6840 MOLECULAR MEDICINE REPORTS 17: 6840-6846, 2018

Alogliptin alleviates hepatic steatosis in a mouse model of

nonalcoholic fatty liver disease by promoting CPT1a expression
via Thr172 phosphorylation of AMPKα in the liver
HIROSHI TOBITA, SHUICHI SATO, TOMOTAKA YAZAKI, TSUYOSHI MISHIRO,
NORIHISA ISHIMURA, SHUNNJI ISHIHARA and YOSHIKAZU KINOSHITA

Department of Gastroenterology and Hepatology, Shimane University Faculty of Medicine, Izumo, Shimane 693‑8501, Japan

Received November 14, 2017; Accepted February 6, 2018

DOI: 10.3892/mmr.2018.8673

Abstract. Pioglitazone (PIO) has been reported to be effec- Introduction

tive for nonalcoholic fatty liver disease (NAFLD) and
alogliptin (ALO) may have efficacy against NAFLD progres- Nonalcoholic fatty liver disease (NAFLD) is the most common
sion in patients with type 2 diabetes mellitus (T2DM). The chronic liver disease with a worldwide with a prevalence
present study examined the effectiveness of ALO in a ranging from 6 to 35% (1). In patients with type 2 diabetes
rodent model of NAFLD and diabetes mellitus. KK‑Ay mice mellitus (T2DM), the prevalence of NAFLD is ~60% (2). Patients
were used to produce an NAFLD model via administration with NAFLD are at a high risk of mortality from cardiovas-
of a choline‑deficient (CD) diet. To examine the effects of cular disease and liver‑associated diseases, including cirrhosis
alogliptin, KK‑Ay mice were provided with a CD diet with complications and hepatocellular carcinoma (3). In particular,
0.03% ALO and/or 0.02% PIO orally for 8 weeks. Biochemical patients with NAFLD and T2DM are at risk of liver‑associated
parameters, pathological alterations and hepatic mRNA levels mortality (4); however, at present, no pharmacological therapies
associated with fatty acid metabolism were assessed. Severe are established for T2DM patients with NAFLD refractory to
hepatic steatosis was observed in KK‑Ay mice fed with a CD lifestyle intervention. Thiazolidinediones (TZDs) and dipeptidyl
diet, which was alleviated by the administration of ALO peptidase‑4 (DPP‑4) inhibitors are known to be effective for
and/or PIO. ALO administration increased the hepatic carni- the treatment of various T2DM pathophysiological processes.
tine palmitoyltransferase 1a (CPT1a) mRNA expression level Pioglitazone (PIO), which is one of the TZDs, has been demon-
and enhanced the Thr172 phosphorylation of AMP‑activated strated to decrease serum liver enzyme levels, and to improve
protein kinase α (AMPKα) in the liver. PIO administration hepatic steatosis and lobular inflammation in patients with
tended to decrease the hepatic fatty acid synthase mRNA nonalcoholic steatohepatitis (NASH) without T2DM (5). PIO
expression level and increase the serum adiponectin level. additionally prevented methionine‑ and choline‑deficient (CD)
Homeostasis model of assessment‑insulin resistance values diet‑induced steatohepatitis in mice (6). Among the available
tended to improve with ALO and PIO administration. ALO DPP‑4 inhibitors, sitagliptin is reported to reduce serum liver
and PIO alleviated hepatic steatosis in KK‑Ay mice fed with enzyme levels and decrease ballooning score in patients with
a CD diet. ALO increased hepatic mRNA expression levels NASH and T2DM (7). Alogliptin (ALO) may possess effi-
associated with fatty acid oxidation. In addition, the results of cacy against NAFLD progression in patients with T2DM (8).
the present study suggested that ALO promotes CPT1a expres- However, whether ALO is effective for NAFLD remains to be
sion via Thr172 phosphorylation of AMPKα. elucidated. The present study examined the effectiveness of
ALO in a rodent model of NAFLD and diabetes mellitus.

Materials and methods

Animal experiments. PIO and ALO were provided by Takeda

Pharmaceutical Company, Ltd. (Osaka, Japan). The CD diet
Correspondence to: Dr Hiroshi Tobita, Department of
and standard chow were purchased from Oriental Yeast Co.,
Gastroenterology and Hepatology, Shimane University Faculty of
Medicine, 89‑1 Enya‑cho, Izumo, Shimane 693‑8501, Japan Ltd. (Tokyo, Japan). Eight‑week‑old 30 male KK‑Ay mice
E‑mail: ht1020@[Link]‑[Link] were purchased from CLEA Japan, Inc. (Tokyo, Japan). These
mice demonstrate ectopic overexpression of agouti peptide, an
Key words: nonalcoholic fatty liver disease, diabetes mellitus, endogenous melanocortin‑4 receptor (MC4R) antagonist, and
alogliptin, carnitine palmitoyltransferase 1a, AMP‑activated protein social isolation promotes obesity due primarily to decreased
kinase α, KK‑Ay mice energy expenditure and secondarily to increased food consump-
tion. In addition, such isolation leads to insulin‑independent
diabetes associated with increased hepatic gluconeogenic
 TOBITA et al: ALOGLIPTIN ALLEVIATES HEPATIC STEATOSIS BY PROMOTING CPT1a EXPRESSION 6841

