0% found this document useful (0 votes)
719 views50 pages

Day 3 - Transcription and RNA Processing

1. Transcription is the first step of gene expression where information from DNA is copied into RNA. 2. RNA polymerase binds to promoter sequences on DNA and synthesizes RNA using one DNA strand as a template. 3. The resulting RNA transcript may undergo further processing before being used to produce a protein via translation.

Uploaded by

Aniket Parab
Copyright
© Attribution Non-Commercial (BY-NC)
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
719 views50 pages

Day 3 - Transcription and RNA Processing

1. Transcription is the first step of gene expression where information from DNA is copied into RNA. 2. RNA polymerase binds to promoter sequences on DNA and synthesizes RNA using one DNA strand as a template. 3. The resulting RNA transcript may undergo further processing before being used to produce a protein via translation.

Uploaded by

Aniket Parab
Copyright
© Attribution Non-Commercial (BY-NC)
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
  • The Central Dogma: Explains the flow of genetic information from DNA to RNA to protein, highlighting the basic molecular biology dogma.
  • Exceptions to the Central Dogma: Details cases where genetic information flow deviates from the traditional dogma, involving reverse transcription and ribozymes.
  • Transcription and Translation: Describes the processes of transcription and translation, including enzyme roles and sequence information conversion.
  • RNA Precursors and Structure: Discusses components, formation, and structure of RNA, including nucleotide bonding and RNA polynucleotide chains.
  • Transcription Mechanisms: Explores how RNA polymerase catalyzes RNA synthesis, highlighting important features of transcription initiation and elongation.
  • Transcription Cycle and Regulation: Covers the transcription cycle including initiation, elongation, and termination, with a focus on regulatory mechanisms in prokaryotes.
  • Sigma Factors and Promoters in E. coli: Explains the role of sigma factors in transcription initiation and the structure and function of different promoter elements.
  • Transcription Termination: Analyzes both factor-independent and factor-dependent transcription termination processes in prokaryotic systems.
  • Antibiotics Affecting Transcription: Examines how various antibiotics interact with transcription machinery, inhibiting processes crucial for bacterial survival.
  • RNA Processing and Editing: Details the pathways involved in RNA processing, modification, and editing, including specific cases observed in organisms like Trypanosomes.

Transcription and RNA Processing

The Central Dogma


For the phenotypic expression of any gene, information contained in DNA is first transcribed into an RNA from where it is translated into the amino-acid sequence of the corresponding protein. Phenotypes are the manifestation of the activity/function of proteins and catalytic RNAs.

DNA

Transcription

RNA Pol + factors

RNA

Translation

Ribosomes, tRNAaa + other factors

Protein

Function Enzyme, structural element, hormone, regulatory, etc

Phenotype

The assumptions of the central dogma are sound, but there are exceptions!

The Revised Central Dogma


DNA
REVERSE TRANSCRIPTION

Ribozymes

FUNCTION

Interactions

FUNCTION

Exceptions to the Central Dogma


1. Information contained in RNA can be copied into DNA by reverse transcriptases and telomerase. EXAMPLES: retroviruses, mobile introns. 2. After transcription, nucleotides can be added to, deleted from, or modified in some mRNAs by processes known as RNA editing. EXAMPLES: addition and deletion of Us in the mitochondria of trypanosomes, conversion of Cs to Us in plant mitochondria by deamination. 3. Not all genes are expressed phenotypically through proteins. EXAMPLES: the RNAs of mobile introns are nucleases, the LSU ribosomal RNA has peptide synthetase activity. Such RNAs are classified as ribozymes.

Ribozymes favor the concept that a more primitive RNA-based ancestral form of life may have preceded the DNA-, RNA-, protein-based life as we know it now.

Transcription
The first step of the expression of a gene (DNA) is to transcribe the information contained in the nucleotide sequence from one strand (template or antisense strand) into an RNA. The product of this transaction is a transcript. If a gene carries information for the assembly of a protein, the transcript is a messenger RNA (mRNA).

