Mock Exam: Basic & Medical Genetics
Mock Exam: Basic & Medical Genetics
NOTE: YOU ARE FREE TO TAKE THE QUESTION PAPER AWAY FROM THE
EXAMINATION HALL ONCE YOU ARE DONE
SECTION C1
You are again reminded to use pencil to write “SECTION C1”
at the bottom of the scannable.
All the section C1 scripts across programmes will be pulled
together and graded. Yours must be identified with your index
number, therefore in addition write and shade in your index
number on the scannable
SECTION C1
For the following questions, match the key event of meiosis with the stages listed below.
I. Prophase I VI. Prophase II
II. Metaphase I VII. Metaphase II
III. Anaphase I VIII. Anaphase II
IV. Telophase I IX. Telophase II
V. Interkinesis
I. Tetrads of chromosomes are aligned at the center of the cell; independent assortment soon follows.
a) I
b) III
c) VI
d) VIII
e) II
5. The questions below refer to the following terms. Each term may be used once, more than once, or not at all.
A. incomplete dominance
B. multiple alleles
C. pleiotropy
D. epistasis
E. penetrance
8. The phenotype of the heterozygote differs from the phenotypes of both homozygotes.
Answer: A
9. Barring in chickens is due to a sex-linked dominant gene (B). The sex of chicks at hatching is difficult
determine, but barred chicks can be distinguished from non-barred at that time. To use this trait so that at
hatching all chicks of one sex are differently coloured from those of the opposite sex, what cross would you
make?
A) barred males x barred females
B) barred males x non-barred females
C) non-barred males x non-barred females
D) None of the above crosses will produce differently barred chicks.
E) non-barred males X barred females
11. From the following list, which is the first event in translation in eukaryotes?
A) elongation of the polypeptide
B) binding of the larger ribosomal subunit to smaller ribosome subunits
C) covalent bonding between the first two amino acids
D) base pairing of activated methionine-tRNA to AUG of the messenger
E) Both B and D occur simultaneously.
12. Muscle cells and nerve cells in one kind of animal owe their differences in structure to
A) having different genes.
B) using different genetic codes.
C) expressing different genes.
D) having unique ribosomes.
E) having different chromosomes.
14. If one were to observe the activity of methylated DNA, it would be expected that it would
A) be replicating.
B) be very active in translation.
C) be unwinding in preparation for protein synthesis.
D) have turned off or slowed down the process of transcription.
E) induce protein synthesis by not allowing repressors to bind with it.
16. If cells in the process of dividing are subjected to colchicine, a drug that interferes with the functioning of the
spindle apparatus, at which stage will mitosis be arrested?
A) Anaphase
B) metaphase
C) prophase
D) telophase
E) interphase
17. A cell containing 92 chromatids at the start of mitosis would, at its completion, produce cells containing how
many chromosomes?
A) 12
B) 46
C) 16
D) 23
E) 92
19. If a pair of homologous chromosomes fails to separate during anaphase of meiosis I, what will be the
chromosome number (n) of the four resulting gametes?
A) n+l; n-1; n; n
B) n+l; n-l; n-l; n-l
C) n+1; n+l; n; n
D) n+l; n+l; n-l; n-l
E) n-l; n-1; n; n
20. Genes A and B are linked with 12 map units between them. A heterozygous individual Ab/aB would be
expected to produce gametes in which of the following frequencies?
A) 44% AB 6% Ab 6% aB 44% ab
B) 6% AB 6% Ab 44% aB 44% ab
C) 12% AB 12% Ab 38% aB 38% ab
D) 6% AB 44%Ab 44%aB 6% a
E) 6% Ab 12% aB 50% AB 32% ab
21. If radioactive sulphur (35S) is used in the culture medium of bacteria that harbour phage viruses, it will later
appear in the
A) viral DNA.
B) bacterial RNA.
C) viral RNA.
D) bacterial cell wall.
E) viral coats.
22. In analysis of the nucleotide composition of DNA to see which bases are equivalent in concentration, which
of the following would be TRUE?
A) A=C
B) A+C = G+T
C) A = G and C = T
D) A+T = G+C
E) Both B and C are true.
23. Which of these statements represents a common misconception regarding point mutations?
A) They involve changes in one base pair.
B) They can cause drastic changes in polypeptide structure.
C) They could result in a frameshift mutation.
D) They always produce a change in the amino acid sequence of a protein.
E) They can lead to the shortening of the mutated polypeptide.
24. Which of the following represents a difference between viruses and viroids?
A) Viruses infect many types of cells, while viroids infect only prokaryotic cells.
B) Viruses contain introns; viroids have only exons.
C) Viruses have genomes composed of DNA; while viroids have genomes composed of RNA.
D) Viruses have capsids composed of protein, while viroids have no capsids.
E) Viruses cannot pass through plasmodesmata; viroids can.
25. Which of the following statements is TRUE about control mechanisms in eukaryotic cells?
A) Cytoplasmic inductive influences act by altering what a particular gene makes.
B) Eukaryotic genes are organized in large operon systems.
C) Methylation of DNA may cause inactivity in part or all of a chromosome.
D) Active gene transcription occurs in the heterochromatic regions of the nucleus.
E) Lampbrush chromosomes are areas of active tRNA synthesis.
Figure 1
27. If the cell whose nuclear material is shown in Figure 1continues toward completion of mitosis. Which of the
following events would occur next?
A) cell membrane synthesis
B) centromere uncoupling
C) spindle fiber formation
D) nuclear envelope breakdown
E) chromatid synthesis
28. All of the following occur during the latter stages of mitotic prophase EXCEPT:
A) The centrioles move apart.
B) Chromosomes are duplicated.
C) The nucleolus disintegrates.
D) The nuclear envelope disappears.
E) The spindle is organized.
29. If the haploid number for a species is 3, each dividing diploid cell will have how many chromatids at
metaphase?
A) 3
B) 12
C) 6
D) 9
E) 18
30. Eukaryotic sexual life cycles show tremendous variation. Of the following elements, which do all sexual life
cycles have in common?
