Molecular Basis of Inheritance
Molecular Basis of Inheritance
James Watson & Francis Crick proposed double helix phosphates. The bases project inside.
model of DNA. It was based on the X-ray diffraction data
The 2 chains have anti-parallel polarity, i.e. one chain
produced by Maurice Wilkins & Rosalind Franklin. has the polarity 53 and the other has 35.
The bases in 2 stands are paired through H-bonds
forming base pairs (bp).
A=T (2 hydrogen bonds) CG (3 hydrogen bonds)
Purine comes opposite to a pyrimidine. This generates
uniform distance between the 2 strands.
Erwin Chargaffs rule: In DNA, the proportion of A is
equal to T and the proportion of G is equal to C.
i.e, [A] + [G] = [T] + [C] or [A] + [G] / [T] + [C] =1
Length of DNA = number of base pairs X distance
between two adjacent base pairs.
174 (a bacteriophage) has 5386 nucleotides.
Bacteriophage lambda has 48502 base pairs (bp).
6
E. coli has 4.6x10 bp.
9
Haploid content of human DNA is 3.3x10 bp.
Number of base pairs in human = 9
6.6 x 10
Hence, the length of DNA =
6.6 x10 x 0.34x 10
9 -9
=
2.2 m
In E. coli, length of DNA -3
=1.36 mm (1.36 x 10 m)
The number of base pairs 1.36x10
3
= 9
0.34 x 10
6
=
4 x 10 bp
PACKAGING OF DNA
HELIX
In prokaryotes (E.g. E. coli), the DNA is not scattered Histones are rich in positively charged basic amino
throughout the cell. DNA, being negatively charged, is held acid residues lysines and arginines.
with some positively charged proteins and form nucleoid.
8 histones form histone octamer.
In eukaryotes, there is a set of positively charged, Negatively charged DNA is wrapped around histone
basic proteins called histones. octamer to give nucleosome.
1
Nucleosomes in chromatin = beads-on-string.
Chromatin is packaged chromatin fibres coiled and
condensed at metaphase stage chromosomes.
Higher level packaging of chromatin requires non-histone
chromosomal (NHC) proteins.
Chromatins include
Euchromatin: Loosely packed and
A typical nucleosome contains 200 bp. transcriptionally active chromatin and stains light.
Therefore, the total number of nucleosomes in human =
6.6x109 bp
Heterochromatin: Densely packed and inactive
= 3.3x107
DNA REPLICATION
Replication is the copying of DNA from parental
DNA.
Watson & Crick proposed Semi-conservative
model of replication. It suggests that the parental DNA
strands act as template for the synthesis of new
complementary strands. After the completion of
replication, each DNA molecule would have one parental
and one new strand.
Matthew Messelson & Franklin Stahl (1958)
experimentally proved Semi-conservative model.
15
They cultured E. coli in a medium containing NH4Cl
15 15
( N: heavy isotope of N). N was incorporated into both
strands of bacterial DNA and the DNA became heavier.
14
Another preparation containing N salts labeled with N is
14
also made. N was also incorporated in both strands of
DNA and became lighter.
These 2 types of DNA can be separated by centrifugation
in a CsCl density gradient.
15
They took E. coli cells from N medium and transferred
14
to N medium. After one generation (i.e. after 20
minutes), they isolated and centrifuged the DNA. Its
15
density was intermediate (hybrid) between N DNA
14
and N DNA. This shows that the newly formed DNA
15 14
one strand is old ( N type) and one strand is new ( N
type). This confirms semi-conservative replication.
After II generation (i.e. after 40 minutes), there was equal
amounts of hybrid DNA and light DNA.
Taylor & colleagues (1958) performed similar experiments
on Vicia faba (faba beans) using radioactive thymidine to
detect distribution of newly synthesized DNA in the
chromosomes. It proved that the DNA in chromosomes also
replicate semiconservatively.
The Machinery and Enzymes for
Replication
DNA replication starts at a point called origin (ori).