gene expression (9). KK‑Ay mice were housed individually in acyl‑coenzyme A dehydrogenase (LCAD) genes were prepared
stainless‑steel cages, and provided with unrestricted access as previously described (11). Primers for mouse peroxisome
to chow and tap water throughout the duration of the present proliferator‑activated receptor α (PPARα), α smooth muscle
study. KK‑Ay mice were housed in the room of 23±3˚C and actin (α SMA), superoxide dismutase 1 (SOD1), carnitine
50±10% humidity and maintained on 12 h light/dark cycle. palmitoyltransferase 1a (CPT1a), microsomal triglyceride
Following a 4‑week acclimation period (12 weeks of age), the transfer protein (MTP), monocyte chemoattractant protein 1
mice (45.5±4.9 g) were randomly separated into five groups (MCP1) and GAPDH genes were prepared using NCBI blast
of 6 mice each and administered the following diets: Control tool and Primer3 Input (version 0.4.0, [Link]
group, standard chow; CD group, a CD diet; PIO group, the primer3‑0.4.0/) which is most commonly used for primer
CD diet containing 0.02% PIO; ALO group, the CD diet design (12). The primers are presented in Table I. All the
containing 0.03% ALO; and the PIO+ALO group, the CD diet mRNA levels were normalized to GAPDH mRNA in the same
with 0.02% PIO and 0.03% ALO. Following 8 weeks of the preparation.
diet, the mice received no food for 18 h and were administered
ether anesthesia and euthanized by exsanguination from the Protein extraction and western blotting assays. Protein
inferior vena cava. Serum and hepatic tissue samples were extraction was performed using PRO‑PREP™ protein extrac-
obtained and frozen at ‑80˚C until assayed. Certain hepatic tion solution (Intron Biotechnology, Inc., Seongnam, Korea),
tissues were fixed in 10% formalin for 48 h at room tempera- according to the manufacturer's protocol. A total of 10 mg
ture and 3 µm paraffin‑embedded hepatic tissues were stained of liver tissue was suspended in 500 µl PRO‑PREP™ solu-
with hematoxylin for 10 min and eosin for 5 min at room tion mixed with 5 µl Phosphatase‑Inhibitor Mix II (Cosmo
temperature. Then the histology of samples was analyzed under Bio Co., Ltd., Tokyo, Japan). Subsequently, the tissue was
a light microscope (magnification, x40 or x100). The present disrupted using a Tissue Lyser II (Qiagen GmbH) for 3 min at
study was performed in strict accordance with the recom- 30 Hz and homogenized with a syringe equipped with a 23‑G
mendations in the Guide for the Care and Use of Laboratory needle, followed by incubation on ice for 30 min and sonica-
Animals of the National Institutes of Health (Bethesda, MD, tion with Bioruptor UCD‑200 TM (Cosmo Bio Co., Ltd.). In
USA). The protocol was approved by the Institute for Animal water cooled with ice, sonication for 5 min at 20 KHz was
Experimentation of Shimane University (Shimane, Japan; performed for 30 sec every 60 sec. The resulting liver tissue
protocol no. IZ23‑164). lysate was centrifuged at 14,000 x g for 5 min at 4˚C, and
the supernatant was collected and subjected to downstream
Measurements of serum parameters. Serum levels of aspartate processing. The protein concentration was estimated using a
aminotransferase (AST), alanine aminotransferase (ALT), Pierce™ Bicinchoninic Acid Protein Assay kit (Takara Bio,
γ‑glutamyl transpeptidase (γ‑GTP), triglyceride (TG), total Inc., Otsu, Japan), for which 50 µg protein/lane was loaded and
cholesterol (T‑Chol) and high‑density lipoprotein‑cholesterol processed for SDS‑PAGE fractionation (4‑12% SDS‑PAGE
(HDL‑C), in addition to fasting serum glucose were measured mini; Tefco Technical Frontier Co., Tokyo, Japan) and trans-
using a Spotchem 4430 Benchtop Biochemistry Analyzer ferred to a polyvinylidene difluoride membrane (Hybond‑P;
(Arkray; SCIL, Holtzheim, France). Serum levels of fasting GE Healthcare Life Sciences, Little Chalfont, UK). Following
insulin and adiponectin were measured using ELISA kits blocking of the membrane for 1 h using 5% skimmed milk
(AKRIN‑011T and AKMAN‑011, respectively; Shibayagi Co., (Difco; BD Biosciences, Franklin Lakes, NJ, USA) in
Ltd., Tokyo, Japan). Homeostasis model of assessment‑insulin TBS‑Tween-20 (TBST; TBS and 0.05% Tween‑20, pH 7.4)
resistance (HOMA‑IR) values were calculated using the at room temperature, it was incubated for 24 h with a phos-
following formula: HOMA‑IR=[fasting serum glucose phorylated‑AMP‑activated protein kinase (AMPK)α (Thr172)
(mmol/l) x fasting serum insulin (ng/ml)]/22.5 (10). rabbit monoclonal antibody (cat. no. 2535S; Cell Signaling
Technology, Inc., Danvers, MA, USA) at a 1:500 dilution at
Determination of hepatic mRNA levels. Total RNA was 4˚C, reacted with peroxidase‑conjugated polyclonal goat
isolated from hepatic tissues with RNAlater RNA Stabilization anti‑rabbit immunoglobulins (cat. no. P7‑0448; Dako; Agilent
Reagent and purified using an RNeasy Mini kit (both from Technologies Inc., Santa Clara, CA, USA) at a 1:1,000 dilu-
Qiagen GmbH, Hilden, Germany). Samples of cDNA were tion at room temperature for 2 h, and washed three times in
generated using a cDNA synthesis kit according to the manu- TBST. The resulting signals were imaged using electrochemi-
facturer's protocols (Applied Biosystems; Thermo Fisher luminescence (GE Healthcare Bio‑Sciences, Pittsburgh, PA,
Scientific, Inc., Waltham, MA, USA). RT‑qPCR was then USA). Goat anti‑β ‑actin antibody (catalogue no. SC‑47778;
performed using an ABI PRISM 7700 sequence detection Santa Cruz Biotechnology, Inc., Dallas, TX, USA) was used as
system (Thermo Fisher Scientific, Inc.) with SYBR®-Green an internal control. Band densitometry was performed using
PCR master mix (Applied Biosystems; Thermo Fisher ImageJ software of version 1.51 (National Institutes of Health,
Scientific, Inc.). The PCR protocol used was as follows: Bethesda, MD, USA).
Enzyme activation: 94˚C for 10 min; thermocycling, 94˚C
for 15 sec, 60˚C for 1 min, repeat for 43 cycles. The relative Statistical analysis. All data are presented as the
expression of each gene was normalized to that of GAPDH. mean ± standard deviation (n=3). Mann‑Whitney's U test was
qPCR was replicated two times for each sample of cDNA. used for comparisons between two groups, while Steel‑Dwass
Primers for mouse fatty acid transport protein (FATP)1‑4, test following a Kruskal‑Wallis test was used for comparisons
fatty acid synthase (FAS), liver‑type fatty acid binding protein among multiple groups. P<0.05 was considered to indicate a
(L‑FABP), acyl‑coenzyme A oxidase 1 (AOX) and long‑chain statistically significant difference. All statistical analyses were
6842 MOLECULAR MEDICINE REPORTS 17: 6840-6846, 2018