Translation
The information in mRNAs is decoded by ribosomes and translated by alignment of three-nucleotide codons with corresponding tRNAs that deliver the corresponding amino acids.

The messenger: a general view of transcription and Coding strand of DNA translation
Template strand of DNA

mRNA

Transcription and RNA Processing


Topics
1. RNA structure. 2. RNA synthesis. 3. Transcription: initiation, elongation and termination. 4. RNA processing: cleavage of precursor transcripts and modification of bases. 5. RNA and protein splicing. 6. RNA editing.
Videos

RNA precursors
Base
O

Ribonucleoside triphosphate

RNA polynucleotide chain Fig. 2.1

RNA Structure
Primary structure: order of the nucleotides read 5 3 5 ACUCAUCGGCACGUCAUGCUGAUAUCCGGCUUGACACU 3 Secondary structure: regions of base pairing (double-stranded helical regions) Tertiary structure: folding of the entire RNA chain

Only non-covalent hydrogen bonding is involved in secondary and tertiary structure formation

Stem-loop

Fig 2.2

Pseudoknot

Tertiary structure of a transfer RNA


5 3

Structure of E. coli 16S rRNA


1. ~1500 nucleotides long 2. Compact 3-D folding 3. Highly conserved

5 3

Kinds of RNA found in a typical bacterium (E. coli )


RNA Function Size 620S Stability T Few minutes longer than one generation longer than one generation variable No. of different kinds ~4000 variable <27

Messenger contains information for mRNA assembly of amino-acid sequence of protein by ribosomes and tRNA tRNA Transfer codon recognition in partnership with ribosome and transfer of amino acid into polypeptide Ribosomal component of ribosome, binding of mRNA, tRNA and formation of peptide bond between amino acids Diverse roles: primers, gene regulation, guide RNAs, RNA processing and degradation, cofactor in protein complexes

4S 23S 16S 5S <5S

rRNA

3 unknown and growing

Small RNAs

S = Sedimentation coefficient (Swedberg units), related to size and shape of molecule.

RNAs and DNAs can be separated by size in sucrose gradients by centrifugation and by gel-electrophoresis

16S 23S 30S


Start

30S Precursor 23S 16S

Separation by Electrophoresis

5S

Transcription: RNA polymerase (RNAP) catalyzed synthesis of RNA on a DNA template


RNA polymerases do NOT require a primer for the initiation of RNA synthesis.

Direction of RNA synthesis:

5 3
Direction of reading of template DNA strand:

3 5
Do you remember the principles of nucleic-acid synthesis? Ch. 1!

Subunits of the E. coli holo RNAP and their Functions


Subunit
alpha () beta () beta () omega () sigma (70)

Size aa Da
329 1342 1407 91 613 36,511 150,616 155,159 10,237 70,263

Gene Function
rpoA rpoB rpoC rpoZ rpoD
Assembly of RNAP, binding of some regulatory proteins, catalysis. Catalysis of chain initiation and elongation. Binding to DNA template. Restores denatured enzyme to fully functional form. Directs enzyme to corresponding promoters.

Important Features of Transcription in Prokaryotes


Transcription starts at promoters, located in the DNA upstream of the coding region of one gene or a group of functionally related genes. Promoters are relatively short nucleotide sequences in the DNA (genome) that are recognized by sigma () proteins (factors). Sigma factors bound to promoters recruit (interact, bind) the RNA polymerase core enzyme for the initiation of transcription at specific transcription start sites that are part of the promoter sequence in the DNA.
What do promoters look like?

Typical structure of Bacterial Housekeeping-Gene 70 Promoters with 10 and 35 Regions

Coding-strand consensus sequences Coding 5 Template 3 RNA


(A/G)NNNNN --

DNA

Question: What do the negative numbers mean?