I. copulation
II. meiosis
III. fertilization
IV. gametes
V. spores
A) I, IV and V
B) All of the above
C) I, II and IV
D) II, III and IV
E) II, IV, and V
31. A cell has a diploid chromosome number of 2n = 4. We will designate these four as chromosomes A, B, C,
and D. If meiosis occurred WITHOUT the formation of homologous pairs, and the chromosomes were
distributed randomly among the resulting cells, how many gametes could be formed?
A) 2 (AB and CD)
B) 6 (AB,AC, AD, BC, BD, and CD)
C) 3 (AB, BC, and CD)
D) 4 (AB, AB, BC, and CD)
E) 5 (AB, AC, AD, BC, and CD)
32. A 9 purple to 7 white phenotype in sweet peas in the F2 generation most likely is due to
A) linkage.
B) epistasis.
C) trisomy 2l.
D) crossing over.
E) pleiotropy.
33. In cattle, roan coat colour (mixed red and white hairs) occurs in the heterozygous (Rr) offspring of red (RR)
and white (rr) homozygotes. When two roan cattle are crossed, the phenotypes of the progeny are found to be
in the ratio of 1 red:2 roan:1 white. Which of the following crosses could produce the highest percentage of
roan cattle?
A) roan x roan
B) white X roan
C) red x roan
D) red x white
E) All of the above crosses would give the same percentage of roan.
34. A DNA molecule consists of two strands of nucleotides. One strand is the information used by the cell, and
the other strand is a complementary series of bases. This is analogous to
A) two sides of a divided highway.
B) a baseball and a bat.
C) an up escalator and a down escalator.
D) a photograph and a photographic negative.
E) Both B and D are correct.
35. For a couple of decades, we knew the nucleus contained DNA and proteins. The prevailing opinion was that
the proteins were the genes and the DNA was a "string" that held them together. The reason for this belief
was that
A) proteins take a greater variety of three-dimensional forms.
B) proteins have four different levels of structure; DNA has only two.
C) All of the below are correct.
D) proteins are made of 20 amino acids and DNA is made of four nucleotides.
E) proteins can vary in their polarity and charge; DNA cannot.
The following DNA sequence shows a "gene" encoding a small peptide. The three "stop" codons are UAA,
VAG, and DGA.
promoter
5'(ATGACGTATAA)TGACCGTACATGAGTAATACATAAATCAG 3'
3'(TACTGCATATT)ACTGGCATGTACTCATTATGTATTTAGTCS 5'
36. How many animo acids long will the small protein encoded by this" gene" be?
A) 3
B) 5
C) 6
D) 4
E) 7
38. What amino acid sequence will be generated based on the following mRNA codon sequence? 5'AUG-UCU-
UCG-UUA-UCC-UUG
A) met-arg-glu-arg-glu-agr
B) met-ser-ser-leu-ser-leu
C) met-glu-arg-arg-gln-leu
D) met-ser-leu-ser-leu-ser
E) met-leu-phe-arg-glu-glu
39. A peptide has the sequence NH2-phe-pro-lys-gly-phe-pro-COOH. What is the sequence in DNA that codes for
this peptide?
A) 3' UUU-CCC-AAA-GGG-UUU-CCC
B) 3' AAA-GGG- TTT -CCC-AAA-GGG
C) 3' AUG-AAA-GGG-TTT-CCC-AAA-GGG
D) 5'GGG-AAA-TTT-AAA-CCC-ACf-GGG
E) 5' ACT-TAC-CAT-AAA-CAT-TAC-UGA
40. What is the sequence of a peptide based on the mRNA sequence 5'UUUUCUUAUUGUCUU?
A) leu-cys-tyr-ser-phe
B) phe-ser-tyr-cys-leu
C) cyc-phe-tyr-cys-leu
D) phe-leu-ile-met-val
E) leu-pro-asp-lys-gly
The questions below refer to the following terms. Each term may be used once, more than once, or not at
all.
A. enhancer sequence
B. promoter region
C. RNA polymerase III
D. pseudogene
E. intron
41. transcribes the genes for small RNA molecules, including tRNA
Answer: C
42. recognition sites for proteins that make the DNA more accessible to RNA polymerase, thereby boosting the
activity of nearby genes several hundredfold
Answer: A
43. site important for controlling the initiation of transcription in eukaryotic DNA
Answer: B
44. has sequences very similar to functional genes, but lacks the signals for gene expression
Answer: D
45. Eco RI and Hin dIII are two different restriction endonucleases. If the DNA of different animals were cut with
either Eco RI or Hin dIII, which of the cut DNAs would not join together easily so that they could be sealed
with ligase?
A) human DNA cut with Eco RI and chimp DNA cut with Eco RI
B) E. coli DNA cut with Eco RI and mouse DNA cut with Hin dIII
C) prokaryotic DNA cut with Hin dIII and eukaryotic DNA cut with Hin dIII
D) mouse liver DNA cut with Eco RI and mouse kidney DNA cut with Eco RI
E) mouse DNA cut with Hin dIII and chimp DNA cut with Hin dIII
46. Movement of the chromosomes during anaphase would be most affected by a drug that
A) reduced cyclin concentrations.
B) prevented shortening of microtubules.
C) increased cyclin concentrations.
D) prevented elongation of microtubules.
E) prevented attachment of the microtubules to the kinetochore.
47. Which of the following terms belongs with the words synapsis, tetrads and chiasmata?
A) haploid
B) autosomes
C) prophase II
D) crossing over
E) fertilization
48. The X and the Y chromosomes are called sex chromosomes because
A) the chromosomes determine whether the individual will be male or female.
B) they are formed only as a result of fertilization.
C) females have X chromosomes and males have Y chromosomes.
D) they are present only when cells undergo meiosis.
E) genes located on the chromosomes playa role in determining the sex of the individual.
49. Tallness (T) is dominant to dwarfness (t), while red (R) flower colour is dominant to white (r). The
heterozygous condition results in pink (Rr) flower colour. A dwarf red snapdragon is crossed with a plant
homozygous for tallness and white flowers. What are the genotype and phenotype of the Fl individuals?
