Gödel, Escher, Bach - An Eternal Golden Braid (20th Anniversary Edition) by Douglas R. Hofstadter (Charm-Quark) PDF
Gödel, Escher, Bach - An Eternal Golden Braid (20th Anniversary Edition) by Douglas R. Hofstadter (Charm-Quark) PDF
ESCHER,
BACH:
an Eternal Golden Braid
GODEL,
ESCHER,
BACH:
an Eternal Golden Braid
Douglas R. Hofstadter
B
BOOKS
A Member of the Perseus Books Group
Preface to the Twentieth-anniversary Edition
copyright 1999 Douglas R. Hofstadter
Bibliography: p. 746
Includes index.
l. Metamathematics. 2. Symmetry. 3. Artificial intelligence.
4. Bach, Johann Sebastian, 1685-1750.
5. Escher, Maurits Cornelis, 1898-1971.
6. Codel, Kurt. I. Title.
[QA9.8.H63 1980] 510'.1 80-11354
ISBN 0-465-02656-7
The Key Images and Ideas that Lie at the Core of GEB
What is so weird in this is that the formal systems where these skeletal
"selves" come to exist are built out of nothing but meaningless symbols. The
self, such as it is, arises solely because of a special type of swirly, tangled
pattern among the meaningless symbols. But now a confession: I am being a
bit coy when I repeatedly type the phrase "meaningless symbols" (as at the
ends of both of the previous sentences), because a crucial part of my book's
argument rests on the idea that meaning cannot be kept out of formal
systems when sufficiently complex isomorphisms arise. Meaning comes in
despite one's best efforts to keep symbols meaningless!
Let me rephrase these last couple of sentences without using the slightly
technical term "isomorphism". When a system of "meaningless" symbols has
patterns in it that accurately track, or mirror, various phenomena in the
world, then that tracking or mirroring imbues the symbols with some degree
of meaning - indeed, such tracking or mirroring is no less and no more
than what meaning is. Depending on how complex and subtle and reliable
the tracking is, different degrees of meaningfulness arise. I won't go further
into this here, for it's a thesis that is taken up quite often in the text, most of
all in Chapters 2, 4, 6, 9, and II.
Compared to a typical formal system, human language is unbelievably
fluid and subtle in its patterns of tracking reality, and for that reason the
symbols in formal systems can seem quite arid; indeed, without too much
trouble, one can look at them as totally devoid of meaning. But then again,
one can look at a newspaper written in an unfamiliar writing system, and the
strange shapes seem like nothing more than wondrously intricate but totally
meaningless patterns. Thus even human language, rich though it is, can be
drained of its seeming significance.
As a matter of fact, there are still quite a few philosophers, scientists,
and so forth who believe that patterns of symbols per se (such as books or
movies or libraries or CD-ROM's or computer programs, no matter how
complex or dynamic) never have meaning on their own, but that meaning
instead, in some most mysterious manner, springs only from the organic
chemistry, or perhaps the quantum mechanics, of processes that take place
in carbon-based biological brains. Although I have no patience with this
parochial, bio-chauvinistic view, I nonetheless have a pretty clear sense of its
intuitive appeal. Trying to don the hat of a believer in the primacy, indeed
the uniqueness, of brains, I can see where such people are coming from.
I've just claimed that the shift of focus from material components to abstract
patterns allows the quasi-magical leap from inanimate to animate, from
nonsemantic to semantic, from meaningless to meaningful, to take place.
But how does this happen? Mter all, not all jumps from matter to pattern
give rise to consciousness or soul or self, quite obviously: in a word, not all
patterns are conscious. What kind of pattern is it, then, that is the telltale
mark of a self? GEB's answer is: a strange loop.
The irony is that the first strange loop ever found - and my model for
the concept in general - was found in a system tailor-made to keep loopiness
out. 1 speak of Bertrand Russell and Alfred North Whitehead's famous
treatise Principia Mathematica, a gigantic, forbidding work laced with dense,
prickly symbolism filling up volume after volume, whose creation in the
years 1910-1913 was sparked primarily by its first author's desperate quest
for a way to circumvent paradoxes of self-reference in mathematics.
At the heart of Principia Mathematica lay Russell's so-called "theory of
types", which, much like the roughly contemporaneous Maginot line, was
designed to keep "the enemy" out in a most staunch and watertight manner.
I can't help but recall, at this point, a horribly elitist but very droll remark by
one of my favorite writers, the American "critic of the seven arts", James
Huneker, in his scintillating biography of Frederic Chopin, on the subject of
Chopin's etude Op. 25, No. 11 in A minor, which for me, and for Huneker,
is one of the most stirring and most sublime pieces of music ever written:
"Small-souled men, no matter how agile their fingers, should avoid it."
"Small-souled men"?! Whew! Does that phrase ever run against the
grain of American democracy! And yet, leaving aside its offensive, archaic
sexism (a crime I, too, commit in GEB, to my great regret), I would suggest
that it is only because we all tacitly do believe in something like Huneker's
shocking distinction that most of us are willing to eat animals of one sort or
another, to smash flies, swat mosquitos, fight bacteria with antibiotics, and
so forth. We generally concur that "men" such as a cow, a turkey, a frog,
and a fish all possess some spark of consciousness, some kind of primitive
"soul", but by God, it's a good deal smaller than ours is - and that, no more
and no less, is why we "men" feel that we have the perfect right to extinguish
the dim lights in the heads of these fractionally-souled beasts and to gobble
down their once warm and wiggling, now chilled and stilled protoplasm with
limitless gusto, and not to feel a trace of guilt while doing so.
Enough sermonizing! The real point here is that not all strange loops
give rise to souls as grand and glorious as yours and mine, dear reader.
Thus, for example, I would not want you or anyone else to walk away from
reading all or part of GEB, shake their head and say with sadness, 'That
weird Hofstadter guy has convinced himself that Russell and Whitehead's
Principia Mathematica is a conscious person with a soul!" Horsefeathers!
Balderdash! Poppycock! G6del's strange loop, though it is my paragon for
the concept, is nonetheless only the most bare-bones strange loop, and it
resides in a system whose complexity is pathetic, relative to that of an
organic brain. Moreover, a formal system is static; it doesn't change or grow
over time. A formal system does not live in a society of other formal systems,
mirroring them inside itself, and being mirrored in turn inside its "friends".
Well, I retract that last remark, at least a bit: any formal system as powerful
as PM does in fact contain models not just of itself but of an infinite number
of other formal systems, some like it, some very much unlike it. That is
essentially what G6del realized. But still, there is no counterpart to time, no
counterpart to development, let alone to birth and death.
And so whatever I say about "selves" coming to exist in mathematical
formal systems has to be taken with the proper grain of salt. Strange loops
are an abstract structure that crops up in various media and in varying
degrees of richness. GEB is in essence a long proposal of strange loops as a
metaphor for how selfhood originates, a metaphor by which to begin to
grab a hold of just what it is that makes an "I" seem, at one and the same
time, so terribly real and tangible to its own possessor, and yet also so vague,
so impenetrable, so deeply elusive.
Why, one might wonder, if the author's aim was merely to propose a theory
of strange loops as the crux of our consciousness and the source of our
irrepressible "I "-feeling, did he wind up writing such a vast book with so
many seeming digressions in it? Why on earth did he drag in fugues and
canons? Why recursion? And Zen? And molecular biology? Et cetera ...
The truth of the matter is, when I started out, I didn't have the foggiest
idea that I would wind up talking about these kinds of things. Nor did I
dream that my future book would include dialogues, let alone dialogues
based on musical forms. The complex and ambitious nature of my project
evolved only gradually. In broad strokes, it came about this way.
I earlier alluded to my reading, as a teen-ager, of Ernest Nagel and
James R. Newman's little book COde/'s Proof Well, that book just radiated
excitement and depth to me, and it propelled me like an arrow straight into
the study of symbolic logic. Thus, as an undergraduate math major at
Stanford and a few years later, in my short-lived career as a graduate student
in math at Berkeley, I took several advanced logic courses, but to my bitter
disappointment, all of them were arcane, technical, and utterly devoid of
the magic I'd known in Nagel and Newman. The upshot of my taking these
highbrow courses was that my keen teen interest in Godel's wondrous proof
and its "strange loopiness" was nearly killed off. Indeed, I was left with such
a feeling of sterility that in late 1967, almost in desperation, I dropped out
of math grad school in Berkeley and took up a new identity as physics grad
student at the University of Oregon in Eugene, where my once-ardent
fascination with logic and metamathematics went into deep dormancy.
Several years passed, and then one day in May of 1972, while browsing
the math shelves in the University of Oregon bookstore, I stumbled across
philosopher Howard DeLong's superb book A Profile of Mathematical Logic,
took a chance on buying it, and within weeks, myoid love for the great
Godelian mysteries and all they touch on was reawakened. Ideas started
churning around like mad inside my teetering bulb of dread and dream.
Despite this joy, I was very discouraged with the way my physics studies
and my life in general were going, so in July I packed all my belongings into
a dozen or so cardboard boxes and set out on an eastward trek across the
vast American continent in Quicksilver, my faithful 1956 Mercury. Where I
was headed, I wasn't sure. All I knew is that I was looking for a new life.
Mter a few days in the Canadian Rockies, I headed south again and
eventually reached Boulder, Colorado. There, one afternoon, a host of
fresh ideas started gushing out in a spontaneous letter to myoId friend
Robert Boeninger. Mter several hours of writing, I saw that although my
letter was longer than I'd expected - thirty handwritten pages or so - I'd
said only about half of what I'd wanted to say. This made me think that
maybe I should write a pamphlet, not a letter, and to this day, Robert has
never received my unfinished missive.
From Boulder I headed further east, bouncing from one university town
to another, and eventually, almost as if it had been beckoning me the whole
time, New York City loomed as my ultimate goal. Indeed, I wound up
spending several months in Manhattan, taking graduate courses at City
College and teaching elementary physics to nurses at Hunter College, but as
1973 rolled around, I faced the fact that despite loving New York in many
ways, I was even more agitated than I had been in Eugene, and I decided it
would be wiser to return to Oregon and to finish graduate school there.
Although my hoped-for "new life" had failed to materialize, in certain
respe~ts I was relieved to be back. For one thing, the U of 0 in those days
had the enlightened policy that any community member could invent and
teach a for-credit "SEARCH" course, as long as one or more departments
approved it. And so I petitioned the philosophy and math departments to
sponsor a spring-quarter SEARCH course centered on Godel's theorem, and
my request was granted. Things were looking up.
My intuition told me that my personal fascination with strange loops -
not only with their philosophical importance but also with their esthetic
charm - was not just some unique little neurotic obsession of mine, but
could well be infectious, if only I could get across to my students that these
notions were anything but dull and dry, as in those frigid, sterile logic
courses I'd taken, but rather - as Nagel and Newman had hinted - were
intimately related to a slew of profound and beautiful ideas in mathematics,
physics, computer science, psychology, philosophy, linguistics, and so on.
I gave my course the half-dippy, half-romantic title 'The Mystery of the
Undecidable" in the hopes that I might attract students from wildly diverse
As I was writing that draft, I certainly wasn't thinking about Escher pictures.
Nor was I thinking about Bach's music. But one day I found myself on fire
with ideas about mind, brain, and human identity, and so, shamelessly
borrowing Lewis Carroll's odd couple of Achilles and the Tortoise, whose
droll personalities amused me no end, I sat down and in absolute white heat
dashed off a long, complex dialogue, all about a fictitious, unimaginably
large book each of whose pages, on a one-by-one basis, contained exhaustive
information on one specific neuron in Einstein's brain. As it happened, the
dialogue featured a short section where the two characters imagined each
other in another dialogue, and each of them said, "You might then say
this ... to which I might well reply as follows ... and then you would go on ... "
and so forth. Because of this unusual structural feature, after I'd finally put
the final period on the final speech, I flipped back to the top of page one
and there, on a whim, typed out the single word "FUGUE".
My Einstein-book dialogue was not r~ally a fugue, of course - not even
close - and yet it somehow reminded me'of one. From earliest childhood,
I had been profoundly moved by the music ~f Bach, and this off-the-wall
idea of marrying Bach-like contrapuntal for~ to lively dialogues with
intellectually rich content grabbed me with a pa~n. Over the next few
weeks, as I tossed the idea around in my head, I realized how much room
for play there was along these lines, and I could imagine how voraciously I as
a teen-ager might have consumed such dialogues. Thus I was led to the idea
of inserting contrapuntal dialogues every so often, partly to break the
tedium of the heavy ideas in my chapters, and partly to allow me to
introduce lighter, more allegorical versions of all the abstruse concepts.
Now that I had found a publisher, there came the question of turning the
manuscript from crude computer printout to a finely typeset book. It was a
piece of true luck that Pentti, to enhance 1V-Edit, had just developed one of
the world's first computer typesetting systems, and he strongly encouraged
me to use it. Kessler, ever the adventurer, was also willing to give it a try-
partly, of course, because it would save Basic Books some money, but also
because he was by nature a shrewd risk-taker.
Do-it-yourself typesetting, though for me a great break, was hardly a
piece of cake. Computing then was a lot more primitive than it is today, and
to use Pentti's system, I had to insert into each chapter or dialogue literally
thousands of cryptic typesetting commands, next chop each computer file
into several small pieces - five or six per file, usually - each of which had
to be run through a series of two computer programs, and then each of the
resulting output files had to be punched out physically as a cryptic pattern
of myriad holes on a long, thin roll of paper tape. I myself had to walk the
200 yards to the building where the hole-puncher was located, load the
paper tape, and sit there monitoring it carefully to make sure it didn't jam.
Next, I would carry this batch of oily tapes another quarter-mile to the
building where The Stanford Daily was printed, and if it was free, I would use
their phototypesetting machine myself. Doing so was a long, elaborate
operation involving cartridges of photosensitive paper, darkrooms, chemical
baths with rollers through which the paper had to be passed to get all the
developing chemicals off, and clotheslines on which all the five-foot long
galleys with my text on them would be hung out to dry for a day or two. The
process of actually seeing what my thousands of typesetting commands had
wrought was thus enormously unwieldy and slow. Truth to tell, though, I
didn't mind that; in fact, it was arcane, special, and kind of exciting.
But one day, when nearly all the galleys had been printed - two to
three hundred of them - and I thought I was home free, I made a
horrendous discovery. I'd seen each one emerge with jet-black print from
the developing baths, and yet on some of the more recently-<iried ones, the
text looked brownish. What!? As I checked out others, slightly older, I saw
light-brown print, and on yet older ones, it was orangy, or even pale yellow!
Oops ...
There were of course many ideas that vied with each other for entry into the
book taking shape during those years, and some made it in while others did
not. One of the ironies is that the Einstein-book dialogue, which in its
"fugality" was the inspiration for all dialogues to come, was chopped.
There was another long and intricate dialogue, too, that was chopped,
or more accurately, that wound up getting transmogrified nearly beyond
recognition, and its curious story is connected with an intense debate that
was raging inside my brain at that time.
I had been made acutely aware, by some leaflets I'd read in the student
union at Oregon in 1970, of sexist language and its insidious unconscious
effects. My mind was awakened to the subtle ways that generic "he" and
"man" (and a host of similar words and phrases) contribute to the shaping
A few years later, a wholly unexpected chance came along to make amends,
at least in part, for my sexist sin. That opportunity was afforded me by the
challenge of translating GEB into various foreign languages.
When I was writing the book, the idea that it might someday appear in
other languages never crossed my mind. I don't know why, since I loved
languages and loved translation, but somehow it just never occurred to me.
However, as soon as the idea was proposed to me by my publisher, I was very
excited about seeing my book in other languages, especially ones that I
spoke to some extent - most of all French, since that was a language that I
spoke fluently and loved very deeply.
There were a million issues to consider in any potential translation,
since the book is rife not only with explicit wordplay but also with what Scott
Kim dubbed "structural puns" - passages where form and content echo or
reinforce each other in some unexpected manner, and very often thanks to
happy coincidences involving specific English words. Because of these
intricate medium-message tangles, I painstakingly went through every last
sentence of GEB, annotating a copy for translators into any language that
might be targeted. This took me about a year of on-again, off-again toil, but
finally it was done, and just in the nick of time, because contracts with
foreign publishers started flowing thick and fast around 1982. I could write
a short book - a pamphlet? - on the crazy, delightful, knotty puzzles and
dilemmas that arose in translating GEE, but here I will mention just one-
how to render the simple-seeming phrase "Mr. Tortoise" in French.
When in the spring of 1983, Jacqueline Henry and Bob French, the
book's excellent translators into French, began to tackle the dialogues, they
instantly ran headlong into the conflict between the feminine gender of the
French noun tortue and the masculinity of my character, the Tortoise. By
the way, I must ruefully mention that in the malVelous but little-known
Lewis Carroll dialogue from which I borrowed these delightful characters
(reprinted in GEB as 'Two-part Invention"), the Tortoise turns out, if you
look carefully, never to have been attributed either gender. But when I first
read it, the question never entered my mind. This was clearly a he-tortoise.
Otherwise, I would have known not only that it was female but also why it was
female. Mter all, an author only introduces a female character for some
special reason, right? Whereas a male character in a "neutral" context (e.g.,
philosophy) needs no raison d'etre, a female does. And so, given no clue as
to the Tortoise's sex, I unthinkingly and uncritically envisaged it as a male.
Thus does sexism silently pervade well-meaning but susceptible brains.
The French translation was greeted, overall, very favorably. One specially
gratifying moment for Bob, Jacqueline, and myself was when a truly glowing
full-page review by Jacques Attali appeared in the most prestigious French
newspaper, Le Monde, not just praising the book for its ideas and style, but
also making a particular point of praising its translation.
A few months later, I received a pair of reviews published in successive
issues of Humanisme, an obscure journal put out by the Society of French
Freemasons. Both had issued from the pen of one author, Alain Houlou,
and I tackled them with interest. The first one was quite lengthy and, like
that in Le Monde, glowed with praise; I was gratified and grateful.
I then went on to the second review, which started out with the poetic
phrase Apres les roses, les epines... ("Mter roses, thorns ... "), and which then
proceeded for several pages, to my amazement, to rip GEB apart as un pwge
tres grave ("a very dangerous trap") in which the mindless bandwagon of Zen
Buddhism was eagerly jumped on, and in which a rabidly antiscientific,
beatnik-influenced, hippie-like irrationality typical of American physicists
was embraced as the supreme path to enlightenment, with the iconoclastic
Zen-influenced American composer John Cage as the patron saint of it all.
Since sending GEB off to the printers two decades ago, I've somehow
managed to keep myself pretty busy. Aside from striving, with a team of
excellent graduate students, to develop computer models of the mental
mechanisms that underlie analogy and creativity, I've also written several
further books, each of which I'll comment on here, though only very briefly.
The first of these, appearing in late 1981, was The Mind's I, an anthology
co-edited with a new friend, philosopher Daniel Dennett. Our purpose,
closely related to that of GEB, was to force our readers to confront, in the
most vivid and even jolting manner, the fundamental conundrum of human
As I said above, writing, though crucial, was not my only intellectual focus;
research into cognitive mechanisms was an equally important one. My early
hunches about how to model analogy and creativity are actually set forth
quite clearly in GEB's Chapter 19, in my discussion of Bongard problems,
and although those were just the germs of an actual architecture, I feel it is
fair to say that despite many years of refinement, most of those ideas can be
found in one form or another in the models developed in my research
group at Indiana University and the University of Michigan (where I spent
the years 1984-1988, in the Psychology Department).
Mter a decade and a half of development of computer models, the time
seemed ripe for a book that would pull all the main threads together and
describe the programs' principles and performance in clear and accessible
language. Thus over several years, Fluid Concepts and Creative Analogies took
shape, and finally appeared in print in 1995. In it are presented a series of
closely related computer programs - Seek-Whence, Jumbo, Numbo,
Copycat, Tabletop, and (still in progress) Metacat and Letter Spirit -
together with philosophical discussions that attempt to set them in context.
Several of its chapters are co-authored by members of the Fluid Analogies
Research Group, and indeed FARG gets its proper billing as my collective
co-author. The book shares much with GEB, but perhaps most important of
all is the basic philosophical article of faith that being an "I" - in other
words, possessing a sense of self so deep and ineradicable that it blurs into
causality - is an inevitable concomitant to, and ingredient of, the flexibility
and power that are synonymous with intelligence, and that the latter is but
another term for conceptual flexibility, which in tum means meaningful symbols.
A very different strand of my intellectual life was my deep involvement
in the translation of GEB into various languages, and this led me, perhaps
inevitably, in retrospect, to the territory of verse translation. It all started in
1987 with my attempt to mimic in English a beautiful French miniature by
sixteenth-century French poet Clement Marot, but from there it spun off in
many directions at once. To make a long story short, I wound up writing a
complex and deeply personal book about translation in its most general and
metaphorical sense, and while writing it, I experienced much the same
feeling of exhilaration as I had twenty years earlier, when writing GEB.
This book, Le Ton beau de Marot: In Praise of the Music of Language, winds
through many diverse terrains, including what it means to "think in" a given
language (or a blur of languages); how constraints can enhance creativity;
how meaning germinates, buds, and flowers in minds and might someday
do so in machines; how words, when put together into compounds, often
melt together and lose some or all of their identity; how a language spoken
on a neutron star might or might not resemble human languages; how
poetry written hundreds of years ago should be rendered today; how
translation is intimately related to analogy and to the fundamental human
process of understanding one another; what kinds of passages, if any, are
Le Ton beau de Marot is a bit longer than GEB, and on its first page, I go out
on a limb and call it "probably the best book I will ever write". Some of my
readers will maintain that GEB is superior, and I can see why they might do
so. But it's so long since I wrote GEB that perhaps the magical feeling I had
when writing it has faded, while the magic of LeTbM is still vivid. Still,
there's no denying that, at least in the short run, LeTbM has had far less
impact than GEB did, and I confess that that's disappointed me quite a bit.
Permit me to speculate for a moment as to why this might be the case.
In some sense, GEB was a "forward-looking" book, or at least on its surface it
gave that appearance. Many hailed it as something like "the bible of
artificial intelligence", which is of course ridiculous, but the fact is that many
young students read it and caught the bug of my own fascination with the
modeling of mind in all of its elusive aspects, including the evanescent goals
of "I" and free will and consciousness. Although I am the furthest thing in
the world from being a futurist, a science-fiction addict, or a technology
guru, I was often pigeonholed in just that way, simply because I had written
a long treatise that dealt quite a bit with computers and their vast potential
(in the most philosophical of senses), and because my book was quite a hit
among young people interested in computers.
Well, by contrast, Le Ton beau de Marot might be seen as a "backward-
looking" book, not so much because it was inspired by a sixteenth-century
poem and deals with many other authors of the past, such as Dante and
Pushkin, but because there simply is nothing in the book's pages that could
Given that I was quite wrong in a prediction made twenty years ago, why not
rewrite the "Ten Questions and Speculations" section, updating it and
talking about how I feel in light of Deep Blue? Well, of course, this brings
up a much larger issue: that of revising the 1979 book from top to bottom,
and coming out with a spanking new 1999 edition of GEB. What might
militate for, and what might militate against, undertaking such a project?
I don't deny that some delightful, if small, improvements were made in
the translated versions. For example, my magistrally Bach-savvy friend
Bernie Greenberg informed me that the "BACH goblet" I had invented out
of whole cloth in my dialogue "Contracrostipunctus" actually exists! The
real goblet is not (as in my dialogue) a piece of glass blown by Bach, but
rather a gift from one of his prize st.udents; nonetheless, its key feature -
that of having the melody "BACH" etched into the glass itself - is just as I
said in the dialogue! This was such an amazing coincidence that I rewrote
the dialogue for the French version to reflect the real goblet's existence, and
insisted on having a photograph of the BACH goblet in the French GEB.
Another delicious touch in the French GEB was the replacement of the
very formal, character-less photo of Godel by a far more engaging snapshot
in which he's in a spiffy white suit and is strolling with some old codger in a
forest. The latter, decked out in a Hoppy hat and baggy pants held up by
gawky suspenders, looks every inch the quintessential rube, so I rewrote the
caption as Kurt COdel avec un paysan non identifie ("Kurt Godel with unknown
peasant"). But as anyone who has lived in the twentieth century can see in a
split second, the paysan non identifie is none other than A. Einstein.
Why not, then, incorporate those amusing changes into a revised
edition in English? On a more substantial level, why not talk a bit about the
Well, the only answer I can give, other than that life is short, is that GEB was
written in one sitting, so to speak. GEB was a clean and pure vision that was
dreamed by someone else - someone who, to be sure, was remarkably
similar to yours truly, but someone who nonetheless had a slightly different
perspective and a slightly different agenda. GEB was that person's labor of
love, and as such - at least so say I - it should not be touched.
Indeed, I somehow feel a strange inner confidence that the true author
of GEB, when one fine day he finally reaches my ripe age, will tender to me
the truest of thanks for not having tampered with the vessel into which he
poured so much of his young and eager soul - the work that he even went
so far as to call, in what some might see as a cryptic or even naively romantic
remark, "a statement of my religion". At least I know what he meant.
Part I: GEB
Introduction: A Musico-Logical Offering 3
Three-Part Invention 29
Chapter I: The MU-puzzle 33
Two-Part Invention 43
Chapter II: Meaning and Form in Mathematics 46
Sonata for Unaccompanied Achilles 61
Chapter III: Figure and Ground 64
Contracrostipunctus 75
Chapter IV: Consistency, Completeness, and Geometry 82
Little Harmonic Labyrinth 103
Chapter V: Recursive Structures and Processes 127
Canon by Intervallic Augmentation 153
Chapter VI: The Location of Meaning 158
Chromatic Fantasy, And Feud 177
Chapter VII: The Propositional Calculus 181
Crab Canon 199
Chapter VIII: Typographical Number Theory 204
A Mu Offering 231
Chapter IX: Mumon and Godel 246
Part II: EGB
Prelude . . . 275
Chapter X: Levels of Description, and Computer Systems 285
... Ant Fugue 311
Chapter XI: Brains and Thoughts 337
English French German Suite 366
Chapter XII: Minds and Thoughts 369
A ria with Diverse Variations 391
Chapter XIII: BlooP and FlooP and GlooP 406
Air on G's String 431
Chapter XIV: On Formally Undecidable Propositions of TNT
and Related Systems 438
Birthday Cantatatata . . . 461
Chapter XV: Jumping out of the System 465
Edifying Thoughts of a Tobacco Smoker 480
Chapter XVI: Self-Ref and Self-Rep 495
The Magnificrab, Indeed 549
Chapter XVII: Church, Turing, Tarski, and Others 559
SHRDLU, Toy of Man's Designing 586
Chapter XVIII: Artificial Intelligence: Retrospects 594
Contrafactus 633
Chapter XIX: Artificial Intelligence: Prospects 641
Sloth Canon 681
Chapter XX: Strange Loops, Or Tangled Hierarchies 684
Six-Part Ricercar 720
Notes 743
Bibliography 746
Credits 757
Index 759
Contents vii
Overview
Part I: GEB
Chapter II: Meaning and Form in Mathematics. A new formal system (the
pq-system) is presented, even simpler than the MIU-system of Chapter I. Ap-
parently meaningless at first, its symbols are suddenly revealed to possess mean-
ing by virtue of the form of the theorems they appear in. This revelation is the
first important insight into meaning: its deep connection to isomorphism. Vari-
ous issues related to meaning are then discussed, such as truth, proof, symbol
manipulation, and the elusive concept, "form".
Sonata for Unaccompanied Achilles. A Dialogue which imitates the Bach Sonatas
for unaccompanied violin. In particular, Achilles is the only speaker, since it is a
transcript of one end of a telephone call, at the far end of which is the Tortoise.
Their conversation concerns the concepts of "figure" and "ground" in various
viii Overview
contexts-e.g., Escher's art. The Dialogue itself forms an example of the distinc-
tion, since Achilles' lines form a "figure", and the Tortoise's lines-implicit in
Achilles' lines-form a "ground".
Chapter Ill: Figure and Ground. The distinction between figure and ground in
art is compared to the distinction between theorems and nontheorems in formal
systems. The question "Does a figure necessarily contain the same information as
its ground?" leads to the distinction between recursively enumerable sets and
recursive sets.
Contracrostipunctus. This Dialogue is central to the book, for it contains a set of
paraphrases of Godel's self-referential construction and of his Incompleteness
Theorem. One of the the paraphrases of the Theorem says, "For each record
player there is a record which it cannot play." The Dialogue's title is a cross
between the word "acrostic" and the word "contrapunctus", a Latin word which
Bach used to denote the many fugues and canons making up his Art of the Fugue.
Some explicit references to the Art of the Fugue are made. The Dialogue itself
conceals some acrostic tricks.
Chapter IV: Consistency, Completeness, and Geometry. The preceding
Dialogue is explicated to the extent it is possible at this stage. This leads back to
the question of how and when symbols in a formal system acquire meaning. The
history of Euclidean and non-Euclidean geometry is given, as an illustration of
the elusive notion of "undefined terms". This leads to ideas about the consistency
of different and possibly "rival" geometries. Through this discussion the notion
of undefined terms is clarified, and the relation of undefined terms to perception
and thought processes is considered.
Little Harmonic Labyrinth. This is based on the Bach organ piece by the same
name. It is a playful introduction to the notion of recursive-i.e., nested-
structures. It contains stories within stories. The frame story, instead of finishing
as expected, is left open, so the reader is left dangling without resolution. One
nested story concerns modulation in music-particularly an organ piece which
ends in the wrong key, leaving the listener dangling without resolution.
Chapter V: Recursive Structures and Processes. The idea of recursion is
presented in many different contexts: musical patterns, linguistic patterns,
geometric structures, mathematical functions, physical theories, computer pro-
grams, and others.