Number of bases upstream (5) of a designated place, which, in this case, is the first base of the RNA (transcription start point).

Fig 2.6

Active site of RNA polymerase and binding of 70


1 4 are domains of 70 proteins Promoter contacts Active site channel pincer 35 10

pincer

RNA exit channel

Secondary channel for nucleoside triphosphate entry

Core RNA polymerase


Crabclaw structure

Holoenzyme

Transcription starts at promoters and ends at terminators


Proteins called factors bind to core RNAP and direct it to DNA nucleotide sequences called promoters. The two strands of the DNA are separated by . A transcription bubble is generated, and transcription starts at a T or C in the template strand. No primer is required for transcript initiation and no helicase is required for the unwinding of the DNA.

RNA synthesis proceeds for ~8 9 nt along the template, is released. Transcription continues until the polymerase with its transcription bubble reaches a transcription termination (t ) site. The RNA and the polymerase dissociate and are released from the DNA.

Fig. 2.7

Transcription Cycle
binding

Termination Closed complex (RPC) Transcription elongation complex (TEC) release and elongation Open complex (RPO)

Promoter recognition

DNA isomerization

Escape

Initiation

Abort

Not all 70 promoters are created equal

UP element Extended 10

Evolutionarily Conserved Regions and Functional domains of Bacterial 70 Factors


70 factors initiate the transcription of housekeeping genes (named after the 70 kDa housekeeping factor of E. coli ). Shown below is the linear arrangement of the 70-like factor of Thermus aquaticus (~43 kDa).

Inhibition of -DNA binding

Down arrows indicate contact points with core RNAP proteins Electrostatic interactions Direct hydrogen bonds Indirect hydrogen bonds potential hydrophobic (van der Waals) contacts.
From S. Borukhov and E. Nudler 2003. Curr. Opinion. Microbiol. 6: 93-100

RNAP Holoenzyme Open Initiation Complex


Part of has been removed to expose the interior of the holoenzyme initiation complex.
Modified from K.S. Murakami and S. A. Darst 2003. Curr. Opinion Structural Biol. 13: 31-39.

RNA channel Nascent RNA

Coding-strand

Template-strand

Transcription Elongation Complex (TEC)

The RNA polymerase adds from 30 to 100 nucleotides per second to the growing RNA molecule (6000 maximum per min).

RNA Polymerase Backtracking


The formation of a secondary structure (stem-loop or hairpin) at the 3 end of a growing transcript can cause backtracking of the RNA polymerase. The 3 end of the RNA is pushed into the secondary channel. GreA/GreB insert their N-termini, which have exonuclease activity, into the secondary channel and degrade the RNA until it is rearranged (properly paired with the DNA template?) in the active site channel so that elongation can be resumed. The true function of RNAP pausing and backtracking is somewhat enigmatic.

The number of different factors varies greatly among organisms


Mycoplasma genitalium has only ONE factor E. coli has SEVEN different factors Streptomyces coelicolor has MORE THAN SIXTY different factors

Each type of factor recognizes its own unique class of promoter sequences
See next page

The Seven Sigma Factors of E. coli and their Functions


Sigma factor
70 (D) N (54) H (32) S (38) E (24) F (28) FecI

Gene
rpoD rpoN (ntrA, glnF) rpoH rpoS rpoE rpoF fecI

Function
Principal sigma factor (housekeeping gene transcription). Nitrogen-regulated gene transcription. Heat-shock gene transcription. Gene expression in stationary phase cells. Periplasmic stress response proteins. Expression of flagellar operons. Regulates the fec genes for iron dicitrate transport.

Consensus Sequences of E. coli Promoters


CONSENSUS SEQUENCE Sigma 70 (D) H (32) E (24) F (28) FecI (18) S (38) 35 region TTGACA CTTGAA GAACTT CTAAA GAAAAT TTGACA 25 region N (54) CTGGCAC Spacer (b) 16 18 13 15 15 17 15 15 14 18 Spacer (b) 6 10 region TATAAT CCCCATNT TCTGA GCCCATAA TGTCCT CTAYACTT 12 region TTGCA

Watch for signals along the track!