A) ttRr - dwarf and pink
B) TtRr - tall and pink
C) ttrr - dwarf and white
D) TtRr - tall and red
E) TTRR - tall and red
50. Tobacco mosaic virus has RNA rather than DNA as its genetic material. IfRNA from a tobacco mosaic virus
is mixed with proteins from a DNA virus, the result is a mixed virus. If that virus infects a cell reproduces,
what would you expect the resulting viruses to be like?
A) a DNA virus
B) a hybrid: tobacco mosaic virus RNA and protein from the DNA virus
C) a hybrid: tobacco mosaic virus protein and nucleic acid from the DNA virus
D) tobacco mosaic virus
E) I would not expect any viruses to result.
51. Which of the following is LEAST related to the others in the list?
A) transformation
B) DNA
C) Griffith
D) Avery
E) phage
52. Which of the following is LEAST related to the others in the list?
A) ligase
B) primase
C) helicase
D) nuclease
E) DNA polymerase
54. A virus injects its DNA into a cell. Some genes are transcribed quite rapidly. Those genes are probably
involved in
A) producing DNA polymerase.
B) producing repressor proteins to control the bacterial cell.
C) producing viral capsule proteins.
D) producing proteins that lyse the bacterial cell.
E) producing various enzymes to alter cellular metabolism.
The questions below refer to the following terms. Each term may be used once, more than once, or not at
all.
A. highly repetitive DNA
B. moderately repetitive DNA
C. unique sequence DNA
D. methylated DNA
E. pseudogenes
55. When DNA is heated, the two strands separate. As the DNA cools, the strands come back together
("reanneal") as a function of the complementation of the sequences of bases. Which type of DNA would
reanneal first?
Answer: A
56. When DNA is heated, the two strands separate. As the DNA cools, the strands come back together (reanneal)
as a function of the complementation of the sequences of bases. Which type of DNA would reanneal last?
Answer: C
58. Control regions such as promoters would fall into which class of DNA?
Answer: B
59. Most genes coding for proteins would fall into which class of DNA?
Answer: C
61. portions of the genome having sequences similar to functional genes, but that lack control regions
Answer: E
62. DNA fragments from a gel are transferred to a membrane via a procedure called Southern blotting. The
purpose of Southern blotting is to
A) permanently attach the DNA fragments to a substrate.
B) separate the two complementary DNA strands.
C) transfer only the DNA that is of interest.
D) analyze the RFLPs in the DNA.
E) separate out the PCRs.
64. Colchicine is a drug that binds to the protein that forms microtubules, thereby preventing microtubules from
forming. Colchicine has been used to study mitosis because it stops the process. Most likely this is due to
A) prevention of sister chromatid formation.
B) inhibition of DNA synthesis.
C) alteration of centriole structure.
D) prevention of kinetochore formation.
E) prevention of cell-plate formation.
65. In animals, somatic cells result from mitosis and ___ result from meiosis.
A) clones
B) zygotes
C) gametes
D) spores
E) diploid cells
66. In the following list, which term is LEAST related to the others?
A) trisomic
B) monosomic
C) triploid
D) aneuploidy
E) nondisjunction
67. In the following list, which term is LEAST related to the others?
A) hemizygous
B) sex-linked genes
C) homogametic
D) wild type
E) hemophilia
68. Which of the following help to hold the DNA strands apart while they are being replicated?
A) helicase
B) DNA polymerase
C) single-stranded binding proteins
D) ligase
E) exonuclease
69. In making a movie, sometimes an editor will cut out one piece of film and insert another. This is analogous to
which of the following?
A) mismatch repair
B) transformation repair
C) recombinational repair
D) excision repair
E) telomerase repair
72. Once transcribed, eukaryotic mRNA typically undergoes substantial alteration that includes
A) fusion into circular forms known as plasmids.
B) excision of introns
C) linkage to histone molecules.
D) union with ribosomes.
E) fusion with other newly transcribed mRNA.
73. The tryptophan synthetase operon uses glucose to synthesize tryptophan. Repressible operons such as this
one are
A) turned off whenever tryptophan is added to the growth medium
B) turned off only when glucose is present in the growth medium.
C) turned on only when tryptophan is present in the growth medium.
D) turned on only when glucose is present in the growth medium.
E) permanently turned on.
74. A DNA molecule consists of two strands of nucleotides. One strand is the information used by the cell,
and the other strand is a complementary series of bases. This is analogous to
A) two sides of a divided highway.
B) a baseball and a bat.
C) an up escalator and a down escalator.
D) a photograph and a photographic negative.
E) Both B and D are correct.
75. In a given organism, how do cells at the completion of meiosis compare with cells that are just a begin
meiosis?
A) They have twice the amount of cytoplasm and half the amount of DNA.
B) They have half the number of chromosomes and one-fourth the amount of DNA.
C) They have half the number of chromosomes and half the amount of DNA.
D) They have the same number of chromosomes and half the amount of DNA.
E) They have half the amount of cytoplasm and twice the amount of DNA.
78. All of the following were determined directly from X-ray diffraction photographs of crystallized DNA
EXCEPT
A) the diameter of the double helix.
B) the helical shape of DNA.
C) the linear distance required for one full turn of the double helix.
D) the width of the helix.
E) the specificity of base pairing.
79. Which enzyme catalyses the elongation of a DNA strand in the 5' → 3' direction?
A) primase
B) DNA ligase
C) DNA polymerase
D) topoisomerase
E) helicase
81. The bacteria that contained the plasmid, but not the eukaryotic gene, would grow
A) in all four types of broth.
B) in the nutrient broth plus ampicillin, but not in the broth containing tetracycline.
C) only in the broth containing both antibiotics.
D) in the broth containing tetracycline, but not in the broth containing ampicillin.
E) only in the broth that contained no antibiotics.
The questions below consist of five phrases or sentences concerned with the cell cycle. For each phrase or sentence,
select answer letter from below that is most closely related to it. Each answer may be used once, more than once, or
not at all.
A. G0
B. G1
C. S
D. G2
E. M
Refer to the following information to answer the questions below. An achondroplastic dwarf man with
normal vision marries a colour-blind woman of normal height. The man's father was six feet tall, and both
the woman's parents were of average height. Achondroplastic dwarfism is autosomal dominant, and red-
green colour blindness is X -linked recessive.