Canon by Intervallic Augmentation. Achilles and the Tortoise try to resolve the
question, "Which contains more information-a record, or the phonograph
which plays it?" This odd question arises when the Tortoise describes a single
record which, when played on a set of different phonographs, produces two
quite different melodies: B-A-C-H and C-A-G-E. It turns out, however, that
these melodies are "the same", in a peculiar sense.
Chapter VI: The Location of Meaning. A broad discussion of how meaning is
split among coded message, decoder, and receiver. Examples presented include
strands of DNA, undeciphered inscriptions on ancient tablets, and phonograph
records sailing out in space. The relationship of intelligence to "absolute" mean-
ing is postulated.
Chromatic Fantasy, And Feud. A short Dialogue bearing hardly any resemblance,
except in title, to Bach's Chromatic Fantasy and Fugue. It concerns the proper way
to manipulate sentences so as to preserve truth-and in particular the question
Overview
of whether there exist rules for the usage of the word "and". This Dialogue has
much in common with the Dialogue by Lewis Carroll.
Chapter VII: The Propositional Calculus. It is suggested how words such as
"and" can be governed by formal rules. Once again, the ideas of isomorphism
and automatic acquisition of meaning by symbols in such a system are brought
up. All the examples in this Chapter, incidentally, are "Zentences"-sentences
taken from Zen k6ans. This is purposefully done, somewhat tongue-in-cheek,
since Zen k6ans are deliberately illogical stories.
Crab Canon. A Dialogue based on a piece by the same name from the Musical
Offering. Both are so named because crabs (supposedly) walk backwards. The
Crab makes his first appearance in this Dialogue. It is perhaps the densest
Dialogue in the book in terms of formal trickery and level-play. Godel, Escher,
and Bach are deeply intertwined in this very short Dialogue.
Chapter Vlll: Typographical Number Theory. An extension of the Proposition-
al Calculus called "TNT" is presented. In TNT, number-theoretical reasoning
can be done by rigid symbol manipulation. Differences between formal reason-
ing and human thought are considered.
A Mu Offering. This Dialogue foreshadows several new topics in the book.
Ostensibly concerned with Zen Buddhism and k6ans, it is actually a thinly veiled
discussion of theoremhood and nontheoremhood, truth and falsity, of strings in
number theory. There are fleeting references to molecular biology-particularly
the Genetic Code. There is no close affinity to the Musical Offering, other than in
the title and the playing of self-referential games.
Chapter IX: Mumon and G6del. An attempt is made to talk about the strange
ideas of Zen Buddhism. The Zen monk Mumon, who gave well known commen-
taries on many k6ans, is a central figure. In a way, Zen ideas bear a metaphorical
resemblance to some contemporary ideas in the philosophy of mathematics.
After this "Zennery", Godel's fundamental idea of Godel-numbering is intro-
duced, and a first pass through Godel's Theorem is made.
Prelude. .. This Dialogue attaches to the next one. They are based on preludes
and fugues from Bach's Well-Tempered Clavier. Achilles and the Tortoise bring a
present to the Crab, who has a guest: the Anteater. The present turns out to be a
recording of the W.T.C.; it is immediately put on. As they listen to a prelude,
they discuss the structure of preludes and fugues, which leads Achilles to ask
how to hear a fugue: as a whole, or as a sum of parts? This is the debate between
holism and reductionism, which is soon taken up in the Ant FUffUe.
x Overview
.. Ant Fugue. An imitation of a musical fugue: each voice enters with the same
statement. The theme-holism versus reductionism-is introduced in a recur-
sive picture composed of words composed of smaller words, etc. The words
which appear on the four levels of this strange picture are "HOLISM", "REDUC-
TIONISM", and "MU". The discussion veers off to a friend of the Anteater's-
Aunt Hillary, a conscious ant colony. The various levels of her thought processes
are the topic of discussion. Many fugal tricks are ensconced in the Dialogue. As a
hint to the reader, references are made to parallel tricks occurring in the fugue
on the record to which the foursome is listening. At the end of the Ant Fugue,
themes from the Prelude return, transformed considerably.
Chapter Xl: Brains and Thoughts. "How can thoughts be supported by the
hardware of the brain?" is the topic of the Chapter. An overview of the large-
scale and small-scale structure of the brain is first given. Then the relation
between concepts and neural activity is speculatively discussed in some detail.
Chapter Xll: Minds and Thoughts. The preceding poems bring up in a forceful
way the question of whether languages, or indeed minds, can be "mapped" onto
each other. How is communication possible between two separate physical
brains? What do all human brains have in common? A geographical analogy is
used to suggest an answer. The question arises, "Can a brain be understood, in
some objective sense, by an outsider?"
Aria with Diverse Variations. A Dialogue whose form is based on Bach's Goldberg
Variations, and whose content is related to number-theoretical problems such as
the Goldbach conjecture. This hybrid has as its main purpose to show how
number theory's subtlety stems from the fact that there are many diverse varia-
tions on the theme of searching through an infinite space. Some of them lead to
infinite searches, some of them lead to finite searches, while some others hover in
between.
Chapter Xlll: BlooP and FlooP and GlooP. These are the names of three
computer languages. BlooP programs can carry out only predictably finite
searches, while FlooP programs can carry out unpredictable or even infinite
searches. The purpose of this Chapter is to give an intuition for the notions of
primitive recursive and general recursive functions in number theory, for they
are essential in Godel's proof.
Overview Xl
Birthday Cantatatata . " In which Achilles cannot convince the wily and skeptical
Tortoise that today is his (Achilles') birthday. His repeated but unsuccessful tries
to do so foreshadow the repeatability of the Godel argument.
Chapter XV: Jumping out of the System. The repeatability of Godel's argu-
ment is shown, with the implication that TNT is not only incomplete, but
"essentially incomplete". The fairly notorious argument by J. R. Lucas, to the
effect that Godel's Theorem demonstrates that human thought cannot in any
sense be "mechanical", is analyzed and found to be wanting.
Chapter XVI: Self-Ref and Self-Rep. This Chapter is about the connection be-
tween self-reference in its various guises, and self-reproducing entities (e.g.,
computer programs or DNA molecules). The relations between a self-
reproducing entity and the mechanisms external to it which aid it in reproducing
itself (e.g., a computer or proteins) are discussed-particularly the fuzziness of
the distinction. How information travels between various levels of such systems is
the central topic of this Chapter.
The Magnificrab, Indeed. The title is a pun on Bach's Magnificat in D. The tale is
about the Crab, who gives the appearance of having a magical power of distin-
guishing between true and false statements of number theory by reading them as
musical pieces, playing them on his flute, and determining whether they are
"beautiful" or not.
Chapter XVII: Church, Turing, Tars ki , and Others. The fictional Crab .of the
preceding Dialogue is replaced by various real people with amazing mathemati-
cal abilities. The Church-Turing Thesis, which relates mental activity to compu-
tation, is presented in several versions of differing strengths. All are analyzed,
particularly in terms of their implications for simulating human thought
mechanically, or programming into a machine an ability to sense or create
beauty. The connection between brain activity and computation brings up some
other topics: the halting problem of Turing, and Tarski's Truth Theorem.
xu Overview
Contrafactus. About how we unconsciously organize our thoughts so that we can
imagine hypothetical variants on the real world all the time. Also about aberrant
variants of this ability-such as possessed by the new character, the Sloth, an avid
lover of French fries, and rabid hater of counterfactuals.
Chapter XIX: Artificial Intelligence: Prospects. The preceding Dialogue trig-
gers a discussion of how knowledge is represented in layers of contexts. This
leads to the modern AI idea of "frames". A frame-like way of handling a set of
visual pattern puzzles is presented, for the purpose of concreteness. Then the
deep issue of the interaction of concepts in general is discussed, which leads into
some speculations on creativity. The Chapter concludes with a set of personal
"Questions and Speculations" on AI and minds in general.
Sloth Canon. A canon which imitates a Bach canon in which one voice plays the
same melody as another, only upside down and twice as slowly, while a third
voice is free. Here, the Sloth utters the same lines as the Tortoise does, only
negated (in a liberal sense of the term) and twice as slowly, while Achilles is free.
Chapter XX: Strange Loops, Or Tangled Hierarchies. A grand windup of
many of,the ideas about hierarchical systems and self-reference. It is concerned
with the snarls which arise when systems turn back on themselves-for example,
science probing science, government investigating governmental wrongdoing,
art violating the rules of art, and finally, humans thinking about their own brains
and minds. Does Godel's Theorem have anything to say about this last "snarl"?
Are free will and the sensation of consciousness connected to Godel's Theorem?
The Chapter ends by tying Godel, Escher, and Bach together once again.
Six-Part Ricercar. This Dialogue is an exuberant game played with many of the
ideas which have permeated the book. It is a reenactment of the story of the
Musical Offering, which began the book; it is simultaneously a "translation" into
words of the most complex piece in the Musical Offering: the Six-Part Ricercar.
This duality imbues the Dialogue with more levels of meaning than any other in
the book. Frederick the Great is replaced by the Crab, pianos by computers, and
so on. Many surprises arise. The Dialogue's content concerns problems of mind,
consciousness, free will, Artificial Intelligence, the Turing test, and so forth,
which have been introduced earlier. It concludes with an implicit reference to
the beginning of the book, thus making the book into one big self-referential
loop, symbolizing at once Bach's music, Escher's drawings, and Godel's Theorem.
Overview Xlll
List of Illustrations
XlV Illustrations
25. Cretan Labyrinth. 119
26. The structure of the Dialogue Little Harmonic Labyrinth. 129
27. Recursive Transition Networks for ORNATE NOUN
and FANCY NOUN. 132
28. The FANCY NOUN RTN with one node recursively expanded. 134
29. Diagrams G and H represented implicitly. 135
30. Diagram G further expanded. 136
31. An RTN for Fibonacci numbers. 136
32. Graph of the function INT(x). 139
33. Skeletons of INT and Gplot. 141
34. Gplot: a recursive graph. 143
35. A complex Feynman diagram. 145
36. Fish and Scales, by M. C. Escher. 147
37. Butterflies, by M. C. Escher. 148
38. A tic-tac-toe game tree. 151
39. The Rosetta Stone. 165
40. A collage of scripts. 168
41. Base sequence for the chromosome of bacteriophage </>XI74. 176
42. "Crab Canon", by M. C. Escher. 198
43. A short section of one of the Crab's Genes. 201
44. Crab Canon from the Musical Offering, by J. S. Bach. 202
45. La Mezquita, by M. C. Escher. 235
46. Three Worlds, by M. C. Escher. 247
47. Dewdrop, by M. C. Escher. 249
48. Another World, by M. C. Escher. 250
49. Day and Night, by M. C. Escher. 252
50. Rind, by M. C. Escher. 253
5l. Puddle, by M. C. Escher. 256
52. Rippled Surface, by M. C. Escher. 257
53. Three Spheres II, by M. C. Escher. 258
Part II: The "EGB" trip-let casting its three orthogonal shadows.
54. Mobius Strip II, by M. C. Escher. 276
55. Pierre de Fermat. 278
56. Cube with Magic Ribbons, by M. C. Escher. 282
57. The idea of "chunking". 288
58. Assemblers, compilers, and levels of computer languages. 294
59. Intelligence as built up layer by layer. 300
60. The "MU-picture". 310
61. "Ant Fugue", by M. C. Escher. 323
62. A "crisscross" of two well-known names. 331
Illustrations xv
63. Phot6 of an ant bridge (de Fourmi, Lierre). 334
64. \'\. HOLISM-REDUCTIONISM "propeller". 335
65. Schematic drawing of a neuron. 339
66. The human brain, seen from one side. 341
67. Responses to patterns by certain sample neurons. 345
68. Overlapping neural pathways. 357
69. The construction of an arch by termite workers. 358
70. A tiny portion of the author's "semantic network". 370
71. Order and Chaos, by M. C. Escher. 399
72. The structure of a call-less BlooP program. 415
73. Georg Cantor. 423
74. Above and Below, by M. C. Escher. 432
75. "Multifurcation" of TNT. 467
76. Dragon, by M. C. Escher. 474
77. The Shadows, by Rene Magritte. 480
78. State of Grace, by Rene Magritte. 481
79. Tobacco Mosaic Virus. 485
80. The Fair Captive, by Rene Magritte. 489
81. Self-engulfing TV screens. 490-1
82. The Air and the Song, by Rene Magritte. 494
83. Epimenides executing his own death sentence. 496
84. An Epimenides-paradox iceberg. 496
85. A Quine-sentence soapcake. 497
86. A self-reproducing song. 500
87. The Typogenetic Code. 510
88. The tertiary structure of a typoenzyme. 511
89. Table of binding-preferences for typoenzymes. 511
90. The Central Dogma of Typogenetics. 513
91. The four constituent bases of DNA. 515
92. Ladder-like structure of DNA. 515
93. Molecular model of the DNA double helix. 516
94. The Genetic Code. 520
95. Secondary and tertiary structure of myoglobin. 521
96. A section of mRNA passing through a ribosome. 523
97. A polyribosome. 526
98. A two-tiered molecular canon. 527
99. The Central Dogmap. 533
100. The Godel Code. 535
101. The T4 bacterial virus. 537
102. Infection of a bacterium by a virus. 538
103. The morphogenetic pathway of the T4 virus. 539
104. Castrovalva, by M. C. Escher. 550
XVt Illustrations
105. Srinivasa Ramanujan and one of his strange Indian melodies. 563
106. Isomorphisms connecting natural numbers, calculators,
and human brains. 568
107. Neural and symbolic activity in the brain. 571
108. "Skimming off" the top level of the brain. 573
109. Conflict between low and high levels of a brain. 576
110. The opening scene from a Dialogue with SHRDLU. 586
111. A later scene from the Dialogue with SHRDLU. 587
112. One last scene from the Dialogue with SHRDLU. 589
113. Alan Mathison Turing. 594
114. Pons Asinorum Proof. 606
115. Zeno's endless goal tree. 610
116. A meaningful story in Arabic. 624
117. Mental Arithmetic, by Rene Magritte. 627
118. Procedural representation of "a red cube which supports
a pyramid." 631
119. Bongard problem 51. 646
120. Bongard problem 47. 648
121. Bongard problem 91. 649
122. Bongard problem 49. 650
123. A small portion of a concept network for Bongard problems. 652
124. Bongard problem 33. 654
125. Bongard problems 85-87. 655
126. Bongard problem 55. 658
127. Bongard problem 22. 658
128. Bongard problem 58. 659
129. Bongard problem 61. 659
130. Bongard problems 70-71. 660
131. A schematic diagram of the Dialogue Crab Canon. 666
132. Two homologous chromosomes joined at the center by
a centromere. 668
133. "Sloth Canon" from the Musical Offering, by J. S. Bach. 682
134. An authorship triangle. 689
135. Drawing Hands, by M. C. Escher. 690
136. Abstract diagram of M. C. Escher's Drawing Hands. 690
137. Common Sense, by Rene Magritte. 700
138. The Two Mysteries, by Rene Magritte. 701
139. Smoke Signal, by the author. 702
140. Pipe Dream, by the author. 703
141. The Human Condition I, by Rene Magritte. 705
142. Print Gallery, by M. C. Escher. 714
143. Abstract diagram of M. C. Escher's Print Gallery. 715
Illustrations XVtt
144. A collapsed version of the previous figure. 715
145. Further collapse of Figure 143. 716
146. Another way of collapsing Figure 143. 716
147. Bach's Endlessly Rising Canon, played in Shepard tones,
forms a Strange Loop. 717
148. Two complete cycles of a Shepard tone scale, notated for piano. 718
149. Verbum, by M. C. Escher. 732
150. Charles Babbage. 733
151. The Crab's Theme. 740
152. Last page of the Six-Part Ricercar, from the original edition
of the Musical Offering, by J. S. Bach. 741
XVttt Illustrations
Words of Thanks
This book was brewing in my mind over a period of probably nearly twenty
years-ever since I was thirteen and thinking about how I thought in
English and French. And even before that, there were clear signs of my
main-line interest. I remember that at some early age, there was nothing
more fascinating to me than the idea of taking three 3's: operating upon 3
with itself! I was sure that this idea was so subtle that it was inconceivable to
anyone else-but I dared ask my mother one day how big it was anyway,
and she answered "Nine". I wasn't sure she knew what I meant, though.
Later, my father initiated me into the mysteries of square roots, and i ...
lowe more to my parents than to anyone else. They have been pillars
of support I could rely on at all times. They have guided me, inspired me,
encouraged me, and sustained me. Most of all, they have always believed in
me. It is to them that this book is dedicated.
To two friends of many years-Robert Boeninger, Peter Jones-lowe
special thanks, for they helped mold a million ways of thought, and their
influences and ideas are spread all around in this book.
To Charles Brenner, I am much indebted for his having taught me to
program when we were both young, and for his constant pushing and
prodding-implicit praise-and occasional criticism.
I am pleased to acknowledge the immense influence of Ernest Nagel, a
long-time friend and mentor. I loved "Nagel and Newman", and I have
learned much from many conversations, long ago in Vermont and more
recently in New York.
Howard DeLong, through his book, reawakened in me a long-
dormant love of the matters in this book. I truly owe him a great debt.
David Jonathan Justman taught me what it is to be a Tortoise-an
ingenious, persistent, and humorous being, with a fondness for paradox
and contradiction. I hope that he will read and enjoy this book, which owes
a great deal to him.
Scott Kim has exerted a gigantic influence on me. Ever since we met
some two and a half years ago, the resonance between the two of us has
been incredible. Aside from his tangible contributions of art, music,
humor, analogies, and so on-including much-appreciated volunteer labor
at crucial times-Scott has contributed new perspectives and insights which
have changed my own views of my endeavor as it has evolved. If anyone
understands this book, it is Scott.
For advice on matters of large scale or small, I have turned repeatedly
to Don Byrd, who knows this book forwards and backwards and every
which way ... He has an unerring sense for its overall goals and structure,
and time and again has given me good ideas which I have delightedly
incorporated. My only regret is that I won't be able to include all thefuture
ideas Don will come up with, once the book is in print. And let me not
xx Words of Thanks
standing attitudes. In addition, Paul Csonka read an entire early version
and made helpful comments.
Thanks to E. O. Wilson for reading and commenting on an early
version of my Prelude, Ant Fugue.
Thanks to Marsha Meredith for being the meta-author of a droll koan.
Thanks to Marvin Minsky for a memorable conversation one March
day in his home, parts of which the reader will find reconstructed herein.
Thanks to Bill Kaufmann for advice on publication, and to Jeremy
Bernstein and Alex George for encouraging words when needed.
Very warm thanks to Martin Kessler, Maureen Bischoff, Vincent
Torre, Leon Dorin, and all the other people at Basic Books, for undertak-
ing this publishing venture which is unusual in quite a few ways.
Thanks to Phoebe Hoss for doing well the difficult job of copy editing,
and to Larry Breed for valuable last-minute proofreading.
Thanks to my many Imlac-roommates, who took so many phone
messages over the years; also to the Pine Hall crew, who developed and
maintained much of the hardware and software that this book has so vitally
depended on.
Thanks to Dennis Davies of the Stanford Instructional Television
Network for his help in setting up the "self-engulfing televisions" which I
spent hours photographing.
Thanks to Jerry Pryke, Bob Parks, Ted Bradshaw, and Vinnie Aveni
of the machine shop in the High Energy Physics Laboratory at Stanford,
for generously helping me make trip-lets.
Thanks to my uncle and aunt, Jimmy and Betty Givan, for the Christ-
mas present they never knew would so delight me: a "Black Box" which
had no other function than to turn itself off.
Finally, I would like to give special thanks to my freshman English
teacher, Brent Harold, who first spn;tng Zen on me; to Kees Gugelot, who
gave me a record of the Musical Offering one sad November long ago; and
to Otto Frisch, in whose office at Cambridge I first saw the magic of Escher.
I have tried to remember all the people who have contributed to the
development of this book, but I have undoubtedly failed to include all of
them.
In a way, this book is a statement of my religion. I hope that this will
come through to my readers, and that my enthusiasm and reverence for
certain ideas will infiltrate the hearts and minds of a few people. That is the
best I could ask for.
D.R.H.
Bloomington and Stanford
january, 1979.
Author:
FREDERICK THE GREAT, King of Prussia, came to power in 1740.
Although he is remembered in history books mostly for his military astute-
ness, he was also devoted to the life of the mind and the spirit. His court in
Potsdam was one of the great centers of intellectual activity in Europe in
the eighteenth century. The celebrated mathematician Leonhard Euler
spent twenty-five years there. Many other mathematicians and scientists
came, as well as philosophers-including Voltaire and La Mettrie, who
wrote some of their most influential works while there.
But music was Frederick's real love. He was an avid flutist and com-
poser. Some of his compositions are occasionally performed even to this
day. Frederick was one of the first patrons of the arts to recognize the
virtues of the newly developed "piano-forte" ("soft-loud"). The piano had
been developed in the first half of the eighteenth century as a modification
of the harpsichord. The problem with the harpsichord was that pieces
could only be played at a rather uniform loudness-there was no way to
strike one note more loudly than its neighbors. The "soft-loud", as its name
implies, provided a remedy to this problem. From Italy, where Bartolom-
meo Cristofori had made the first one, the soft-loud idea had spread
widely. Gottfried Silber mann, the foremost German organ builder of the
day, was endeavoring to make a "perfect" piano-forte. Undoubtedly King
Frederick was the greatest supporter of his efforts-it is said that the King
owned as many as fifteen Silbermann pianos!
Bach
Frederick was an admirer not only of pianos, but also of an organist and
composer by the name of J. S. Bach. This Bach's compositions were some-
what notorious. Some called them "turgid and confused", while others
claimed they were incomparable masterpieces. But no one disputed Bach's
ability to improvise on the organ. In those days, being an organist not only
meant being able to play, but also to extemporize, and Bach was known far
and wide for his remarkable extemporizations. (For some delightful anec-
dotes about Bach's extemporization, see The Bach Reader, by H. T. David
and A. Mendel.)
In 1747, Bach was sixty-two, and his fame, as well as one of his sons,
had reached Potsdam; in fact, Carl Philipp Emanuel Bach was the
Capellmeister (choirmaster) at the court of King Frederick. For years the
King had let it be known, through gentle hints to Philipp Emanuel, how
It'
FIGURE 3. The Royal Theme.
When Bach sent a copy of his Musical Offering to the King, he included
a dedicatory letter, which is of interest for its prose style if nothing else-
rather submissive and flattersome. From a modern perspective it seems
comical. Also, it probably gives something of the flavor of Bach's apology
for his appearance. 2
MOST GRACIOUS KING!
Your Majesty's
most humble and obedient servant,
THE AUTHOR
Leipzig, July 7
1747
Some twenty-seven years later, when Bach had been dead for twenty-
four years, a Baron named Gottfried van Swieten-to whom, incidentally,
Forkel dedicated his biography of Bach, and Beethoven dedicated his First
Symphony-had a conversation with King Frederick, which he reported as
follows:
He [Frederick] spoke to me, among other things, of music, and of a great
organist named Bach, who has been for a while in Berlin. This artist [Wilhelm
Friedemann Bach] is endowed with a talent superior, in depth of harmonic
knowledge and power of execution, to any I have heard or can imagine, while
those who knew his father claim that he, in turn, was even greater. The King
FIGURE 4.
("At the King's Command, the Song and the Remainder Resolved with
Canonic Art.") Here Bach is punning on the word "canonic", since it means
not only "with canons" but also "in the best possible way". The initials of
this inscription are
RICERCAR
-an Italian word, meaning "to seek". And certainly there is a great deal to
seek in the Musical Offering. It consists of one three-part fugue, one six-part
fugue, ten canons, and a trio sonata. Musical scholars have concluded that
the three-part fugue must be, in essence, identical with the one which Bach
improvised for King Frederick. The six-part fugue is one of Bach's most
complex creations, and its theme is, of course, the Royal Theme. That
theme, shown in Figure 3, is a very complex one, rhythmically irregular
and highly chromatic (that is, filled with tones which do not belong to the
key it is in). To write a decent fugue of even two voices based on it would
not be easy for the average musician!
Both of the fugues are inscribed "Ricercar", rather than "Fuga". This
is another meaning of the word; "ricercar" was, in fact, the original name
for the musical form now known as "fugue". By Bach's time, the word
"fugue" (or fuga, in Latin and Italian) had become standard, but the term
"ricercar" had survived, and now designated an erudite kind of fugue,
perhaps too austerely intellectual for the common ear. A similar usage
survives in English today: the word "recherche" means, literally, "sought
out", but carries the same kind of implication, namely of esoteric or high-
brow cleverness.
The trio sonata forms a delightful relief from the austerity of the
fugues and canons, because it is very melodious and sweet, almost dance-
Escher
To my mind, the most beautiful and powerful visual realizations of this
notion of Strange Loops exist in the work of the Dutch graphic artist M. C.
Escher, who lived from 1902 to 1972. Escher was the creator of some of the
G6del
In the examples we have seen of Strange Loops by Bach and Escher, there
is a conflict between the finite and the infinite, and hence a strong sense of
paradox. Intuition senses that there is something mathematical involved
here. And indeed in our own century a mathematical counterpart was
discovered, with the most enormous repercussions. And, just as the Bach
and Escher loops appeal to very simple and ancient intuitions-a musical
scale, a staircase-so this discovery, by K. Godel, of a Strange Loop in
Actually, it was in German, and perhaps you feel that it might as well be in
German anyway. So here is a paraphrase in more normal English:
All consistent axiomatic formulations of number theory
include undecidable propositions.
This is the pearl.
In this pearl it is hard to see a Strange Loop. That is because the
Strange Loop is buried in the oyster-the proof. The proof of Godel's
Incompleteness Theorem hinges upon the writing of a self-referential
mathematical statement, in the same way as the Epimenides paradox is a
self-referential statement of language. But whereas it is very simple to talk
about language in language, it is not at all easy to see how a statement about
numbers can talk about itself. In fact, it took genius merely to connect the
idea of self-referential statements with number theory. Once Godel had the
intuition that such a statement could be created, he was over the major
hurdle. The actual creation of the statement was the working out of this
one beautiful spark of intuition.
Taken together, these sentences have the same effect as the original
Epimenides paradox; yet separately, they are harmless and even potentially.
useful sentences. The "blame" for this Strange Loop can't be pinned on
either sentence--only on the way they "point" at each other. In the same
way, each local region of Ascending and Descending is quite legitimate; it is
only the way they are globally put together that creates an impossibility.
Since there are indirect as well as direct ways of achieving self-reference,
one must figure out how to ban both types at once-if one sees self-
reference as the root of all evil.
Achilles (a Greek warrior, the fleetest offoot of all mortals) and a Tortoise
are standing together on a dusty runway in the hot sun. Far down the
runway, on a tall flagpole, there hangs a large rectangular flag. The flag
is solid red, except where a thin ring-shaped hole has been cut out of it,
through which one can see the sky.
Achilles: What is that strange flag down at the other end of the track? It
reminds me somehow of a print by my favorite artist, M. C. Escher.
Tortoise: That is Zeno's flag.
Achilles: Could it be that the hole in it resembles the holes in a Mobius
strip Escher once drew? Something is wrong about that flag, I can tell.
Tortoise: The ring which has been cut from it has the shape of the numeral
for zero, which is Zeno's favorite number.
Achilles: But zero hasn't been invented yet! It will only be invented by a
Hindu mathematician some millennia hence. And thus, Mr. T, my
argument proves that such a flag is impossible.
Tortoise: Your argument is persuasive, Achilles, and I must agree that
such a flag is indeed impossible. But it is beautiful anyway, is it not?
Achilles: Oh, yes, there is no doubt of its beauty.
Tortoise: I wonder if its beauty is related to its impossibility. I don't know;
I've never had the time to analyze Beauty. It's a Capitalized Essence;
and I never seem to have the time for Capitalized Essences.
Achilles: Speaking of Capitalized Essences, Mr. T, have you ever won-
dered about the Purpose of Life?
Tortoise: Oh, heavens, no.
Achilles: Haven't you ever wondered why we are here, or who invented
us?
Tortoise: Oh, that is quite another matter. We are inventions of Zeno (as
you will shortly see); and the reason we are here is to have a footrace.
Achilles: A footrace? How outrageous! Me, the fleetest of foot of all mor-
tals, versus you, the ploddingest of all plodders! There can be no point
to such a race.
Tortoise: You might give me a head start.
Achilles: It would have to be a huge one.
Tortoise: I don't object.
Achilles: But I will catch you, sooner or later-most likely sooner.
Tortoise: Not if things go according to Zeno's paradox, you won't. Zeno is
hoping to use our footrace to show that motion is impossible, you see.
It is only in the mind that motion seems possible, according to Zeno. In
truth, Motion Is Inherently Impossible. He proves it quite elegantly.
Three-Part Invention 29
FIGURE 10. Mobius Strip I, by M. C. E,cher (wood-engraving printedfromfour blocks,
1961).
Achilles: Oh, yes, it comes back to me now: the famous Zen koan about
Zen Master Zeno. As you say, it is very simple indeed.
Tortoise: Zen koan? Zen Master? What do you mean?
Achilles: It goes like this: Two monks were arguing about a flag. One said,
"The flag is moving." The other said, "The wind is moving." The sixth
patriarch, Zeno, happened to be passing by. He told them, "Not the
wind, not the flag; mind is moving."
Tortoise: I am afraid you are a little befuddled, Achilles. Zeno is no Zen
master; far from it. He is, in fact, a Greek philosopher from the town
of Elea (which lies halfway between points A and B). Centuries hence,
he will be celebrated for his paradoxes of motion. In one of those
paradoxes, this very footrace between you and me will playa central
role.
Achilles: I'm all confused. I remember vividly how I used to repeat over
and over the names of the six patriarchs of Zen, and I always said,
"The sixth patriarch is Zeno, the sixth patriarch is Zeno ... " (Suddenly
a soft warm breeze picks up.) Oh, look, Mr. Tortoise-look at the flag
waving! How I love to watch the ripples shimmer through its soft
fabric. And the ring cut out of it is waving, too!