Transcription is not a smoothly flowing process: pausing occurs frequently at sites that allow the formation of hairpin structures in the RNA. When hairpins structures form in the portion of the RNA that is located in the exit channel of the polymerase they cause temporary displacement of the 3 OH from the polymerization active site of the RNA polymerase. When this happens, the polymerase backtracks along the template, and several nucleotides at the 3 OH end are pushed into the secondary channel, where they are progressively removed backward by GreA and GreB until a proper pairing of the RNA with the DNA template is restored. Pausing is an important feature involved in the regulation of gene expression through coordination of the synthesis of mRNA with its simultaneous translation, termination and antitermination of transcription, and attenuation of transcription.

Transcription Termination
There are two kinds of transcription termination: 1. Factor independent termination and 2. Factor-dependent termination.
Factor-independent transcription termination occurs at sites in the DNA that include a region of two-fold symmetry followed by a stretch of at least four As in the template strand.

GC-rich inverted repeat


Fig. 2.18 MORE

Run of at least 4 As in the template strand

Factor-independent transcription termination


Folding of the transcript (RNA) in the active site channel breaks hydrogen bonding to the template DNA strand and causes the release of the RNA and the core RNA polymerase.

RNA

Dissociation of nascent RNA and RNA polymerase from template strand

RNA 3 end Fig. 2.18 MORE

Factor-independent transcription termination


How did scientist figure out this mechanism of termination? Mutations that disrupt base pairing in the hairpin loop structure of RNA (two-fold symmetry in DNA) or shorten the run of adjacent Us (As in the DNA template) cause continuation of transcription beyond terminator sites.

Factor-dependent Transcription Termination


Features of factor-dependent transcription-termination sites in DNA: a site specifying a sequence in the RNA, for example rut, that is recognized and bound by a protein, for example Rho () that chases the RNA polymerase and releases it and the transcript from the DNA template at transcription pausing sites (usually a G:C-rich sequence).

Specifies factor-binding sequence in RNA (EXAMLE:rut )

DNA
Any transcription-pause site in DNA DNA Polysomes In prokaryotes, translation is coupled to transcription.

IMPORTANT: Factor-dependent transcription occurs preferentially when the translation of a nascent mRNA is stalled.

Factor-dependent transcription termination


How does it work?
Rho hexamer binds to rut in the nascent RNA and then chases the RNA polymerase until it reaches it at a transcriptionpause site on the DNA. Rho then unwinds the RNA/DNA duplex, releasing the transcript and the RNA polymerase from the DNA.

binds

rut

RNA polymerase reaches a pause site unwinds RNA/DNA hybrid

Stalled ribosome

Fig 2.19

RNA and RNAP are released

E. coli has at least three different


transcription-termination factors
Rho () binds at rut sequences in nascent RNA, moves along RNA (movement requires ATP) until it reaches the RNA polymerase at a transcription-pause site. HOWEVER, if a ribosome has passed a rut site BEFORE is bound, then the ribosome prevents from catching up with the RNA polymerase, and transcription continues past the pause-site. Rho appears to be an RNA/DNA helicase. However, it is not clear whether or not can directly access the RNA/DNA duplex within the active-site channel of a paused RNA polymerase core enzyme. The other two proteins that have termination-factor characteristics similar to those of are: Tau () and NusA In comparison to , the RNA-binding sites and interactions of Tau and NusA with the RNA polymerase at transcription pause sites are not well characterized yet.