Table I. Primer sequences for reverse transcription‑quantitative the CD, PIO, ALO and PIO+ALO groups, mean body weights
polymerase chain reaction. prior to starting the diet were 49.0±1.4, 48.2±2.4, 48.5±2.5,
48.2±2.3 and 48.9±2.3 g, respectively, while those following
Primer Sequence 8 weeks of diet consumption were 52.5±2.3, 52.6±4.9, 59.9±7.5,
53.3±4.1 and 63.8±2.5 g, respectively, illustrating that the body
FATP1‑fwd 5'‑CGCTTTCTGCGTATCGTCTG‑3' weight of the PIO+ALO group was significantly increased
FATP1‑rev 5'‑GATGCACGGGATCGTGTCT‑3' compared with that of the CD (P=0.03) and ALO (P=0.03)
FATP2‑fwd 5'‑GGTATGGGACAGGCCTTGCT‑3' groups at the end of the 8‑week period (Table II).
FATP2‑rev 5'‑GGGCATTGTGGTATAGATGACATC‑3'
FATP3‑fwd 5'‑AGTGCCAGGGATTCTACCATC‑3' Macrovesicular hepatic steatosis areas become small following
FATP3‑rev 5'‑GAACTTGGGTTTCAGCACCAC‑3' PIO and/or ALO administration. Following 8 weeks of the
FATP4‑fwd 5'‑GATGGCCTCAGCTATCTGTGA‑3' dietary treatment, the liver/body weight ratio of the CD group
FATP4‑rev 5'‑GGTGCCCGATGTGTAGATGTA‑3' was significantly greater compared with the Control group
FAS‑fwd 5'‑TGCTCCCAGCTGCAGGC‑3' (P=0.006). By contrast, no significant differences were identi-
fied among the CD, PIO, ALO and PIO+ALO groups (Table II).
FAS‑rev 5'‑GCCCGGTAGCTCTGGGTGTA‑3'
Mild microvesicular hepatic steatosis was recognized in the
L‑FABP‑fwd 5'‑GTGGTCCGCAATGAGTTCAC‑3'
Control group and severe macrovesicular hepatic steatosis was
L‑FABP‑rev 5'‑GTATTGGTGATTGTGTCTCC‑3' recognized in the CD group. Macrovesicular hepatic steatosis
AOX‑fwd 5'‑CTTGTTCGCGCAAGTGAGG‑3' areas in the PIO, ALO and PIO+ALO groups were smaller
AOX‑rev 5'‑CAGGATCCGACTGTTTACC‑3' compared with the CD group (Fig. 1).
LCAD‑fwd 5'‑AAGGATTTATTAAGGGCAAGAAGC‑3'
LCAD‑rev 5'‑GGAAGCGGAGGCGGAGTC‑3' CD diet fed to KK‑Ay mice for 8 weeks does not present
PPARα‑fwd 5'‑TGCAAACTTGGACTTGAACG‑3' evident histological findings of inflammation and fibrosis. No
PPARα‑rev 5'‑TGATGTCACAGAACGGCTTC‑3' evident histological inflammatory alterations in the liver were
αSMA‑fwd 5'‑CAACTGGGACGACATGGAA‑3' observed in the CD group; however, the level of MCP1 expres-
αSMA‑rev 5'‑GGTCTCAAACATAATCTGGGTCA‑3' sion in the livers of the CD group was significantly increased
SOD1‑fwd 5'‑GAACCATCCACTTCGAGCAG‑3' compared with in the Control group. Conversely, no significant
differences were identified between MCP1 expression levels in
SOD1‑rev 5'‑AAAATGAGGTCCTGCACTGG‑3'
the livers of the PIO, ALO and PIO+ALO groups compared
CPT1a‑fwd 5'‑TGTCAAAGATACCGTGAGCAG‑3'
with in the CD group. There was no evident hepatic fibrosis
CPT1a‑rev 5'‑GCCCACCAGGATTTTAGCTT‑3' observed in the CD group and the expression levels of αSMA
MTP‑fwd 5'‑CATGTCAGCCATCCTGTTTG‑3' in the liver were not significantly different compared with in
MTP‑rev 5'‑CTCGCGATACCACAGACTGA‑3' the Control group (Table III).
MCP1‑fwd 5'‑AGGTCCCTGTCATGCTTCTG‑3'
MCP1‑rev 5'‑TCATTGGGATCATCTTGCTG‑3' Serum parameter of liver tests and metabolic laboratory
GAPDH‑fwd 5'‑ACCCAGAAGACTGTGGATGG‑3' variables are not altered by PIO or ALO administration.
GAPDH‑rev 5'‑GGTCCTCAGTGTAGCCCAAG‑3' The serum levels of AST (P=0.006) and ALT (P=0.006)
were significantly higher in the CD group compared with
FATP, fatty acid transport protein; FAS, fatty acid synthase; L‑FABP, the Control group, whereas those levels in the PIO, ALO and
long‑chain acyl‑coenzyme A dehydrogenase; AOX, acyl‑coenzyme PIO+ALO groups were not statistically different from the CD
A oxidase 1; LCAD, long‑chain acyl‑coenzyme A dehydrogenase; group (Table IV). Serum adiponectin in the CD group was not
PPARα, peroxisome proliferator‑activated receptor α; αSMA, α smooth
statistically different compared with the Control group, while
muscle actin; SOD1, superoxide dismutase 1; CPT1a, carnitine palmi-
toyltransferase 1a; MTP, microsomal triglyceride transfer protein;
its level in the PIO group demonstrated a tendency to be higher
MCP1, monocyte chemoattractant protein 1; GAPDH, glyceralalde- compared with the CD group (P=0.09; Table IV). Fasting serum
hyde‑3‑phosphate dehydrogenase; fwd, forward; rev, reverse; insulin in the CD group demonstrated a tendency to be lower
compared with the Control group (P=0.055), while no signifi-
cant differences were identified among the CD diet groups. On
the other hand, fasting serum glucose in the CD group tended
performed using Statistical Analysis Software (BellCurve for to be higher compared with the PIO+ALO (P=0.082) group
Excel, version 2.14; Social Survey Research Information Co., and HOMA‑IR in the PIO+ALO (P=0.082) group also tended
Ltd., Tokyo, Japan). to be lower compared with the CD group (Table IV). Serum TG
in the CD group was almost equal to that in the Control group
Results and did not alter with PIO/ALO administration (Table IV).
However, serum T‑Cho and HDL‑C in the CD group were
Diet consumption and body weight are not affected by the significantly higher compared with the Control group, while
administration of PIO or ALO. The Control group consumed a serum HDL‑C in the PIO+ALO group was higher compared
greater amount of food compared with the CD group (23.5±1.6 with the ALO group (Table IV).
and 16.8±2.5 kcal/body/day, respectively; P=0.006). No signifi-
cant differences were identified in the amounts of food consumed mRNA expression of CPT1a in the liver is significantly
among the CD, PIO, ALO and PIO+ALO groups (Table II). In increased by ALO administration. The gene expression levels
 TOBITA et al: ALOGLIPTIN ALLEVIATES HEPATIC STEATOSIS BY PROMOTING CPT1a EXPRESSION 6843