During replication, the 2 strands unwind and
separate by breaking H-bonds in presence of an enzyme,
Helicase.
In the presence of an enzyme, DNA dependent DNA
Unwinding of the DNA molecule at a point forms a
Y-shaped structure called replication fork. polymerase, many nucleotides join with one another to
The separated strands act as templates for the primer strand and form a polynucleotide chain (new strand).
synthesis of new strands. The DNA polymerase forms one new strand (leading
DNA replicates in the 53 direction. strand) in a continuous stretch in the 53 direction
Deoxyribonucleoside triphosphates (dATP, dGTP, (Continuous synthesis).
The other new strand is formed in small stretches (Okazaki
dCTP & TTP) act as substrate and also provide energy for
polymerization. fragments) in 53 direction (Discontinuous synthesis).
The Okazaki fragments are then joined together to form a
Firstly, a small RNA primer is synthesized in
presence of an enzyme, primase. new strand by an enzyme, DNA ligase. This new strand is
called lagging strand.
If a wrong base is introduced in the new strand, DNA
polymerase can do proof reading.
E. coli completes replication within 38 minutes. i.e. 2000
bp per second.
In eukaryotes, the replication of DNA takes place at S-
phase of the cell cycle. Failure in cell division after DNA
replication results in polyploidy.
TRANSCRIPTI
ON
- It is the process of copying genetic information from one Transcription Unit
strand of the DNA into RNA. - It is the segment of DNA between the sites of initiation
- Here, adenine pairs with uracil instead of thymine. and termination of transcription. It consists of 3 regions:
- Both strands are not copied during transcription, because A promoter (Transcription start site): Binding site
The code for proteins is different in both strands. This for RNA polymerase.
complicates the translation. Structural gene: The region between promoter and
If 2 RNA molecules are produced simultaneously this terminator where transcription takes place.
would be complimentary to each other, hence form a A terminator: The site where transcription stops.
double stranded RNA. This prevents translation. - The DNA- dependent RNA polymerase catalyzes the
polymerization only in 53direction.
3
triphosphates (ATP, GTP, UTP & CTP) are added. This is
complementary to the base sequence in the DNA template.
Termination: A termination factor ( factor) binds
to the RNA polymerase and terminates the transcription.
In bacteria (Prokaryotes) transcription and translation can
be coupled (Translation can begin before mRNA is fully
- 35 acts as template strand. 53 acts as coding strand. transcribed) because
3-ATGCATGCATGCATGCATGCATGC-5 template strand. 5- mRNA requires no processing to become active.
TACGTACGTACGTACGTACGTACG-3 coding strand.
Transcription and translation take place in the same
Transcription unit and gene compartment (no separation of cytosol and nucleus).
- Gene: Functional unit of inheritance. It is the DNA In eukaryotes, there are 2 additional complexities:
sequence coding for RNA molecule. 1. There are 3 RNA polymerases:
- Cistron: A segment of DNA coding for a polypeptide. RNA polymerase I: Transcribes rRNAs (28S, 18S &
- Structural gene in a transcription unit is 2 types: 5.8S).
Monocistronic structural genes (split genes): It is RNA polymerase II: Transcribes the
seen in eukaryotes. Here, the coding sequences
(expressed sequences or exons) are interrupted by heterogeneous nuclear RNA (hnRNA). It is the
introns (intervening sequences). precursor of mRNA.
Polycistronic structural genes: It is seen in RNA polymerase III: Transcribes tRNA, 5S rRNA
prokaryotes. Here, there are no split genes.
and snRNAs (small nuclear RNAs).
Steps of transcription in prokaryotes
2. The primary transcripts (hnRNA) contain both the exons
Initiation: Here, the enzyme RNA polymerase binds and introns and are non-functional. Hence introns have to be
at the promoter site of DNA. This causes the local unwinding removed. For this, it undergoes the following processes:
of the DNA double helix. An initiation factor ( factor)
present in RNA polymerase initiates the RNA synthesis. Splicing: From hnRNA introns are removed (by
the spliceosome) and exons are spliced (joined)
GENETIC
CODE
It is the sequence of nucleotides (nitrogen bases) in mRNA George Gamow: Suggested that for coding 20 amino
acids, the code should be made up of 3 nucleotides.
that contains information for protein synthesis (translation).