30 Three-Part Invention
Tortoise: Don't be silly. The flag is impossible, hence it can't be waving.
The wind is waving.
(At this moment, Zeno happens by.)
Zeno: Hallo! Hulloo! What's up? What's new?
Achilles: The flag is moving.
Tortoise: The wind is moving.
Zeno: 0 Friends, Friends! Cease your argumentation! Arrest your vit-
riolics! Abandon your discord! For I shall resolve the issue for you
forthwith. Ho! And on such a fine day!
Achilles: This fellow must be playing the fool.
Tortoise: No, wait, Achilles. Let us hear what he has to say. Oh, Unknown
Sir, do impart to us your thoughts on this matter.
Zeno: Most willingly. Not the wind, not the flag-neither one is moving,
nor is anything moving at all. For I have discovered a great Theorem,
which states: "Motion Is Inherently Impossible." And from this
Theorem follows an even greater Theorem-Zeno's Theorem:
"Motion Unexists."
Achilles: "Zeno's Theorem"? Are you, sir, by any chance, the philosopher
Zeno of Elea?
Zeno: I am indeed, Achilles.
Achilles (scratching his head in puzzlement): Now how did he know my name?
Zeno: Could I possibly persuade you two to hear me out as to why this is
the case? I've come all the way to Elea from point A this afternoon,just
trying to find someone who'll pay some attention to my closely honed
argument. But they're all hurrying hither and thither, and they don't
have time. You've no idea how disheartening it is to meet with refusal
after refusal. Oh, but I'm sorry to burden you with my troubles. I'djust
like to ask one thing: Would the two of you humor a silly old
philosopher for a few moments---only a few, I promise you-in his
eccentric theories?
Achilles: Oh, by all means! Please do illuminate us! I know I speak for both
of us, since my companion, Mr. Tortoise, was only moments ago
speaking of you with great veneration-and he mentioned especially
your paradoxes.
Zeno: Thank you. You see, my Master, the fifth patriarch, taught me that
reality is one, immutable, and unchanging; all plurality, change, and
motion are mere illusions of the senses. Some have mocked his views;
but I will show the absurdity of their mockery. My argument is quite
simple. I will illustrate it with two characters of my own Invention:
Achilles (a Greek warrior, the fleetest of foot of all mortals), and a
Tortoise. In my tale, they are persuaded by a passerby to run a
footrace down a runway towards a distant flag waving in the breeze.
Let us assume that, since the Tortoise is a much slower runner, he gets
a head start of, say, ten rods. Now the race begins. In a few bounds,
Achilles has reached the spot where the Tortoise started.
Three-Part Invention 31
Achilles: Hah!
Zeno: And now the Tortoise is but a single rod ahead of Achilles. Within
only a moment, Achilles has attained that spot.
Achilles: Ho hot
Zeno: Yet, in that short moment, the Tortoise has managed to advance a
slight amount. In a flash, Achilles covers that distance, too.
Achilles: Hee hee heel
Zeno: But in that very short flash, the Tortoise has managed to inch ahead
by ever so little, and so Achilles is still behind. Now you see that in
order for Achilles to catch the Tmtoise, this game of "try-to-catch-me"
will have to be played an INFINITE number of times-and therefore
Achilles can NEVER catch up with the Tortoise!
Tortoise: Heh heh heh heh!
Achilles: Hmm ... hmm ... hmm ... hmm ... hmm ... That argument sounds
wrong to me. And yet, I can't quite make out what's wrong with it.
leno: Isn't it a teaser? It's my favorite paradox.
Tortoise: Excuse me, Zeno, but I believe your tale illustrates the wrong
principle, does it not? You have just told us what will come to be
known, centuries hence, as Zeno's "Achilles paradox", which shows
(ahem!) that Achilles will never catch the Tortoise; but the proof that
Motion Is Inherently Impossible (and thence that Motion Unexists) is
your "dichotomy p~radox", isn't that so?
Zeno: Oh, shame on me. Of course, you're right. That's the one about
how, in getting from A to B, one has to go halfway first-and of that
stretch one also has to go halfway, and so on and so forth. But you see,
both those paradoxes really have the same flavor. Frankly, I've only
had one Great Idea-I just exploit it in different ways.
Achilles: I swear, these arguments contain a flaw. I don't quite see where,
but they cannot be correct.
Zeno: You doubt the validity of my paradox? Why not just try it out? You
see that red flag down there, at the far end of the runway?
Achilles: The impossible one, based on an Escher print?
Zeno: Exactly. What do you say to you and Mr. Tortoise racing for it,
allowing Mr. T a fair head start of, well, I don't know-
Tortoise: How about ten rods?
Zeno: Very good-ten rods.
Achilles: Any time.
Zeno: Excellent! How exciting! An empirical test of my rigorously proven
Theorem! Mr. Tortoise, will you position yourself ten rods upwind?
32 Three-Part Invention
CHAPTER
The MU-puzzle
Formal Systems
ONE OF THE most central notions in this book is that of a formal system. The
type of formal system I use was invented by the American logician Emil
Post in the 1920's, and is often called a "Post production system". This
Chapter introduces you to a formal system and moreover, it is my hope that
you will want to explore this formal system at least a little; so to provoke
your curiosity, I have posed a little puzzle.
"Can you produce MU?" is the puzzle. To begin with, you will be
supplied with a string (which means a string of letters). * Not to keep you in
suspense, that string will be Ml. Then you will be told some rules, with
which you can change one string into another. If one of those rules is
applicable at some point, and you want to use it, you may, but-there is
nothing that will dictate which rule you should use, in case there are several
applicable rules. That is left up to you-and of course, that is where playing
the game of any formal system can become something of an art. The major
point, which almost doesn't need stating, is that you must not do anything
which is outside the rules. We might call this restriction the "Requirement
of Formality". In the present Chapter, it probably won't need to be stressed
at all. Strange though it may sound, though, I predict that when you play
around with some of the formal systems of Chapters to come, you will find
yourself violating the Requirement of Formality over and over again,
unless you have worked with formal systems before.
The first thing to say about our formal system-the MIU-system-is that
it utilizes only three letters of the alphabet: M, I, U. That means that"the
only strings of the MIU-system are strings which are composed of those
three letters. Below are some strings of the MIU-system:
MU
UIM
MUUMUU
UIIUMIUUIMUIIUMIUUIMUIIU
>I< In this book, we shall employ the following conventions when we refer to strings. When
the string is in the same typeface as the text, then it will be enclosed in single or double quotes.
Punctuation which belongs to the sentence and not to the string under discussion will go
outside of the quotes, as logic dictates. For example, the first letter of this sentence is 'F', while
the first letter of 'this sentence'is 't'. When the string is in Quadrata Roman, however, quotes
will usually be left off, unless clarity demands them. For example, the first letter of Quadrata
is Q.
The MU-puzzle 33
But although all of these are legitimate strings, they are not strings which
are "in your possession". In fact, the only string in your possession so far is
MI. Only by using the rules, about to be introduced, can you enlarge your
private collection. Here is the first rule:
RULE I: If you possess a string whose last letter is 1, you can add on a U at
the end.
By the way, if up to this point you had not guessed it, a fact about the
meaning of "string" is that the letters are in a fixed order. For example, MI
and 1M are two different strings. A string of symbols is not just a "bag" of
symbols, in which the order doesn't make any difference.
Here is the second rule:
RULE II: Suppose you have Mx. Then you may add Mxx to your collec-
tion.
So the letter 'x' in the rule simply stands for any string; but once you have
decided which string it stands for, you have to stick with your choice (until
you use the rule again, at which point you may make a new choice). Notice
the third example above. It shows how, once you possess MU, you can add
another string to your collection; but you have to get MU first! I want to
add one last comment about the letter 'x': it is not part of the formal system
in the same way as the three letters 'M', 'I', and 'U' are. It is useful for us,
though, to have some way to talk in general about strings of the system,
symbolically-and that is the function of the 'x'; to stand for an arbitrary
string. If you ever add a string containing an 'x' to your "collection", you
have done something wrong, because strings of the MIU-system never
contain "x" 's!
Here is the third rule:
RULE III: If III occurs in one of the strings in your collection, you may
make a new string with U in place of III.
Examples:
From UMIIIMU, you could make UMUMU.
From MIIII, you could make MIU (also MUI).
From IIMII, you can't get anywhere using this rule.
(The three I's have to be consecutive.)
From Mlil, make MU.
Don't, under any circumstances, think you can run this rule backwards, as
in the following example:
34 The MU-puzzJe
From MU, make Mill. : This is wrong.
RULE IV: If UU occurs inside one of your strings, you can drop it.
There you have it. Now you may begin trying to make MU. Don't worry if
you don't get it. Just try it out a bit-the main thing is for you to get the
flavor of this MU-puzzle. Have fun.
(1) MI axiom
(2) MIl from (1) by rule II
The MU-puzzle 35
(3) MIIII from (2) by rule II
(4) MIIIIU from (3) by rule I
(5) MUIU from (4) by rule III
(6) MUIUUIU from (5) by rule II
(7) MUIIU from (6) by rule IV
36 The MU-puzzle
repetitive behavior very quickly. Or, to take a silly example, a car will never
pick up the idea, no matter how much or how well it is driven, that it is
supposed to avoid other cars and obstacles on the road; and it will never
learn even the most frequently traveled routes of its owner.
The difference, then, is that it is possible for a machine to act unobserv-
ant; it is impossible for a human to act unobservant. Notice I am not saying
that all machines are necessarily incapable of making sophisticated observa-
tions; just that some machines are. Nor am I saying that all people are
always making sophisticated observations; people, in fact, are often very
unobservant. But machines can be made to be totally unobservant; and
people cannot. And in fact, most machines made so far are pretty close to
being totally unobservant. Probably for this reason, the property of being
unobservant seems to be the characteristic feature of machines, to most
people. For example, if somebody says that some task is "mechanical", it
does not mean that people are incapable of doing the task; it implies,
though, that only a machine could do it over and over without ever
complaining, or feeling bored.
The MU-puzzle 37
boring ritual of checkmating. Although it lost every game it played, it did it
in style. A lot of local chess experts were impressed. Thus, if you define
"the system" as "making moves in a chess game", it is clear that this
program had a sophisticated, preprogrammed ability to exit from the
system. On the other hand, if you think of "the system" as being "whatever
the computer had been programmed to do", then there is no doubt that the
computer had no ability whatsoever to exit from that system.
It is very important when studying formal systems to distinguish work-
ing within the system from making statements or observations about the
system. I assume that you began the MU-puzzle, as do most people, by
working within the system; and that you then gradually started getting
anxious, and this anxiety finally built up to the point where without any
need for further consideration, you exited from the system, trying to take
stock of what you had produced, and wondering why it was that you had
not succeeded in producing MU. Perhaps you found a reason why you
could not produce MU; that is thinking about the system. Perhaps you
produced MIU somewhere along the way; that is working within the system.
Now I do not want to make it sound as if the two modes are entirely
incompatible; I am sure that every human being is capable to some extent
of working inside a system and simultaneously thinking about what he is
doing. Actually, in human affairs, it is often next to impossible to break
things neatly up into "inside the system" and "outside the system"; life is
composed of so many interlocking and interwoven and often inconsistent
"systems" that it may seem simplistic to think of things in those terms. But it
is often important to formulate simple ideas very clearly so that one can use
them as models in thinking about more complex ideas. And that is why I
am showing you formal systems; and it is about time we went back to
discussing the MIU-system.
38 The MU-puzzle
also have some figuring on it. We will occasionally refer back to these two
modes of dealing with a formal system, and we will call them the Mechanical
mode (M-mode) and the Intelligent mode (I-mode). To round out our modes,
with one for each letter of the MIU-system, I will also mention a final
mode-the Un-mode (U-mode), which is the Zen way of approaching things.
More about this in a few Chapters.
Decision Procedures
An observation about this puzzle is that it involves rules of two opposing
tendencies-the lengthening rules and the shortening rules. Two rules (I and
II) allow you to increase the size of strings (but only in very rigid, pre-
scribed ways, of course); and two others allow you to shrink strings some-
what (again in very rigid ways). There seems to be an endless variety to the
order in which these different types of rules might be applied, and this
gives hope that one way or another, MU could be produced. It might
involve lengthening the string to some gigantic size, and then extracting
piece after piece until only two symbols are left; or, worse yet, it might
involve successive stages of lengthening and then shortening and then
lengthening and then shortening, and so on. But there is no guarantee of
it. As a matter of fact, we already observed that U cannot be produced at all,
and it will make no difference if you lengthen and shorten till kingdom
come.
Still, the case of U and the case of MU seem quite different. It is by a
very superficial feature of U that we recognize the impossibility of produc-
ing it: it doesn't begin with an M (whereas all theorems must). It is very
convenient to have such a simple way to detect nontheorems. However,
who says that that test will detect all nontheorems? There may be lots of
strings which begin with M but are not producible. Maybe MU is one of
them. That would mean that the "first-letter test" is of limited usefulness,
able only to detect a portion of the nontheorems, but missing others. But
there remains the possibility of some more elaborate test which discrimi-
nates perfectly between those strings which can be produced by the rules,
and those which cannot. Here we have to face the question, "What do we
mean by a test?" It may not be obvious why that question makes sense, or is
important, in this context. But I will give an example of a "test" which
somehow seems to violate the spirit of the word.
Imagine a genie who has all the time in the world, and who enjoys
using it to produce theorems of the MIU-system, in a rather methodical
way. Here, for instance, is a possible way the genie might go about it:
Step 1: Apply every applicable rule to the axiom MI. This yields
two new theorems: MIU, MIl.
Step 2: Apply every applicable rule to the theorems produced in
step 1. This yields three new theorems: MIIU, MIUIU, MlIIl.
The MU-puzzle 39
Step 3: Apply every applicable rule to the theorems produced in
step 2. This yields five new theorems: MIIIIU, MIIUIIU,
MIUIUIUlU, Mil 111111 , MUI.
This method produces every single theorem sooner or later, because the
rules are applied in every conceivable order. (See Fig. 11.) All of the
lengthening-shortening alternations which we mentioned above eventually
get carried out. However, it is not clear how long to wait for a given string
o. MI
~~
u ~~
I.
2.
''U ;6"U ~~~
3. MIUIUIUIU MIIUIIU MIIIIU Mil II II II MUI MIU
/ / //\ d!/I\~ \\ \
MU
FIGURE 11. A systematically constructed "tree" of all the theorems of the MIU-system. The
Nth level down contains those theorems whose derivations contain exactly N steps. The
encircled numbers tell which rule was employed. Is MU anywhere in this tree?
to appear on this list, since theorems are listed according to the shortness of
their derivations. This is not a very useful order, if you are interested in a
specific string (such as MU), and you don't even know if it has any deriva-
tion, much less how long that derivation might be.
Now we state the proposed "theoremhood-test":
40 The MU-puzzle
amount of time, then that test is called a decision procedure for the given
formal system.
When you have a decision procedure, then you have a very concrete
characterization of the nature of all theorems in the system. Offhand, it
might seem that the rules and axioms of the formal system provide no less
complete a characterization of the theorems of the system than a decision
procedure would. The tricky word here is "characterization". Certainly the
rules of inference and the axioms of the MIU-system do characterize,
implicitly, those strings that are theorems. Even more implicitly, they charac-
terize those strings that are not theorems. But implicit characterization is
not enough, for many purposes. If someone claims to have a characteriza-
tion of all theorems, but it takes him infinitely long to deduce that some
particular string is not a theorem, you would probably tend to say that
there is something lacking in that characterization-it is not quite concrete
enough. And that is why discovering that a decision procedure exists is a
very important step. What the discovery means, in effect, is that you can
perform a test for theoremhood of a string, and that, even if the test is
complicated, it is guaranteed to terminate. In principle, the test is just as easy,
just as mechanical, just as finite, just as full of certitude, as checking
whether the first letter of the string is M. A decision procedure is a "litmus
test" for theoremhood!
Incidentally, one requirement on formal systems is that the set of
axioms must be characterized by a decision procedure-there must be a
litmus test for axiomhood. This ensures that there is no problem in getting
off the ground at the beginning, at least. That is the difference between the
set of axioms and the set of theorems: the former always has a decision
procedure, but the latter may not.
I am sure you will agree that when you looked at the MIU-system for
the first time, you had to face this problem exactly. The lone axiom was
known, the rules of inference were simple, so the theorems had been
implicitly characterized-and yet it was still quite unclear what the conse-
quences of that characterization were. In particular, it was still totally
unclear whether MU is, or is not, a theorem.
The MU-puzzle 41
Two-Part!nvention
or,
What the Tortoise Said to Achilles
by Lewis CarrolP
Achilles had overtaken the Tortoise, and had seated himself comfortably
on its back.
"So you've got to the end of our race-course?" said the Tortoise. "Even
though it DOES consist of an infinite series of distances? I thought some
wiseacre or other had proved that the thing couldn't be done?"
"It CAN be done," said Achilles. "It HAS been done! Solvitur ambulando.
You see the distances were constantly DIMINISHING; and so--"
"But if they had been constantly INCREASING?" the Tortoise inter-
rupted. "How then?"
"Then I shouldn't be here," Achilles modestly replied; "and YOU
would have got several times round the world, by this time!"
"You flatter me-FLATTEN, I mean," said the Tortoise; "for you ARE a
heavy weight, and NO mistake! Well now, would you like to hear of a
race-course, that most people fancy they can get to the end of in two or
three steps, while it REALLY consists of an infinite number of distances, each
one longer than the previous one?"
"Very much indeed!" said the Grecian warrior, as he drew from his
helmet (few Grecian warriors possessed POCKETS in those days) an enor-
mous note-book and penci1. "Proceed! And speak SLOWLY, please! SHORT-
HAND isn't invented yet!"
"That beautiful First Proposition by Euclid!" the Tortoise murmured
dreamily. "You admire Euclid?"
"Passionately! So far, at least, as one CAN admire a treatise that won't be
published for some centuries to come!"
"Well, now, let's take a little bit of the argument in that First
Proposition-just TWO steps, and the conclusion drawn from them. Kindly
enter them in your note-book. And in order to refer to them conveniently,
let's call them A, B, and Z:-
(A) Things that are equal to the same are equal to each other.
(B) The two sides of this Triangle are things that are equal
to the same.
(Z) The two sides of this Triangle are equal to each other.
Readers of Euclid will grant, I suppose, that Z follows logically from A
and B, so that anyone who accepts A and B as true, MUST accept Z as true?"
"Undoubtedly! The youngest child in a High School-as soon as High
Two-Part Invention 43
Schools are invented, which will not be till some two thousand years
later-will grant THAT."
"And if some reader had NOT yet accepted A and B as true, he might
still accept the SEQUENCE as a VALlD one, 1 suppose?"
"No doubt such a reader might exist. He might say, 'I accept as true the
Hypothetical Proposition that, IF A and B be true, Z must be true; but 1
DON'T accept A and B as true.' Such a reader would do wisely in abandon-
ing Euclid, and taking to football."
"And might there not ALSO be some reader who would say 'I accept A
and B as true, but 1 DON'T accept the Hypothetical'?"
"Certainly there might. HE, also, had better take to football."
"And NEITHER of these readers," the Tortoise continued, "is AS YET
under any logical necessity to accept Z as true?"
"Quite so," Achilles assented.
"Well, now, 1 want you to consider ME as a reader of the SECOND kind,
and to force me, logically, to accept Z as true."
"A tortoise playing football would be-" Achilles was beginning.
"-an anomaly, of course," the Tortoise hastily interrupted. "Don't
wander from the point. Let's have Z first, and football afterwards!"
"I'm to force you to accept Z, am I?" Achilles said musingly. "And your
present position is that you accept A and B, but you DON'T accept the
H ypothetical-"
"Let's call it C," said the Tortoise.
"-but you DON'T accept
(A) Things that are equal to the same are equal to each other.
(B) The two sides of this Triangle are things that are equal to
the same.
(C) If A and B are true, Z must be true.
(Z) The two sides of this Triangle are equal to each other."
"You should call it D, not Z," said Achilles. "It comes NEXT to the other
three. If you accept A and Band C, you MUST accept Z."
44 Two-Part Invention
"And why must I?"
"Because it follows LOGICALLY from them. If A and Band C are true, Z
MUST be true. You can't dispute THAT, I imagine?"
"If A and Band C are true, Z MUST be true," the Tortoise thoughtfully
repeated. "That's ANOTHER Hypothetical, isn't it? And, if I failed to see its
truth, I might accept A and Band C, and STILL not accept Z, mightn't I?"
"You might," the candid hero admitted; "though such obtuseness
would certainly be phenomenal. Still, the event is POSSIBLE. SO I must ask
you to grant ONE more Hypothetical."
"Very good, I'm quite willing to grant it, as soon as you've written it
down. We will call it
Two-Part Invention 45
CHAPTER II
THIS Two-Part Invention was the inspiration for my two characters. Just as
Lewis Carroll took liberties with Zeno's Tortoise and Achilles, so have I
taken liberties with Lewis Carroll's Tortoise and Achilles. In Carroll's
dialogue, the same events take place over and over again, only each time on
a higher and higher level; it is a wonderful analogue to Bach's Ever-Rising
Canon. The Carrollian Dialogue, with its wit subtracted out, still leaves a
deep philosophical problem: Do words and thoughts follow formal rules, or do
they not? That problem is the problem of this book.
In this Chapter and the next, we will look at several new formal
systems. This will give us a much wider perspective on the concept of
formal system. By the end of these two Chapters, you should have quite a
good idea of the power of formal systems, and why they are of interest to
mathematicians and logicians.
The pq-System
The formal system of this Chapter is called the pq-system. It is not important
to mathematicians or logicians-in fact, it is just a simple invention of mine.
Its importance lies only in the fact that it provides an excellent example of
many ideas that playa large role in this book. There are three distinct
symbols of the pq-system:
p q
Note that 'x' must stand for the same string of hyphens in both occurrences.
For example, --p-q--- is an axiom. The literal expression 'xp-qx-' is
not an axiom, of course (because 'x' does not belong to the pq-system); it is
more like a mold in which all axioms are cast-and it is called an axiom
schema.
The pq-system has only one rule of production:
RULE: Suppose x, y, and z all stand for particular strings containing only
hyphens. And suppose that x p y q z is known to be a theorem. Then
xpy-qz- is a theorem.
For example, take x to be' --', y to be' ---', and z to be '-'. The rule tells
us:
A moment's reflection will show that you can't fail to produce every
theorem of the pq-system this way. Moreover, the bucket is getting filled
with longer and longer theorems, as time goes on. It is again a consequence
of that lack of shortening rules. So if you have a particular string, such as
--p---q-----, which you want to test for theoremhood, just follow the
numbered steps, checking all the while for the string in question. If it turns
up-theorem! If at some point everything that goes into the bucket is
longer than the string in question, forget it-it is not a theorem. This
decision procedure is bottom-up because it is working its way up from the
basics, which is to say the axioms. The previous decision procedure is
top-down because it does precisely the reverse: it works its way back down
towards the basics.
p :~ plus
q :~ equals
- :~ one
-- :~ two
--- :~ three
etc.
p :~ horse
q :~ happy
- :~ apple
--p--p--p--q--------
is a theorem. At least, one might wish that this string were a theorem. But
wishing doesn't change the fact that it isn't. And it would be a serious
mistake to think that it "must" be a theorem, just because 2 plus 2 plus 2
plus 2 equals 8. It would even be misleading to attribute it any meaning at
all, since it is not well-formed, and our meaningful interpretation is entirely
derived from looking at well-formed strings.
In a formal system, the meaning must remain passive; we can read each
string according to the meanings of its constituent symbols, but we do not
have the right to create new theorems purely on the basis of the meanings
we've assigned the symbols. Interpreted formal systems straddle the line
between systems without meaning, and systems with meaning. Their
strings can be thought of as "expressing" things, but this must come only as
a consequence of the formal properties of the system.
Double-Entendrel
And now, I want to destroy any illusion about having found the meanings
for the symbols of the pq-system. Consider the following association:
p :~ equals
q :~ taken from
- :~ one
-- :~ two
etc.
And that would be the "proof". Nearly everyone believes that if you
counted the squares, you would get 144 of them; few people feel that the
outcome is in doubt.
The conflict between the two points of view comes into sharper
focus when you consider the problem of determining the value of
987654321 X 123456789. First of all, it is virtually impossible to construct
the appropriate rectangle; and what is worse, even if it were constructed,
and huge armies of people spent centuries counting the little squares, only
a very gullible person would be willing to believe their final answer. It is just
too likely that somewhere, somehow, somebody bobbled just a little bit. So
is it ever possible to know what the answer is? If you trust the symbolic
process which involves manipulating digits according to certain simple
rules, yes. That process is presented to children as a device which gets the
right answer; lost in the shuffle, for many children, are the rhyme and
reason of that process. The digit-shunting laws for multiplication are based
mostly on a few properties of addition and multiplication which are as-
sumed to hold for all numbers.
Now you count them. At the same time, somebody else counts them, but
starting from the other end. Is it clear that the two of you will get the same
answer? The result of a counting process is independent of the way in
which it is done. This is really an assumption about what counting is. It
would be senseless to try to prove it, because it is so basic; either you see it
or you don't-but in the latter case, a proof won't help you a bit.
From this kind of assumption, one can get to die commutativity and
associativity of addition (i.e., first that b + c = c + b always, and second
that b + (c + d) = (b + c) + d always). The same assumption can also lead
you to the commutativity and associativity of multiplication; just think of
Ideal Numbers
Numbers as realities misbehave. However, there is an ancient and innate
sense in people that numbers ought not to misbehave. There is something
clean and pure in the abstract notion of number, removed from counting
beads, dialects, or clouds; and there ought to be a way of talking about
numbers without always having the silliness of reality come in and intrude.
The hard-edged rules that govern "ideal" numbers constitute arithmetic,
and their more advanced consequences constitute number theory. There is
only one relevant question to be asked, in making the transition from
numbers as practical things to numbers as formal things. Once you have
Euclid's Proof
The reason is that reasoning tells them it is so. Let us follow the reasoning
involved. We wiIllook at a variant of Euclid's proof. This proof works by
showing that whatever number you pick, there is a prime larger than it.
Pick a number-No Multiply all the positive integers starting with 1 and
ending with N; in other words, form the factorial of N, written "N!". What
you get is divisible by every number up to N. When you add 1 to N!, the
result
can't be a multiple of 2 (because it leaves lover,
when you divide by 2);
can't be a multiple of 3 (because it leaves lover,
when you divide by 3);
can't be a multiple of 4 (because it leaves lover,
when you divide by 4);
The tq-System
A first step might be to try to solve a simpler, but related, problem. We
could try to make a system similar to the pq-system, except that it repre-
sents multiplication, instead of addition. Let's call it the tq-system, 't' for
'times'. More specifically, suppose X, Y, and Z are, respectively, the num-
bers of hyphens in the hyphen-strings x, y, and z. (Notice I am taking
special pains to distinguish between a string and the number of hyphens it
contains.) Then we wish the string x ty q z to be a theorem if and only if X
times Y equals Z. For instance, -- t---q ------ should be a theorem
because 2 times 3 equals 6, but --t---q--- should not be a theorem. The
tq-system can be characterized just about as easily as the pq-system-
namely, by using just one axiom schema and one rule of inference:
Notice how the middle hyphen-string grows by one hyphen each time the
rule of inference is applied; so it is predictable that if you want a theorem
with ten hyphens in the middle, you apply the rule of inference nine times
in a row.
FIGURE 15.
For a similar effect, take a look at my drawing Smoke Signal (Fig. 139).
Along these lines, you might consider this puzzle: can you somehow create
a drawing containing words in both the figure and the ground?
Let us now officially distinguish between two kinds of figures: cursively
drawable ones, and recursive ones (by the way, these are my own terms-they
are not in common usage). A cursively drawable figure is one whose ground
is merely an accidental by-product of the drawing act. A recursive figure is
one whose ground can be seen as a figure in its own right. Usually this is
quite deliberate on the part of the artist. The "re" in "recursive" represents
the fact that both foreground and background are cursively drawable-the
figure is "twice-cursive". Each figure-ground boundary in a recursive figure
is a double-edged sword. M. C. Escher was a master at drawing recursive
figures-see, for instance, his beautiful recursive drawing of birds (Fig. 16).
(In the special case of the FIGURE-FIGURE Figure, the two characterizations
are equivalent-but in most black-and-white pictures, they would not be.)
Now in Chapter VIII, when we create our Typographical Number Theory
(TNT), it will be our hope that the set of all false statements of number
theory can be characterized in two analogous ways:
(1) inside the set of all nontheorems are found some truths;
(2) outside the set of all negated theorems are found some false-
hoods.
You will see why and how this happens, in Chapter XIV. Meanwhile,
ponder over a pictorial representation of the situation (Fig. 18).
Well-formed formulas
Strings
FIGURE 18. Considerable visual symbolism is featured in this diagram of the relationship
between various classes of TNT strings. The biggest box represents the set of all TNT strings.
The next-biggest box represents the set of all well-formed TNT strings. Within it is found the
set of all sentences of TNT. Now things begin to get interesting. The set of theorems is
pictured as a tree growing out of a trunk (representing the set of axioms). The tree-symbol was
chosen because of the recursive growth pattern which it exhibits: new branches (theorems)
constantly sprouting from old ones. The fingerlike branches probe into the corners of the
constraining region (the set of truths), yet can never fully occupy it. The boundary between
the set of truths and the set of falsities is meant to suggest a randomly meandering coastline
which, no matter how closely you examine it, always has finer levels of structure, and is
consequently impossible to describe exactly in any finite way. (See B. Mandelbrot's book
Fractals.) The reflected tree represents the set of negations of theorems: all of them false,
yet unable collectively to span the space of false statements. [Drawing by the author.]
puts one voice on the on-beats, and the other voice on the off-beats, so the
ear separates them and hears two distinct melodies weaving in and out, and
harmonizing with each other. Needless to say, Bach didn't stop at this level
of complexity ...