Table II. Food intake, body weight and liver weight/body weight at 8 weeks in each group.

Variable Control CD PIO ALO PIO+ALO

Food intake, kcal/day/body 23.5±1.6 16.8±2.4a 16.9±2.3 16.3±1.5 18.6±0.7

Body weight after eight weeks, g 52.5±2.3 52.6±4.9 59.9±7.5 53.3±4.1 63.8±2.5b,c
Liver weight/body weight (%) 5.8±0.6 12.7±4.4a 7.2±1.4 10.6±2.6 7.3±2.8

Data are presented as the mean ± standard deviation. aP<0.05 vs. Control group, bP<0.05 vs. CD group, cP<0.05 vs. ALO group. CD, choline‑defi-
cient diet group; PIO, pioglitazone group; ALO, alogliptin group; PIO+ALO, pioglitazone and alogliptin group.

Table III. mRNA levels of MCP1 and αSMA relative to the mRNA level of GAPDH in the livers of the Control, CD, PIO, ALO
and PIO+ALO groups.

Control CD PIO ALO PIO+ALO

MCP1 0.05±0.01 0.63±0.07a 0.64±0.04 0.74±0.08 0.71±0.14

αSMA 1.31±0.68 2.42±0.32 1.49±1.25 1.84±1.25 1.74±1.15

Data are presented as the mean ± standard deviation. aP<0.05 vs. Control group. MCP1, monocyte chemoattractant protein 1; αSMA, α smooth
muscle actin; CD, choline‑deficient diet group; PIO, pioglitazone group; ALO, alogliptin group; PIO+ALO, pioglitazone and alogliptin group.

