effects of X on Y" is a
common title trope for scientific papers. A t-test comparing a treatment and
control can inform us as to whether an effect exists, but it has trouble telling
us how big of an effect there is. Indeed, statistics like t-tests can be very
misleading when sample sizes get very big, because they can show
significant differences even when "effect sizes" are infinitesimally small (a
big problem in social science and medical research).

Linear regression, on the other hand, shows the size of an effect very
clearly. In a linear regression experiment, we have some independent
variable that we hypothesize to have an effect on a dependent variable.
We then experimentally alter the amount of the independent variable and
measure the response in the dependent variable. For instance, in the
experiments in Chapter 9, UV exposure time was the independent
variable, and CFU/mL was the dependent variable. Our hypothesis was
that CFU/mL would decrease at a constant rate under exposure to UV.

Mathematically, linear regression starts with a plot of independent variable

data (x-axis) vs. dependent variable data (y-axis) and looks for a straight
line that is the "best fit" for the real data. This line minimizes the value of
the residuals, or the distances between the actual data points and the
nearest point on the line (Fig A2). This line is defined by a slope and an
intercept (e.g. y=mx+b), although for most purposes the slope is all we
care about. A line is "statistically significant" if its slope is different than 0;
the size of the 95% confidence
interval of the slope is a
function of the size of the
residuals, or how well the line
fits the actual data.

In order to calculate a linear

regression in Excel, the best
choice is to use the function
linest (Fig. A3). This formula
is input in a somewhat different
manner from most Excel
formulas, because it covers
multiple cells. In order to do a
linest, select a 2x3 (width vs.
height) block of cells and type

Figure A2. A linear regression.

127
=linest(cells containing dependent variable values, cells containing
independent variable values, 1, 1)

then hit command+shift+enter on a Mac or ctrl+shift+enter on a PC.

Note that the number of dependent and independent variable values must
be the same, and must be in the same order (i.e., value 1 for dependent
variable matches value 1 for independent). This will result in a 2x3 output
that contains the following values:

Slope (m) Y-intercept (b)

Standard error of the slope Standard error of the intercept
r2 value (from 0 - 1) Standard error of the y-estimate

These values are interpreted as follows:

Slope: The slope of a regression means the same thing as it does in the
familiar equation for a straight line: it's "rise over run", or the amount that
the dependent variable changes for every unit change of the independent
variable. This is usually the most important value from a regression
analysis.

Y-intercept: This is the other familiar parameter from the straight-line

equation, or where the best-fit line crosses the Y-axis. It is not usually
important analytically, but it is critical if you want to calculate what
dependent variable value you would expect for a given value of the
independent variable -- e.g., if you are trying to develop a standard curve.

Standard errors of the slope, intercept, and y-estimate: These values

are derived from the size of the residuals (i.e., how well the line actually fits
the data) and the number of data points used to generate the line. To
calculate the 95% confidence interval of the slope and intercept, we need
to know how many degrees of freedom we have, which in the case of

Figure A3. Screenshots of the "linest" function in Excel.

128
linear regression is the number of dependent variable measurements (n) we
have minus 2. The Excel formula for the confidence interval is thus:

= standard error * tinv(0.05,n-2)

To determine if the slope is significant, perform a one sample t-test

(Appendix 3) using the value of the slope as the "mean" and 0 as the test
value. Here is the Excel code to get a p-value:

=tdist(slope/standard error,n-1,2)

r2 value: The r2 value is a measure of how well the line fits the data. If
there is a perfect match (no residuals) then r2 = 1. The lower the r2 the
worse the fit. If you are producing a standard curve, you should be very
worried if your r2 value is less than 0.9.

In some cases you might be interested to see if two slopes are significantly
different from each other. For example, are your two isolates killed at
different rates by exposure to UV radiation? This is easily calculated as a t-
test. For two slopes m1 and m2 with standard errors s1 and s2, calculate t
as:
|𝑚) − 𝑚A |
𝑡=
U𝑠) A + 𝑠A A

Here is the Excel formula to get a p-value:

=tdist(abs(slope1-slope2)/sqrt(s1^2+s2^2),n-1,2)

When reporting the results of a linear regression, always give the sample
size and r2 value of the regression. Usually you will also give the value of
the slope (make sure to include proper units!) as well as its p-value in
comparison with a test value of 0. For instance:

Viability of Isolate 1 decreased during UV exposure (linear

regression of CFU/mL vs. time of exposure, n = 18, r2 = 0.86, m = -
0.24 per second, p = 0.004).