87. How many of their female children might be expected to be colour-blind dwarfs?
A) all
B) half
C) none
D) one out of four
E) three out of four
88. How many of their male children would be colour-blind and normal height?
A) all
B) none
C) one out of four
D) three out of four
E) half
89. They have a daughter who is a dwarf with normal colour vision. What is the probability that she is
heterozygous for both genes?
A) 0
B) 0.25
C) 0.5
D) 1.00
E) 0.75
Refer to the following information to answer the following questions. For each of the important discoveries
that led to our present knowledge of the nature of genes described below, select the investigator(s)
associated with each.
A. Hershey and Chase
B. Griffith
C. Meselson and Stahl
D. Avery, MacLeod, and McCarty
E. Chargaff
92. Chemicals from heat-killed S cells were purified. The chemicals were tested for the ability to transform
live R cells. The transforming agent was found to be DNA.
Answer: D
93. The DNA of a phage was injected into the bacterial host, but the protein coat stayed outside. The viral
DNA directed the host to replicate new phage viruses.
Answer: A
94. In any DNA sample, the amount of adenine equals the amount of thymine and the amount of guanine
equals the amount of cytosine.
Answer: C
96. Which of the following events is necessary for the production of a truly malignant tumor?
A) activation of an oncogene in the cell
B) the inactivation of tumor suppressor genes within the cell
C) the presence of mutagenic substances within the cell's environment
D) the presence of a retrovirus within the cell
E) Both A and B are necessary
98. Barring in chickens is due to a sex-linked dominant gene (B). The sex of chicks at hatching is difficult
determine, but barred chicks can be distinguished from non-barred at that time. To use this trait so that at
hatching all chicks of one sex are differently coloured from those of the opposite sex, what cross would
you make?
A) non-barred males X barred females
B) barred males x barred females
C) barred males x non-barred females
D) non-barred males x non-barred females
E) None of the above crosses will produce differently barred chicks.
99. From the following list, which is the first event in translation in eukaryotes?
A) base pairing of activated methionine-tRNA to AUG of the messenger
B) elongation of the polypeptide
C) binding of the larger ribosomal subunit to smaller ribosome subunits
D) covalent bonding between the first two amino acids
E) Both B and D occur simultaneously.
100.As a ribosome translocates along an mRNA molecule by one codon, which of the following occurs?
A) The tRNA that was in the A site moves into the P site.
B) The tRNA that was in the P site moves into the A site.
C) The tRNA that was in the P site departs from the ribosome.
D) The tRNA that was in the A site departs from the ribosome.
E) Both A and C are correct.
101.Genes A and B are linked with 12 map units between them. A heterozygous individual Ab/aB would be
expected to produce gametes in which of the following frequencies?
A) 44% AB 6% Ab 6% aB 44% ab
B) 6% AB 44%Ab 44%aB 6% a
C) 6% AB 6% Ab 44% aB 44% ab
D) 12% AB 12% Ab 38% aB 38% ab
E) 6% Ab 12% aB 50% AB 32% ab
102.If radioactive sulphur (35S) is used in the culture medium of bacteria that harbour phage viruses, it will
later appear in the
A) viral coats.
B) viral DNA.
C) bacterial RNA.
D) viral RNA.
E) bacterial cell wall.
F)
104.All of the following occur during the latter stages of mitotic prophase EXCEPT:
A) The centrioles move apart.
B) Chromosomes are duplicated.
C) The nucleolus disintegrates.
D) The nuclear envelope disappears.
E) The spindle is organized.
105.If the haploid number for a species is 3, each dividing diploid cell will have how many chromatids at
metaphase?
A) 3
B) 12
C) 6
D) 9
E) 18The following questions refer to Figure 17.1,
106.A possible sequence of nucleotides in DNA that would code for the polypeptide sequence Phe-Leu-Ile-Val
would be
A) 5' TTG-CTA-CAG- TAG 3',
B) 3' AAA-GAA-TAA-CAA 5',
C) 3' AAC-GAC-GUC-AUA 5',
D) 5' AUG-CTG-CAG-TAT3',
E) 3' AAA-AAT-ATA-ACA 5',
107.What amino acid sequence will be generated based on the following mRNA codon sequence? 5'AUG-
UCU-UCG-UUA-UCC-UUG
A) met-arg-glu-arg-glu-agr
B) met-ser-ser-leu-ser-leu
C) met-glu-arg-arg-gln-leu
D) met-ser-leu-ser-leu-ser
E) met-leu-phe-arg-glu-glu
108.The numerous copies of rRNA genes in a salamander are an example of
A) prokaryotic multigene families.
B) eukaryotic multigene families.
C) a highly repetitive sequence.
D) enhanced promoter regions.
E) satellite DNA.
F) with endonuclease X and then insert the gene into the plasmid.
109.From the list above, which of the following is the most logical sequence of steps for splicing foreign DNA
into a plasmid and inserting the plasmid into a bacterium?
A) III, II, IV, V, I
B) I, II, IV, III, V
C) II, III, V, IV, I
D) III, IV, V, I, II
E) IV, V, I, II, III
110.Eco RI and Hin dIII are two different restriction endonucleases. If the DNA of different animals were cut
with either Eco RI or Hin dIII, which of the cut DNAs would not join together easily so that they could be
sealed with ligase?
A) human DNA cut with Eco RI and chimp DNA cut with Eco RI
B) prokaryotic DNA cut with Hin dIII and eukaryotic DNA cut with Hin dIII
C) mouse liver DNA cut with Eco RI and mouse kidney DNA cut with Eco RI
D) E. coli DNA cut with Eco RI and mouse DNA cut with Hin dIII
E) mouse DNA cut with Hin dIII and chimp DNA cut with Hin dIII
112.The finding that defective genes behave differently in offspring depending on whether they belong to the
maternal or paternal chromosome is implicated in which of the following?
A) Prader- Willi syndrome
B) fragile X syndrome
C) Angelman syndrome
D) A, B, and D are correct
E) Only A and D are correct.