Har Gobind Khorana: Developed the chemical method
20 AMINO ACIDS INVOLVED IN in synthesizing RNA molecules with defined
TRANSLATION combinations of bases (homopolymers & copolymers).
Marshall Nirenberg: Developed cell-free system for
1. Alanine (Ala) 11. Leucine (Leu) protein synthesis.
2. Arginine (Arg) 12. Lysine (Lys) Severo Ochoa (polynucleotide phosphorylase) enzyme
is used to polymerize RNA with defined sequences in a
3. Asparagine (Asn) 13. Methionine (Met) template independent manner.
4. Aspartic acid (Asp) 14. Phenyl alanine (Phe) Salient features of genetic code
5. Cystein (Cys) 15. Proline (Pro) Triplet code (three-letter code).
6. Glutamine (Gln) 16. Serine (Ser) 61 codons code for amino acids. 3 codons (UAA,
7. Glutamic acid (Glu) 17. Threonine (Thr) UAG & UGA) do not code for any amino acids. They
8. Glycine (Gly) 18. Tryptophan (Trp) function as stop codons (Termination codons or non-sense
9. Histidine (His) 19. Tyrosine (Tyr)
codons).
10. Isoleucine (Ile) 20. Valine (Val)
Genetic code is universal. E.g. From bacteria to
The codons for the various amino human UUU codes for Phenylalanine. Some exceptions
acids are found in mitochondrial codons, and in some
protozoans.
No punctuations b/w adjacent codons (comma less
code). The codon is read in mRNA in a contiguous
fashion.
Genetic code is Non-overlapping.
A single amino acid is represented by many codons
(except AUG for methionine & UGG for tryptophan).
Such codons are called degenerate codons.
Genetic code is unambiguous and specific. i.e.
one codon specifies only one amino acid.
4
AUG has dual functions. It codes for Methionine tRNA- the adapter molecule
(met), and also acts as initiator codon. In eukaryotes, tRNA has
methionine is the first amino acid and formyl methionine An Anticodon (NODOC) loop that has bases
in prokaryotes. complementary to the code.
TYPES OF RNA An amino acid acceptor end to which amino acid
binds.
- mRNA (messenger RNA): Provide template for
translation (protein synthesis). - For initiation, there is another tRNA called initiator tRNA.
- rRNA (ribosomal RNA): Structural & catalytic role during - There are no tRNAs for stop codons.
translation. E.g. 23S rRNA in bacteria acts as ribozyme. - Secondary (2-D) structure of tRNA looks like a clover-
leaf. 3-D structure looks like inverted L.
- tRNA (transfer RNA or sRNA or soluble RNA): Brings
amino acids for protein synthesis and reads the genetic code.
TRANSLATION (PROTEIN
SYNTHESIS)
It takes place in ribosomes. Includes 4 steps anticodon binds to the second codon on the mRNA and a
1. Charging of tRNA (aminoacylation of peptide bond is formed between first and second amino
tRNA) acids in presence of an enzyme, peptidyl transferase.
Formation of peptide bond requires energy obtained from ATP. First amino acid and its tRNA are broken. This tRNA is
For this, amino acids are activated (amino acid + ATP) and removed from P site and second tRNA at the A site is pulled
linked to their cognate tRNA in the presence of aminoacyl to P site along with mRNA. This is called translocation.
tRNA synthetase. So the tRNA becomes charged. Then 3
rd
codon comes into A site and a suitable tRNA with
rd
2.Initiation 3 amino acid binds at the A site. This process is repeated.
It begins at the 5-end of mRNA in the presence of A group of ribosomes associated with a single mRNA for
an initiation factor. translation is called a polyribosome (polysomes).