1 3 7 12 18 26 35 45 56 69 ...
For example, -----ON 0--, where x has been replaced by '--' and y by
, ,
If you use the rule twice, you can generate this theorem:
-----ON 0------------
which is interpreted as "5 does not divide 12". But ---0 N 0------ is
not a theorem. What goes wrong if you try to produce it?
Now in order to determine that a given number is prime, we have to
build up some knowledge about its nondivisibility properties. In particular,
we want to know that it is not divisible by 2 or 3 or 4, etc., all the way up to 1
less than the number itself. But we can't be so vague in formal systems as to
say "et cetera". We must spell things out. We would like to have a way of
saying, in the language of the system, "the number Z is divisorjree up toX",
meaning that no number between 2 and X divides Z. This can be done, but
there is a trick to it. Think about it if you want.
Here is the solution:
AXIOM: P--.
And there you have it. The principle of representing primality formally is
that there is a test for divisibility which can be done without any backtrack-
ing. You march steadily upward, testing first for divisibility by 2, then by 3,
and so on. It is this "monotonicity" or unidirectionality-this absence of
cross-play between lengthening and shortening, increasing and
decreasing-that allows primality to be captured. And it is this potential
complexity of formal systems to involve arbitrary amounts of backwards-
forwards interference that is responsible for such limitative results as
Godel's Theorem, Turing's Halting Problem, and the fact that not all
recursively enumerable sets are recursive.
Contracrostipunctus 75
Achilles: Naturally, I suppose you disagreed.
Tortoise: True, but he would hear nothing of my arguments. He staunchly
maintained that any sound whatever was reproducible on his
machine. Since I couldn't convince him of the contrary, I left it
at that. But not long after that, I returned the visit, taking with
me a record of a song which I had myself composed. The song
was called "I Cannot Be Played on Record Player 1".
Achilles: Rather unusual. Was it a present for the Crab?
Tortoise: Absolutely. I suggested that we listen to it on his new phono-
graph, and he was very glad to oblige me. So he put it on. But
unfortunately, after only a few notes, the record player began
vibrating rather severely, and then with a loud "pop", broke
into a large number of fairly small pieces, scattered all about
the room. The record was utterly destroyed also, needless to
say.
Achilles: Calamitous blow for the poor fellow, I'd say. What was the matter
with his record player?
Tortoise: Really, there was nothing the matter, nothing at all. It simply
couldn't reproduce the sounds on the record which I had
brought him, because they were sounds that would make it
vibrate and break.
Achilles: Odd, isn't it? I mean, I thought it was a Perfect phonograph.
That's what the salesman had told him, after all.
Tortoise: Surely, Achilles, you don't believe everything that salesmen tell
you! Are you as naive as the Crab was?
Achilles: The Crab was naiver by far! I know that salesmen are notorious
prevaricators. I wasn't born yesterday!
Tortoise: In that case, maybe you can imagine that this particular salesman
had somewhat exaggerated the quality of the Crab's piece of
equipment . .. perhaps it was indeed less than Perfect, and
could not reproduce every possible sound.
Achilles: Perhaps that is an explanation. But there's no explanation for the
amazing coincidence that your record had those very sounds
on it ...
Tortoise: Unless they got put there deliberately. You see, before returning
the Crab's visit, I went to the store where the Crab had bought
his machine, and inquired as to the make. Having ascertained
that, I sent off to the manufacturers for a description of its
design. After receiving that by return mail, I analyzed the
entire construction of the phonograph and discovered a cer-
tain set of sounds which, if they were produced anywhere in
the vicinity, would set the device to shaking and eventually to
falling apart.
Achilles: Nasty fellow! You needn't spell out for me the last details: that
you recorded those sounds yourself, and offered the dastardly
item as a gift ...
76 Contracrostipunctus
Tortoise: Clever devil! You jumped ahead of the story! But that wasn't the
end of the adventure, by any means, for the Crab did not
believe that his record player was at fault. He was quite stub-
born. So he went out and bought a new record player, this one
even more expensive, and this time the salesman promised to
give him double his money back in case the Crab found a sound
which it could not reproduce exactly. So the Crab told me
excitedly about his new model, and I promised to come over
and see it.
Achilles: Tell me if I'm wrong-I bet that before you did so, you once
again wrote the manufacturer, and composed and recorded a
new song called "I Cannot Be Played on Record Player 2",
based on the construction of the new model.
Tortoise: Utterly brilliant deduction, Achilles. You've quite got the spirit.
Achilles: So what happened this time?
Tortoise: As you might expect, precisely the same thing. The phonograph
fell into innumerable pieces, and the record was shattered.
Achilles: Consequently, the Crab finally became convinced that there can
be no such thing as a Perfect record player.
Tortoise: Rather surprisingly, that's not quite what happened. He was sure
that the next model up would fill the bill, and having twice the
money, he-
Achilles: Oho-I have an idea! He could have easily outwitted you, by
obtaining a LOW-fidelity phonograph-one that was not capa-
ble of reproducing the sounds which would destroy it. In that
way, he would avoid your trick.
Tortoise: Surely, but that would defeat theoriginal purpose-namely, to
have a phonograph which could reproduce any sound what-
soever, even its own self-breaking sound, which is of course
impossible.
Achilles: That's true. I see the dilemma now. If any record player-say
Record Player X-is sufficiently high-fidelity, then when it
attempts to play the song "I Cannot Be Played on Record
Player X", it will create just those vibrations which will cause it
to break ... So it fails to be Perfect. And yet, the only way to get
around that trickery, namely for Record Player X to be of
lower fidelity, even more directly ensures that it is not Perfect.
It seems that every record player is vulnerable to one or the
other of these frailties, and hence all record players are defec-
tive.
Tortoise: I don't see why you call them "defective". It is simply an inherent
fact about record players that they can't do all that you might
wish them to be able to do. But if there is a defect anywhere, it
is not in THEM, but in your expectations of what they should be
able to do! And the Crab was just full of such unrealistic
expectations.
Contracrostipunctus 77
Achilles: Compassion for the Crab overwhelms me. High fidelity or low
fidelity, he loses either way.
Tortoise: And so, our little game went on like this for a few more rounds,
and eventually our friend tried to become very smart. He got
wind of the principle upon which I was basing my own records,
and decided to try to outfox me. He wrote to the phonograph
makers, and described a device of his own invention, which
they built to specification. He called it "Record Player Omega".
It was considerably more sophisticated than an ordinary record
player.
Achilles: Let me guess how: Did it have no moving parts? Or was it made
of cotton? Or-
Tortoise: Let me tell you, instead. That will save some time. In the first
place, Record Player Omega incorporated a television camera
whose purpose it was to scan any record before playing it. This
camera was hooked up to a small built-in computer, which
would determine exactly the nature of the sounds, by looking
at the groove-patterns.
Achilles: Yes, so far so good. But what could Record Player Omega do with
this information?
Tortoise: By elaborate calculations, its little computer figured out what
effects the sounds would have upon its phonograph. If it de-
duced that the sounds were such that they would cause the
machine in its present configuration to break, then it did some-
thing very clever. Old Omega contained a device which could
disassemble large parts of its phonograph subunit, and rebuild
them in new ways, so that it could, in effect, change its own
structure. If the sounds were "dangerous", a new configuration
was chosen, one to which the sounds would pose no threat, and
this new configuration would then be built by the rebuilding
subunit, under direction of the little computer. Only after this
rebuilding operation would Record Player Omega attempt to
play the record.
Achilles: Aha! That must have spelled the end of your tricks. I bet you
were a little disappointed.
Tortoise: Curious that you should think so ... I don't suppose that you
know Godel's Incompleteness Theorem backwards and for-
wards, do you?
Achilles: Know WHOSE Theorem backwards and forwards? I've never
heard of anything that sounds like that. I'm sure it's fascinat-
ing, but I'd rather hear more about "music to break records
by". It's an amusing little story. Actually, I guess I can fill in the
end. Obviously, there was no point in going on, and so you
sheepishly admitted defeat, and that was that. Isn't that exactly
it?
Tortoise: What! It's almost midnight! I'm afraid it's my bedtime. I'd love to
talk some more, but really I am growing quite sleepy.
78 Contracrostipunctus
Achilles: As am I. Well, I'll be on my way. (As he reaches the door, he suddenly
stops, and turns around.) Oh, how silly of me! I almost forgot, I
brought you a little present. Here. (Hands the Tortoise a small,
neatly wrapped package.)
Tortoise: Really, you shouldn't have! Why, thank you very much indeed. I
think I'll open it now. (Eagerly tears open the package, and inside
discovers a glass goblet.) Oh, what an exquisite goblet! Did you
know that I am quite an aficionado for, of all things, glass
goblets?
Achilles: Didn't have the foggiest. What an agreeable coincidence!
Tortoise: Say, if you can keep a secret, I'll let you in on something: I'm
trying to find a Perfect goblet: one having no defects of any
sort in its shape. Wouldn't it be something if this goblet-let's
call it "G"-were the one? Tell me, where did you come across
Goblet G?
Achilles: Sorry, but that's MY little secret. But you might like to know who
its maker is.
Tortoise: Pray tell, who is it?
Achilles: Ever hear of the famous glassblower Johann Sebastian Bach?
Well, he wasn't exactly famous for glassblowing-but he dab-
bled at the art as a hobby, though hardly a soul knows it-and
this goblet is the last piece he blew.
Tortoise: Literally his last one? My gracious. If it truly was made by Bach,
its value is inestimable. But how are you sure of its maker?
Achilles: Look at the inscription on the inside-do you see where the
letters 'B', 'A', 'C', 'H' have been etched?
Tortoise: Sure enough! What an extraordinary thing. (Gently sets Goblet G
down on a shelf) By the way, did you know that each of the four
letters in Bach's name is the name of a musical note?
Achilles: , tisn't possible, is it? After all, musical notes only go from 'A'
through 'G'.
Tortoise: Just so; in most countries, that's the case. But in Germany, Bach's
own homeland, the convention has always been similar, except
that what we call 'B', they call 'H', and what we call 'B-Hat', they
call 'B'. For instance, we talk about Bach's "Mass in B Minor",
whereas they talk about his "H-moll Messe". Is that clear?
Achilles: ... hmm ... I guess so. It's a little confusing: H is B, and B is
B-Hat. I suppose his name actually constitutes a melody, then.
Tortoise: Strange but true. In fact, he worked that melody subtly into one
of his most elaborate musical pieces-namely, the final Con-
trapunctus in his Art cif the Fugue. It was the last fugue Bach ever
wrote. When I heard it for the first time, I had no idea how it
would end. Suddenly, without warning, it broke off. And then
... dead silence. I realized immediately that was where Bach
died. It is an indescribably sad moment, and the effect it had on
me was-shattering. In any case, B-A-C-H is the last theme of
that fugue. It is hidden inside the piece. Bach didn't point it out
Contracrostipunctus 79
~n .... --- ..
'---
. -
n
.. ......
~ ~ 1--- - L
-
~
..........
211O
,n -...~ ~ .
-w
n
--
.- Q .. .
~ ~
.
---.
-
--
--
2315
n ...
.-
"
n
~
- -- -
... !!.P:-- .... ti.&. .... .~jIlb~
(1685-1750)
FIGURE 19. The last page oj Bach's Art of the Fugue.1n the original manuscript, in the
handwriting of Bach's son Carl Philipp Emanuel, is written: "N.B. 1n the course oj this
fugue, at the point where the name B.A.C.H. was brought in as countersubject, the composer
died." (B-A-C-H in box.) 1 have let this final page oj Bach's last fugue serve as an epitaph.
[Music printed by Donald Byrd's program "SMUT", developed at Indiana University.]
explicitly, but if you know about it, you can find it without
much trouble. Ah, me-there are so many clever ways of hid-
ing things in music ...
Achilles: ... or in poems. Poets used to do very similar things, you know
(though it's rather out of style these days). For instance, Lewis
Carroll often hid words and names in the first letters (or
characters) of the successive lines in poems he wrote. Poems
which conceal messages that way are called "acrostics".
Tortoise: Bach, too, occasionally wrote acrostics, which isn't surprising.
After all, counterpoint and acrostics, with their levels of hidden
meaning, have quite a bit in common. Most acrostics, however,
have only one hidden level-but there is no reason that one
couldn't make a double-decker-an acrostic on top of an acros-
tic. Or one could make a "contracrostic"-where the initial
letters, taken in reverse order, form a message. Heavens!
There's no end to the possibilities inherent in the form.
Moreover, it's not limited to poets; anyone could write
acrostics-even a dialogician.
Achilles: A dial-a-Iogician? That's a new one on me.
Tortoise: Correction: I said "dialogician", by which I meant a writer of
dialogues. Hmm ... something just occurred to me. In the
unlikely event that a dialogician should write a contrapuntal
acrostic in homage to J. S. Bach, do you suppose it would be
more proper for him to acrostically embed his OWN name-<>r
that of Bach? Oh, well, why worry about such frivolous mat-
ters? Anybody who wanted to write such a piece could make up
his own mind. Now getting back to Bach's melodic name, did
you know that the melody B-A-C-H, if played upside down and
backwards, is exactly the same as the original?
Achilles: How can anything be played upside down? Backwards, I can
see-you get H-C-A-B-but upside down? You must be pulling
my leg.
Tortoise: ' pon my word, you're quite a skeptic, aren't you? Well, I guess
I'll have to give you a demonstration. Let me just go and fetch
my fiddle- (Walks into the next room, and returns in a jiffy with an
ancient-looking violin.) -and play it for you forwards and back-
wards and every which way. Let's see, now ... (Places his copy of
the Art of the Fugue on his music stand and opens it to the last page.)
... here's the last Contrapunctus, and here's the last theme ...
The Tortoise begins to play: B-A-C- - but as he bows
the final H, suddenly, without warning, a shattering
sound rudely interrupts his performance. Both he and
Achilles spin around, just in time to catch a glimpse of
myriad fragments of glass tinkling to the floor from the
shelf where Goblet G had stood, only moments before. And
then . . . dead silence.
Contracrostipunctus 81
CHAPTER IV
Consistency, Completeness,
and Geometry
Therefore we can even make an isomorphism between the two levels of the
story, in which we equate the way in which the records and goblet
boomerang back to destroy themselves, with the way in which the Tortoise's
own fiendish method boomerangs back to get him in the end. Seen this
This is not the full extent of the isomorphism between Godel's Theo-
rem and the Contracrostipunctus, but it is the core of it. You need not worry
if you don't fully grasp Godel's Theorem by now-there are still a few
Chapters to go before we reach it! Nevertheless, having read this Dialogue,
you have already tasted some of the flavor of Godel's Theorem without
necessarily being aware of it. I now leave you to look for any other types of
implicit meaning in the Contracrostipunctus. "Quaerendo invenietis!"
(1) A straight line segment can be drawn joining any two points.
(2) Any straight line segment can be extended indefinitely in a
straight line.
(3) Given any straight line segment, a circle can be drawn having
the segment as radius and one end point as center.
(4) All right angles are congruent.
(5) If two lines are drawn which intersect a third in such a way
that the sum of the inner angles on one side is less than two
right angles, then the two lines inevitably must intersect each
other on that side if extended far enough.
But later, when convinced his son really "had something", he urged
him to publish it, anticipating correctly the simultaneity which is so fre-
quent in scientific discovery:
When the time is ripe for certain things, these things appear in different
places in the manner of violets coming to light in early spring.2
Undefined Terms
This should begin to sound familiar. In particular, it harks back to the
pq-system, and its variant, in which the symbols acquired passive meanings
by virtue of their roles in theorems. The symbol q is especially interesting,
Varieties of Consistency
We have been speaking of "consistency" and "inconsistency" all along,
without defining them. We have just relied on good old everyday notions.
But now let us say exactly what is meant by consistency of a formal system
(together with an interpretation): that every theorem, when interpreted,
becomes a true statement. And we will say that inconsistency occurs when
there is at least one false statement among the interpreted theorems.
This definition appears to be talking about inconsistency with the
external world-what about internal inconsistencies? Presumably, a system
would be internally inconsistent if it contained two or more theorems
whose interpretations were incompatible with one another, and internally
consistent if all interpreted theorems were compatible with one another.
Consider, for example, a formal system which has only the following three
theorems: TbZ, ZbE, and EbT. If T is interpreted as "the Tortoise", Z as
"Zeno", E as "Egbert", and x by as "x beats y in chess always", then we have
the following interpreted theorems:
In this case, it doesn't matter whether the individual statements are true or
false-and perhaps there is no way to know which ones are true, and which
are not. What is nevertheless certain is that not all three can be true at once.
Thus, the interpretation makes the system internally inconsistent. This
internal inconsistency depends not on the interpretations of the three
capital letters, but only on that of b, and on the fact that the three capitals
are cyclically permuted around the occurrences of b. Thus, one can have
internal inconsistency without having interpreted all of the symbols of the
formal system. (In this case it sufficed to interpret a single symbol.) By the
time sufficiently many symbols have been given interpretations, it may be
clear that there is no way that the rest of them can be interpreted so that all
theorems will come out true. But it is not just a question of truth-it is a
question of possibility. All three theorems would come out false if the
capitals were interpreted as the names of real people-but that is not why
we would call the system internally inconsistent; our grounds for doing so
would be the circularity, combined with the interpretation of the letter b.
(By the way, you'll find more on this "authorship triangle" in Chapter XX.)
Completeness
If consistency is the minimal condition under which symbols acquire pas-
sive meanings, then its complementary notion, completeness, is the maximal
confirmation of those passive meanings. Where consistency is the property
Tortoise: This is my favorite ride. One seems to move so far, and yet in
reality one gets nowhere.
Achilles: I can see why it would appeal to you. Are you all strapped in?
Tortoise: Yes, I think I've got this buckle done. Well, here we go. Whee!
Achilles: You certainly are exuberant today.
Tortoise: I have good reason to be. My aunt, who is a fortune-teller, told
me that a stroke of Good Fortune would befall me today. So I am
tingling with anticipation.
Achilles: Don't tell me you believe in fortune-telling!
Tortoise: No ... but they say it works even if you don't believe in it.
Achilles: Well, that's fortunate indeed.
Tortoise: Ah, what a view of the beach, the crowd, the ocean, the city ...
Achilles: Yes, it certainly is splendid. Say, look at that helicopter over
there. It seems to be flying our way. In fact it's almost directly above us
now.
Tortoise: Strange-there's a cable dangling down from it, which is coming
very close to us. It's coming so close we could practically grab it.
Achilles: Look! At the end of the line there's a giant hook, with a note.
(He reaches out and snatches the note. They pass by and are on their way
down.)
Tortoise: Can you make out what the note says?
Achilles: Yes-it reads, "Howdy, friends. Grab a hold of the hook next
time around, for an Unexpected Surprise."
Tortoise: The note's a little corny but who knows where it might lead.
Perhaps it's got something to do with that bit of Good Fortune due me.
By all means, let's try it!
Achilles: Let's!
(On the trip up they unbuckle their buckles, and at the crest of the ride, they
grab for the giant hook. All of a sudden they are whooshed up by the cable,
which quickly reels them skyward into the hovering helicopter. A large
strong hand helps them in.)
Voice: Welcome aboard-Suckers.
Achilles: Wh-who are you?
{COD}
Achilles: Well, YOU can read it if you want, but as for me,
I'm not going to take any chances with that
popping-tonie-one of the lizards might knock it
off the table, so I'm going to get it right now!
(He dashes over to the table and reaches for the
popping-tonic, but in his haste he somehow bumps the
flask of tonic, and it tumbles off the desk and begins
rolling.)
Oh, no! Mr. T -look! I accidentally knocked the
tonic onto the floor, and it's rolling towards-
towards-the stairwell! Quick-before it falls!
(The Tortoise, however, is completely wrapped up in
the thin volume which he has in his hands.)
Recursive Structures
and Processes
What Is Recursion?
WHAT IS RECURSION? It is what was illustrated in the Dialogue Little
Harmonic Labyrinth: nesting, and variations on nesting. The concept is very
general. (Stories inside stories, movies inside movies, paintings inside paint-
ings, Russian dolls inside Russian dolls (even parenthetical comments in-
side parenthetical comments!)-these are just a few of the charms of
recursion.) However, you should be aware that the meaning of "recursive"
in this Chapter is only faintly related to its meaning in Chapter III. The
relation should be clear by the end of this Chapter.
Sometimes recursion seems to brush paradox very closely. For exam-
ple, there are recursive definitions. Such a definition may give the casual
viewer the impression that something is being defined in terms of itself.
That would be circular and lead to infinite regress, if not to paradox
proper. Actually, a recursive definition (when properly formulated) never
leads to infinite regress or paradox. This is because a recursive definition
never defines something in terms of itself, but always in terms of simpler
versions of itself. What I mean by this will become clearer shortly, when I
show some examples of recursive definitions.
One of the most common ways in which recursion appears in daily life
is when you postpone completing a task in favor of a simpler task, often of
the same type. Here is a good example. An executive has a fancy telephone
and receives many calls on it. He is talking to A when B calls. To A he says,
"Would you mind holding for a moment?" Of course he doesn't really care
if A minds; he just pushes a button, and switches to B. Now C calls. The
same deferment happens to B. This could go on indefinitely, but let us not
get too bogged down in our enthusiasm. So let's say the call with C termi-
nates. Then our executive "pops" back up to B, and continues. Meanwhile,
A is sitting at the other end of the line, drumming his fingernails against
some table, and listening to some horrible Muzak piped through the phone
lines to placate him ... Now the easiest case is if the call with B simply
terminates, and the executive returns to A finally. But it could happen that
after the conversation with B is resumed, a new caller-D--calls. B is once
again pushed onto the stack of waiting callers, and D is taken care of. After
D is done, back to B, then back to A. This executive is hopelessly mechani-
cal, to be sure-but we are illustrating recursion in its most precise form.
L -_ _ _ ~'" \l At q 0
Convn: and C01lCaw L \ ~
f-----.., .......
Rep"",
r----~---'
R.ptik'
':i
)
~
~~ t~ !~~
'@
~
'"Evil MajOlaur's
Little Harmonic Labyrinth
FIGURE 26. Diagram of the structure of the Dialogue Little Harmonic Labyrinth.
Vertical descents are "pushes"; rises are "pops". Notice the similarity of this diagram to the
indentation pattern of the Dialogue. From the diagram it is clear that the initial tension-
Goodfortune's threat-never was resolved; Achilles and the Tortoise were just left dangling in
the sky. Some readers might agonize over this unpopped push, while others might not bat an
eyelash. In the story, Bach's musical labyrinth likewise was cut off too soon-but Achilles didn't
even notice anythingfunny. Only the Tortoise was aware of the more global dangling tension.
Stacks in Music
While we're talking about the Little Harmonic Labyrinth, we should discuss
something which is hinted at, if not stated explicitly in the Dialogue: that we
hear music recursively-in particular, that we maintain a mental stack of
keys, and that each new modulation pushes a new key onto the stack. The
implication is further that we want to hear that sequence of keys retraced in
reverse order-popping the pushed keys off the stack, one by one, until the
tonic is reached. This is an exaggeration. There is a grain of truth to it,
however.
Any reasonably musical person automatically maintains a shallow stack
with two keys. In that "short stack", the true tonic key is held, and also the
most immediate "pseudotonic" (the key the composer is pretending to be
in). In other words, the most global key and the most local key. That way,
the listener knows when the true tonic is regained, and feels a strong sense
of "relief". The listener can also distinguish (unlike Achilles) between a
local easing of tension-for example a resolution into the pseudotonic-
Recursion in Language
Our mental stacking power is perhaps slightly stronger in language. The
grammatical structure of all languages involves setting up quite elaborate
push-down stacks, though, to be sure, the difficulty of understanding a
sentence increases sharply with the number of pushes onto the stack. The
proverbial German phenomenon of the "verb-at-the-end", about which
(b)
FANCY
NOUN,
FIGURE 27. Recursive Transition Networks for ORNATE NOUN and FANCY NOUN.
not exhibited any true recursion so far. Things get recursive-and seem-
ingly circular-when you go to an RTN such as the one in Figure 27b, for
FANCY NOUN. As you can see, every possible pathway in FANCY NOUN
involves a call on ORNATE NOUN, so there is no way to avoid getting a
noun of some sort or other. And it is possible to be no more ornate than
that, coming out merely with "milk" or "big red blue green sneezes". But
three of the pathways involve recursive calls on FANCY NOUN itself. It
certainly looks as if something is being defined in terms of itself. Is that
what is happening, or not?
The answer is "yes, but benignly". Suppose that, in the procedure
SENTENCE, there is a node which calls FANCY NOUN, and we hit that node.
This means that we commit to memory (viz., the stack) the location of that
node inside SENTENCE, so we'll know where to return to-then we transfer
our attention to the procedure FANCY NOUN. Now we must choose a
pathway to take, in order to generate a FANCY NOUN. Suppose we choose
the lower of the upper pathways-the one whose calling sequence goes:
"the strange bagels that the purple cow without horns gobbled"
will get passed upwards to the patient SENTENCE, as we pop for the last
time.
As you see, we didn't get into any infinite regress. The reason is that at
least one pathway inside the RTN FANCY NOUN does not involve any
recursive calls on FANCY NOUN itself. Of course, we could have perversely
insisted on always choosing the bottom pathway inside FANCY NOUN, and
then we would never have gotten finished, just as the acronym "GOD"
never got fully expanded. But if the pathways are chosen at random, then
an infinite regress of that sort will not happen.
Expanding Nodes
One graphic way of thinking about RTN's is this. Whenever you are
moving along some pathway and you hit a node which calls on an RTN, you
"expand" that node, which means to replace it by a very small copy of the
RTN it calls (see Fig. 28). Then you proceed into the very small RTN!
FIGURE 28. The FANCY NOUN RTN with one node recursively expanded.
When you pop out of it, you are automatically in the right place in the big
one. While in the small one, you may wind up constructing even more
miniature RTN's. But by expanding nodes only when you come across
them, you avoid the need to make an infinite diagram, even when an RTN
calls itself.
Expanding a node is a little like replacing a letter in an acronym by the
word it stands for. The "GOD" acronym is recursive but has the defect--or
advantage-that you must repeatedly expand the 'G'; thus it never bottoms
out. When an RTN is implemented as a real computer program, however,
it always has at least one pathway which avoids recursivity (direct or indi-
rect) so that infinite regress is not created. Even the most heterarchical
program structure bottoms out--otherwise it couldn't run! It would just be
constantly expanding node after node, but never performing any action.
W (a)
H
(c)
G H H
G G
G H
(b) (d)
FlBO(n):
value is 1
How does this function G(n) code for the tree-structure? Quite simply, if
you construct a tree by placing G(n) below n, for all values of n, you will
recreate Diagram G. In fact, that is how I discovered Diagram G in the first
place. I was investigating thefunction G, and in trying to calculate its values
quickly, I conceived of displaying the values I already knew in a tree. To my
surprise, the tree turned out to have this extremely orderly recursive
geometrical description.
What is more wonderful is that if you make the analogous tree for a
function H(n) defined with one more nesting than G-
A Chaotic Sequence
One last example of recursion in number theory leads to a small mystery.
Consider the following recursive definition of a function:
5+6=11
~
~
To obtain the next one, move leftwards (from the three dots) respectively
10 and 9 terms; you will hit a 5 and a 6, shown by the arrows. Their
sum-II-yields the new value: Q( 18). This is the strange process by which
the list of known Q-numbers is w;ed to extend itself. The resulting se-
quence is, to put it mildly, erratic. The further out you go, the less sense it
seems to make. This is one of those very peculiar cases where what seems to
be a somewhat natural definition leads to extremely puzzling behavior:
chaos produced in a very orderly manner. One is naturally led to wonder
whether the apparent chaos conceals some subtle regularity. Of course, by
definition, there is regularity, but what is of interest is whether there is
another way of characterizing this sequence-and with luck, a nonrecursive
way.
.9
.8
..,:....- /
, ~\
.7 \'
.6
FIGURE 32. Graph of the function INT(x). There is a jump discontinuity at every rational
value qf x.
How does it ever get off the ground? That is a very interesting matter. The
main thing to notice is that, to describe INT to someone who hasn't seen it,
it will not suffice merely to say, "It consists of copies of itself." The other
half of the story-the nonrecursive half-tells where those copies lie inside
the square, and how they have been deformed, relative to the full-size
graph. Only the combination of these two aspects of INT will specify the
structure of INT. It is exactly as in the definition of Fibonacci numbers,
where you need two lines-one to define the recursion, the other to define
the bottom (i.e., the values at the beginning). To be very concrete, if you
make one of the bottom values 3 instead of 1, you will produce a completely
different sequence, known as the Lucas sequence:
FIGURE 33(a) The skeleton from which [NT can be constructed by recursive substitutions.
(b) The skeleton from which Gplot can be constructed by recursive substitutions. ( b)
~------------------------
Gplot shows that distribution. The horizontal axis represents energy,
and the vertical axis represents the above-mentioned ratio of time periods,
which we can call "0". At the bottom, 0 is zero, and at the top 0 is unity.
When 0 is zero, there is no magnetic field. Each of the line segments
making up Gplot is an "energy band"-that is, it represents allowed values
of energy. The empty swaths traversing Gplot on all different size scales are
therefore regions of forbidden energy. One of the most startling properties
of Gplot is that when 0 is rational (say plq in lowest terms), there are exactly
q such bands (though when q is even, two of them "kiss" in the middle).
And when 0 is irrational, the bands shrink to points, of which there are
infinitely many, very sparsely distributed in a so-called "Cantor set"-
another recursively defined entity which springs up in topology.