Figure 1. Hematoxylin‑eosin staining of livers. Mild microvesicular hepatic steatosis (filled arrow) was recognized in the Control group. Magnification, x40.
Severe macrovesicular hepatic steatosis (open arrow) was recognized in the CD group. Magnification, x40. Enlarged images of microvesicular and macrove-
sicular steatosis are presented in the lower right of the images of the Control and the CD groups, respectively. Magnification, x100. CD, choline‑deficient diet
group; PIO, pioglitazone group; ALO, alogliptin group; PIO+ALO, pioglitazone and alogliptin group. Small arrows and open arrows indicate microvesicular
steatosis and macrovesicular steatosis respectively.

of enzymes associated with lipid metabolism in liver tissue expression levels of PPARα (P=0.017), L‑FABP (P=0.018),
were examined using RT‑qPCR, including genes associated LCAD (P=0.011) and MTP (P=0.006) in the liver were
with fatty acid uptake (FATP1, 2, 3 and 4), fatty acid synthesis, significantly decreased in the CD group compared with the
fatty acid oxidation (PPARα, L‑FABP, CPT1a, AOX and Control group (Table V). Macrovesicular hepatic areas were
LCAD) and very low density lipoprotein export. The expres- decreased in the PIO, ALO and PIO+ALO groups compared
sion levels of FATP3 (P=0.006) and FAS (P=0.006) in the with the CD group (Fig. 1). The expression levels of lipid
liver were significantly increased in the CD group compared metabolic genes in the livers of mice in the PIO, ALO and
with the Control group (Table V). On the other hand, the PIO+ALO groups were also compared with those in the CD
6844 MOLECULAR MEDICINE REPORTS 17: 6840-6846, 2018

Table IV. Alterations in serum parameters.

Parameter Control CD PIO ALO PIO+ALO

AST, IU/l 37±6 301±120a 268±99 213±68 236±76

ALT, IU/l 27±9 609±206a 405±129 463±204 398±115
Adiponectin, mg/ml 5.50±2.15 3.62±1.02 5.03±0.62 4.10±0.80 5.40±1.57
Fasting serum insulin, ng/ml 3.1±0.5 1.3±1.3 0.9±0.6 1.0±0.6 0.3±0.1
Fasting serum glucose, mmol/l 11.3±2.1 14.0±1.8 11.8±1.0 13.2±2.9 10.5±1.9
HOMA‑IR 1.61±0.53 0.83±0.85 0.46±0.36 0.63±0.44 0.16±0.83
TG, mg/dl 143±21 143±23 118±24 140±23 110±12
T‑Chol, mg/dl 95±11 155±23a 163±32 141±29 156±14
HDL‑C, mg/dl 64±8 84±8a 85±13 79±6 94±7b

Data are presented as the mean ± standard deviation. aP<0.05 vs. Control group; bP<0.05 vs. ALO group. CD, choline‑deficient diet group;
PIO, pioglitazone group; ALO, alogliptin group; PIO+ALO, pioglitazone and alogliptin group; AST, aspartate aminotransferase; ALT, alanine
aminotransferase; HOMA‑IR, homeostasis model of assessment‑insulin resistance; TG, triglyceride; T‑Chol, total cholesterol; HDL‑C, high
density lipoprotein‑cholesterol.

Table V. mRNA levels of various target genes/mRNA level of GAPDH in liver following pioglitazone and/or alogliptin
administration.

Target gene Control CD PIO ALO PIO+ALO

FATP1 0.79±0.14 0.56±0.17 0.62±0.12 0.42±0.13 0.43±0.14

FATP2 2.64±0.33 1.25±0.39a 1.88±0.65 1.65±0.59 1.57±0.69
FATP3 0.37±0.05 0.91±0.26a 0.72±0.16 0.78±0.31 0.82±0.22
FATP4 0.79±0.14 0.56±0.17 0.68±0.22 0.81±0.14 0.82±0.14
FAS 0.39±0.04 0.78±0.23a 0.48±0.10 0.55±0.13 0.53±0.15
L‑FABP 1.21±0.35 0.78±0.18a 1.07±0.46 0.89±0.18 0.94±0.12
AOX 1.30±0.39 1.03±0.23 1.64±0.63 1.16±0.25 1.45±0.58
LCAD 1.61±0.44 0.90±0.25a 0.93±0.59 0.92±0.21 0.91±0.13
PPARα 1.25±0.39 0.72±0.25a 1.15±0.56 0.92±0.07 1.05±0.28
SOD1 0.93±0.45 0.34±0.14a 0.57±0.31 0.55±0.20 0.70±0.14
CPT1a 0.47±0.19 0.55±0.20 0.49±0.26 2.00±0.63b,c 1.94±0.73b,c
MTP 1.39±0.14 0.94±0.11a 0.99±0.22 0.97±0.14 0.99±0.34