In order to use your regression results to predict a value (as in the standard
curve generated in Chapter 6), simple multiply the predictor variable (e.g.,
the optical density measurement) by the slope, and add the intercept. If
error bars are required for this estimate, use the "standard error of the y-
prediction" from the linest output.

129
Practice: You measure the zone of inhibition of one of your isolates across
a range of concentrations of the antibiotic streptomycin and collect the
following data (note that there are replicate measurements for each
concentration):
[Streptomycin] (ug/mL) Zone of Inhibition (mm)
1 1.1
1 1.3
5 2.8
5 3.2
10 4.4
10 3.8
20 6.2
20 4.1

How strongly does increasing streptomycin affect inhibition?

Solution: By running a linear regression with ZOI as the y-value and

[Streptomycin] as the x-value, we calculate a slope of 0.19 mm per ug/mL
of streptomycin, indicating that the ZOI increases with dose (as expected).
The 95% confidence interval of the slope is 0.14 however, which is nearly as
high as the slope itself! Indeed, the r2 value is only 0.78, and when we
calculate a p-value of the comparison of the slope to a value of 0 (no
relationship between x and y), we get a p value of 0.23, indicating the slope
isn’t statistically significant. A graph of the data shows the likely reason is
the widespread different between the 20 ug/mL measurements – despite the
fact there is a clear effect, the data is too noisy for statistical significance.
The solution? Do more replicates!

130
Appendix 6. THE CHI-SQUARED TEST.
Linear regression and t-tests are appropriate for continuous data, or data
where the measured values aren't limited to integers. However, sometimes
your data is discrete, where it can only take certain values. The most
common reason you can have this sort of data is because you are counting
something, often "successes" and "failures" or yes/no kinds of questions. If
you are interested to know if the number of "yes" answers in one group is
significantly different from that in another group, you can test this using
Pearson's chi-squared test on a contingency table. To make a
contingency table, each row should be an experimental condition, and each
column should be a possible result. The cells contain the number of
observations for each condition that were of the column’s result. The chi-
square test statistic 𝜒 A is calculated with this formula:
Z
A
(𝑠> − 𝐸> )A
𝜒 =X
𝐸>
>C)

where N is the number of cells in the table, si is the count in the ith cell, and
Ei is the expected count for the cell (equal to the number of total
observations in the row times the expected likelihood for the column’s
result). If we take a simple coin-flipping example, we might ask if a coin is
"fair", i.e., it comes up heads or tails with equal probability. Let's say we flip
it 10 times and count 9 successes. We can make a very simple contingency
table:

Heads Tails
9 1

The total number of flips is 10 and the expected probability is 0.5 for both
heads and tails, so Ei is 0.5 * 10 = 5 for both cells. We can then calculate
chi-squared for the two cells:

Heads Tails
(9-5)2/5 = 3.2 (1-5)2/5 = 3.2

Sum these up and you get 𝜒 A = 6.4. We can get a p-value with this excel
code:

=chisq.dist.rt(𝜒 A ,1)

If we type in this code, we see that the p-value is 0.011. This is the
probability of getting 9 heads on a fair coin -- about 1%. Because this is

131
less than 0.05, we can reject the idea that this is a fair coin -- the actual
number of successes is significantly higher than we would expect from a fair
coin.

In practice, we usually don’t have an expected probability of a success, like

we do in a coin toss. In this case we have to use a contingency table.
Here’s an example: in Experiment 9B you used EcoPlates to see how many
different carbon sources your isolates could use. Let's say one isolate used
6 of the 31 possible sources and the other used 18. To do our chi-squared
test, we make a table:

Used Not Used

Isolate 1 6 25
Isolate 2 18 13

To calculate our test statistic, we use the equation above for each cell in the
table, using the null hypothesis that the probability of a “yes” is the total
number of “yes” divided by the total number of observations, or
(6+18)/(31+31) = 0.39. Thus, the probability of a “no” is 1-0.39=0.61. We
then add up the chi-squared statistics in each cell. So, we can make a
second table:

Used Not Used

Isolate 1 3 1.9
Isolate 2 3 1.9

The sum of the cells is 9.79. Plugging into Excel we derive a p value of 0.002
– so these isolates do in fact use significantly different proportions of
substrates. (Note that the fact that the values are identical down each
column is caused by the fact that the sample sizes are exactly the same,
31.)