114.To function as the heritable genetic code, DNA molecules must have all of the following structural
features EXCEPT
A) the ability to form complementary base pairs with other DNA nucleotides.
B) the ability to form complementary base pairs with RNA nucleotides.
C) a sequence of nucleotides that can be decoded into a sequence of amino acids in a protein.
D) histone proteins associated with the double
F) During the S phase of the cell cycle there will be 32 separate chromosomes.
117.Probes are short, single-stranded DNA segments that are used to identify DNA fragments with a particular
sequence. Before the probe can identify a specific restriction fragment, what must be done?
A) The fragments must be separated by electrophoresis.
B) A, B, and C
C) The double-stranded DNA must be heated to make it single stranded.
D) The DNA must be permanently attached to a suitable substrate so it doesn't migrate.
E) Both A and B
118.DNA fragments from a gel are transferred to a membrane via a procedure called Southern blotting. The
purpose of Southern blotting is to
A) permanently attach the DNA fragments to a substrate.
B) separate the two complementary DNA strands.
C) transfer only the DNA that is of interest.
D) analyze the RFLPs in the DNA.
E) separate out the PCRs.
120.Which of the following help to hold the DNA strands apart while they are being replicated?
A) helicase
B) DNA polymerase
C) single-stranded binding proteins
D) ligase
E) exonuclease
121.A ce1l that passes the restriction point will most likely
A) move into prophase of mitosis
B) have just completed cytokinesis to separate into two new cells.
C) stop dividing.
D) undergo chromosome duplication
E) show a drop in MPF concentration.
122.Cytokinesis usually, but not always, follows mitosis. If cells undergo mitosis and not cytokinesis, this
would result in
A) a cell with a single large nucleus.
B) a cell with two or more nuclei.
C) cells with abnormally small nuclei.
D) feedback responses that prevent mitosis.
E) death of the cell line.
125.The DNA strand that is replicated smoothly and continuously is called the:
a) primary strand.
b) leading strand.
c) first strand.
d) alpha strand.
e) None of the above.
128._____ refers to a situation in which several pairs of alleles interact to affect a single trait.
a) Variegation
b) Epistasis
c) Codominance
d) Incomplete dominance
e) None of the above
130.When pink-flowered plants were crossed they produced red-flowered, pink-flowered, and white-flowered
plants in a ratio of 1:2:1. This is an example of:
a) variegation.
b) hybrid vigor.
c) epistasis.
d) a polygenic trait.
e) incomplete dominance.
133._____ are genes that govern the same feature, such as eye color, and occupy corresponding positions on
homologous chromosomes.
a) Loci
b) Homozygotes
c) Coupled traits
d) Alleles
e) None of the above
140.How is insulin produced by genetically engineered E. coli cells superior to insulin obtained from animal
sources?
a) Animal insulin has a shorter life span than insulin produced using recombinant DNA techniques.
b) Recombinantly produced insulin contains human rather than animal sequences, thus reducing the chances
of an allergic response in the recipient.
c) Animal insulin is more difficult to purify than is recombinantly produced insulin.
d) All of the above are true.
e) None of the above are true.
141.The entire process of producing two cells from one cell
a) starts with prophase.
b) ends with cytokinesis.
c) results in the equal distribution of organelles between cells.
d) occurs only in multicellular organisms.
e) both a and b, but not c or d
142.Polar bodies
a) are dumping places for excess genetic material.
b) have no known biological function.
c) are produced by meiosis.
d) will serve as the gametes if something happens to the egg.
e) all but d are correct
143.Which organism did Mendel utilize to work out the laws of segregation and independent assortmen
a) the fruit fly
b) Neurospora
c) the garden pea
d) the chicken
e) E. coli
145.Like many genetic disorders, galactosemia is a disruption of a metabolic pathway due to a malfunctioning
a) reactant.
b) cofactor.
c) energy source.
d) product.
e) enzyme.
146._____ refers to multiple independent pairs of genes having similar and additive effects on the same
characteristic.
a) Polygenic inheritance
b) Complete dominance
c) Additive dominance
d) Codominance
e) Epistasis
147.Research on nutrient requirements in bread mold led to the idea that one gene specifies the makeup of one
a) amino acid.
b) enzyme.
c) polypeptide.
d) both b and c are correct
e) a, b, and c are correct
148. From X-ray diffraction data, which of the following was determined about DNA?
a) The molecule had uniform diameter.
b) The molecule was long and narrow.
c) Part of the molecule repeated itself often.
d) The shape of the molecule could be spiral.
e) all of the above
5. Four of the five answers listed below are related by a common number. Select the exception.
a) number of nucleotides in a codon
b) number of building blocks (parts) in a nucleotide
c) number of stop codons
d) number of types of RNA
e) number of types of DNA
6.
Four of the five answers listed below are therapeutic measures applied to affected individuals. Select
the exception.
a) prenatal diagnosis
b) chemotherapy
c) surgical correction
d) diet modification
e) environmental adjustment
7. Four of the five answers listed below are caused by recessive genes. Select the exception.
a) phenylketonuria
b) Huntington's disorder color blindness
c) hemophilia
d) albinism
8. The pea plant, Pisum sativum, was used by Mendel as a model organism for which of the following
reason(s):
a) there were easily visible traits such as flower color and seed shape.
b) self-fertilization was possible.
c) it was relatively easy to grow.
d) all of the above are correct.