You might well wonder whether such an intricate structure would ever
show up in an experiment. Frankly, I would be the most surprised person
in the world if Gplot came out of any experiment. The physicality of Gplot
lies in the fact that it points the way to the proper mathematical treatment
of less idealized problems of this SOIt. In other words, Gplot is purely a
contribution to theoretical physics, not a hint to experimentalists as to what
to expect to see! An agnostic friend of mine once was so struck by Gplot's
infinitely many infinities that he called it "a picture of God", which I don't
think is blasphemous at all.
~
-:::::~:~~~~::~::=.:;:~:::~~~~:::j?{:~??}!tf!:?0::~~~~ ~~!'l~~:?T?~ \~:???::~?E~.~~:~:::::;.~:=::~:~2~:::~:;7:':::--
.9 .~.. ~ ..-- ~ - ~.y. ~ -_ .. -. .-,.-
..... ~ ...._-~ _.-M!< __ _;'
......
............ ""'-_ .~- -'r ._.d'- ~
-..y- ------- --
""'- -~ ~ .._ -V- _.. ~~- ~ /
.8 '\.- ""'~
~~ ~~.4 ~~..dr
:. - ~::: {.. -5'-'< _-/
~ ~.-?~~~.,.-..... T .--."d,~""f AI
~\. ~~.- A... ..~~7 _i.W
.7 v~ 'If" _~ V /r~'i
I~~ 1 _... ~::~~~:;~::.~ , /-df~\
\'<:;:Tf~ \ ' ..:::.."'~~"'''-:;:.- J ""'i..<-'~/7~
.6
\"l~
I~'
~
,........~
~ r~l
L"!:!
~~........
rji'I~
r ..... ~\
r-v.y- ~~ l ,"'W"'/ r;;~_~ . ."9'/
iiii .G:"A.
'"'-~ ...., ;.7#il. ""'~-
.5 l~"U='\II"''''M\''.''.::M
. . . .:-r:~~:.......................
~~
... ""--
.. ___ -......
\
~:1"l'!':'!'\~4J'\:':#I'\:-':I".I".":~""""
..~
.4
~~/".r
.,
lA..-"",
I~..i
't~
~-.
T __ ~T
'r.,..:::c:;;-.y
y:il..:..,. .4
~r-;.y
~vtiP"
&6-'
1 -~ ... ,-........;:...-,:,,;... :.r,./
~ '"C"~;'+1
~ ~ ~-~'!
,~\
'~/~l~I
~\
iw
l~.l.~ ~~-
.,..-.~.,., ..... ,
_d;=~
b~\~
.3
lr 1-~~'-1 ~1
/
~_ T _.~ ,~
.2
, .-. "~~~
A~"-- ~ ,
~?"- .d.#:::~~~ "","--........... '~
L .-----
~..,., -; no. ..,,'- .~~
1 ..
~... "." ...... ~~p~ --"'~~ ~....'---
~-~ --------- ......... ....... ... .....
.0
__":::::;.;~=:;~;~;':;;:::;..:;:;;~:';i~~:i~~\~i~ZE~i;;LD}iEir~~ i~ifiii[Jj;Ej{&~i~~L~~~i;:~;~;~i~~~~:;,::;.;:::;;;:;~~~~
FIGURE 34. Gplot: a recursive graph showing energy bands for electrons in an idealized
crystal in a magnetic field. ex, representing magnetic field strength, runs vertically from 0 to 1.
Energy runs horizontally. The horizontal line segments are bands of allowed electron energies.
Let us be a little more concrete, now. Let's limit ourselves to only two
kinds of particles: electrons and photons. We'll also have to throw in the
electron's antiparticle, the positron. (Photons are their own antiparticles.)
Imagine first a dull world where a bare electron wishes to propagate from
point A to point B, as Zeno did in my Three-Part Invention. A physicist would
draw a picture like this:
A - - - - - -..._ - - - -........ B
A .. .B
Now as our electron propagates, it may emit and reabsorb one photon after
another, or it may even nest them, as shown below:
A .B
The electron has a right-pointing arrow, while the positron's arrow points
leftwards.
>-t-.,,....--...- -..... B
FIGURE 35. A Feynman diagram showing the propagation of a renormalized electron from
A to B. In this diagram, time increases to the right. Therefore, in the segments where the
electron's arrow points leftwards, it is moving "backwards in time". A more intuitive way to say
this is that an antielectron (positron) is moving forwards in time. Photons are their own
antiparticles; hence their lines have no need of arrows.
Let us now consider Gplot once again. You will remember that in the
Introduction, we spoke of different varieties of canons. Each type of canon
exploited some manner of taking an original theme and copying it by an
isomorphism, or information-preserving transformation. Sometimes the
copies were upside down, sometimes backwards, sometimes shrunken or
expanded ... In Gplot we have all those types of transformation, and
more. The mappings between the full Gplot and the "copies" of itself inside
itself involve size changes, skewings. reflections, and more. And yet there
remains a sort of skeletal identity, which the eye can pick up with a bit of
effort, particularly after it has practiced with INT.
Escher took the idea of an object's parts being copies of the object itself
and made it into a print: his woodcut Fishes and Scales (Fig. 36). Of course
these fishes and scales are the same only when seen on a sufficiently abstract
plane. Now everyone knows that a fish's scales aren't really small copies of
the fish; and a fish's cells aren't small wpies of the fish; however, a fish's
DN A, sitting inside each and everyone of the fish's cells, is a very convo-
It will recur over and over again in this book. We shall come at it from all
sorts of skew angles, and in the end, we shall see how deeply this simple
question is connected with the nature of intelligence.
That this issue arose in the Chapter on recursion is no accident, for
recursion is a domain where "sameness-in-differentness" plays a central
role. Recursion is based on the "same" thing happening on several differ-
FIGURE 38. The branching tree of moves and countermoves at the start of a game of
tic-tac-toe.
Now what is the connection between the recursive processes of this Chap-
ter, and the recursive sets of the preceding Chapter? The answer involves
the notion of a recursively enumerable set. For a set to be r.e. means that it can
be generated from a set of starting points (axioms), by the repeated applica-
tion of rules of inference. Thus, the set grows and grows, each new element
being compounded somehow out of previous elements, in a sort of "math-
ematical snowball". But this is the essence of recursion-something being
defined in terms of simpler versions of itself, instead of explicitly. The
Fibonacci numbers and the Lucas numbers are perfect examples of r.e.
sets-snowballing from two elements by a recursive rule into infinite sets. It
isjust a matter of convention to call an r.e. set whose complement is also r.e.
"recursive" .
Recursive enumeration is a process in which new things emerge from
old things by fixed rules. There seem to be many surprises in such process-
es-for example the unpredictability of the Q-sequence. It might seem that
recursively defined sequences of that type possess some sort of inherently
increasing complexity of behavior, so that the further out you go, the less
predictable they get. This kind of thought carried a little further suggests
that suitably complicated recursive systems might be strong enough to
break out of any predetermined patterns. And isn't this one of the defining
properties of intelligence? Instead of just considering programs composed
of procedures which can recursively call themselves, why not get really
sophisticated, and invent programs which can modify themselves-pro-
grams which can act on programs, extending them, improving them,
generalizing them, fixing them, and so on? This kind of "tangled recur-
sion" probably lies at the heart of intelligence.
Achilles and the Tortoise have just finished a delicious Chinese banquet
for two, at the best Chinese restaurant in town.
J
Achilles: Could I ever forget it?
Tortoise: This was record player B-1. Then it finished, and was slowly
rolled back into its hanging position, so that C-3 could be slid into
position.
Achilles: Now don't tell me that C-3 played another song?
Tortoise: It did just that.
Achilles: Ah, I understand. It played the flip side of the first song, or
another band on the same side.
Tortoise: No, the record has grooves only on one side, and has only a
single band.
, ~.
I
I J
The interval pattern in semitones was;
~ ~r
An Unlikely UFO
We can get some perspective on this issue by considering a strange
hypothetical event. A record of David Oistrakh and Lev Oborin playing
Bach's sonata in F Minor for violin and clavier is sent up in a satellite. From
the satellite it is then launched on a course which will carry it outside of the
solar system, perhaps out of the entire galaxy-just a thin plastic platter
with a hole in the middle, swirling its way through intergalactic space. It has
certainly lost its context. How much meaning does it carry?
If an alien civilization were to encounter it, they would almost certainly
be struck by its shape, and would probably be very interested in it. Thus
immediately its shape, acting as a trigger, has given them some informa-
tion: that it is an artifact, perhaps an information-bearing artifact. This
idea-communicated, or triggered, by the record itself-now creates a new
context in which the record will henceforth be perceived. The next steps in
the decoding might take considerably longer-but that is very hard for us
to assess. We can imagine that if such a record had arrived on earth in
Bach's time, no one would have known what to make of it, and very likely it
would not have gotten deciphered. But that does not diminish our convic-
tion that the information was in principle there; we just know that human
knowledge in those times was not very sophisticated with respect to the
possibilities of storage, transformation, and revelation of information.
"Imaginary Spacescape"
In ~sking about the meaning of a molecule of DNA above, I used the
phrase "compelling inner logic"; and I think this is a key notion. To
illustrate this, let us slightly modify our hypothetical record-into-space
event by substituting John Cage's "Imaginary Landscape no. 4" for the
Bach. This piece is a classic of aleatoric, or chance, music-music whose
structure is chosen by various random processes, rather than by an attempt
to convey a personal emotion. In this case, twenty-four performers attach
themselves to the twenty-four knobs on twelve radios. For the duration of
the piece they twiddle their knobs in aleatoric ways so that each radio
randomly gets louder and softer, switching stations all the while. The total
sound produced is the piece of music. Cage's attitude is expressed in his
own words: "to let sounds be themselves, rather than vehicles for man-
made theories or expressions of human sentiments."
out the same way. That is why the meaning is part of the text itself; it acts
upon intelligence in a predictable way. Generally, we can say: meaning is
part of an object to the extent that it acts upon intelligence in a predictable
way.
In Figure 39 is shown the Rosetta stone, one of the most precious of all
historic discoveries. It was the key to the decipherment of Egyptian hiero-
glyphics, for it contains parallel text in three ancient scripts: hieroglyphics,
demotic characters, and Greek. The inscription on this basalt stele was first
deciphered in 1821 by Jean Fran~ois Champollion, the "father of Egyptol-
ogy"; it is a decree of priests assembled at Memphis in favor of Ptolemy V
Epiphanes.
This outer level is perforce an implicit message, in the sense that the sender
cannot ensure that it will be understood. It would be a vain effort to send
instructions which tell how to decode the outer message, for they would
have to be part of the inner message, which can only be understood once
the decoding mechanism has been found. For this reason, the outer message is
necessarily a set of triggers, rather than a message which can be revealed by a
known decoder.
The formulation of these three "layers" is only a rather crude begin-
ning at analyzing how meaning is contained in messages. There may be
layers and layers of outer and inner messages, rather than just one of each.
Think, for instance, of how intricately tangled are the inner and outer
messages of the Rosetta stone. To decode a message fully, one would have
to reconstruct the entire semantic structure which underlay its creation-
and thus to understand the sender in every deep way. Hence one could
throwaway the inner message, because if one truly understood all the
finesses of the outer message, the inner message would be reconstructible.
The book After Babel, by George Steiner, is a long discussion of the
interaction between inner and outer messages (though he never uses that
terminology). The tone of his book is given by this quote:
We normally use a shorthand beneath which there lies a wealth of subcon-
scious, deliberately concealed or declared associations so extensive and intri-
Thoughts along the same lines are expressed by Leonard B. Meyer, in his
book Music, the Arts, and Ideas:
The way of listening to a composition by Elliott Carter is radically different
from the way of listening appropriate to a work by John Cage. Similarly, a
novel by Beckett must in a significant sense be read differently from one by
Bellow. A painting by Willem de Kooning and one by Andy Warhol require
different perceptional-cognitive attitudes. 2
Perhaps works of art are trying to convey their style more than any-
thing else. In that case, if you could ever plumb a style to its very bottom,
you could dispense with the creations in that style. "Style", "outer message",
"decoding technique"-all ways of expressing the same basic idea.
YrltJfrnlJrn'El'llYJ1UVlvrJUmmVlI'l'ElU fllmlJ
~T~~~~~~ ~I
u
J
u
1tJt1tJl
..
LutJm!tl'El'llf)~!t mGl, mlm Ll~::; mm
~~T~tKT~~
LL~"lW~n 1~m-)VVlfllmlu1Ut1Ul m~ ~Wf)
~tlJ'~T ~ ~ u
rulT~~~ulI.;[email protected]~~'ii/fI~
.J)/~;iJ@;flUJ uL~(J~n~ 9u&:~u UlTtT~,r6 (J~
IT.[f)JW ~tT~lJU'IT(j)iI~8Wd.JfI~ IiiIlQ?W. wmuulT'--.11l
u6IiJr-R ikJ5moYrGYr (Jru6liJr'1-UJ ~iA'Friut;Gfr tf),u
<!i\5 '5li61I"'1I~ i61I"'1I~C1 ~.
(!!jii6)JD6lI. c3~& ~tT~~~~ @6l01riut;
rulT~ ~&Gisr (Jru.[f)JU~'&orr8; 5mLj!9- <!i\5 ~ ~ ~--.
Ii.] Q.fiITGfrru~fo 61J6'Pi~ 6l...~. @~JD ~<I'~~~.
.J)/.!fiI8'rfI~.J~DlJW5jb.[f)J~ITGfr<01J.] ~
LiMtJDlJIT~.JtJYOin j!9.D&orrUJITL...iJM IFWuIi ~UuL.L.J.
~ <l'rncar ~ I
~~~~~<f
~ Ci5c<f ~ ~ -n
~~. -n
~~'i~~
(\l)1(l\)am an1rumsl ~ooml~o ~~~~.
~ ~Q(f C'lf ~ ~
~ <ffiTcar ~
mJSrm m1@flrl]1m ruillJcIJ6lW
Next, one opens the bottle and examines the marks on the paper. Perhaps
they are in Japanese; this can be discovered without any of the inner
message being understood-it merely comes from a recognition of the
characters. The outer message can be stated as an English sentence: "I am
in Japanese." Once this has been discovered, then one can proceed to
the inner message, which may be a call for help, a haiku poem, a lover's
lament ...
It would be of no use to include in the inner message a translation of
the sentence "This message is in Japanese", since it would take someone
who knew Japanese to read it. And before reading it, he would have to
recognize the fact that, as it is in Japanese, he can read it. You might try to
wriggle out of this by including translations of the statement "This message
is in Japanese" into many different languages. That would help in a
practical sense, but in a theoretical sense the same difficulty is there. An
English-speaking person still has to recognize the "Englishness" of the
message; otherwise it does no good. Thus one cannot avoid the problem
that one has to find out how to decipher the inner message from the outside;
the inner message itself may provide clues and confirmations, but those are
at best triggers acting upon the bottle finder (or upon the people whom he
enlists to help).
Similar kinds of problem confront the shortwave radio listener. First,
he has to decide whether the sounds he hears actually constitute a message,
or are just static. The sounds in themselves do not give the answer, not even
in the unlikely case that the inner message is in the listener's own native
language, and is saying, "These sounds actually constitute a message and
are not just static!" If the listener recognizes a frame message in the sounds,
then he tries to identify the language the broadcast is in-and clearly, he is
still on the outside; he accepts triggers from the radio, but they cannot
explicitly tell him the answer.
It is in the nature of outer messages that they are not conveyed in any
FIGURE 40. A collage of scripts. Uppermost on the left is an inscription in the unde-
ciphered boustrophedonic writing system from Easter Island, in which every second line is
upside down. The characters are chiseled on a wooden tablet, 4 inches by 35 inches. Moving
clockwise, we encounter vertically written Mongolian: above, present-day Mongolian, and
below, a document dating from 1314. Then we come to a poem in Bengali lry Rabindranath
Tagore in the bottom righthand corner. Next to it is a newspaper headline in Malayiilam (West
Kerala, southern India), above which is the elegant curvilinear language Tamil (East
Kerala). The smallest entry is part of a folk tale in Buginese (Celebes Island, Indonesia). In the
center if the collage is a paragraph in the Thai language, and above it a manuscript in Runic
datingfrom the fourteenth century, containing a sample if the provincial law of Scania (south
Sweden). Finally, wedged in on the left is a section of the laws of Hammurabi, written in
Assyrian cuneiform. As an outsider, I feel a deep sense of mystery as I wonder how meaning is
cloaked in the strange curves and angles of each of these beautiful aperiodic crystals. In form,
there is content. [From Hans Jensen, Sign, Symbol, and Script (New York: G. Putnam's Sons,
1969), pp. 89 (cuneiform), 356 (Easter Island), 386, 417 (Mongolian), 552 (Runic); from Kenneth
Katzner, The Languages of the World (New York: Funk & Wagnalls, 1975), pp. 190 (Bengali), 237
(Buginese); from I. A. Richards and Christine Gibson, English Through Pictures (New York:
Washington Square Press, 1960), pp. 73 (Tamil), 82 (Thai).]
Earth Chauvinism
This ascribing of meaning to a message comes from the invariance of the
processing of the message by intelligences distributed anywhere in the
universe. In that sense, it bears some resemblance to the ascribing of mass
to an object. To the ancients, it must have seemed that an object's weight
was an intrinsic property of the object. But as gravity became understood, it
was realized that weight varies with the gravitational field the object is
immersed in. Nevertheless, there is a related quantity, the mass, which does
not vary according to the gravitational field; and from this invariance came
the conclusion that an object's mass was an intrinsic property of the object
itself. If it turns out that mass is also variable, according to context, then we
will backtrack and revise our opinion that it is an intrinsic property of an
object. In the same way, we might imagine that there could exist other
Here there is evidence of a rule governing the progression from one line to
the next. In fact, the recursive part of the definition of the Fibonacci
numbers can be inferred, with some confidence, from this list. Suppose we
think of the initial pair of values (1,1) as a "genotype" from which the
"phenotype"-the full Fibonacci sequence-is pulled out by a recursive
rule. By sending the genotype alone-namely the first version of the
plaque-we fail to send the information which allows reconstitution of the
phenotype. Thus, the genotype does not contain the full specification of
-the Lucas sequence. And for every set of two initial values-that is, for
every short genotype-there will be a corresponding phenotype. But the
short genotypes, unlike the long ones, are only triggers-buttons to be
pushed on the jukeboxes into which the recursive rule has been built. The
long genotypes are informative enough that they trigger, in an intelligent
being, the recognition of what kind of ')ukebox" to build. In that sense, the
long genotypes contain the information of the phenotype, whereas the
short genotypes do not. In other words, the long genotype transmits not
only an inner message, but also an outer message, which enables the inner
message to be read. It seems that the clarity of the outer message resides in
the sheer length of the message. This is not unexpected; it parallels pre-
cisely what happens in deciphering ancient texts. Clearly, one's likelihood
of success depends crucially on the amount of text available.
CCGTCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTTCTTATTACCCTTCTGAATGTCACGCTG,
rACGAATACCTTCGGTTCGTAACCCCTAACTCTTTCTCATCTTTACGGTGTTCGGAGTTATCGTCCAAATTCTCGGAGCTATGCGAGTTTCAGTTTTATTA'
~GATGGATAACCGCATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATGTTGACGGCCATAAGGCT,
rACAATAATTATAGTTCAACCCCCTCGTGTAACATCGTAACACGGTTAAGTAGGTAATTGAAGAGTCATTGTCTATGTTTGAGTAGTGCTTGCAGTCTTCG~
~CTATAGACCAGCGCCCCGAAGGGGACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCCCTCTTAA,
rTTTCGGAGATGCGCTATAGAATCACCTCCGGAGGTCGTTAGAACTTGTGAGTAGGAATTATGGAAAGAAAAACCCCATTAATATGAGTAGCGCTTATAGGC
~GCTATTCAGCGTTTGATGAATGCAATGCGACAGGCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGT,
CGTCAGCCGCACACTTAGTAATCGGAACGCTGGGAGCCGTCGTTCTTGGTATGCTGGTTATAGTGCTTTTATCAGTGCGTTTCGTAACCCTAATAGTATTT
CTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGCCGTCTTCATTTCCATGCGGTGCACTTTATGCGGACACTTCCTACAGGTAGCGTTGAC,
,CGCACArCGCTTGACGCTACCCGTATGACATTGGTATTCCGGTGCATAAAACGTTCGATAAATTGACCGCCGCTAACGCATAGGCTGCTGGTTTTAATCC~
AGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTCTTGATGCTAAAGGTGAGCCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAA)
~GAACCCTTCATCGCTGTCGAAGCAAAAATCAGTCAACAAGGTAAGAAATCGAGGATCTGGAAATCGTCGTTCCAGGTATAGACTGAAAAACAATTGCATA
AAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTGTCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTT)
,ACGCGGCGGTTTTGCAGCCGATGTCATTGAAAAGGGTCGGAGTTAGAGTAGAGAGAAAAACGCAAGACGAAGTTATAGACCAACTTGCCGCAGCGCAGCA
ACCTGTGACGACAAAT~'GCTCAAATTTATGCGCGCTTCGATAAAAATGATTGCCGTATCCAACCTGCAGAGTTTTATCGCTTCCATGACGCAGAAGTTA)
CAAGGCGGTCGTCAGGTGAAGCTAAATTAAGCATTTGTrCGTCATCATTAAGGACGAAATAGTTCTATTAAAAAGCTGAGTAGTCTTTATAGGCTrTCACA
~I~~~I8~2~~Ixgl!~~~~g~g~~~gr~1gJII~g~t~~~IgxgglI~~~~g~~~~~~~g~g~axgg1~~
~AAGAGCGTGGATTACTATCTGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTTTCCAGACCGCT,
,CCAGTCATCGTTAGGTTTGAAACAATGAGCAGTCTTTTAGCTTTAGTAGAAGCCAATTTAGGTTTTGCCGTCTTCGGACTTACTCGAATTATCTCCGGTT~
GCTCTCGTGCTCGTCGCTGCGTTGAGGCTTGCGTTTATGGTACGCTGGACTTTGTAGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCGT,
CGCCTGCGAGCTGCGGTAATTATTACAAAAGGCATTTAAGTCGCGGAAGGTACTACTCTGTCCGGCAAACTTACAACTGCCCTACTTGTATTATTCGTTAC~
GTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTACGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTG)
~TCGCGGAAATGCGAACGGAAATCATGGAGCGTTGCCGACGCCTGCTGGTCCCGCTCGCGGTCTTGCAAAAAATGGAAATCTGTAATGTAGTGAGGAAGGC~
CGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGCCCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTA)
CTAGAGCTTCCTCAGCGGTCGCTATTGGCCTCATCAACTTTACCATTATTCTGCTGGTTAGACTGGTCGTTCCTTCGGTTCTACCCTTTCCAGTACGCCGT~
GGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCT4CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTT,
~GTTGTTTTCGCCGTACCAGTTATATTGGTCATCACAATTGTCAGCGCTCTCCTCACCGTAATTGTGGTAGGAAGTACTTGAATTAGGTGACAAGTGGTATC
gx~g~~~gg~~~~~g~~~~~Cg~~~~~~ggg~~~I~~~~g~~I~x~AA~~rIIi~12~~g~g~IgggIg~gx~'
CACTGAGCTTTCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGCATACTGACCAAGAACGTGATT,C
~GTCTCTAATCTCGCGTACTGTTCATTTCCTGCCAACAGTCGCAGTATACTCCAAAATGGAGGTTTACTTCTTTATTGTAGTACCATTGCGACGTACTTCA
GGCATCTGGCTATGATGTTGATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGCCGCGTTTCTTT,
~TTCAGTTTCGTGGAAATCGCAATTCCArGACTTAGAGAAATCAGCGTCATCCGCCTTTTGCTTGTTCGCGTTCTCATTTGTATCACGGTACGAGTCCTTG~
1~tgg~~~rI8cCX2~~~~x~g~g~lIg~~~~~~~2~~gg~ag~~~I~~~~gg~~~IIgg~II~~lg~~g~aa~~~~I'
~GGTGATrtGCAAGAACGCGTACTTATTCGCAACCATGATTATGACCAGTGTTTCAGTCGTTCAGTTGTTGCAGTGGATAGTCTTACCTCATGTGACGTTT,
~ 8x~"Mm~am~agggg~gg~MI~~~xaglgtII1~~#~a~m~t~I1~~rca~xg~~glli2~gMg~g~
~ATTGGCAGTTTGATAGTTTTATATTGCAACTGCTACATCGAAATCCACAGACATTTTGTCCACGGCTTCTTCGACCTCATTGTCTTCACTCTTGGTCGAA'
ATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTGTCAACGCCGCTAATCAGGTTGTTTCAGTTGGTGCTGATATTGCTTTTGATGC,
CTACCGCTGGTAGGTTTCCTArrTGTAGTATCCGTCAGCCCTCCCATCAGCCTTGGCTTCTTCTGAGTTTCGCTTGGTTTGTCCGTTTTTTAAATCCCAGCC
GATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGCCCGGCAATAACGTCTACGTTGGTTTCATGGTTTGGTCTAACT)
~TCGTGGTTTGTATTTAGTGGAGTGAATTCACCG4CCTCTGTTTATTAGAGAAATTATTGG~CTAAGTCGCTTTGGTTAGGCCCCGTAAATCATGGCCATT~
ATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCArGTCTAAATTGTTTGGAr~Cr~TCAAAAAGCCGCCTCCGGTGGCATTCAAGGTGATGTGC,
, rtTGATCCCCGCCGGAGTAGTCCCAATCCTTGTAATCTCGGAACTTACCGTCTAAATTATGGTCG'rAGTGGGTACGGATGTCATAACAATAGCCATCGTTC
TGTTTCTGGTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGr~GGCTGGCACTTCTGCCGTTTCTGATAAGTTGCTTGATTTGGTTGGA,
~GTAGTCGTGGTCGTGCGAGGGTTCGTAATTCGAGTCCnTACGTCGTCGTTCIATTAGTGCTCATAGGAAAGGAAATAGTCGCCGTCTGAACGGTGGTTC"
CTTCCTCTGCTGGTATGGTTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCCAGATGCAAAATGA)
CGAAGACAAGTATTCGTTCGTAGAGTAAAACACGTATATGGACCAGAAAGCATAAGACCGCACTTCAGCGGCTGACTTACCGTCGTTAGAGAAAAACTCAG
GAGTCTACTGCTCGCGTTGCGTCTATTATGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCAAA,
~ATGGCGACTAAGACGCAAACGACTACTTGATTCAGTTGGAGTCGTGATTGGAACGCTCAGTAAAGAAACTAAACCAGTAACCATTTTATGACTGGTCGGC~
TGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTTCTAATGTCGTCACTGATGCrGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCT,
AATAAAGGATCTGTTTAATCTCGGTTATGGTAGTCGAAATGGCAGAAAGGTCTTTAACAAGGTTCATAGCCGTTG~
Chromatic Fantasy, And Feud
Having had a splendid dip in the pond, the Tortoise is just crawling out
and shaking himself dry, when who but Achilles walks by.
< >
p Q R
v :::>
The first rule of this system that I will reveal is the following:
This rule takes two theorems and combines them into one. It should
remind you of the Dialogue.
Well-Formed Strings
There will be several other rules of inference, and they will all be presented
shortly-but fi.rst, it is important to define a subset of all strings, namely the
(1) -x
(2) < xAy>
(3) < xvy>
(4) <x:::>y>
For example, all of the following are well-formed:
P atom
-P by (1)
--P by (1)
Q' atom
-Q' by (1)
<PA-Q'> by (2)
-<PA-Q'> by (1)
<--P:::>Q'> by (4)
<-<PA-Q'>V< --P:::>Q' by (3)
The last one may look quite formidable, but it is built up straightforwardly
from two components-namely the two lines just above it. Each of them is
in turn built up from previous lines ... and so on. Every well-formed string
can in this way be traced back to its elementary constituents-that is, atoms.
You simply run the formation rules backwards until you can no more. This
process is guaranteed to terminat(~, since each formation rule (when run
forwards) is a lengthening rule, so that running it backwards always drives
you towards atoms.
This method of decomposing strings thus serves as a check on the
well-formedness of any string. It is a top-down decision procedure for well-
formedness. You can test your understanding of this decision procedure by
checking which of the following strings are well-formed:
(1) <P>
(2) <-P>
(3) <PAQAR>
(4) <PAQ>
(5) PAQ>A<Q-AP
(6) <PA-P>
(7) Pv<Q:::>RA<-Pv--R'
(8) <PAQ>A<QAP>
DOUBLE-TILDE RULE: The string '--' can be deleted from any theorem. It
can also be inserted into any theorem, provided that the resulting
string is itself well-formed.
Still, you might wonder, where is the real theorem? The real theorem is the
string
<x:::>y>.
Notice the resemblance of this string to the sentence printed above.
To signal the entry into, and emergence from, a fantasy, one uses the
[ push
<PAQ> premise
P separation
Q separation
<QAP> joining
] pop
< <PAQ> ::J<QAP> > fantasy rule
CARRY-OVER RULE: Inside a fantasy, any theorem from the "reality" one
level higher can be brought in and used.
[ push
P premise of outer fantasy
[ push again
Q premise of inner fantasy
P carry-over of P into inner fantasy
<PAQ> joining
] pop out of inner fantasy, regain outer fantasy
<Q:::><PAQ>> fantasy rule
] pop out of outer fantasy, reach real world!
<P:::><Q:::><PAQ> fantasy rule
Note that I've indented the outer fantasy once, and the inner fantasy
twice, to emphasize the nature of these nested "levels of reality". One way
to look at the fantasy rule is to say that an observation made about the
system is inserted into the system. Namely, the theorem < x:::> y> which gets
produced can be thought of as a representation inside the system of the
statement about the system "If x is a theorem, then y is too". To be more
specific, the intended interpretation for <P:::>Q> is "if P, then Q", or
equivalently, "P implies Q".
Incidentally, this rule is often called "Modus Ponens", and the fantasy rule
is often called the "Deduction Theorem".