Antibiotics that Inhibit Transcription

Rifampin is a member of the rifamycins, macrocyclic lactone antibiotics that inhibit transcription at the initiation stage, but do not block elongation once initiation is complete. Rifamycins bind to the -subunit in the wall of the active-site channel of the RNAP of bacteria, mitochondria and chloroplasts. Two or three nucleotides are polymerized. MORE

Rifampin

Action of Rifampin

pppApN and pppGpN are the most common products. The Streptovaricins are related compounds that have the same action as rifampin, except that they also can block transcript elongation.

Antibiotics that Inhibit Transcription

Binds to the major groove of DNA in G/C rich regions. Inhibits transcription and replication

Actinomycin D

Think about it!


How does the process of RNA synthesis differ from DNA synthesis with respect to: 1. Substrates? 2. Initiation? 3. Template? 4. Priming? 5. Ancillary enzymes? 6. Termination? 7. Editing?

RNA Processing RNA Modification


and

RNA Editing

RNA Processing: rRNA and tRNA (rRNA operon)


Transcript (unprocessed precursor RNA) 16 S tRNA 23S 5S

Endonucleolytic cleavages by Rnases III, P, etc. Spacer Spacer

Processed RNA products Further processing and modification of bases (maturation) MATURE rRNAs and tRNAs

Fig. 2.20

RNase

rRNA processing in E. coli and


RNase

B. subtilis

Rnase M5 is similar to type II DNA topoisomerases RNase Rnase P

tRNA processing
Rnase P consists of an RNA dimer (same sequence, catalytic subunit) complexed with a dimer of a small protein. It is a ribozyme.

RNA modification
Structure of a mature tRNA

Added by CCA transferase


Determining base

Dihydrouridine

IV

The most common RNA modification is U

III

II

Fig. 2.21

Degradation of mRNA
Some of the enzymes involved also participate in rRNA and tRNA processing

Box 2.5

1. ~1500 nucleotids 2. Many modified bases 3. Compact 3-D folding 4. Complexed with 21 proteins 5. Highly conserved

16S rRNA

RNA processing
Introns and splicing
Splicing: Removal of parasitic DNA information from RNA