Data are presented as the mean ± standard deviation. aP<0.05 vs. Control group; bP<0.05 vs. CD group; cP<0.05 vs. PIO group; dP<0.05 vs.
ALO group. CD, choline‑deficient diet group; PIO, pioglitazone group; ALO, alogliptin group; PIO+ALO, pioglitazone and alogliptin group;
FATP, fatty acid transport protein; FAS, fatty acid synthase; L‑FABP, long‑chain acyl‑coenzyme A dehydrogenase; AOX, acyl‑coenzyme A
oxidase 1; LCAD, long‑chain acyl‑coenzyme A dehydrogenase; PPARα, peroxisome proliferator‑activated receptor α; SOD1, superoxide
dismutase 1; CPT1a, carnitine palmitoyltransferase 1a; MTP, microsomal triglyceride transfer protein.

group to examine the mechanism of prevention of fatty liver ALO upregulates CPT1a expression via activation of
by PIO and/or ALO administration. The expression of FAS AMP‑activated protein kinase. Western blotting demonstrated
in the liver demonstrated a tendency to be decreased in the that ALO promoted the phosphorylation of AMPK on Thr‑172
PIO group compared with the CD group (P=0.051), while in the livers of the ALO group mice compared with the CD
the expression of CPT1a in the ALO group was significantly group (Fig. 2).
increased compared with the CD (P=0.031) and PIO (P=0.031)
groups, whereas the expression of AOX did not alter following Discussion
administration of PIO and/or ALO. The antioxidant enzyme
SOD1 was additionally examined. Its expression in the liver The present study demonstrated that severe hepatic steatosis
was significantly decreased in the CD group compared with developed in KK‑Ay mice administered a CD diet (the CD group),
the Control group (P=0.045), while it demonstrated a tendency while weight gain was the same as those fed a standard diet (the
to increase in the PIO+ALO group compared with the CD Control group). It was concluded that the increased expression
group (P=0.051) (Table V). levels of FATP3 and FAS, and the decreased expression levels
 TOBITA et al: ALOGLIPTIN ALLEVIATES HEPATIC STEATOSIS BY PROMOTING CPT1a EXPRESSION 6845

the CD group demonstrated a decreasing tendency compared

with the Control group, PIO tended to increase the level in
the PIO group compared with the CD group. Furthermore, the
RT‑qPCR analysis of hepatic lipid metabolism demonstrated
that PIO decreased the gene expression level of FAS. These
results suggested that PIO improved hepatic steatosis by
increasing the level of adiponectin and decreasing fatty acid
synthesis. Although PIO has been reported to reduce the level
of αSMA mRNA (17), the results of the present study did not
demonstrate such a reduction in the livers of mice in the PIO
and PIO+ALO groups.
A number of DPP‑4 inhibitors have been reported to
be effective for NASH. Linagliptin was demonstrated to
alleviate hepatic steatosis and increased the expression of
acetyl‑CoA carboxylase 2 in the livers of NASH model
mice (18). Kern et al (19) reported that linagliptin significantly
decreased the mRNA expression levels of genes associated
with inflammation, insulin resistance and fatty acid synthesis
in the livers of diet‑induced NASH model mice, although
such an effect was not observed on the mRNA expression
of genes involved in fatty acid oxidation. MK0626, a DPP‑4
inhibitor similar to sitagliptin in regard to pharmacokinetics,
rescued western diet‑induced decreases in hepatic PPARγ
coactivator‑1α (PGC‑1α) and CPT1a mRNA expression (20). In
the present study, ALO alleviated hepatic steatosis in CD‑diet
Figure 2. Western blotting of hepatic Thr‑172 P‑AMPKα. Western blotting
findings demonstrated that ALO promoted the phosphorylation of AMPK on
fed KK‑Ay mice and significantly increased the hepatic mRNA
Thr‑172 in the livers of the ALO group mice, compared with the CD group. expression of CPT1a compared with the CD and PIO groups.
Band densitometry demonstrated that the bands were denser in the ALO It was hypothesized that ALO attenuated hepatic steatosis
group mice (n=5) compared with the CD group (n=6). Data are expressed primarily via a fatty acid oxidation pathway, as hepatic mRNA
as the mean ± standard error of the mean. *P<0.01 vs. CD group. AMPK,
AMP‑activated protein kinase; CD, choline‑deficient diet group; PIO, piogli-
expression is associated with the hepatic uptake of free fatty
tazone group; ALO, alogliptin group; PIO+ALO, pioglitazone and alogliptin acid (FATP1‑4), and fatty acid synthesis and triacylglycerol
group; P, phosphorylated. export did not alter with ALO administration.
The present study additionally demonstrated that ALO
increased hepatic CPT1a expression via the AMPK pathway.
of PPARα, L‑FABP, LCAD and MTP, in the livers of the CD CPT1a is important for limiting fatty acid oxidation, and its
group mice contributed to severe hepatic steatosis. MTP is a activity in the liver was identified to be protecting obese mice
peptide that incorporates triglycerides into very low density against hepatic steatosis and insulin resistance (21). Another
lipoprotein (13), thus it was hypothesized that downregulation of study demonstrated that GLP‑1 reduces hepatic lipogenesis via
MTP expression contributes to hepatic steatosis. As for glucose activation of AMPK (22). AMPK is an evolutionarily conserved
metabolism, no significant differences were identified between metabolic stress‑sensing kinase that regulates cellular energy
fasting serum glucose, fasting serum insulin and HOMA‑IR status through phosphorylation of key substrates (23). An
levels in the Control and CD groups, indicating that the CD diet in vitro study identified that activation of AMPK increases the
did not attenuate insulin resistance or glucose intolerance. By expression of CPT1a (24). Dahlhoff et al (25) demonstrated
contrast, a methionine‑ and choline‑deficient diet fed to KK‑Ay that methyl‑donor supplementation (MDS) in obese mice
mice for 8 weeks resulted in severe liver steatosis, inflammatory prevented the progression of NAFLD, and suggested that
cell infiltration and liver fibrosis (14). MDS activates AMPK and increases CPT1a expression in the
In the present study, hepatic steatosis was evidently allevi- liver, resulting in the promotion of fatty acid oxidation. In the
ated by administration of PIO. PIO is a TZD, which are known present study, ALO increased hepatic CPT1a expression in
to be effective for T2DM treatment. A previous meta‑analysis CD‑diet fed KK‑Ay mice, which it was hypothesized occurred
identified that PIO improves insulin sensitivity, serum ALT via AMPK activation, including from MDS. The results of the
levels and histological features in patients with NASH (15). present study demonstrated that ALO promoted the Thr172
Gastaldelli et al (16) evaluated the association between phosphorylation of AMPK and increased CPT1a expression in
alterations in plasma adiponectin in patients with NASH and the livers of CD‑diet fed KK‑Ay mice.
metabolic/histological improvement following treatment with The present study has certain limitations. The mRNA
PIO, and concluded that PIO increases the level of adiponectin expression levels of genes associated with lipid metabolism
in patients with NASH, which is important to reverse insulin in liver tissue were examined, although not those of proteins.
resistance and improve liver histology. The present study Furthermore, only a single mouse model was utilized. It may
demonstrated that PIO administration in NAFLD model mice be necessary to examine whether gene expression levels at the
with diabetes mellitus tended to increase the plasma concen- mRNA level are the same as at the protein level. In addition,
tration of adiponectin. Although the level of adiponectin in other mouse models may be used in future studies.
6846 MOLECULAR MEDICINE REPORTS 17: 6840-6846, 2018