Now let us look at each of the theorems so far derived, and interpret
them. The first one was <P:::> - -P>. If we keep the same interpretation for
P, we have the following interpretation:
The third theorem was <P:::><Q:::><PI\Q>. This one goes into the
following nested "if-then" sentence:
You probably have noticed that each theorem, when interpreted, says
something absolutely trivial and self-evident. (Sometimes they are so self-
evident that they sound vacuous and-paradoxically enough-confusing
or even wrong!) This may not be very impressive, but just remember that
there are plenty of falsities out there which could have been produced-yet
they weren't. This system-the Propositional Calculus-steps neatly from
truth to truth, carefully avoiding all falsities, just as a person who is
concerned with staying dry will step carefully from one stepping-stone in a
creek to the next, following the layout of stepping-stones no matter how
twisted and tricky it might be. What is impressive is that-in the Proposi-
tional Calculus-the whole thing is done purely typographically. There is
nobody down "in there", thinking about the meaning of the strings. It is all
done mechanically, thoughtlessly, rigidly, even stupidly.
If you are studying it, then you are far from the Way
If you are close to the Way, then you are not studying it.
Once again, the interpreted theorem, though perhaps less than mind-
boggling, is at least true.
Semi-Interpretations
It is natural, when one reads theorems of the Propositional Calculus out
loud, to interpret everything but the atoms. I call this semi-interpreting. For
instance, the semi-interpretation of <Pv-P> would be
P or not P.
Despite the fact that P is not a sentence, the above semisentence still sounds
true, because you can very easily imagine sticking any sentence in for
P-and the form of the semi-interpreted theorem assures you that however
you make your choice, the resulting sentence will be true. And that is the
key idea of the Propositional Calculus: it produces theorems which, when
semi-interpreted, are seen to be "universally true semisentences", by which
is meant that no matter how you complete the interpretation, the final
result will be a true statement.
Ganto's Ax
Now we can do a more advanced exercise, based on a Zen koan called
"Ganto's Ax". Here is how it begins:
One day Tokusan told his student Ganto, "I have two monks who have been
here for many years. Go and examine them." Ganto picked up an ax and
went to the hut where the two monks were meditating. He raised the ax,
saying, "If you say a word I will cut off your heads; and if you do not say a
word, I will also cut off your heads."!
If you say a word I will cut off this koan; and if you do not say a word, I will
also cut off this koan-because I want to translate some of it into our
notation. Let us symbolize "you say a word" by P, and "I will cut off your
heads" by Q. Then Ganto's ax threat is symbolized by the string
P=>Q>I\<-P=>Q. What if this ax threat were an axiom? Here is a
fantasy to answer that ques tion.
(1) [ push
(2) P=>Q>I\<-P=>Q Ganto's axiom
(3) <P=>Q> separation
(4) <-Q=>-P> contra positive
(5) <-P=>Q> separation
(6) <-Q=>--P> contra positive
(7) [ push again
(8) -Q premise
Prudence: We will only KNOW that all theorems come out true under the
intended interpretation if we manage to PROVE it. That is the cautious,
thoughtful way to proceed.
Imprudence: On the contrary. It is OBVIOUS that all theorems will come out
true. If you doubt me, look again at the rules of the system. You will
find that each rule makes a symbol act exactly as the word it represents
ought to be used. For instance, the joining rule makes the symbol '/\' act
as 'and' ought to act; the rule of detachment makes ':::>' act as it ought
to, if it is to stand for 'implies', or 'if-then'; and so on. Unless you are
like the Tortoise, you will recognize in each rule a codification of a
pattern you use in your own thought. So if you trust your own thought
patterns, then you HAVE to believe that all theorems come out true!
That's the way I see it. I don't need any further proof. If you think that
some theorem comes out false, then presumably you think that some
rule must be wrong. Show me which one.
Prudence: I'm not sure that there is any faulty rule, so I can't point one out
to you. Still, I can imagine the following kind of scenario. You, follow-
ing the rules, come up with a theorem-say x. Meanwhile I, also
following the rules, come up with another theorem-it happens to be
- x. Can't you force yourself to conceive of that?
Imprudence: All right; let's suppose it happened. Why would it bother
you? Or let me put it another way. Suppose that in playing with the
MIU-system, I came up with a theorem x, and you came up with xu.
Can you force yourself to conceive of that?
Prudence: Of course-in fact both Ml and MIU are theorems.
Imprudence: Doesn't that bother you?
Prudence: Of course not. Your example is ridiculous, because MI and MIU
are not CONTRADICTORY, whereas two strings x and - x in the Propo-
sitional Calculus ARE contradictory.
(1) push
(2) <PA-P> premise
(3) P separation
(4) -P separation
(5) [ push
(6) -Q premise
(7) P carry-over line 3
(8) --P double-tilde
(9) ] pop
( 10) <-Q::J--P> fantasy
(11) <-P::JQ> contrapositive
(12) Q detachment (Lines 4,11)
(13) ] pop
(14) PA-P>:::JQ> fantasy
<P:::><Q:::>P>>
<P:::><Qv-Q
PA-P>:::>Q>
< <P:::>Q>v<Q:::>P> >
They, and many others like them, all show that there need be no relation-
ship at all between the first and second clauses of an if-then statement for it
to be provable within the Propositional Calculus. In protest, "relevant
implication" puts certain restrictions on the contexts in which the rules of
inference can be applied. Intuitively, it says that "something can only be
derived from something else if they have to do with each other". For
example, line lOin the derivation given above would not be allowed in such
a system, and that would block the derivation of the string
PA-P>:::>Q>.
More radical attempts abandon completely the quest for completeness
or consistency, and try to mimic human reasoning with all its inconsisten-
cies. Such research no longer has as its goal to provide a solid underpinning
for mathematics, but purely to study human thought processes.
Despite its quirks, the Propositional Calculus has some features to
recommend itself. If one embeds it into a larger system (as we will do next
Chapter), and if one is sure that the larger system contains no contradic-
tions (and we will be), then the Propositional Calculus does all that one
could hope: it provides valid propositional inferences-all that can be
made. So if ever an incompleteness or an inconsistency is uncovered, one
can be sure that it will be the fault of the larger system, and not of its
subsystem which is the Propositional Calculus.
Crab Canon
Crab: Hallo! Hulloo! What's up? What's new? You see this bump, this
lump? Given to me by a grump. Ho! And on such a fine day. You see, I
was just idly loafing about the park when up lumbers this giant fellow
from Warsaw-a colossal b~ar of a man-playing a lute. He was three
meters tall, if I'm a day. I mosey on up to the chap, reach skyward and
manage to tap him on the knee, saying, "Pardon me, sir, but you are
Pole-luting our park with your mazurkas." But wow! he had no sense
of humor-not a bit, not a wit--and pow!-he lets loose and belts me
one, smack in the eye! Were it in my nature, I would crab up a storm,
but in the time-honored tradition of my species, I backed off. After all,
when we walk forwards, we move backwards. It's in our genes, you
know, turning round and round. That reminds me-I've always
wondered, "Which came first--the Crab, or the Gene?" That
is to say, "Which came last--the Gene, or the Crab?" I'm always
turning things round and round, you know. It's in our genes, after
all. When we walk backwards, we move forwards. Ah me, oh my!
I must lope along on my merry way-so off I go on such a fine day.
Sing "ho!" for the life of a Crab! TATA! jOle!
Tortoise: That's my good friend. He often plays the fool. But I myself
wouldn't touch a ten-foot Pole with a guitar!
Achilles: Say, don't you play the guitar?
Tortoise: Fiddle. It makes a big difference, you know.
Achilles: Oh, well, it's all the same to me.
Tortoise: To be precise, one has no frets.
Achilles: Tell me, what's it like to be your age? Is it true that one has no
worries at ail?
Tortoise: I don't know. But one thing for certain is that I don't worry about
arguments of taste. Disputandum non est de gustibus.
Achilles: I disagree, in this case. But speaking of taste, I finally heard that
Crab Canon by your favorite composer, J. S. Bach, in a concert the
other day, and I fully appreciate the beauty and ingenuity with which
he made one single theme mesh with itself going both backwards and
forwards. But I'm afraid I will always feel Escher is superior to Bach.
Tortoise: Oh, you are such a philistine. In this area, the Dutch contribu-
tions are of markedly inferior taste, don't you think?
Achilles: Not at all. Here, care for one of my cigars?
Tortoise: Thank you very much.
Achilles: Incidentally, you're looking in very fine fettle these days, I must
say.
01 L-I-- ~ ~ ~
- -....., ..- '-
0 I 0
,..0 ~ v_ u_
- - ""--. --- - '-"- .- .
FIGURE 44. Crab Canon from the Musical Offering, by J. S. Bach. [Music printed by Donald Byrd's program "SMUT".]
Tortoise: Oh, really? I guess there's nothing better for you than walking.
Achilles: And it's a perfect day for a walk. I think I'll be walking home
soon.
Tortoise: That echoes my thoughts.
Achilles: So nice to run into you.
Tortoise: Why, same to you.
Achilles: Good day, Mr. T.
(1) 5 is prime.
(2) 2 is not a square.
(3) 1729 is a sum of two cubes.
(4) No sum of two positive cubes is itself a cube.
(5) There are infinitely many prime numbers.
(6) 6 is even.
This analysis has gotten us a long ways towards the basic elements of the
language of number theory. It is clear that a few phrases reappear over and
over:
Numerals
We will not have a distinct symbol for each natural number. Instead, we will
have a very simple, uniform way of giving a compound symbol to each
natural number-very much as we did in the pq-system. Here is our
notation for natural numbers:
e
d'
e"
b'l'
a' I"
(b+e)
(b 'e)
The next notion we'll symbolize is equals. That is very simple: we use
'='. The advantage of taking over the standard symbol used in
N-nonformal number theory-is obvious: easy legibility. The disadvan-
tage is very much like the disadvantage of using the words "point" and
"line" in a formal treatment of geometry: unless one is very conscious and
careful, one may blur the distinction between the familiar meaning and the
strictly rule-governed behavior of the formal symbol. In discussing
geometry, I distinguished between the everyday word and the formal term
by capitalizing the formal term: thus, in elliptical geometry, a POINT was the
union of two ordinary points. Here, there is no such distinction; hence,
mental effort is needed not to confuse a symbol with all of the associations it
is laden with. As I said earlier, with reference to the pq-system: the string
--- is not the number 3, but it acts isomorphically to 3, at least in the
context of additions. Similar remarks go for the string SSSO.
The first of these strings is an atom; the rest are compound formulas.
(Warning: The 'and' in the phrase "I and 1 make 2" is just another word
for 'plus', and must be represented by '+' (and the requisite parentheses).)
(b+SO)=SSO
Clearly this is true. In the second instance, you get the sentence
Clearly this is false. We now introduce symbols for both of these quantifiers.
These sentences are translated into TNT-notation as follows:
(bb)=SSO (open)
-3b:(b'b)=SSO (closed; a sentence of TNT)
The first one expresses a property which might be possessed by some natural
number. Of course, no natural number has that property. And that is
precisely what is expressed by the second one. It is very crucial to under-
stand this difference between a string with afree variable, which expresses a
property, and a string where the variable is quantified, which expresses a truth
or falsity. The English translation of a formula with at least one free
variable-an open formula-is called a predicate. It is a sentence without a
subject (or a sentence whose subject is an out-of-context pronoun). For
instance,
"is a sentence without a subject"
"would be an anomaly"
"runs backwards and forwards simultaneously"
"improvised a six-part fugue on demand"
are nonarithmetical predicates. They express properties which specific en-
tities might or might not possess. One could as well stick on a "dummy
(SO+SO)=b
is like saying "I plus 1 equals so-and-so". This is a predicate in the variable
b. It expresses a property which the number b might have. If one were to
substitute various numerals for b, one would get a succession of formulas,
most of which would express falsehoods. Here is another example of the
difference between open formulas and sentences:
Vb:Vc:(b+c)=(c+b)
Vc:(b+c)=(c+b)
alone. This string's interpretation is of course neither true nor false; it just
expresses a property which the number e might have.
It is curious that, since we know multiplication is commutative, we
might easily have written
3e:(e 'SSO)=SSSSSSO
Now these three translations of "6 is even" are quite different strings, and it
is by no means obvious that theoremhood of anyone of them is tied to
theoremhood of any of the others. (Similarly, the fact that --p -q --- was
a theorem had very little to do with the fact that its "equivalent" string
-p--q--- was a theorem. The equivalence lies in our minds, since, as
humans, we almost automatically think about interpretations, not struc-
tural properties of formulas.)
We can dispense with sentence 2: "2 is not a square", almost im-
mediately:
- 3b:(b . b) =SSO
Vb:-(b b) =SSO
The first way says, "It is not the case that there exists a number b with the
property that b's square is 2", while the second way says, "For all numbers
b, it is not the case that b's square is 2." Once again, to us, they are
conceptually equivalent-but to TNT, they are distinct strings.
Let us proceed to sentence 3: "1729 is a sum of two cubes." This one
will involve two existential quantifiers, one after the other, as follows:
1729 of them
There are alternatives galore. Reverse the order of the quantifiers; switch
the sides of the equation; change the variables to d and e; reverse the
addition; write the multiplications differently; etc., etc. However, I prefer
the following two translations of the sentence:
3b:3c:(((SSSSSSSSSSOSSSSSSSSSSO) . SSSSSSSSSSO) +
((SSSSSSSSSO SSSSSSSSSO) . SSSSSSSSSO))=(((b . b) b)+((c c) c))
and
3b:3c:( ((SSSSSSSSSSSSO SSSSSSSSSSSSO) . SSSSSSSSSSSSO) +
((SO SO) SO)) =(((b b) . b) +(( c c) c))
You see, we are cubing not band e, but their successors, which must be
positive, since the smallest value which either b or e can take on is zero.
Hence the right-hand side represents a sum of two positive cubes. Inciden-
tally, notice that the phrase "there exist numbers band e such that ... ",
when translated, does not involve the symbol '1\' which stands for 'and'.
That symbol is used for connecting entire well-formed strings, not for
joining two quantifiers.
Now that we have translated "7 is a sum of two positive cubes", we wish
to negate it. That simply involves prefixing the whole thing by a single tilde.
(Note: you should not negate each quantifier, even though the desired
phrase runs "There do not exist numbers band e such that ... ".) Thus we
get:
Now our original goal was to assert this property not of the number 7, but
of all cubes. Therefore, let us replace the numeral SSSSSSSO by the string
((a a) a), which is the translation of "a cubed":
In austere TNT, we could use a' instead of b, and a" instead of e, and the
formula would become:
-3b:3e:SSSSSO=(SSbSSe)
Without the initial tilde, it would be an assertion that two natural numbers
do exist, which, when augmented by 2, have a product equal t,o 5. With the
tilde in front, that whole statement is denied, resulting in an assertion that 5
IS pnme.
If we wanted to assert that d plus e plus 1, rather than 5, is prime, the
most economical way would be to replace the numeral for 5 by the string
(d+Se):
Well, all we have left to do now is to assert that this property actually
obtains, no matter what d is. The way to do that is to universally quantify
over the variable d:
Vd:3e:-3b:3e:(d+Se)=(SSbSSe)
-Ve:3b:(SSOb)=e
Ve:-3b:(SSOb)=e
(Second hint: Either four of them are true and two false, or four false and
two true.)
NUMERALS.
o is a numeral.
A numeral preceded by S is also a numeral.
Examples: 0 SO SSO SSSO SSSSO SSSSSO
The above rules tell how to make parts of well-formed formulas; the
remaining rules tell how to make complete well-formed formulas.
ATOMS.
If sand t are terms, then s = t is an atom.
Examples: SO=O (SSO+SSO)=SSSSO S(b+e)=((ed)e)
If an atom contains a variable u, then u is free in it. Thus there are
four free variables in the last example.
NEGATIONS.
A well-formed formula preceded by a tilde is well-formed.
Examples: -SO=O -3b:(b+b)=SO -<O=O~SO=O> -b=SO
The quantification status of a variable (which says whether the variable is
free or quantified) does not change under negation.
COMPOUNDS.
If x and yare well-formed formulas, and provided that no variable
which is free in one is quantified in the other, then the following
are all well-formed formulas:
<xl\y>, <xvy>, <x~y>.
Examples:<0=01\-0=0> <b=bv-3e:e=b>
<SO=0~Ve:-3b:(b+b)=e>
The quantification status of a variable doesn't change here.
QUANTIFICATIONS.
If u is a variable, and x is a well-formed formula in which u is free,
then the following strings are well-formed formulas:
3u: x and Vu: x.
Examples: Vb:<b=bv-3e:e=b> Ve:-3b:(b+b)=e -3e:Se=d
OPEN FORMULAS contain at least one free variable.
Examples: -e=e b=b <Vb:b=bl\-e=e>
CLOSED FORMULAS (SENTENCES) contain no free variables.
Examples: SO=O -Vd:d=O 3e:<Vb:b=bA-e=e>
The last one you may find a little tricky. But it is nothing, compared to this
one:
b is a power of 10.
Strangely, this one takes great cleverness to render in our notation. I would
caution you to try it only if you are willing to spend hours and hours on
it-and if you know quite a bit of number theory!
A Nontypographical System
This concludes the exposition of the notation of TNT; however, we are still
left with the problem of making TNT into the ambitious system which we
have described. Success would justify the interpretations which we have
given to the various symbols. Until we have done that, however, these
particular interpretations are no more justified than the "horse-apple-
happy" interpretations were for the pq-system's symbols.
Someone might suggest the following way of constructing TNT: {1) Do
not have any rules of inference; they are unnecessary, because (2) We take
as axioms all true statements of number theory (as written in TNT-
notation). What a simple prescription! Unfortunately it is as empty as one's
instantaneous reaction says it is. Part (2) is, of course, not a typographical
description of strings. The whole purpose of TNT is to figure out if and
how it is possible to-- characterize the true strings typographically.
Thus we will follow a more difficult route than the suggestion above; we
will have axioms and rules of inference. Firstly, as was promised, all of the
rules of the Propositional Calculus are taken over into TNT. Therefore, one
theorem of TNT will be this one:
<so=Ov-so=o>
AXIOM 1: Va:-Sa=O
AXIOM 2: Va:(a+O)=a
AXIOM 3: Va:Vb:(a+Sb)=S(a+b)
AXIOM 4: Va:(a'O)=O
AXIOM 5: Va:\fb:(a'Sb)=((a'b)+a)
(In the austere versions, use a' instead of b.) All of them are very simple to
understand. Axiom 1 states a special fact about the number 0; Axioms 2
and 3 are concerned with the nature of addition; Axioms 4 and 5 are
concerned with the nature of multiplication, and in particular with its
relation to addition.
( 1) Genie is a djinn.
(2) Every djinn has a meta (which is also a djinn).
(3) Genie is not the meta of any djinn.
(4) Different djinns have different metas.
(5) If Genie has X, and each djinn relays X to its meta, then all
djinns get X.
In light of the lamps of the Little Harmonic Labyrinth, we should name the set
of all djinns "GOD". This harks back to a celebrated statement by the
German mathematician and logician Leopold Kronecker, archenemy of
Georg Cantor: "God made the natural numbers; all the rest is the work of
man."
Va:-5a=0 axiom
-50=0 specification
Notice that the rule of specification will allow some formulas which contain
free variables (i.e., open formulas) to become theorems. For example, the
following strings could also be derived from Axiom 1, by specification:
-5a=0
-5(c+550)=0
Vc:-S(c+SSO)=O
The need for restrictions on these two rules will shortly be demonstrated
explicitly. Incidentally, this generalization is the same generalization as was
mentioned in Chapter II. in Euclid's proof about the infinitude of primes.
Already we can see how the symbol-manipulating rules are starting to
approximate the kind of reasoning which a mathematician uses.
Va:-Sa=O axiom 1
-3a:Sa=O interchange
By the way, you might notice that both these strings are perfectly natural
renditions, in TNT, of the sentence "Zero is not the successor of any
natural number". Therefore it is good that they can be turned into each
other with ease.
The next rule is. if anything. even more intuitive. It corresponds to the
very simple kind of inference we make when we go from "2 is prime" to
"There exists a prime". The name of this rule is self-explanatory:
You might now try to shunt symbols, according to rules so far given, to
produce the theorem -Vb:3a:Sa=b.
RULES OF EQUALITY:
* * * * *
(1) Va:Vb:(a'Sb)=((a'b)+a) axiom 5
(2) Vb:(SO'Sb)=((SO'b)+SO) specification (SO for a)
(3) (SOSO)=((SOO)+SO) specification (0 for b)
(4) Va:Vb:(a+Sb)=S(a+b) axiom 3
(5) Vb:((SO'O)+Sb)=S((SO'O)+b) specification ((SO' 0) for a)
(6) ((SO' O)+SO)=S((SO 0) +0) specification (0 for b)
(7) Va:(a+O)=a axiom 2
(8) ((SOO)+O)=(SOO) specification ((SO.O) for a)
(9) Va:(a'O)==O axiom 4
(10) (SO'O)=O specification (SO for a)
(11) ((SO'O)+O)=O transitivity (lines 8,10)
(12) S((SO'O)+O)=SO add S
(13) ((SO'O)+SO)=SO transitivity (lines 6,12)
(14) (SO'SO)==SO transitivity (lines 3,13)
I gave this mini-exercise to point out one simple fact: that one should not
jump too fast in manipulating symbols (such as '=') which are familiar. One
must follow the rules, and not one's knowledge of the passive meanings of
the symbols. Of course, this latter type of knowledge is invaluable in
guiding the route of a derivation.
(1) [ push
(2) a=O premise
(3) Va:a=O generalization (Wrong!)
(4) Sa=O specification
(5) ] pop
(6) <a=O~Sa=O> fantasy rule
(7) Va:<a=O~Sa=O> generalization
(8) <O=O~SO=O> specification
(9) 0=0 previous theorem
(0) SO=O detachment (lines 9,8)
This is the first disaster. The other one is via faulty specification.
As a matter of fact, each of the theorems in this family can be derived from
the one directly above it, in only a couple of lines. Thus it is a sort of
"cascade" of theorems, each one triggering the next. (These theorems are
very reminiscent of the pq-theorems, where the middle and right-hand
groups of hyphens grew simultaneously.)
Now there is one string which we can easily write down, and which
summarizes the passive meaning of them all, taken together. That univer-
sally quantified summarizing string is this:
Va:(O+a)=a
Yet with the rules so far given, this string eludes production. Try to
produce it yourself if you don't believe me.
You may think that we should immediately remedy the situation with
the following
(PROPOSED) RULE OFALL: If all the strings in a pyramidal family are theo-
rems, then so is the universally quantified string which summarizes
them.
The problem with this rule is that it cannot be used in the M-mode. Only
people who are thinking about the system can ever know that an infinite set
of strings are all theorems. Thus this is not a rule that can be stuck inside
any formal system.
-Va:(O+a) =a
-is also a nontheorem of TNT. This means that the original string is
undecidable within the system. If one or the other were a theorem, then we
would say that it was decidable. Although it may sound like a mystical term,
there is nothing mystical about undecidability within a given system. It is
only a sign that the system could be extended. For example, within absolute
geometry, Euclid's fifth postulate is undecidable. It has to be added as an
extra postulate of geometry, to yield Euclidean geometry; or conversely, its
negation can be added, to yield non-Euclidean geometry. If you think back
to geometry, you will remember why this curious thing happens. It is
because the four postulates of absolute geometry simply do not pin down
the meanings of the terms "point" and "line", and there is room for different
extensions of the notions. The points and lines of Euclidean geometry
provide one kind of extension of the notions of "point" and "line"; the
POINTS and LINES of non-Euclidean geometry, another. However, using
the pre-flavored words "point" and "line" tended, for two millennia, to
make people believe that those words were necessarily univalent, capable of
only one meaning.
Non-Euclidean TNT
We are now faced with a similar situation, involving TNT. We have
adopted a notation which prejudices us in certain ways. For instance, usage
of the symbol '+' tends to make us think that every theorem with a plus sign
in it ought to say something known and familiar and "sensible" about the
known and familiar operation we call "addition". Therefore it would run
against the grain to propose adding the following "sixth axiom":
-Va:(O+a)=a
Vb:(O+b)=b
A Long Derivation
Now I wish to present one longer derivation in TNT, so that you can see
what one is like, and also because it proves a significant, if simple, fact of
number theory.
* * * * *
(19) (d+SO)=S(d+O) specification
(line 2)
(20) Va:(a+O)=a axiom 1
(21) (d+O)=d specification
(22) S(d+O)=Sd add S
(23) (d+SO)=Sd transitivity
(lines 19,22)
(24) (Sd+O)=Sd specification
(line 20)
(25) Sd=(Sd+O) symmetry
* * * * *
(56) Vd:Vc:(c+d)=(d+c) induction
(lines 49,55)
[Therefore, every d commutes with every c.]
Hilbert's Program
The final question which we will take up in this Chapter is whether we
should have as much faith in the consistency of TNT as we did in the
consistency of the Propositional Calculus; and, if we don't, whether it is
possible to increase our faith in TNT, by proving it to be consistent. One
could make the same opening statement on the "obviousness" of TNT's
consistency as Imprudence did in regard to the Propositional Calculus-
namely, that each rule embodies a reasoning principle which we fully
believe in, and therefore to question the consistency of TNT is to question
our own sanity. To some extent, this argument still carries weight-but not
quite so much weight as before. There are just too many rules of inference,
and some of them just might be slightly "off". Furthermore, how do we
know that this mental model we have of some abstract entities called
"natural numbers" is actually a coherent construct? Perhaps our own
thought processes, those informal processes which we have tried to capture
in the formal rules of the system, are themselves inconsistent! It is of course
not the kind of thing we expect, but it gets more and more conceivable that
our thoughts might lead us astray, the more complex the subject matter
gets-and natural numbers are by no means a trivial subject matter. So
Prudence's cry for a proof of consistency has to be taken more seriously in
this case. It's not that we seriously doubt that TNT could be inconsistent-
but there is a little doubt, a flicker, a glimmer of a doubt in our minds, and a
proof would help to dispel that doubt.
But what means of proof would we like to see used? Once again, we are
faced with the recurrent question of circularity. If we use all the same
equipment in a proof about our system as we have inserted into it, what will
we have accomplished? If we could manage to convince ourselves of the
consistency of TNT, but by using a weaker system of reasoning than TNT,
we will have beaten the circularity objection! Think of the way a heavy rope
is passed between ships (or so I read when I was a kid): first a light arrow is
fired across the gap, pulling behind it a thin rope. Once a connection has
been established between the two ships this way, then the heavy rope can be
pulled across the gap. If we can use a "light" system to show that a "heavy"
system is consistent, then we shall have really accomplished something.
Now on first sight one might think there is a thin rope. Our goal is to
prove that TNT has a certain typographical property (consistency): that no
theorems of the form x and - x ever occur. This is similar to trying to show
that MU is not a theorem of the MIU-system. Both are statements about
typographical properties of symbol-manipulation systems. The visions of a
thin rope are based on the presumption thatfacts about number theory won't be
The Tortoise and Achilles have just been to hear a lecture on the origins of
the Genetic Code, and are now drinking some tea at Achilles' home.
A Mu Offering 231
whole Oriental mysticism trip, with the I Ching, gurus, and whatnot. So
one day I'm thinking to myself, "Why not Zen too?" And that's how it
all began.
Tortoise: Oh, splendid. Then perhaps I can finally become enlightened.
Achilles: Whoa, now. Enlightenment is not the first step on the road to
Zen; if anything, it's the last one! Enlightenment is not for novices like
you, Mr. T!
Tortoise: I see we have had a misunderstanding. By "enlightenment", I
hardly meant something so weighty as is meant in Zen. All I meant is
that I can perhaps become enlightened as to what Zen is all about.
Achilles: For Pete's sake, why didn't you say so? Well, I'd be only too happy
to tell you what I know of Zen. Perhaps you might even be tempted to
become a student of it, like me.
Tortoise: Well, nothing's impossible.
Achilles: You could study with me under my master, Okanisama-the
seventh patriarch.
Tortoise: Now what in the world does that mean?
Achilles: You have to know the hi!'otory of Zen to understand that.
Tortoise: Would you tell me a little of the history of Zen, then?
Achilles: An excellent idea. Zen is a kind of Buddhism which was founded
by a monk named Bodhidharma, who left India and went to China
around the sixth century. Bodhidharma was the first patriarch. The
sixth one was Eno. (I've finally got it straight now!)
Tortoise: The sixth patriarch was Zeno, eh? I find it strange that he, of all
people, would get mixed up in this business.
Achilles: I daresay you underestimate the value of Zen. Listen just a little
more, and maybe you'll come to appreciate it. As I was saying, about
five hundred years later, Zen was brought to Japan, and it took hold
very well there. Since that time it has been one of the principal reli-
gions in Japan.
Tortoise: Who is this Okanisama, the "seventh patriarch"?
Achilles: He is my master, and his teachings descend directly from those of
the sixth patriarch. He has taught me that reality is one, immutable,
and unchanging; all plurality, change, and motion are mere illusions
of the senses.
Tortoise: Sure enough, that's Zeno, a mile away. But however did he come
to be tangled up in Zen? Poor fellow!
Achilles: Whaaat? I wouldn't put it that way. If ANYONE is tangled up, it's
... But that's another matter. Anyway, I don't know the answer to
your question. Instead, let me tell you something of the teachings of
my master. I have learned that in Zen, one seeks enlightenment, or
SATORI-the state of "No-mind". In this state, one does not think about
the world-one just IS. I have also learned that a student of Zen is not
supposed to "attach" to any object or thought or person-which is to
say, he must not believe in, or depend on, any absolute-not even this
philosophy of nonattachment.
232 A M u Offering
Tortoise: Hmm ... Now THERE'S something I could like about Zen.
Achilles: I had a hunch you'd get attached to it.
Tortoise: But tell me: if Zen rejects intellectual activity, does it make sense
to intellectualize about Zen, to study it rigorously?
