0% found this document useful (0 votes)
71 views7 pages

Revision Questions Molecular Basis of Inheritance

Uploaded by

Jeff
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
71 views7 pages

Revision Questions Molecular Basis of Inheritance

Uploaded by

Jeff
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd

Revision questions- Molecular basis of inheritance

1. Retroviruses have no DNA. However, the DNA of the infected host cell does possess viral DNA.
How is it possible? [Outside Delhi Set-I, 2015]
A- The virus has RNA genome. When it enters in the infected host cell, RNA replicates to form
viral DNA using enzyme reverse transcriptase. This viral DNA then incorporates into host
genome.

2. Why is RNA more reactive in comparison to DNA? [Delhi Set-I, Comptt. 2015]
A- OH Present in RNA (in every nucleotide) make it reactive. Detailed Answer: RNA is more
reactive than DNA because : (i) It is single stranded (ii) OH- group is present in every nucleotide
(iii) It mutates faster
3. Name the negatively charged and positively charged components of a nucleosome. [Delhi Set-I,
Comptt. 2015]
A- In a nucleosome, the negatively charged component is DNA, and the positively charged
component is the histone octamer
4. Write the two specific codons that a translational unit of m-RNA is flanked by one on either side.
R [Outside Delhi Set-I, Comptt. 2015]
A- The two specific codons that flank a translational unit of mRNA are AUG (start codon)
and UAA (stop codon).
5. Name the enzyme and state its property that is responsible for continuous and discontinuous
replication of the two strands of a DNA molecule. [Delhi Set-I, III, 2013]
A-

6. Name the types of synthesis ‘a’ and ‘b’ occurring in the replication fork of DNA as shown below:
R [Delhi & Outside Delhi Comptt. 2011]

a.

A- a- Leading strand continuous b-Lagging strand discontinuous.

7. Name the component a and b in the nucleotide with a purine given below. R [Delhi 2008]
a.
A- a is phosphate group. b is nitrogenous base (Purine), i.e., Adenine or
Guanine

A region of a coding DNA strand has the following nucleotide sequence: – ATGC – What shall be
the nucleotide sequence in
(ii) sister DNA segment replicates, and
(iii) m-RNA polynucleotide transcribes. [Foreign Set - I, II, III, 2017]
A- i. – TACG – ii. – UACG –

Why does hnRNA need to undergo splicing? Where does splicing occur in the cell ? [CBSE, Delhi Set-I
& III Comptt. 2016]

A- hnRNA undergoes splicing to remove introns(non-coding sequences) and join exons(coding


sequences). Splicing occurs in the nucleous of the cell.

8. State the difference between the structural genes in a Transcription Unit of Prokaryotes and
Eukaryotes. [Outside Delhi Set-II, 2014]
A-

9. A template strand is given below. Write down the corresponding coding strand and the mRNA
strand that can be formed along with their polarity. [CBSE Foreign 2014]
3’ ATGCATGCATGCATGCATGCATGC 5’
A-

10. Differentiate between a cistron and an exon. [Outside Delhi Set-I, Comptt. 2012]
A-

11. State the dual role of deoxyribonucleoside triphosphates during DNA replication. [Delhi Set-I, II,
III, 2011]
A-

12. Why did Hershey and Chase use radioactive sulfur and radioactive phosphorus in their
experiment?
(ii) Write the conclusion they arrived at and how. [Foreign Set-I, 2016]
A-

13. Differentiate between a template strand and coding strand of DNA


A-

14. A DNA segment has a total of 1000 nucleotides, out of which 240 of them are adenine
containing nucleotides. How many pyrimidines bases this DNA segment possesses? [Delhi Set-I,
2015]

15. Given below is a single stranded DNA molecule. 5’ ATGGGGCTC 3’ sense.Frame and label its
sense and antisense RNA molecule.
How do the RNA molecules made from above DNA strand help in silencing of the specific RNA
molecules? [CBSE SQP 2015]
A-

16. Construct a complete transcription unit with promotor and terminator on the basis of the
hypothetical template strand given below :
i. A T G C A T G C A T A C
(ii) Write the RNA strand transcribed from the above transcription unit along with its
polarity. [CBSE, SQP, 2018 Delhi Set-III, 2012]
A-

17. Identify A, B, C, D, E and F in the following table. [Outside Delhi Comptt. – 2017, Set - I, III]
i.
A-
18. Mention two events in which DNA is unzipped. (b) Predict the consequences when both the
template and the coding strands of a DNA segment participate in transcription process? [CBSE,
SQP, 2018]
A-

You might also like