In conclusion, PIO prevented hepatic steatosis by decreasing 6. Da Silva Morais A, Lebrun V, Abarca‑Quinones J, Brichard S,
Hue L, Guigas B, Viollet B and Leclercq IA: Prevention of steato-
the mRNA expression level of genes previously reported to be hepatitis by pioglitazone: Implication of adiponectin‑dependent
associated with fatty acid synthesis. It is suggested that ALO inhibition of SREBP‑1c and inflammation. J Hepatol 50: 489‑500,
prevents hepatic steatosis in KK‑Ay mice fed a CD diet, primarily 2009.
7. Yilmaz Y, Yonal O, Deyneli O, Celikel CA, Kalayci C and
by increasing the expression of CPT1a via the AMPK pathway. Duman DG: Effects of sitagliptin in diabetic patients with nonal-
coholic steatohepatitis. Acta Gastroenterol Belg 75: 240‑244, 2012.
Acknowledgements 8. Mashitani T, Noguchi R, Okura Y, Namisaki T, Mitoro A, Ishii H,
Nakatani T, Kikuchi E, Moriyasu H, Matsumoto M, et al: Efficacy
of alogliptin in preventing non‑alcoholic fatty liver disease progres-
We thank Rika Tohma, and Keiko Masuzaki (Shimane sion in patients with type 2 diabetes. Biomed Rep 4: 183‑187, 2016.
University, Japan) for their technical assistance, as well as the 9. Nonogaki K, Nozue K and Oka Y: Social isolation affects
members of our laboratory for the helpful discussion. the development of obesity and type 2 diabetes in mice.
Endocrinology 148: 4658‑4666, 2007.
10. Haluzik MM, Lacinova Z, Dolinkova M, Haluzikova D,
Funding Housa D, Horinek A, Vernerova Z, Kumstyrova T and
Haluzik M: Improvement of insulin sensitivity after peroxisome
proliferator‑activated receptor‑alpha agonist treatment is accom-
No funding was received. panied by paradoxical increase of circulating resistin levels.
Endocrinology 147: 4517‑4524, 2006.
Availability of data and materials 11. Rinella ME, Elias MS, Smolak RR, Fu T, Borensztajn J and
Green RM: Mechanisms of hepatic steatosis in mice fed a lipogenic
methionine choline‑deficient diet. J Lipid Res 49: 1068‑1076, 2008.
All data generated or analyzed during this study are included 12. Rozen S and Skaletsky H: Primer3 on the WWW for general
in this published article. users and for biologist programmers. Methods Mol Biol 132:
365‑386, 2000.
13. Raabe M, Véniant MM, Sullivan MA, Zlot CH, Björkegren J,
Authors' contributions Nielsen LB, Wong JS, Hamilton RL and Young SG: Analysis of
the role of microsomal triglyceride transfer protein in the liver of
tissue‑specific knockout mice. J Clin Invest 103: 1287‑1298, 1999.
HT and SS designed the research study and wrote the paper. 14. Okumura K, Ikejima K, Kon K, Abe W, Yamashina S, Enomoto N,
TY, TM and NI performed data acquisition and analysis. SI Takei Y and Sato N: Exacerbation of dietary steatohepatitis
and YK provided major contributions to the design of the and fibrosis in obese, diabetic KK‑A(y) mice. Hepatol Res 36:
217‑228, 2006.
study. All authors read and approved the final manuscript. 15. Boettcher E, Csako G, Pucino F, Wesley R and Loomba R:
Meta‑analysis: Pioglitazone improves liver histology and fibrosis
Ethics approval and consent to participate in patients with non‑alcoholic steatohepatitis. Aliment Pharmacol
Ther 35: 66‑75, 2012.
16. Gastaldelli A, Harrison S, Belfort‑Aguiar R, Hardies J, Balas B,
The present study was performed in strict accordance with Schenker S and Cusi K: Pioglitazone in the treatment of NASH:
the recommendations in the Guide for the Care and Use of The role of adiponectin. Aliment Pharmacol Ther 32: 769‑775, 2010.