Achilles: That matter has troubled me quite a bit. But I think I have finally
worked out an answer. It seems to me that you may begin approaching
Zen through any path you know-even if it is completely antithetical to
Zen. As you approach it, you gradually learn to stray from that path.
The more you stray from the path, the closer you get to Zen.
Tortoise: Oh, it all begins to sound so clear now.
Achilles: My favorite path to Zen is through the short, fascinating, and
weird Zen parables called "koans".
Tortoise: What is a koan?
Achilles: A koan is a story about Zen masters and their students. Some-
times it is like a riddle; other times like a fable; and other times like
nothing you've ever heard before.
Tortoise: Sounds rather intriguing. Would you say that to read and enjoy
koans is to practice Zen?
Achilles: I doubt it. However, in my opinion, a delight in koans comes a
million times closer to real Zen than reading volume after volume
about Zen, written in heavy philosophical jargon.
Tortoise: I would like to hear a koan or two.
Achilles: And I would like to tell you one-or a few. Perhaps I should
begin with the most famous one of all. Many centuries ago, there was a
Zen master named Joshii, who lived to be 119 years old.
Tortoise: A mere youngster!
Achilles: By your standards, yes. Now one day while Joshii and another
monk were standing together in the monastery, a dog wandered by.
The monk asked Joshii, "Does a dog have Buddha-nature, or not?"
Tortoise: Whatever that is. So tell me-what did Joshii reply?
Achilles: 'MU'.
Tortoise: 'MU'? What is this 'MU'? What about the dog? What about
Buddha-nature? What's the answer?
Achilles: Oh, but 'MU' is Joshii's answer. By saying 'MU', Joshii let the
other monk know that only by not asking such questions can one know
the answer to them.
Tortoise: Joshii "unasked" the question.
Achilles: Exactly!
Tortoise: 'MU' sounds like a handy thing to have around. I'd like to unask
a question or two, sometimes. I guess I'm beginning to get the hang of
Zen. Do you know any other koans, Achilles? I would like to hear some
more.
Achilles: My pleasure. I can tell you a pair of koans which go together.
Only ...
Tortoise: What's the matter?
A Mu Offering 233
Achilles: Well, there is one problem. Although both are widely told koans,
my master has cautioned me that only one of them is genuine. And
what is more, he does not know which one is genuine, and which one is
a fraud.
Tortoise: Crazy! Why don't you tell them both to me and we can speculate
to our hearts' content!
Achilles: All right. One of the alleged koans goes like this:
A monk asked Baso: "What is Buddha?"
Baso said: "This mind is Buddha."
Tortoise: Hmm ... "This mind is Buddha"? Sometimes I don't quite
understand what these Zen people are getting at.
Achilles: You might prefer the other alleged koan then.
Tortoise: How does it run?
Achilles: Like this:
A monk asked Baso: "What is Buddha?"
Baso said: "This mind is not Buddha."
Tortoise: My, my! If my shell isn't green and not green! I like that!
Achilles: Now, Mr. T -you're not supposed to just "like" koans.
Tortoise: Very well, then-I don't like it.
Achilles: That's better. Now as I was saying, my master believes only one of
the two is genuine.
Tortoise: I can't imagine what led him to such a belief. But anyway, I
suppose it's all academic, since there's no way to know if a koan is
genuine or phony.
Achilles: Oh, but there you are mistaken. My master has shown us how to
do it.
Tortoise: Is that so? A decision procedure for genuineness of koans? I
should very much like to hear ahout THAT.
Achilles: It is a fairly complex ritual, involving two stages. In the first stage,
you must TRANSLATE the koan in question into a piece of string, folded
all around in three dimensions.
Tortoise: That's a curious thing to do. And what is the second stage?
Achilles: Oh, that's easy-all you need to do is determine whether the
string has Buddha-nature, or not! If it does, then the koan is
genuine-if not, the koan is a fraud.
Tortoise: Hmm ... It sounds as if all you've done is transfer the need for a
decision procedure to another domain. Now it's a decision procedure
for Buddha-nature that you need. What next? After all, if you can't
even tell whether a DOG has Buddha-nature or not, how can you expect
to do so for every possible folded string?
Achilles: Well, my master explained to me that shifting between domains
can help. It's like switching your point of view. Things sometimes look
complicated from one angle, but simple from another. He gave the
example of an orchard, in which from one direction no order is
234 A M u Offering
FIGURE 45. La Mezquita, by M. C. Escher (bln,ck and white chalk, 1936).
A M u Offering 235
look like (picks up a nearby napkin, and draws for the Tortoise these four
figures):
oococo
Tortoise: They are mysterious-looking.
Achilles: Only to the uninitiated. Now once you have made the messenger,
you rub your hands in some ribo, and-
Tortoise: Some ribo? Is that a kind of ritual anointment?
Achilles: Not exactly. It is a special sticky preparation which makes the
string hold its shape, when folded up.
Tortoise: What is it made of?
Achilles: I don't know, exactly. But it feels sort of gluey, and it works
exceedingly well. Anyway, once you have some ribo on your hands,
you can TRANSLATE the sequence of symbols in the messenger into
certain kinds of folds in the string. It's as simple as that.
Tortoise: Hold on! Not so fast! How do you do that?
Achilles: You begin with the string entirely straight. Then you go to one
end and start making folds of various types, according to the geometric
symbols in the messenger. I
236 A M u Offering
Tortoise: Evidently not. What is the origin of the Geometric Code?
Achilles: It came from an ancient master known as "Great Tutor" who my
master says is the only one ever to attain the Enlightenment 'Yond
Enlightenment.
Tortoise: Good gravy! As if one level of the stuff weren't enough. But then
there are gluttons of every sort-why not gluttons for enlightenment?
Achilles: Do you suppose that "Enlightenment 'Yond Enlightenment"
stands for "EYE"?
Tortoise: In my opinion, it's rather doubtful that it stands for you, Achilles.
More likely, it stands for "Meta-Enlightenment"-"ME", that is.
Achilles: For you? Why would it stand for you? You haven't even reached
the FIRST stage of enlightenment, let alone the-
Tortoise: You never know, Achilles. Perhaps those who have learned the
lowdown on enlightenment return to their state before enlightenment.
I've always held that "twice enlightened is unenlightened." But let's get
back to the Grand Tortue-uh, I mean the Great Tutor.
Achilles: Little is known of him, except that he also invented the Art of Zen
Strings.
Tortoise: What is that?
Achilles: It is an art on which the decision procedure for Buddha-nature is
based. I shall tell you about it.
Tortoise: I would be fascinated. There is so much for novices like me to
absorb!
Achilles: There is even reputed to be a koan which tells how the Art of Zen
Strings began. But unfortunately, all this has long since been lost in the
sands of time, and is no doubt gone forever. Which may be just as well,
for otherwise there would be imitators who would take on the master's
name, and copy him in other ways.
Tortoise: But wouldn't it be a good thing if all students of Zen copied that
most enlightened master of all, the Great Tutor?
Achilles: Let me tell you a koan about an imitator.
Zen master Gutei raised his finger whenever he was asked a question
about Zen. A young novice began to imitate him in this way. When Gutei
was told about the novice's imitation, he sent for him and asked him if it
were true. The novice admitted it was so. Cutei asked him if he under-
stood. In reply the novice held up his index finger. Gutei promptly cut it
off. The novice ran from the room, howling in pain. As he reached the
threshold, Cutei called, "Boy!" When the novice turned, Cutei raised his
index finger. At that instant the novice was enlightened.
Tortoise: Well, what do you know! Just when I thought Zen was all about
Joshu and his shenanigans, now I find out that Gutei is in on the
merriment too. He seems to have quite a sense of humor.
Achilles: That koan is very serious. I don't know how you got the idea that
it is humorous.
Tortoise: Perhaps Zen is instructive because it is humorous. I would guess
A Mu Offering 237
that if you took all such stories entirely seriously, you would miss the
point as often as you would get it.
Achilles: Maybe there's something to your Tortoise-Zen.
Tortoise: Can you answer just one question for me? I would like to know
this: Why did Bodhidharma come from India into China?
Achilles: Oho! Shall I tell you whatJoshii said when he was asked that very
question?
Tortoise: Please do.
Achilles: He replied, "That oak tree in the garden."
Tortoise: Of course; that's just what I would have said. Except that I would
have said it in answer to a different question-namely, "Where can I
find some shade from the midday sun?"
Achilles: Without knowing it, you have inadvertently hit upon one of the
basic questions of all Zen. That question, innocent though it sounds,
actually means, "What is the basic principle of Zen?"
Tortoise: How extraordinary. I hadn't the slightest idea that the central
aim of Zen was to find some shade.
Achilles: Oh, no-you've misunderstood me entirely. I wasn't referring to
THAT question. I meant your question about why Bodhidharma came
from India into China.
Tortoise: I see. Well, I had no idea that I was getting into such deep waters.
But let's come back to this curious mapping. I gather that any koan can
be turned into a folded string by following the method you outlined.
Now what about the reverse process? Can any folded string be read in
such a way as to yield a koan?
Achilles: Well, in a way. However ...
Tortoise: What's wrong?
Achilles: You're just not supposed to do it that way 'round. It would violate
the Central Dogma of Zen strings, you see, which is contained in this
picture (picks up a napkin and draws):
koan ~ messenger ~ folded string
transcription translation
238 A Mu Offering
Tortoise: So tell me, what happens when you go against the arrows in the
Central Dogma? Does that mean you begin with a string and make a
koan?
Achilles: Sometimes-but some weirder things can happen.
Tortoise: Weirder than producing koans?
Achilles: Yes ... When you untranslate and untranscribe, you get SOME-
THING, but not always a koan. Some strings, when read out loud this
way, only give nonsense.
Tortoise: Isn't that just another name for koans?
Achilles: You clearly don't have the true spirit of Zen yet.
Tortoise: Do you always get stories, at least?
Achilles: Not always-sometimes you get nonsense syllables, other times
you get ungrammatical sentences. But once in a while you get what
seems to be a koan. .
Tortoise: It only SEEMS to be one?
Achilles: Well, it might be fraudulent, you see.
Tortoise: Oh, of course.
Achilles: I call those strings which yield apparent koans "well-formed"
strings.
Tortoise: Why don't you tell me about the decision procedure which allows
you to distinguish phony koans from the genuine article?
Achilles: That's what I was heading towards. Given the koan, or non-koan,
as the case may be, the first thing is to translate it into the three-
dimensional string. All that's left is to find out if the string has
Buddha-nature or not.
Tortoise: But how do you do THAT?
Achilles: Well, my master has said that the Great Tutor was able, by just
glancing at a string, to tell if it had Buddha-nature or not.
Tortoise: But what if you have not reached the stage of the Enlightenment
'Yond Enlightenment? Is there no other way to tell if a string has
Buddha-nature?
Achilles: Yes, there is. And this is where the Art of Zen Strings comes in. It
is a technique for making innumerably many strings, all of which have
Buddha-nature.
Tortoise: You don't say! And is there a corresponding way of making
strings which DON'T have Buddha-nature?
Achilles: Why would you want to do that?
Tortoise: Oh, I just thought it might be useful.
Achilles: You have the strangest taste. Imagine! Being more interested in
things that DON'T have Buddha-nature than things that DO!
Tortoise: Just chalk it up to my unenlightened state. But go on. Tell me
how to make a string which DOES have Buddha-nature.
Achilles: Well, you must begin by draping a loop of string over your hands
in one of five legal starting positions, such as this one ... (Picks up a
string and drapes it in a simple loop between a finger on each hand.)
A Mu Offering 239
Tortoise: What are the other four legal starting positions?
Achilles: Each one is a position considered to be a SELF-EVIDENT manner
of picking up a string. Even novices often pick up strings in those
positions. And these five strings all have Buddha-nature.
Tortoise: Of course.
Achilles: Then there are some String Manipulation Rules, by which you
can make more complex string figures. In particular, you are allowed
to modify your string by doing certain basic motions of the hands. For
instance, you can reach across like this-and pull like this-and twist
like this. With each operation you are changing the overall configura-
tion of the string draped over your hands.
Tortoise: Why, it looks just like making cat's-cradles and such string
figures!
Achilles: That's right. Now as you watch, you'll see that some of these rules
make the string more complex; some simplify it. But whichever way
you go, as long as you follow the String Manipulation Rules, every
string you produce will have Buddha-nature.
Tortoise: That is truly marvelous. Now what about the koan concealed
inside this string you've just made? Would it be genuine?
Achilles: Why, according to what I've learned, it must. Since I made it
according to the Rules, and began in one of the five self-evident
positions, the string must have Buddha-nature, and consequently it
must correspond to a genuine koan.
Tortoise: Do you know what the koan is?
Achilles: Are you asking me to vIolate the Central Dogma? Oh, you
naughty fellow!
(And with furrowed brow and code book in hand, Achilles points along the
string inch by inch, recording each fold by a triplet of geometric symbols of
the strange phonetic alphabet for Mans, until he has nearly a napkinful.)
Done!
Tortoise: Terrific. Now let's hear it.
Achilles: All right.
A traveling monk asked an old woman the road to Taizan, a popular
temple supposed to give wisdom to the one who worships there. The old
woman said: "Go straight ahead." After the monk had proceeded a few
steps, she said to herself, "He also is a common church-goer." Someone
told this incident to Joshii, who said: "Wait until I investigate." The next
day he went and asked the same question, and the old woman gave the
same answer. Joshii remarked: "I have investigated that old woman."
Tortoise: Why, with his flair for investigations, it's a shame that Joshii
never was hired by the FBI. Now tell me-what you did, I could also
do, if I followed the Rules from the Art of Zen Strings, right?
Achilles: Right.
Tortoise: Now would I have to perform the operations in just the same
ORDER as you did?
240 A Mu Offering
Achilles: No, any old order will do.
Tortoise: Of course, then I would get a different string, and consequently
a different koan. Now would I have to perform the same NUMBER of
steps as you did?
Achilles: By no means. Any number of steps is fine.
Tortoise: Well, then there are an infinite number of strings with Buddha-
nature-and consequently an infinite number of genuine koans! How
do you know there is any string which CAN'T be made by your Rules?
Achilles: Oh, yes-back to things which lack Buddha-nature. It just so
happens that once you know how to make strings WITH Buddha-
nature, you can also make strings WITHOUT Buddha-nature. That is
something which my master drilled into me right at the beginning.
Tortoise: Wonderful! How does it work?
Achilles: Easy. Here, for example-I'll make a string which lacks
Buddha-nature ...
(He picks up the string out of which the preceding Man was "pulled", and
ties a little teeny knot at one end of it, pulling it tight with his thumb and
forefinger.)
This is it-no Buddha-nature here.
Tortoise: Very illuminating. All it takes is adding a knot? How do you
know that the new string lacks Buddha-nature?
Achilles: Because of this fundamental property of Buddha-nature: when
two well-formed strings are identical but for a knot at one end, then
only ONE of them can have Buddha-nature. It's a rule of thumb which
my master taught me.
Tortoise: I'm just wondering about something. Are there some strings with
Buddha-nature which you CAN'T reach by following the Rules of Zen
Strings, no matter in what order?
Achilles: I hate to admit it, but I am a little confused on this point myself.
At first my master gave the strongest impression that Buddha-nature
in a string was DEFINED by starting in one of the five legal starting
positions, and then developing the string according to the allowed
Rules. But then later, he said something about somebody-or-other's
"Theorem". I never got it straight. Maybe I even misheard what he
said. But whatever he said, it put some doubt in my mind as to whether
this method hits ALL strings with Buddha-nature. To the best of my
knowledge, at least, it does. But Buddha-nature is a pretty elusive
thing, you know.
Tortoise: I gathered as much, from Joshu's 'MU'. I wonder ...
Achilles: What is it?
Tortoise: I was just wondering about those two koans-I mean the koan
and its un-koan-the ones which say "This mind is Buddha" and "This
mind is not Buddha"-what do they look like, when turned into strings
via the Geometric Code?
Achilles: I'd be glad to show you.
A Mu Offering 241
(He writes down the phonetic transcriptions, and then pulls from his pocket
a couple of pieces of string, which he carefully folds inch by inch,following
the triplets of symbols written in the strange alphabet. Then he places the
finished strings side by side.)
You see, here is the difference.
Tortoise: They are very similar, indeed. Why, I do believe there is only one
difference between them: it's that one of them has a little knot on its
end!
Achilles: By Josh", you're right.
Tortoise: Aha! Now I understand why your master is suspicious.
Achilles: You do?
Tortoise: According to your rule of thumb, AT MOST ONE of such a pair can
have Buddha-nature, so you know right away that one of the koans
must be phony.
Achilles: But that doesn't tell which one is phony. I've worked, and so has
my master, at trying to produce these two strings by following the
String Manipulation Rules, but to no avail. Neither one ever turns up.
It's quite frustrating. Sometimes you begin to wonder ...
Tortoise: You mean, to wonder if either one has Buddha-nature? Perhaps
neither of them has Buddha-nature-and neither koan is genuine!
Achilles: I never carried my thoughts as far as that-but you're right-it's
possible, I guess. But I think you should not ask so many questions
about Buddha-nature. The Zen master Mumon always warned his
pupils of the danger of too many questions.
Tortoise: All right-no more questions. Instead, I have a sort of hankering
to make a string myself. It would be amusing to see if what I come up
with is well-formed or not.
Achilles: That could be interesting. Here's a piece of string. (He passes one
to the Tortoise.)
Tortoise: Now you realize that I don't have the slightest idea what to do.
We'll just have to take potluck with my awkward production, which will
follow no rules and will probably wind up being completely unde-
cipherable. (Grasps the loop between his feet and, with a few simple manipula-
tions, creates a complex string which he prriffers wordlessly to Achilles. At that
moment, Achilles' face lights up.)
Achilles: Jeepers creepers! I'll have to tryout your method myself. I have
never seen a string like this!
Tortoise: I hope it is well-formed.
Achilles: I see it's got a knot at one end.
Tortoise: Oh-just a moment! May I have it back? I want to do one thing to
it.
Achilles: Why, certainly. Here you are.
(Hands it back to the Tortoise, who ties another knot at the same end. Then
the Tortoise gives a sharp tug, and suddenly both knots disappear!)
242 A Mu Offering
Achilles: What happened?
Tortoise: I wanted to get rid of that knot.
Achilles: But instead of untying it, you tied another one, and then BOTH
disappeared! Where did they go?
Tortoise: Tumbolia, of course. That's the Law of Double Nodulation.
(Suddenly, the two knots reappear from out if nowhere-that is to say,
Tumbolia.)
Achilles: Amazing. They must lie in a fairly accessible layer of Tumbolia if
_ they can pop into it and out of it so easily. Or is all of Tumbolia equally
inaccessible?
Tortoise: I couldn't say. However, it does occur to me that burning the
string would make it quite improbable for the knots to come back. In
such a case, you could think of them as being trapped in a deeper layer
of Tumbolia. Perhaps there are layers and layers of Tumbolia. But
that's neither here nor there. What I would like to know is how my
string sounds, if you turn it back into phonetic symbols. (As he hands it
back, once again, the knots pop into oblivion.)
Achilles: I always feel so guilty about violating the Central Dogma ...
(Takes out his pen and code book, and carefully jots down the many symbol-
triplets which correspond to the curvy involutions of the Tortoise's string; and
when he is finished, he clears his voice.) Ahem. Are you ready to hear what
you have wrought?
Tortoise: I'm willing if you're willing.
Achilles: All right. It goes like this:
A certain monk had a habit of pestering the Grand Tortue (the only one
who had ever reached the Enlightenment 'Yond Enlightenment), by
asking whether various objects had Buddha-nature or not. To such ques-
tions Tortue invariably sat silent. The monk had already asked about a
bean, a lake, and a moonlit night. One day, he brought to Tortue a piece
of string, and asked the same question. In reply, the Grand Tortue
grasped the loop between his feet and-
Tortoise: Between his feet? How odd!
Achilles: Why should YOU find that odd?
Tortoise: Well, ah ... you've got a point there. But please go on!
Achilles: All right.
The Grand Tortue grasped the loop between his feet and, with a few
simple manipulations, created a complex string which he proffered
wordlessly to the monk. At that moment, the monk was enlightened.
Tortoise: I'd rather be twice-enlightened, personally.
Achilles: Then it tells how to make the Grand Tortue's string, if you begin
with a string draped over your feet. I'll skip those boring details. It
concludes this way:
From then on, the monk did not bother Tortue. Instead, he made string
after string by Tortue's method; and he passed the method on to his own
disciples, who passed it on to theirs.
A Mu Offering 243
Tortoise: Quite a yarn. It's hard to believe it was really hidden inside my
string.
Achilles: Yet it was. Astonishingly, you seem to have created a well-formed
string right off the bat.
Tortoise: But what did the Grand Tortue's string look like? That's the
main point of this koan, I'd suppose.
Achilles: I doubt it. One shouldn't "attach" to small details like that inside
koans. It's the spirit of the whole koan that counts, not little parts of it.
Say, do you know what I just realized? I think, crazy though it sounds,
that you may have hit upon that long-lost koan which describes the
very origin of the Art of Zen Strings!
Tortoise: Oh, that would almost be too good to have Buddha-nature.
Achilles: But that means that the great master-the only one who ever
reached the mystical state of the Enlightenment 'Yond
Enlightenment-was named 'Tortue", not "Tutor". What a droll
name!
Tortoise: I don't agree. I think it's a handsome name. I still want to know
how Tortue's string looked. Can you possibly recreate it from the
description given in the koan?
Achilles: I could try ... Of course, I'll have to use my feet, too, since it's
described in terms of foot motions. That's pretty unusual. But I think I
can manage it. Let me give it a go. (He picks up the koan and a piece of
string, and for a few minutes twists and bends the string in arcane ways until he
has the finished product.) Well, here it is. Odd, how familiar it looks.
Tortoise: Yes, isn't that so? I wonder where I saw it before?
Achilles: I know! Why, this is YOVR string, Mr. T! Or is it?
Tortoise: Certainly not.
Achilles: Of course not-it's the string which you first handed to me,
before you took it back to tie an extra knot in it.
Tortoise: Oh, yes-indeed it is. Fancy that. I wonder what that implies.
Achilles: It's strange, to say the least.
Tortoise: Do you suppose my k6an is genuine?
Achilles: Wait just a moment ...
Tortoise: Or that my string has Buddha-nature?
Achilles: Something about your string is beginning to trouble me, Mr.
Tortoise.
Tortoise (looking most pleased with himself and paying no attention to
Achilles): And what about Tortue's string? Does it have Buddha-
nature? There are a host of questions to ask!
Achilles: I would be scared to ask such questions, Mr. T. There is some-
thing mighty funny going on here, and I'm not sure I like it.
Tortoise: I'm sorry to hear it. I can't imagine what's troubling you.
Achilles: Well, the best way I know to explain it is to quote the words of
another old Zen master, Kyogen. Kyogen said:
244 A Mu Offering
Zen is like a man hanging in a tree by his teeth over a precipice. His hands
grasp no branch, his feet rest on no limb, and under the tree another
person asks him: "Why did Bodhidharma come to China from India?" If
the man in the tree does not answer, he fails; and if he does answer, he
falls and loses his life. Now what shall he do?
A M u Offering 245
CHAPTER IX
What Is Zen?
I'M NOT SURE I know what Zen is. In a way, I think I understand it very
well; but in a way, I also think I can never understand it at all. Ever since my
freshman English teacher in college read J6shu's MU out loud to our class,
I have struggled with Zen aspects of life, and probably I will never cease
doing so. To me, Zen is intellectual quicksand-anarchy, darkness,
meaninglessness, chaos. It is tantalizing and infuriating. And yet it is
humorous, refreshing, enticing. Zen has its own special kind of meaning,
brightness, and clarity. I hope that in this Chapter, I can get some of this
cluster of reactions across to you. And then, strange though it may seem,
that will lead us directly to Godelian matters.
One of the basic tenets of Zen Buddhism is that there is no way to
characterize what Zen is. No matter what verbal space you try to enclose
Zen in, it resists, and spills over. It might seem, then, that all efforts to
explain Zen are complete wastes of time. But that is not the attitude of Zen
masters and students. For instance, Zen k6ans are a central part of Zen
study, verbal though they are. K6ans are supposed to be "triggers" which,
though they do not contain enough information in themselves to impart
enlightenment, may possibly be sufficient to unlock the mechanisms inside
one's mind that lead to enlightenment. But in general, the Zen attitude is
that words and truth are incompatible, or at least that no words can capture
truth.
Koan:
Goso said: "When a buffalo goes out of his enclosure to the edge of the abyss,
his horns and his head and his hoof~ all pass through, but why can't the tail
also pass?"
Mumon's Commentary:
If anyone can open one eye at this point and say a word of Zen, he is qualified
to repay the four gratifications, and. not only that, he can save all sentient
beings under him. But if he cannot say such a word of Zen, he should turn
back to his tail.
Mumon's Poem:
If the buffalo runs, he will fall into the trench;
If he returns, he will he butchered.
That little tail
Is a very strange thing.
I think you will have to admit that Mumon does not exactly clear everything
up. One might say that the metalanguage (in which Mumon writes) is not
very different from the object language (the language of the koan). Accord-
ing to some, Mumon's comments are intentionally idiotic, perhaps meant to
show how useless it is to spend one's time in chattering about Zen. How-
ever, Mumon's comments can be taken on more than one level. For in-
stance, consider this: 3
Koan:
A monk asked Nansen: "Is there a teaching no master ever taught before?"
Nansen said: "Yes, there is."
"What is it?" asked the monk.
Nansen replied: "It is not mind, it is not Buddha, it is not things."
Mumon's Commentary:
Old Nansen gave away his treasure-words. He must have been greatly upset.
Mumon's Poem:
Nansen was too kind and lost his treasure.
Truly, words have no power.
Even though the mountain becomes the sea,
Words cannot open another's mind.
In this poem Mumon seems to be saying something very central to Zen, and
not making idiotic statements. Curiously, however, the poem is self-
referential, and thus it is a comment not only on Nansen's words, but also
on its own ineffectiveness. This type of paradox is quite characteristic of
Zen. It is an attempt to "break the mind of logic". You see this paradoxical
quality in the k6an, as well. Concerning Mumon's commentary, do you
think that Nansen was really so sure of his answer? Or did the "correctness"
of his answer matter at all? Or does correctness play any role in Zen? What
is the difference between correctness and truth, or is there any? What if
Nansen had said, "No, there is not any such teaching"? Would it have made
any difference? Would his remark have been immortalized in a k6an?
The student Doko came to a Zen master, and said: "I am seeking the truth. In
what state of mind should I train my~elf, so as to find it?"
Said the master, "There is no mind, so you cannot put it in any state. There
is no truth, so you cannot train yourself for it."
"If there is no mind to train, and no truth to find, why do you have these
monks gather before you every day to study Zen and train themselves for this
study?"
"But I haven't an inch of room here," said the master, "so how could the
monks gather? I have no tongue, so how could I call them together or teach
them?"
If any koan serves to bewilder, this one does. And most likely, causing
bewilderment is its precise purpose, for when one is in a bewildered state,
one's mind does begin to operate nonlogically, to some extent. Only by
stepping outside of logic, so the theory goes, can one make the leap to
enlightenment. But what is so bad about logic? Why does it prevent the leap
to enlightenment?
Koan:
Shuzan held out his short staff and said: "If you call this a short staff, you
oppose its reality. If you do not call it a short staff, you ignore the fact. Now
what do you wish to call this?"
Mumon's Commentary:
If you call this a short staff, you oppose its reality. If you do not call it a short
staff, you ignore the fact. It cannot be expressed with words and it cannot be
expressed without words. Now say quickly what it is.
Mumon's Poem:
Holding out the short staff,
He gave an order of life or death.
Positive and negative interwoven,
Even Buddhas and patria"chs cannot escape this attack.
Zen is holism, carried to its logical extreme. If holism claims that things
can only be understood as wholes, not as sums of their parts, Zen goes one
further, in maintaining that the world cannot be broken into parts at all. To
divide the world into parts is to be deluded, and to miss enlightenment.
A master was asked the question, "What is the Way?" by a curious monk.
"It is right before your eyes," said the master.
"Why do 1 not see it for myself?"
"Because you are thinking of yourself."
"What about you: do you see it?"
"So long as you see double, saying 'I don't', and 'you do', and so on, your
eyes are clouded," said the master.
"When there is neither 'I' nor 'You', can one see it?"
"When there is neither 'I' nor 'You', who is the one that wants to see it?"9
The Zen monk Bassui wrote a letter to one of his disciples who was about to
die, and in it he said: "Your end which is endless is as a snowflake dissolving
in the pure air." The snowflake, which was once very much a discernible
subsystem of the universe, now dissolves into the larger system which once
held it. Though it is no longer present as a distinct subsystem, its essence is
somehow still present, and will remain so. It floats in Tumbolia, along with
hiccups that are not being hiccuped and characters in stories that are not
being read ... That is how I understand Bassui's message.
Zen recognizes its own limitations, just as mathematicians have learned
to recognize the limitations of the axiomatic method as a method for
attaining truth. This does not mean that Zen has an answer to what lies
beyond Zen any more than mathematicians have a clear understanding of
the forms of valid reasoning which lie outside of formalization. One of the
clearest Zen statements about the borderlines of Zen is given in the follow-
ing strange koan, very much in the spirit of Nansen: 10
T6zan said to his monks, "You monks should know there is an even higher
understanding in Buddhism." A monk stepped forward and asked, "What is
the higher Buddhism?" T6zan answered, "It is not Buddha."
(Fig. 48)-pictures that play with reality and unreality the same way as Zen
plays with reality and unreality. Should one take Escher seriously? Should
one take Zen seriously?