Group II introns

Group I introns

Box 2.6

Introns in eukaryotic mRNAs

Removal of parasitic DNA information from proteins


Removal of inteins
GyrA of many prokaryotes contains an intein

N-extein

Intein

C- extein

284

454

738

1071

VMA1 protein of yeast

Box 2.6

RNA Editing: Edited ND1 mRNA of T. brucei

* deleted U u added U

uGAUACAAAAAAACAUGACUACAUGAUAAGUAuCAuuuuAuGuuAuuuuuGGuAGuuuuuuuACAuu uGuAuCGuuuuACAuuuG*GUCCACAGCAuCCCG***CAGCACAuG**GuGuuuuAuGuuGuuuAuuGuA uuuuuGuGGuGA*AuuuAuuGuuuA**UAUUGAuUGuAuuAuA***G*GuuAUUUGCAUCGUGGUACAG AAAAGUUAUGUGAAUAUAAAAGUGUAGAACAAUGUCUUCCGuAUUUCGACAGGUUAGAuuAuG uuA*GuGuuuGuuGuAAuGAGCAuuuGuuGuCuuuA***UGuuuuGAGuAuAuGuuGCGAuGuuGuuuGu CGuuACGuuGuGCAuuuAuGCGuuuAuuAAuuGuA****GAAuuuAC***CCGuAGuuuuAAuGGuuuGuu GuGuAuAuCAuGuAuGGuuuuGG*AuuuAGGuuGuuuGuCUCCGuuG*UUAuGAuCAuuuGAGGAA*** CG*UGACAAAuuGAuGACAuuuuuuGAuuuAuG**UUGuGGuuGuCGuAuGCAuuuGGCUUUCAuGGu uuuAuuA*GGuAUUCUUGAUGAuuuuGuuuuuGGuuuuGuuGAuuuuuuGuuGuuGuuGA***UAAuAuC AuGuuuGuuuGuuAuGGAuuGuuAuGAuuuGuuAuuuGuGGGuAAUCGuuuAuuuUAuuuGCGuuuGC** *GuGGuuuGuCAuuuuuuGAuuuAuAuGAuuuA**GuuuuuA**A**UAGuuuAAGuGGuGuuuuGuCuCGu uCGuuAGGuAuGGuGuGAGAuuGUCGuuuAuuuAGuuGuuA****UGA*****GuUGuAuuuuAuGuuuuG uuAuGAuuAuuGuuuuuGuuuuAuAGGuGAuGCAuuuGA*UCGuuuAuuuuuACGuuuGuuuGAUAuGC GuAuGAGuuuGuuGAuuuGuAAGCAAuGuuuuuuuGuuGGuuuuuuuGuuuuuG*****GuuuuGuuuGuuu GuuuG**AuuAuuuAuAuuGuGAuAuuACCAuuG****AGACCAuuAuuAuGuuAuuuuAuAGuuuGuGGu GuuGuuGuuuGCCGGGuAuA*UCAuuuGC*UUGUGuuGAACACCCCAAAGGuGA***GuAuuGuuuGu uAuuA****UGuuuuuGuGuuGGuuuAuGuuCUCGuuuACGuuuGCGuuGuGCGGAuuuuuuGCA*UAUU UGuuuAuuGGAuGuuuGuuuGCGuGGuuuuuuAuuGCAuGAuuuAGuuGC***C*GuuuuAGGuAAuAuu GAuGuuGuuuuuGGAuCCGUAGAUCGuuA*GuuuuAuAuGuG**A******GGUUAUUGuAGGAUUGUU UAAAAUUGAAUAAAAA Courtesy of Dr. Donna Koslowsky

Mitochondrial RNA Editing in Trypanosomes


Editing a substrate RNA by an editosome using a guide RNA Substrate mRNAs are transcribed from mtDNA maxicircles (5-6) Guide RNAs are transcribed from mtDNA minicircles (~1000)

DNA

5 ATATAAAAGCGGGAGTTA
EDITOSOME

Transcript Guide RNA

UU UU Edited segment 5 AUAUAAAAGCGGGAGUUAUUUUUAUUAUUUUUU 3 .....*... .... 3 UUUUUUUUU UAAAAGUAAUAAA 5 C C Tether G Anchor A A A U C U A G A CC A AC GUIDE

Modified from Catteneo (1990)

RNA Editing: Base Modifications

Mitochondrial and Chloroplast RNAs

Untranslated regions (UTRs) and secondary structure modifications of nuclear RNAs in eukaryotes

C U Editing in the cox2 mRNA of maize mitochondria

Transcription and RNA Processing
The Central Dogma
For the phenotypic expression of any gene, information contained in 
DNA i
The Revised Central Dogma
DNA
REVERSE 
TRANSCRIPTION
Ribozymes
FUNCTION
FUNCTION
Interactions
Exceptions to the Central Dogma
1.  Information contained in RNA can be copied into DNA by reverse 
transcriptases and telome
The first step of the expression of a gene (DNA) is to transcribe the 
information contained in the nucleotide sequence from
The messenger: a general 
view of transcription and 
translation
U
U
U
U
U
Coding strand of DNA
Template strand of DNA
mRNA
5
(http://www.hhmi.org/biointeractive/dna/animations.html)Transcription and 
RNA Processing
Topics
1. RNA structure.
2. RNA sy
Ribonucleoside triphosphate
O
Base
RNA precursors
Fig. 2.1
RNA polynucleotide chain
5’
3’
RNA Structure
Secondary structure: regions of 
base pairing (double-stranded 
helical regions)
Stem-loop
Fig 2.2
Primary stru
Tertiary structure of a transfer RNA
5’
3’
Structure of
E. coli 16S rRNA
1. ~1500 nucleotides long
2. Compact 3-D folding
3. Highly conserved
5’
3’

You might also like