9. If an organism contains two identical alleles for the same trait, it is said to be which of the following?
a) cross-fertilized
b) heterozygous
c) homozygous
d) a hybrid
e) none of the above
10. A testcross is always conducted between an individual whose genotype is unknown, and which of the
following?
a) a homozygous recessive individual
b) a homozygous dominant individual
c) a heterozygous individual
d) any of the above will work
11. Thomas Hunt Morgan's experiment with white-eyed Drosophila provided proof of which of the
following?
a) law of independent assortment
b) chromosomal theory of inheritance
c) theory of natural selection
d) law of segregation
e) none of the above
12. During which of the following stages of the cell cycle is the DNA of the organism replicated?
a) prophase
b) anaphase
c) S phase
d) G2 phase
15. These were the first individuals to demonstrate that DNA is a double-helix.
a) Watson and Crick
b) Pauling
c) Franklin
d) Chargaff
16. The decoding function of translation occurs during ___
a) initiation
b) translocation
c) cotranslational sorting
d) elongation
21. Viruses have some of the properties of living organisms. Which of the following is a characteristic of
all organisms, but NOT of viruses?
a) genetic information stored as nucleic acid
b) plasma membrane
c) ability to control metabolism
d) ability to reproduce
e) structure includes proteins
22. A mammalian zygote with which of the following chromosomal abnormalities will NEVER develop
into a viable embryo?
a) YO
b) XO
c) XXX
d) XXY
e) XXXY
23. Once transcribed, eukaryotic mRNA typically undergoes substantial alteration that includes
a) fusion into circular forms known as plasmids.
b) linkage to histone molecules.
c) union with ribosomes.
d) excision of introns.
e) fusion with other newly transcribed mRNA.
24. A mutation that inactivates the regulator gene of a repressible operon in an E. coli cell would result in
a) complete inhibition of transcription of the structural gene controlled by that regulator.
b) irreversible binding of the repressor to the operator.
c) inactivation of RNA polymerase.
d) Both B and C are correct.
e) continuous transcription of the structural gene controlled by that regulator.
25. The tryptophan synthetase operon uses glucose to synthesize tryptophan. Repressible operons such as
this one are
a) turned on only when tryptophan is present in the growth medium.
b) turned off only when glucose is present in the growth medium.
c) turned on only when glucose is present in the growth medium.
d) turned off whenever tryptophan is added to the growth medium.
e) permanently turned on.
26. In a given organism, how do cells at the completion of meiosis compare with cells that are just a begin
meiosis?
a) They have twice the amount of cytoplasm and half the amount of DNA.
b) They have half the number of chromosomes and one-fourth the amount of DNA.
c) They have half the number of chromosomes and half the amount of DNA.
d) They have the same number of chromosomes and half the amount of DNA.
e) They have half the amount of cytoplasm and twice the amount of DNA.
27. All of the following were determined directly from X-ray diffraction photographs of crystallized DNA
EXCEPT
a) the diameter of the double helix.
b) the helical shape of DNA.
c) the linear distance required for one full turn of the double helix.
d) the width of the helix.
e) the specificity of base pairing.
28. Which enzyme catalyses the elongation of a DNA strand in the 5' → 3' direction?
a) primase
b) DNA ligase
c) topoisomerase
d) helicase
e) DNA polymerase
29. A particular triplet of bases in the coding sequence of DNA is AGT. What is the corresponding triplet
in the complementary strand of DNA?
a) AGT
b) TCA
c) UCA
d) GAC
e) TCA in eukaryotes, but UCA in prokaryotes
30. A particular triplet of bases in the coding sequence of DNA is AGT. The anticodon on the tRNA that
binds the mRNA codon is
a) AGT.
b) AGU.
c) UCA.
d) TCA.
e) Either UCA or TCA, depending on wobble in the first base.
31. Bacteriophage DNAs that have become integrated into the host cell chromosome are called
a) intemperate bacteriophages.
b) transposons.
c) T -even bacteriophages.
d) plasmids.
e) prophages.
32. The fact that all seven of the garden pea traits studied by Mendel obeyed the principle of independent
assortment means that the
a) haploid number of garden peas is 7.
b) seven pairs of alleles determining these traits are on the same pair of homologous
chromosomes.
c) seven pairs of alleles determining these traits behave as if they are on different chromosomes.
d) formation of gametes in plants is by mitosis only.
e) diploid number of garden peas is 7.
34. What percentage of the DNA in a typical eukaryotic cell is expressed at any given time?
a) 5-20%
b) 20-40%
c) 40-60%
d) 3-5%
e) 60-90%
35. From the following list, which is the first event in translation in eukaryotes?
a) elongation of the polypeptide
b) binding of the larger ribosomal subunit to smaller ribosome subunits
c) covalent bonding between the first two amino acids
d) base pairing of activated methionine-tRNA to AUG of the messenger
e) Both B and D occur simultaneously.
36. If a pair of homologous chromosomes fails to separate during anaphase of meiosis I, what will be the
chromosome number (n) of the four resulting gametes?
a) n+l; n-1; n; n
b) n+l; n-l; n-l; n-l
c) n+1; n+l; n; n
d) n+l; n+l; n-l; n-l
e) n-l; n-1; n; n
37. Genes A and B are linked with 12 map units between them. A heterozygous individual Ab/aB would
be expected to produce gametes in which of the following frequencies?
a) 44% AB 6% Ab 6% aB 44% ab
b) 6% AB 6% Ab 44% aB 44% ab
c) 12% AB 12% Ab 38% aB 38% ab
d) 6% AB 44%Ab 44%aB 6% a
e) 6% Ab 12% aB 50% AB 32% ab
38. If radioactive sulphur (35S) is used in the culture medium of bacteria that harbour phage viruses, it will
later appear in the
a) viral DNA.
b) bacterial RNA.
c) viral RNA.
d) bacterial cell wall.
e) viral coats.
39. A chromosome's gene sequence that was ABCDEFG before damage and ABFEDCG after is an
example of
a) deletion.
b) duplication.
c) inversion.
d) translocation.
e) aneuploidy.
40. Which of the following is a transfer of genes between non-homologous chromosomes?
a) crossing over
b) aneuploidy
c) trisomy
d) translocation
e) duplication
41. During prophase I of meiosis, homologous chromosomes lie side by side. This phenomenon is known
as:
a) homologue pairing
b) synapsis
c) paternal pairing
d) tetrad formation
e) None of the above.