Laboratory Animals of the National Institutes of Health 17. Kon K, Ikejima K, Hirose M, Yoshikawa M, Enomoto N,
Kitamura T, Takei Y and Sato N: Pioglitazone prevents
(Bethesda, MD, USA). The protocol was approved by the early‑phase hepatic fibrogenesis caused by carbon tetrachloride.
Institute for Animal Experimentation of Shimane University Biochem Biophys Res Commun 291: 55‑61, 2002.
(Shimane, Japan; protocol no. IZ23‑164). 18. Klein T, Fujii M, Sandel J, Shibazaki Y, Wakamatsu K, Mark M
and Yoneyama H: Linagliptin alleviates hepatic steatosis and
inflammation in a mouse model of non‑alcoholic steatohepatitis.
Consent for publication Med Mol Morphol 47: 137‑149, 2014.
19. Kern M, Klöting N, Niessen HG, Thomas L, Stiller D, Mark M,
Klein T and Blüher M: Linagliptin improves insulin sensitivity and
Not applicable. hepatic steatosis in diet‑induced obesity. PLoS One 7: e38744, 2012.
20. Aroor AR, Habibi J, Ford DA, Nistala R, Lastra G, Manrique C,
Competing interests Dunham MM, Ford KD, Thyfault JP, Parks EJ, et al: Dipeptidyl
peptidase‑4 inhibition ameliorates Western diet‑induced hepatic
steatosis and insulin resistance through hepatic lipid remodeling
The authors declare that they have no competing interests. and modulation of hepatic mitochondrial function. Diabetes 64:
1988‑2001, 2015.
21. Orellana‑Gavaldà JM, Herrero L, Malandrino MI, Pañeda A,
References Sol Rodríguez‑Peña M, Petry H, Asins G, Van Deventer S,
Hegardt FG and Serra D: Molecular therapy for obesity and
1. Bellentani S: The epidemiology of non‑alcoholic fatty liver diabetes based on a long‑term increase in hepatic fatty‑acid
disease. Liver Int 1: 81‑84, 2017. oxidation. Hepatology 53: 821‑832, 2011.
2. Dai W, Ye L, Liu A, Wen SW, Deng J, Wu X and Lai Z: Prevalence 22. Ben‑Shlomo S, Zvibel I, Shnell M, Shlomai A, Chepurko E,
of nonalcoholic fatty liver disease in patients with type 2 diabetes Halpern Z, Barzilai N, Oren R and Fishman S: Glucagon‑like
mellitus: A meta‑analysis. Medicine (Baltimore) 96: e8179, 2017. peptide‑1 reduces hepatic lipogenesis via activation of
3. Angulo P, Kleiner DE, Dam‑Larsen S, Adams LA, Bjornsson ES, AMP‑activated protein kinase. J Hepatol 54: 1214‑1223, 2011.
Charatcharoenwitthaya P, Mills PR, Keach JC, Lafferty HD, 23. Steinberg GR and Kemp BE: AMPK in health and disease.
Stahler A, et al: Liver fibrosis, but no other histologic features, Physiol Rev 89: 1025‑1078, 2009.
is associated with long‑term outcomes of patients with nonalco- 24. Kim JH, Kang SI, Shin HS, Yoon SA, Kang SW, Ko HC and
holic fatty liver disease. Gastroenterology 149: 389‑397, 2015. Kim SJ: Sasa quelpaertensis and p‑coumaric acid attenuate
4. Rafig N, Bai C, Fang Y, Srishord M, McCullough A, Gramlich T oleic acid‑induced lipid accumulation in HepG2 cells. Biosci
and Younossi ZM: Long‑term follow‑up of patients with nonal- Biotechnol Biochem 77: 1595‑1598, 2013.
coholic fatty liver. Clin Gastroenterol Hepatol 7: 234‑238, 2009. 25. Dahlhoff C, Worsch S, Sailer M, Hummel BA, Fiamoncini J,
5. Sanyal AJ, Chalasani N, Kowdley KV, McCullough A, Diehl AM, Uebel K, Obeid R, Scherling C, Geisel J, Bader BL and
Bass NM, Neuschwander‑Tetri BA, Lavine JE, Tonascia J, Daniel H: Methyl‑donor supplementation in obese mice prevents
Unalp A, et al: Pioglitazone, vitamin E, or placebo for nonalco- the progression of NAFLD, activates AMPK and decreases
holic steatohepatitis. N Engl J Med 362: 1675‑1685, 2010. acyl‑carnitine levels. Mol Metab 3: 565‑580, 2014.