The mRNA binds to the small subunit of ribosome. 4.Termination
Now the large subunit binds to the small subunit to When aminoacyl tRNA reaches the termination codon like
complete the initiation complex. UAA, UAG & UGA, the termination of translation occurs.
Large subunit has 2 binding sites for tRNA- The polypeptide and tRNA are released from the ribosomes.
aminoacyl tRNA binding site (A site) and peptidyl site The ribosome dissociates into large and small subunits at
(P site). the end of protein synthesis.
Initiation codon for methionine is AUG. So An mRNA has additional sequences that are not translated
methionyl tRNA complex would have UAC at the (untranslated regions or UTR). UTRs are present at both
Anticodon site. 5-end (before start codon) and 3-end (after stop codon).
3.Elongation They are required for efficient translation process.
At the P site the first codon of mRNA binds with
anticodon of methionyl tRNA complex.
Another aminoacyl tRNA complex with an
appropriate amino acid enters the ribosome and attaches
to A site. Its
REGULATION OF GENE
EXPRESSION
Gene expression results in the formation of a polypeptide. When a substrate is added to growth medium of bacteria,
In eukaryotes, the regulation includes the following levels: a set of genes is switched on to metabolize it. This is
called induction.
1. Transcriptional level (formation of primary transcript)
When a metabolite (product) is added, the genes to produce
it are turned off. This is called repression.
2. Processing level (regulation of splicing)
Lac operon in E. coli: The operon controlling lactose
3. Transport of mRNA from nucleus to the cytoplasm metabolism. It consists of
4. Translational level. a) A regulatory or inhibitor (i) gene: Codes for the repressor.
The metabolic, physiological and environmental conditions b) 3 structural genes:
regulate expression of genes. E.g.
Each metabolic reaction is controlled by a set of genes - The genes present in the operon function together in the
5
produce the repressor protein; this protein binds to the So repressor protein cannot bind to operator gene. The
operator genes and blocks RNA polymerase movement. operator gene becomes free and induces the RNA
So the structural genes are not expressed. polymerase to bind with promoter gene. Then
- If lactose is provided in the growth medium, the lactose is transcription starts. Regulation of lac operon by repressor
transported into the E. coli cells by the action of is called negative regulation.
permease. Lactose (inducer) binds with repressor protein.
In the absence of inducer: In the presence of inducer:
Model questions
1. Analogy type questions.
a. DNA: Thymine and cytosine RNA:
b. UGG: Tryptophan AUG:
2. The percentage of adenosine phosphate in DNA isolated from human liver is observed to be
30.7%. What is the
expected percentage of four
nitrogen bases? 3. Schematically
represent Griffiths experiment.
4. Analyze the following diagram
5. Analyse the below flowchart which represent the central dogma of molecular biology, and
answer the following
A B Protein
DNA RNA s
a. Mention the processes represented by the letters A and B
b. How the central dogma is modified with discovery of reverse transcriptase?
6. Find odd one and give reason: UAA, AUG, UAG, UGA
7. Protein synthesis will fail in the absence of tRNA molecule. Justify this statement.
8. If the coding region of a gene is estimated to consist of 450 nucleotide base pairs.
a. How many amino acids would the corresponding polypeptide chain contain?
b. Justify your answer.
9. Given below is the DNA sequence, representing a part of the gene. Analyse this and answer the
following questions.
5 ATGGGGGTGCTCAATATATGCCCC CGT AGTTAA 3
3 TACCCC CAC GAGTTATATACGGGGGCATCAATT 5
a. Construct the mRNA molecule which will be transcribed from this DNA sequence.
b. Make a processed mRNA (assuming that all the codons containing a C represent the
intron DNA).
c. How many amino acid residues will make up the polypeptide corresponding to this
processed mRNA?
d. In a sample of DNA 14% of the nucleotides contained cytosine. What will be the % of
adenine?
10. Observe the diagrammatic representation of the lac operon given below and
answer the questions. (see the second diagram of lac operon)
a. What is the inducer in lac operon? b. How does it ensure the switching-on of genes?
11. Draw a flowchart of steps involved in DNA fingerprinting.