43. Which of the following represent the possible genotypes resulting from a cross between an individual
homozygous for black hair (BB) and an individual heterozygous for black hair (Bb)?
a) BB and Bb
b) BB, Bb and bb
c) BB only
d) Bb only
e) bb only
45. Which point mutation would be most likely to have a catastrophic effect on the functioning of a
protein?
a) a base substitution
b) a base deletion near the end of the coding sequence, but not in the terminator codon
c) deletion of three bases near the start of the coding sequence, but not in the initiator codon
d) a base deletion near the start of the coding sequence
e) a base insertion near the end of the coding sequence, but not in the terminator codon
46. .Which of the following represent the possible genotypes resulting from a cross between two
individuals that are heterozygous for black hair (Bb)?
a) BB and Bb
b) BB, Bb and bb
c) BB only
d) Bb only
e) bb only
47. Which of the following represent the possible genotypes resulting from a cross between an individual
homozygous for black hair (BB) and an individual homozygous for blonde hair (bb)?
a) BB and Bb
b) BB, Bb and bb
c) BB only
d) Bb only
e) bb only
49. During mitosis nucleoli disappear during ___ and again become apparent during.
a) metaphase, anaphase
b) prophase, anaphase
c) prophase, telophase
d) interphase, telophase
e) anaphase, telophase
50. How does the replication of cellular organelles relate to the cell cycle?
a) Organelles replicate at roughly the same time as do the chromosomes.
b) Organelles replicate during interphase and are apportioned more or less between the daughter cells.
c) Organelles contain their own chromosomes that undergo a mitosis of their own while the cell is dividing.
d) None of the above are true.
e) Both a and c are true.
51. An organism with a diploid number of 36 chromosomes will have ____ chromosome in their gametes
and _____ chromosomes in their somatic cells.
a) 18, 18
b) 18, 36
c) 36, 18
d) 36, 36
e) 36, 72
52. During prophase I, each chiasmata represents:
a) the site at which homologous chromosomes are united
b) the site at which maternal and paternal homologues are united
c) a site of crossing over
d) a newly formed haploid gamete
e) None of the above
53. During which of the following stages of meiosis do the chromatids separate?
a) metaphase I
b) anaphase I
c) metaphase II
d) anaphase II
e) telophase II
54. _____ egg(s) are formed by oogenesis and ____ sperm (s) are formed by spermatogenesis.
a) 4, 4
b) 1, 1
c) 4, 1
d) 1, 4
e) 2, 2
55. In prenatal diagnosis, the newest procedure that can be performed early in pregnancy involves
sampling the
a) chorion.
b) amnion.
c) allantois.
d) yolk sac.
e) umbilical cord.
56. The most recent technique for analyzing the genetics of the unborn child involves the sampling of
a) the fetus directly.
b) cells in the amniotic fluid.
c) material from the allantois.
d) the chorionic villi.
e) yolk sac material.
57. The maximum number of tRNAs that can be on one ribosome at one time is
a) unlimited.
b) unknown.
c) 2.
d) 3.
e) 43
59. Which of the following does NOT belong with the other four?
a) polyploidy
b) inversion
c) deletion
d) duplication
e) translocation
61. Which of the following conditions is characterized by a karyotype with forty-five chromosomes?
a) Down syndrome
b) testicular feminization syndrome
c) Klinefelter syndrome
d) Turner syndrome
e) cri-du-chat
For the following questions, match the key event of meiosis with the stages listed below.
I. Prophase I VI. Prophase II
II. Metaphase I VII. Metaphase II
III. Anaphase I VIII. Anaphase II
IV. Telophase I IX. Telophase II
V. Interkinesis
64. Tetrads of chromosomes are aligned at the center of the cell; independent assortment soon follows.
a) I
b) II
c) III
d) VI
e) VIII
69. Human females have two X chromosomes, a condition which is referred to as:
a) a sex-linked trait.
b) dominant chromosome sex determination.
c) homogametic.
d) heterogametic.
e) none of the above.
70. Why are slightly more male children born than are females?
a) X-bearing sperm are less likely to survive spermatogenesis.
b) Y-bearing sperm must have some competitive advantage over X-bearing sperm.
c) More Y-bearing sperm are produced.
d) All of the above are true.
e) None of the above are true.
71. When pink-flowered plants were crossed they produced red-flowered, pink-flowered, and white-
flowered plants in a ratio of 1:2:1. This is an example of:
f) variegation.
g) hybrid vigor.
h) incomplete dominance.
i) epistasis.
j) a polygenic trait.
72. Breeding a yellow dog to a brown dog produced mixed color puppies (with both yellow and brown
hairs). This is an example of :
a) variegation.
b) codominance
c) incomplete dominance.
d) epistasis.
e) a polygenic trait.
73. _____ refers to a situation in which several pairs of alleles interact to affect a single trait.
f) Variegation
g) Codominance
h) Incomplete dominance
i) Epistasis
j) None of the above
74. Usually, an individual has the same blood group for life. However, it may rarely change through
addition or suppression of an antigen during:
(a) Malignancy
(b) Autoimmune disease
(c) Infection
(d) All
75. The A and B alleles of blood group differ from each other by nucleotide substitutions:
(a) 3
(b) 5
(c) 7
(d) 9
76. The first successful experiment on blood transfusion was conducted on a dog by:
(a) Richard Lowenin (1666)
(b) Charles Bonnet (1745)
(c) Young (1802)
(d) Franeeseo Redi (1988)
Consider the following statements:
(A) Environment plays a significant role in the determination of blood groups
(B) In ABO blood group, both blood group A and blood group B are dominant over blood group 0
(C) A man with blood group B and his wife with blood group AB, can produce a child of 0 blood group
(D) If the father is of A blood group the mother is of B group their child may be of A, B, AB or 0 blood
group
77. The correct statements are:
(a) All
(b) A, Band D
(c) A and D
(d) Band D
78. If mother is A- and father is O+, the blood group of their child may be:
(a) Nor 0+
(b) A- or 0-
(c) N, A- or 0+,0-
(d) A+ or 0+
79. Mother-foetus ABO incompatibility most commonly occurs when the mother is of _
type and foetus is of A, B or AB type:
(a) A
(b) B
(c) AB
(d) 0
80. If the mother is of blood group 0 and father is of AB, the possible blood group of their child is:
(a) AorAB
(b) B,ABorO
(c) AorB
(d) AB or O
81. Parents having blood group AB cannot produce a child of the blood group:
(a) A
(b) B
(c) AB
(d) 0
83. A couple has three sons belonging to blood groups A, AB and 0, the possible genotypes of the couple:
(a)IA IA and 1°1°
(b) IA IO and IBlo
(c) IAIA and IBlo
(d) IAIB and 1010
84. If the blood group of the father is O and that of the mother is AB, what are the chances of blood group
O in their children?