132
Practice: You notice that your organism sometimes forms yellow colonies,
and sometimes forms red colonies. You think this might be affected by the
incubation temperature, with the red pigment being a molecule that protects
against high temperature stress. You incubate spread plates at 30 C and at
42 C and count the number of red colonies and yellow colonies on each
plate:

Temperature Red Colonies Yellow Colonies Total Colonies

30 C 12 31 43
42 C 55 62 117

Is this organism significantly more likely to be red at 42 C?

Solution: The “red” and “yellow” columns above are a contingency table.
The overall probability of being red is (12+55)/(43+117)=0.42, and the
probability of being yellow is 1-0.42 = 0.58. Using the chi-squared formula
on each cell of the contingency table, we get:

Temperature Red Yellow

30C 2 1.44
42C 0.74 0.53

The sum of the cells is 4.71, which yields a p value of 0.03. The two
samples do in fact have significantly different proportions of red colonies.

133
Appendix 7. CHOOSING THE RIGHT
STATISTICAL TEST.
Here is a flow chart to help you decide which statistical test is right for the
data you are planning to collect. Note that only the tests described in this
manual are considered; there may be better tests available, but these are
sufficient for our purposes.

134
Appendix 8. MEDIA RECIPES

Sterile Saline
Dissolve 8.5 g of NaCl in 1 L of deionized water
Autoclave

R2A Broth
Dissolve in 1L deionized water:
0.5 g yeast extract
0.5 g proteose peptone
0.5 g casamino acids
0.5 g dextrose/glucose
0.5 g soluble starch
0.3 g sodium pyruvate
0.3 g dipotassium phosphate
0.05 g MgSO4 * 7 H2O
Autoclave

R2A agar, Standard

Make 1 L R2A broth as above
add 15 g agar prior to autoclaving

BHI Broth/Agar
Use commercial (BD) BHI broth or agar powders according to
manufacturer's instructions.

R2A/BHI Swim Agar

Make 1 L R2A or BHI broth
Add 3 g of agar prior to autoclaving

Low-carbon R2A Swim Agar

Dissolve in 1L deionized water:
0.1 g yeast extract
0.1 g proteose peptone
0.1 g casamino acids
0.1 g dextrose/glucose
0.1 g soluble starch
0.06 g sodium pyruvate
0.3 g dipotassium phosphate
0.05 g MgSO4 * 7 H2O
3g agar
Autoclave

135
pH-adjusted R2A/BHI agar
For pH 5, 7, and 9, make R2A/BHI agar as above, but adjust pH prior
to autoclaving using 1N HCl or NaOH
For pH 3, make R2A/BHI and add 2.2 mL concentrated HCl after
autoclaving

NaCl-adjusted R2A/BHI agar

Make 1L of R2A/BHI as above.
Add NaCl before autoclaving:
0.5% NaCl 5g
5% NaCl 50 g
10% NaCl 100 g
15% NaCl 150 g

Soil/Water Extract
Add 200 g of unfertilized garden soil to 1 L deionized water in a 2L
Erlenmeyer flask
Autoclave
Pass through a coffee filter into a storage bottle
Autoclave again

Soil Broth/Agar
Dissolve in 950 mL deionized water:
7 g K2HPO4 * 3 H2O
2 g KH2PO4
1 g Ammonium sulfate
0.5 g Sodium citrate dihydrate
Autoclave, and while still hot aseptically add 50 mL soil/water extract

For plates, add 15 g agar prior to autoclaving

Heavy Metal Solutions

For the antimicrobial experiment, prepare 200 uM Pb(NO3)2, 12.5 mM MnCl2,
and 250 uM ZnCl2. Filter sterilize solutions prior to use.

136
REFERENCES
Handelsman, J. Miller, S. Pfund, C. 2007. Scientific Teaching, Roberts &
Company Publishers, United States of America

Moss, M. Bacterial pigments. Microbiologist 3, 10–12 (2012)

Philippot, L., Raaijmakers, J. M., Lemanceau, P. & van der Putten, W. H.

Going back to the roots: the microbial ecology of the rhizosphere. Nature
Rev. Microbiol. 11, 789–799 (2013)

Sanders, E.R. ,Miller, J.H., I, Microbiologist: A Discovery-Based Course in

Microbial and Molecular Evolution. ASM Press, Washington D.C. (2010)

137