(a) 75 per cent
(b) 50 per cent
(c) 25 per cent
(d) 0 per cent
85. Blood group of the mother is AB and that of the father is also AB, the chances of AB blood group in
their children is:
(a) 25 per cent
(b) 50 per cent
(c) 75 per cent
(d) 0 per cent
88. The most frequent type of translocation in humans is the centric fusion of chromosomes:
(a) 8 and 12
(b) 10 and 12
(c) 13 and 14
(d) 16 and 17
Match column I with column II and select the correct answer using answer codes:
Column I Column 11
(A) Garrod 1. First human gene assignment
(B) Wilson 2. Chromosome analysis on blood
(C) Roberts 3. Biochemical variation
(D) Moorhead 4. United Kingdom's first genetic clinic
89. Answer codes:
A B C D
(a) 3 4 I 2
(b) 3 1 4 2
(c) 4 2 1 4
(d) 2 1 3 4
90. Which one of the following is responsible for 47 + XXX abnormality?
(a) Nondisjunction in female meiotic division.
(b) Nondisjunction in female meiotic division or at the male second meiotic division.
(c) Nondisjunction at the male first or second meiotic division.
(d) Nondisjunction at the second meitotic division either in male or female.
91. Which one of the following is uncommon in eskimos?
(a) Cystic fibrosis
(b) Diabetes inspidus
(c) Diabetes mellitus
(d) Twins
Match column I with column IT and select the correct answer using answer codes:
Column I Column 11
(A) Cystic fibrosis 1. Dominant gene on chromosome 17
(B) Tay-Sachs disease 2. Recessive gene on chromosome 7
(C) Huntington disease 3. Dominant gene on chromosome 15
(D) Neurofibro matosis 4. Dominant gene on chromosome 4
Match column I with column 11 and select the correct answer using answer codes:
Column I Column 11
(A) Sex limited I. AB blood group
(B) Sex influenced 2. Baldness
(C) Sex linked 3. Milk production
(D) Co-dominance 4. Duchenne muscular dystrophy
99. Answer codes:
A B C D
(a) 4 2 1 3
(b) 2 4 2 3
(c) 3 4 4 2
(d) 3 2 4 1
106.With respect to the given symbols used for karyotype description, which one of the following is an
incorrect match?
(a) p - Short arm
(b) qter - Tip of long arm
(c) i-Inversion
(d) 1- Mosaicism
Match column I with column II and select the correct answer using answers code:
Column I Column II
(A) Wilson disease 1. Inactivation of one of the two X chromosomes
(B) Lesch-Nyhan disease 2. Defective copper metabolism
(C) Ehlers-Danlos syndrome 3. Found only in males
(D) Lyons hypothesis 4. Autosomal dominant but X-linked and
autosomal recessive forms are known
108.Answer codes:
A B C D
(a) 2 4 3 1
(b)2 3 4 1
(c)4 3 1 2
(d)3 1 2 4
115.The most commonly associated chromosomal abnormalities with Down syndrome is:
(a) Deletion
(b) Translocation
(c) Mosaicsm
(d) Trisomy
117.The chronological age of a boy is 5 years and his mental age is 15, his I.Q is:
(a) 3
(b) 45
(c) 150
(d) 100
Match column I with column II and select the correct answer using codes:
Column I ColumnII
(A) Enzyme defect 1. G-6-PD deficiency
(B) Alteration of protein 2. Albinism
(C) Defect in receptor and transport system 3. Hypercholesteremia
(D) Genetically determined and 4. Sickle cell anaemia
adverse reaction to drugs
121.Answer codes:
A B C D
(a) 2 3, 1 4
(b) 3 4 2 1
(c) 4 3 1 2
(d) 2 4 3 1
122.According to a recent finding, Down syndrome individuals by the age 35 years develop:
(a) Parkinson disease
(b) Alzheimer syndrome
(c) Retinoblastoma
(d) Fragile X syndrome
Match column I with column II and select the correct match using answer codes:
Column I Column 11
(A) Eugenics 1. Sum total of genes in a population
(B) Euphenics 2. Improvement of human race
(C) Gene pool 3. Increase in homozygosity
(D) Consanguinity 4. Phenotypic improvement of humans after birth
123.Answer codes:
A B C D
(a) 2 4 1 3
(b) 2 3 4 I
(c) 3 2 4 1
(d) 4 2 1 3
124.In humans, the possible of number of phenotypes for ABO blood group is:
(a) 2
(b)4
( c) 6
(d)8
125.Which one of the following is an incorrect statement?
(a) Campomelic dysplasia is a genetic disorder.
(b) It is due to a mutation in the gene SOX9, located on the chromosomes 17.
(c) SOX9 is related with sex reversal.
(d) Gene SOX9 is responsible for Waardenburg syndrome.
126.In male human beings, which one of the following is essential for gonadal development?
(a) Testis-determining gene SRY
(b) X-linked genes
(c) Both (a) and (b)
(d) None
127.Which one of the following regions of X and Y chromosomes are paired during synapses?
(a) Differential region
(b) Pairing region
(c) Both (a) and (b)
(d) None
135.Which one of the following is not used in the analysis of human genetics?
(a) Test cross
(b) Karyotyping
(c) Pedigree analysis
(d) RFLP analysis
136.Which one of the following is an X-linked dominant trait within uterolethality for a hemizygous male?
(a) Marfan syndrome
(b) Mucopolysaccharidosis
(c) Incontinentia pigmenti
(d) Intestinal polyposis
141.Which one of the following is an autosomal dominant trait with complete but age-dependent
penetrance having locus on 4 pter?
(a) Huntington disease
(b) Wilson disease
(c) Morquio disease
(d) von Recklinghausen disease
145.If the affected males of an autosomal dominant trait with sex limitation are infertile, then the pedigree
pattern is identical to where males do not reproduce:
(a) An X-linked dominant
(b) An X-linked recessive
(c) XY-linked
(d) Autosomal recessive