There is a delicate, haiku-like study of reflections in Dewdrop (Fig. 47);
and then there are two tranquil images of the moon reflected in still waters:
Puddle (Fig. 51), and Rippled Surface (Fig. 52). The reflected moon is a
theme which recurs in various koans. Here is an example: II
Chiyono studied Zen for many years under Bukko of Engaku. Still, she could
not attain the fruits of meditation. At last one moonlit night she was carrying
water in an old wooden pail girded with bamboo. The bamboo broke, and the
bottom fell out of the pail. At that moment, she was set free. Chiyono said,
"No more water in the pail, no mort~ moon in the water."
Three Worlds: an Escher picture (Fig. 46), and the subject of a Zen
koan: 12
A monk asked Ganto, "When the three worlds threaten me, what shall I do?"
Ganto answered, "Sit down." "I do not understand," said the monk. Ganto
said, "Pick up the mountain and bring it to me. Then I will tell you."
Indra's Net
Finally, consider Three Spheres II (Fig. 53), in which every part of the world
seems to contain, and be contained in, every other part: the writing table
reflects the spheres on top of it, the spheres reflect each other, as well as the
writing table, the drawing of them, and the artist drawing it. The endless
connections which all things have to each other is only hinted at here, yet
the hint is enough. The Buddhist allegory of "Indra's Net" tells of an
endless net of threads throughout the universe, rhe horizontal threads
running through space, the vertical ones through time. At every crossing of
threads is an individual, and every individual is a crystal bead. The great
light of "Absolute Being" illuminates and penetrates every crystal bead;
moreover, every crystal bead reflects not only the light from every other
crystal in the net-but also every reflection of every reflection throughout
the universe.
To my mind, this brings forth an image of renormalized particles: in
every electron, there are virtual photons, positrons, neutrinos, muons ... ;
in every photon, there are virtual electrons, protons, neutrons, pions ... ;
in every pion, there are ...
But then another image rises: that of people, each one reflected in the
minds of many others, who in turn are mirrored in yet others, and so on.
Both of these images could be represented in a concise, elegant way by
using Augmented Transition Networks. In the case of particles, there
would be one network for each category of particle; in the case of people,
Murnon on MU
Let us conclude this brief excursion into Zen by returning to Mumon. Here
IShis comment on Joshii's MU: 13
To realize Zen one has to pass through the barrier of the patriarchs. En-
lightenment always comes after the road of thinking is blocked. If you do not
pass the barrier of the patriarchs or if your thinking road is not blocked,
whatever you think, whatever you do, is like a tangling ghost. You may ask:
"What is a barrier of a patriarch?" This one word, 'MU', is it.
This is the barrier of Zen. If you pass through it, you will see Joshu face to
face. Then you can work hand in hand with the whole line of patriarchs. Is
this not a pleasant thing to do?
If you want to pass this barrier, you must work through every bone in your
body, through every pore of your skin, filled with this question: "What is
'MU'?" and carry it day and night. Do not believe it is the common negative
symbol meaning nothing. It is not nothingness, the opposite of existence. If
you really want to pass this barrier, you should feel like drinking a hot iron
ball that you can neither swallow nor spit out.
Then your previous lesser knowledge disappears. As a fruit ripening in
season, your subjectivity and objectivity naturally become one. It is like a
dumb man who has had a dream. He knows about it but he cannot tell it.
When he enters this condition his ego-shell is crushed and he can shake the
heaven and move the earth. He is like a great warrior with a sharp sword. If a
Buddha stands in his way, he will cut him down; if a patriarch offers him any
obstacle, he will kill him; and he will be free in his way of birth and death. He
can enter any world as if it were his own playground. I will tell you how to do
this with this koan:
Just concentrate your whole energy into this MU, and do not allow any
discontinuation. When you enter this MU and there is no discontinuation,
your attainment will be as a candle burning and illuminating the whole
universe.
(1) that the MU-puzzle has depth largely because it involves the
interplay of lengthening and shortening rules;
(2) that hope nevertheless exists for cracking the problem by
employing a tool which is in some sense of adequate depth to
handle matters of that complexity: the theory of numbers.
We did not analyze the MU-puzzle in those terms very carefully in Chapter
I; we shall do so now. And we will see how the second observation (when
generalized beyond the insignificant MIU-system) is one of the most fruit-
ful realizations of all mathematics, and how it changed mathematicians'
view of their own discipline.
For your ease of reference, here is a recapitulation of the MI U-system:
SYMBOLS: M, I, U
AXIOM: MI
RULES:
1. If xl is a theorem, so is xiU.
II. If Mx is a theorem, so is Mxx.
III. In any theorem, III can be replaced by U.
IV. UU can be dropped from any theorem.
M ~ 3
I ~ 1
U ~ 0
MU ~ 30
MIIU ~ 3110
etc.
(1) MI axiom 31
(2) Mil rule 2 311
(3) Mill I rule 2 31111
(4) MUI rule 3 301
(5) MUiU rule 1 3010
(6) MUlUUIU rule 2 3010010
(7) MUIIU rule 4 30110
Now we could have stuck with a purely typographical rule, such as the
following one:
They would have the same effect. This is why the right-hand column has a
"dual nature": it can be viewed either as a series of typographical opera-
Let us not forget our axiom! Without it we can go nowhere. Therefore, let
us postulate that:
MIU-Producible Numbers
Just as any set of typographical rules generates a set of theorems, a corre-
sponding set of natural numbers will be generated by repeated applications
of arithmetical rules. These producible numbers play the same role inside
number theory as theorems do inside any formal system. Of course, differ-
ent numbers will be producible, depending on which rules are adopted.
"Producible numbers" are only producible relative to a system of arithmetical
rules. For example, such numbers as 31, 3010010, 3111, and so forth
could be called MIU-producible numbers-an ungainly name, which might
be shortened to MIU-numbers, symbolizing the fact that those numbers are
the ones that result when you transcribe the MIU-system into number
theory, via Godel-numbering. If we were to Godel-number the pq-system
All we have done is replace one relatively short string (MU) by another (the
monstrous MUMON), and a simple formal system (the MIU-system) by a
complicated one (TNT). It isn't likely that the answer will be any more
forthcoming even though the question has been reshaped. In fact, TNT
has a full complement of both lengthening and shortening rules, and the
reformulation of the question is likely to be far harder than the original.
One might even say that looking at MU via MUMON is an intentionally
idiotic way of doing things. However, MUMON can be looked at on more
than one level.
In fact, this is an intriguing point: MUMON has two different passive
meanings. Firstly, it has the one which was given before:
30 is a MIU-number.
But secondly, we know that this statcment is tied (via isomorphism) to the
statement
It could be said that MUMON is, by Fact 1, a coded message, where the
symbols of the code are, by Fact 2, just symbols of TNT.
30 is a MIU-number.
The moral of the story is one we have heard before: that meaning is an
automatic by-product of our recognition of any isomorphism; therefore
there are at least two passive meanings of MUMON-maybe more!
Notice that I changed the name of the "Add S" rule to "Insert '123"', since
that is the typographical operation which it now legitimizes.
This new notation has a pretty strange feel to it. You lose all sense of
meaning; but if you had been brought up on it, you could read strings in
this notation as easily as you do TNT. You would be able to look and, at a
glance, distinguish well-formed formulas from ill-formed ones. Naturally,
since it is so visual, you would think of this as a typographical operation-
but at the same time, picking out well-formed formulas in this notation is
picking out a special class of integers, which have an arithmetical definition,
too.
Now what about "arithmetizing" all the rules of inference? As matters
stand, they are all still typographical rules. But wait! According to the
Central Proposition, a typographical rule is really equivalent to an
arithmetical rule. Inserting and moving digits in decimally represented
numbers is an arithmetical operation, which can be carried out typographi-
cally. Just as appending a '0' on the end is exactly the same as multiplying by
10, so each rule is a condensed way of describing a messy arithmetical
operation. Therefore, in a sense, we do not even need to look for equiva-
lent arithmetical rules, because all of the rules are already arithmetical!
a is a TNT-number.
a is not a TNT-number.
TNT ~ N ~ meta-TNT
I should quickly add that G also has a passive meaning which is a statement of
number theory; just like MUMON it is susceptible to being construed in (at
least) two different ways. The important thing is that each passive meaning
is valid and useful and doesn't cast doubt on the other passive meaning in
any way. (The fact that a phonograph playing a record can induce vibra-
tions in itself and in the record does not diminish in any way the fact that
those vibrations are musical sounds!)
Let us be sure to form our own opinion on this matter, rather than rely on
G's opinion about itself. After all, G may not understand itself any better
than a Zen master understands himself. Like MUMON, G may express a
falsity. Like MU, G may be a nontheorem. We don't need to believe every
possible string of TNT-only its theorems. Now let us use our power of
reasoning to clarify the issue as best we can at this point.
We will make our usual assumption: that TNT incorporates valid
Is the Tortoise's string in the Mu Offering the analogue ofG? Not quite.
The analogue of the Tortoise's string is -G. Why is this so? Well, let us
think a moment about what -G says. It must say the opposite of what G
says. G says, "G is not a theorem of TNT", so -G must say "G is a theorem".
We could rephrase both G and -G this way:
It is -G which is parallel to the Tortoise's string, for that string spoke not
about itself, but about the string which the Tortoise first proffered to
Achilles-which had an extra knot on it (or one too few, however you want
to look at it).
Achilles and the Tortoise have come to the residence of their friend the
Crab, to make the acquaintance of one of his friends, the Anteater. The
introductions having been made, the four of them settle down to tea.
Tortoise: We have brought along a little something for you, Mr. Crab.
Crab: That's most kind of you. But you shouldn't have.
Tortoise: Just a token of our esteem. Achilles, would you like to give it to
Mr. C?
Achilles: Surely. Best wishes, Mr. Crab. I hope you enjoy it.
(Achilles hands the Crab an elegantly wrapped present, square and very
thin. The Crab begins unwrapping it.)
Anteater: I wonder what it could be.
Crab: We'll soon find out. (Completes the unwrapping, and pulls out the gift.)
Two records! How exciting! But there's no label. Uh-oh-is this
another of your "specials", Mr. T?
Tortoise: If you mean a phonograph-breaker, not this time. But it is in fact
a custom-recorded item, the only one of its kind in the entire world. In
fact, it's never even been heard before--except, of course, when Bach
played it.
Crab: When Bach played it? What do you mean, exactly?
Achilles: Oh, you are going to be fabulously excited, Mr. Crab, when
Mr. T tells you what these records in fact are.
Tortoise: Oh, you go ahead and tell him, Achilles.
Achilles: May I? Oh, boy! I'd better consult my notes, then. (Pulls out a
small filing card, and clears his voice.) Ahem. Would you be interested in
hearing about the remarkable new result in mathematics, to which
your records owe their existence?
Crab: My records derive from some piece of mathematics? How curious!
Well, now that you've provoked my interest, I must hear about it.
Achilles: Very well, then. (Pauses for a moment to sip his tea, then resumes.)
Have you heard of Fermat's infamous "Last Theorem"?
Anteater: I'm not sure ... It sounds strangely familiar, and yet I can't quite
place it.
Achilles: It's a very simple idea. Pierre de Fermat, a lawyer by vocation but
mathematician by avocation, had been reading in his copy of the classic
text Arithmetica by Diophantus, and came across a page containing the
equation
Prelude . .. 275
He immediately realized that this equation has infinitely many solu-
tions a, b, c, and then wrote in the margin the following notorious
comment:
The equation
an+bn=c n
Ever since that day, some three hundred years ago, mathematicians
have been vainly trying to do one of two things: either to prove
Fermat's claim, and thereby vindicate Fermat's reputation, which, al-
though very high, has been somewhat tarnished by skeptics who think
he never really found the proof he claimed to have found--or else to
refute the claim, by finding a counterexample: a set of four integers
a, b, c, and n, with n > 2, which satisfy the equation. Until very
recently, every attempt in either direction had met with failure. To be
sure, the Theorem has been proven for many specific values of n-in
particular, all n up to 125,000.
Anteater: Shouldn't it be called a "Conjecture" rather than a "Theorem", if
it's never been given a proper proof?
Achilles: Strictly speaking, you're right, but tradition has kept it this way.
Crab: Has someone at last managed to resolve this celebrated question?
Achilles: Indeed! In fact, Mr. Tortoise has done so, and as usual, by a
wizardly stroke. He has not only found a PROOF of Fermat's Last
Theorem (thus justifying its name as well as vindicating Fermat), but
also a COUNTEREXAMPLE, thus showing that the skeptics had good
intuition!
Crab: Oh my gracious! That is a revolutionary discovery.
Anteater: But please don't leave us in suspense. What magical integers are
they, that satisfy Fermat's equation? I'm especially curious about the
value of n.
Achilles: Oh, horrors! I'm most embarrassed! Can you believe this? I left
the values at home on a truly colossal piece of paper. Unfortunately it
was too huge to bring along. I wish I had them here to show to you. If
it's of any help to you, I do remember one thing-the value of n is the
only positive integer which does not occur anywhere in the continued
fraction for 1T.
Crab: Oh, what a shame that you don't have them here. But there's no
reason to doubt what you have told us.
Prelude. . . 277
FIGURE 55. Pierre de Fermat.
Anteater: Anyway, who needs to see n written out decimally? Achilles has
just told us how to find it. Well, Mr. T, please accept my hearty
felicitations, on the occasion of your epoch-making discovery!
Tortoise: Thank you. But what I feel is more important than the result
itself is the practical use to which my result immediately led.
Crab: I am dying to hear about it, since I always thought number theory
was the Queen of Mathematin.-the purest branch of mathematics-
the one branch of mathematics which has NO applications!
Tortoise: You're not the only one with that belief, but in fact it is quite
impossible to make a blanket statement about when or how some
branch-or even some individual Theorem-of pure mathematics will
have important repercussiom outside of mathematics. It is quite
unpredictable-and this case is a perfect example of that phenome-
non.
Achilles: Mr. Tortoise's double-barreled result has created a breakthrough
in the field of acoustico-retrieval!
Anteater: What is acoustico-retrieyal?
Achilles: The name tells it all: it is the retrieval of acoustic information
from extremely complex sources. A typical task of acoustico-retrieval is
to reconstruct the sound which a rock made on plummeting into a lake
from the ripples which spread out over the lake's surface.
Crab: Why, that sounds next to impossible!
Achilles: Not so. It is actually quite similar to what one's brain does, when it
reconstructs the sound made in the vocal cords of another person from
the vibrations transmitted by the eardrum to the fibers in the cochlea.
Crab: I see. But I still don't see where number theory enters the picture,
or what this all has to do with my new records.
278 Prelude . ..
Achilles: Well, in the mathematics of acoustico-retrieval, there arise many
questions which have to do with the number of solutions of certain
Diophantine equations. Now Mr. T has been for years trying to find a
way of reconstructing the sounds of Bach playing his harpsichord,
which took place over two hundred years ago, from calculations involv-
ing the motions of all the molecules in the atmosphere at the present
time.
Anteater: Surely that is impossible! They are irretrievably gone, gone
forever!
Achilles: Thus think the naive ... But Mr. T has devoted many years to
this problem, and came to the realization that the whole thing hinged
on the number of solutions to the equation
an + bn = en
Prelude . .. 279
Crab: Don't tell me it's a recording of Bach playing his own works for
harpsichord!
Achilles: I'm sorry, but I have to, for that is indeed just what it is! This is a
set of two records of Johann Sebastian Bach ~laying all of his Well-
Tempered Clavier. Each record contains one of the two volumes of the
Well-Tempered Clavier; that is to say, each record contains 24 preludes
and fugues-one in each major and minor key.
Crab: Well, we must absolutely put one of these priceless records on,
immediately! And how can I e\er thank the two of you?
Tortoise: You have already thanked us plentifully, with this delicious tea
which you have prepared.
(The Crab slides one of the records out of its jacket, and puts it on. The
sound of an incredibly masterful harpsichordistfills the room, in the highest
imaginable fidelity. One even hears.,.--or is it one's imagination? -the soft
sounds of Bach singing to him,ell as he plays . .. )
Crab: Would any of you like to follow along in the score? I happen to have
a unique edition of the Well-Tempered Clavier, specially illuminated by a
teacher of mine who happens also to be an unusually fine calligrapher.
Tortoise: I would very much enjoy that.
(The Crab goes to his elegant glwsenclosed wooden bookcase, opens the
doors, and draws out two large volumes.)
Crab: Here you are, Mr. Tortoise. I've never really gotten to know all the
beautiful illustrations in this edition. Perhaps your gift will provide the
needed impetus for me to do so.
Tortoise: I do hope so.
Anteater: Have you ever noticed how in these pieces the prelude always
sets the mood perfectly for the following fugue?
Crab: Yes. Although it may be hard to put it into words, there is always
some subtle relation between the two. Even if the prelude and fugue
do not have a common melodic subject, there is nevertheless always
some intangible abstract quality which underlies both of them, binding
them together very strongly.
Tortoise: And there is something very dramatic about the few moments of
silent suspense hanging between prelude and fugue-that moment
where the the theme of the fugue is about to ring out, in single tones,
and then to join with itself in e\ er-increasingly complex levels of weird,
exquisite harmony.
Achilles: I know just what you mean. There are so many preludes and
fugues which I haven't yet gotten to know, and for me that fleeting
interlude of silence is very exciting; it's a time when I try to second-
guess old Bach. For example, I always wonder what the fugue's tempo
will be: allegro, or adagio? Will it be in 6/8, or 4/4? Will it have three
voices, or five-or four? And then, the first voice starts ... Such an
exquisite moment.
280 Prelude . ..
Crab: Ah, yes, well do I remember those long-gone days of my youth, the
days when I thrilled to each new prelude and fugue, filled with the
excitement of their novelty and beauty and the many unexpected
surprises which they conceal.
Achilles: And now? Is that thrill all gone?
Crab: It's been supplanted by familiarity, as thrills always will be. But in
that familiarity there is also a kind of depth, which has its own compen-
sations. For instance, I find that there are always new surprises which I
hadn't noticed before.
Achilles: Occurrences of the theme which you had overlooked?
Crab: Perhaps-especially when it is inverted and hidden among several
other voices, or where it seems to come rushing up from the depths,
out of nowhere. But there are also amazing modulations which it is
marvelous to listen to over and over again, and wonder how old Bach
dreamt them up.
Achilles: I am very glad to hear that there is something to look forward to,
after I have been through the first flush of infatuation with the Well-
Tempered Clavier-although it also makes me sad that this stage could
not last forever and ever.
Crab: Oh, you needn't fear that your infatuation will totally die. One of
the nice things about that sort of youthful thrill is that it can always be
resuscitated, just when you thought it was finally dead. It just takes the
right kind of triggering from the outside.
Achilles: Oh, really? Such as what?
Crab: Such as hearing it through the ears, so to speak, of someone to
whom it is a totally new experience-someone such as you, Achilles.
Somehow the excitement transmits itself, and I can feel thrilled again.
Achilles: That is intriguing. The thrill has remained dormant somewhere
inside you, but by yourself, you aren't able to fish it up out of your
subconscious.
Crab: Exactly. The potential of reliving the thrill is "coded", in some
unknown way, in the structure of my brain, but I don't have the power
to summon it up at will; I have to wait for chance circumstance to
trigger it.
Achilles: I have a question about fugues which I feel a little embarrassed
about asking, but as I amjusta novice at fugue-listening, I was wonder-
ing if perhaps one of you seasoned fugue-listeners might help me in
learning ... ?
Tortoise: I'd certainly like to offer my own meager knowledge, if it might
prove of some assistance.
Achilles: Oh, thank you. Let me come at the question from an angle. Are
you familiar with the print called Cube with Magic Ribbons, by M. C.
Escher?
Tortoise: In which there are circular bands having bubble-like distortions
which, as soon as you've decided that they are bumps, seem 'to turn into
dents-and vice versa?
Prelude . .. 281
FIGURE 56. Cube with Magic Ribbons, by M. C. Escher (lithograph, 1957).
Achilles: Exactly.
Crab: I remember that picture. Those little bubbles always seem to flip
back and forth between being concave and convex, depending on the
direction that you approach them from. There's no way to see them
simultaneously as concave AND convex-somehow one's brain doesn't
allow that. There are two mutually exclusive "modes" in which one can
perceive the bubbles.
Achilles: Just so. Well, I seem to have discovered two somewhat analogous
modes in which I can listen to a fugue. The modes are these: either to
follow one individual voice at a time, or to listen to the total effect of all
of them together, without trying to disentangle one from another. I
have tried out both of these modes, and, much to my frustration, each
one of them shuts out the other. It's simply not in my power to follow
the paths of individual voices and at the same time to hear the whole
effect. I find that I flip back and forth between one mode and the
other, more or less spontaneously and involuntarily.
282 Prelude . ..
Anteater: Just as when you look at the magic bands, eh?
Achilles: Yes. I was just wondering ... does my description of these two
modes of fugue-listening brand me unmistakably as a naive, inexperi-
enced listener, who couldn't even begin to grasp the deeper modes of
perception which exist beyond his ken?
Tortoise: No, not at all, Achilles. I can only speak for myself, but I too find
myself shifting back and forth from one mode to the other without
exerting any conscious control over which mode should be dominant. I
don't know if our other companions here have also,experienced any-
thing similar.
Crab: Most definitely. It's quite a tantalizing phenomenon, since you feel
that the essence of the fugue is Hitting about you, and you can't quite
grasp all of it, because you can't quite make yourself function both
ways at once.
Anteater: Fugues have that interesting property, that each of their voices is
a piece of music in itself; and thus a fugue might be thought of as a
collection of several distinct pieces of music, all based on one single
theme, and all played simultaneously. And it is up to the listener (or his
subconscious) to decide whether it should be perceived as a unit, or as a
collection of independent parts, all of which harmonize.
Achilles: You say that the parts are "independent", yet that can't be liter-
ally true. There has to be some coordination between them, otherwise
when they were put together one would just have an unsystematic
clashing of tones-and that is as far from the truth as could be.
Anteater: A better way to state it might be this: if you listened to each voice
on its own, you would find that it seemed to make sense all by itself. It
could stand alone, and that is the sense in which I meant that it is
independent. But you are quite right in pointing out that each of these
individually meaningful lines fuses with the others in a highly nonran-
dom way, to make a graceful totality. The art of writing a beautiful
fugue lies precisely in this ability, to manufacture several different
lines, each one of which gives the illusion of having been written for its
own beauty, and yet which when taken together form a whole, which
does not feel forced in any way. Now, this dichotomy between hearing
a fugue as a whole, and hearing its component voices, is a particular
example of a very general dichotomy, which applies to many kinds of
structures built up from lower levels.
Achilles: Oh, really? You mean that my two "modes" may have some more
general type of applicability, in situations other than fugue-listening?
Anteater: Absolutely.
Achilles: I wonder how that could be. I guess it has to do with alternating
between perceiving something as a whole, and perceiving it as a collec-
tion of parts. But the only place I have ever run into that dichotomy is
in listening to fugues.
Tortoise: Oh, my, look at this! I just turned the page while following the
music, and came across this magnificent illustration facing the first
page of the fugue.
Prelude . .. 283
Crab: I have never seen that illustration before. Why don't you pass it
'round?
(The Tortoise passes the book around. Each of the foursome looks at it in a
characteristic way---this one from afar, that one from close up, everyone
tipping his head this way and that in puzzlement. Finally it has made the
rounds, and returns to the Tortoise, who peers at it rather intently.)
Achilles: Well, I guess the prelude isjust about over. I wonder if, as I listen
to this fugue, I will gain any more insight into the question, "What is
the right way to listen to a fugue: as a whole, or as the sum of its parts?"
TTortoise: Listen carefully, and you will!
(The prelude ends. There is a moment of silence; and . . .)
[ATTACCA]
284 Prelude . ..
CHAPTER X
Levels of Description,
and Computer Systems
Levels of Description
GODEL'S STRING G, and a Bach fugue: they both have the property that
they can be understood on different levels. We are all familiar with this
kind of thing; and yet in some cases it confuses us, while in others we
handle it without any difficulty at all. For example, we all know that we
human beings are composed of an enormous number of cells (around
twenty-five trillion), and therefore that everything we do could in principle
be described in terms of cells. Or it could even be described on the level of
molecules. Most of us accept this in a rather matter-of-fact way; we go to
the doctor, who looks at us on lower levels than we think of ourselves. We
read about DNA and "genetic engineering" and sip our coffee. We seem to
have reconciled these two inconceivably different pictures of ourselves
simply by disconnecting them from each other. We have almost no way to
relate a microscopic description of ourselves to that which we feel ourselves
to be, and hence it is possible to store separate representations of ourselves
in quite separate "compartments" of our minds. Seldom do we have to flip
back and forth between these two concepts of ourselves, wondering "How
can these two totally different things be the same me?"
Or take a sequence of images on a television screen which shows
Shirley MacLaine laughing. When we watch that sequence, we know that
we are actually looking not at a woman, but at sets of flickering dots on a flat
surface. We know it, but it is the furthest thing from our mind. We have
these two wildly opposing representations of what is on the screen, but that
does not confuse us. We can just shut one out, and pay attention to the
other-which is what all of us do. Which one is "more real"? It depends on
whether you're a human, a dog, a computer, or a television set.
Similar Levels
Usually, we are not required to hold more than one level of understanding
of a situation in our minds at once. Moreover, the different descriptions of
a single system are usually so conceptually distant from each other that, as
was mentioned earlier, there is no problem in maintaining them both; they
are just maintained in separate mental compartments. What is confusing,
though, is when a single system admits of two or more descriptions on
different levels which nevertheless resemble each other in some way. Then
we find it hard to avoid mixing levels when we think about the system, and
can easily get totally lost.
Undoubtedly this happens when we think about our own
psychology-for instance, when we try to understand people's motivations
for various actions. There are many levels in the human mental
structure-certainly it is a system which we do not understand very well yet.
But there are hundreds of rival theories which tell why people act the way
they do, each theory based on some underlying assumptions about how far
down in this set of levels various kinds of psychological "forces" are found.
Since at this time we use pretty much the same kind of language for all
mental levels, this makes for much level-mixing and most certainly for
hundreds of wrong theories. For instance, we talk of "drives"-for sex, for
power, for fame, for love, etc., etc.-without knowing where these drives
come from in the human mental structure. Without belaboring the point, I
simply wish to say that our confusion about who we are is certainly related
to the fact that we consist of a large set of levels, and we use overlapping
language to describe ourselves on all of those levels.
Computer Systems
There is another place where many levels of description coexist for a single
system, and where all the levels are conceptually quite close to one another.
I am referring to computer systems. When a computer program is run-
ning, it can be viewed on a number of levels. On each level, the description
is given in the language of computer science, which makes all the descrip-
tions similar in some ways to each other-yet there are extremely important
differences between the views one gets on the different levels. At the lowest
level, the description can be so complicated that it is like the dot-description
of a television picture. For some purposes, however, this is by far the most
important view. At the highest level, the description is greatly chunked, and
,,
,
,, ., ,
I
I \
\
,
I
: . - - - ~ - - - - -
,
-1- _ :~~ ---.. ~ ---~ . ~ .--.~. ";0
I
I ,I
.''
I
\ \
\ \
,, \
,'
I
\,
... --'
FIGURE 57. The idea of "chunking": a group of items is reperceived as a single "chunk".
The chunk's boundnry is a little like a cell membrane or a national border: it establishes a
separate identity for the cluster within. AC/:ording to context, one may wish to ignore the
chunk's internal structure or to take it into account.
concrete facts about computers, beginning with a very quick skim of what a
computer system is like on the lowest leveL The lowest level? Well, not
really, for I am not going to talk about elementary particles-but it is the
lowest level which we wish to think about.
At the conceptual rock-bottom of a computer, we find a memory, a
central processing unit (CPU), and some input-output (I/O) devices. Let us first
describe the memory. It is divided up into distinct physical pieces, called
words. For the sake of concreteness, let us say there are 65,536 words of
memory (a typical number, being 2 to the 16th power). A word is further
divided into what we shall consider the atoms of computer science-bits.
The number of bits in a typical word might be around thirty-six. Physically,
a bit is just a magnetic "switch" that can be in either of two positions.
lololxlolxlxlxlolxlololxlxlololxlolxlxlxlxlxlxlolxlxlololxlxlxlololololol
Unless the instruction explicitly dictates otherwise, the CPU will pick
up the very next word and interpret it as an instruction. In other words, the
CPU assumes that it should move down the "street" sequentially, like a
mailman, interpreting word after word as an instruction. But this sequen-
tial order can be broken by such instructions as the JUMP instruction, and
others.
Perhaps the central point about assembly language is not its differences
from machine language, which are not that enormous, but just the key idea
that programs could be written on a different level at all! Just think about
it: the hardware is built to "understand" machine language programs-se-
quences of bits-but not letters and decimal numbers. What happens when
hardware is fed a program in assembly language? It is as if you tried to get a
cell to accept a piece of paper with the nucleotide sequence written out in
letters of the alphabet, instead of in chemicals. What can a cell do with a
piece of paper? What can a computer do with an assembly language
program?
And here is the vital point: someone can write, in machine language, a
translation program. This program, called an assembler, accepts mnemonic
instruction names, decimal numbers, and other convenient abbreviations
which a programmer can remember easily, and carries out the conversion
into the monotonous but critical bit-sequences. After the assembly lan-
guage program has been assembled (i.e., translated), it is run-or rather, its
machine language equivalent is run. But this is a matter of terminology.
Which level program is running? You can never go wrong if you say that
the machine language program is running, for hardware is always involved
when any program runs-but it is also quite reasonable to think of the
running program in terms of assembly language. For instance, you might
very well say, "Right now, the CPU is executing a JUMP instruction",
instead of saying, "Right now, the CPU is executing a '111010000' instruc-
tion". A pianist who plays the notes G-E-B E-G-B is also playing an arpeg-
gio in the chord of E minor. There is no reason to be reluctant about
describing things from a higher-level point of view. So one can think of the
assembly language program running concurrently with the machine lan-
guage program. We have two modes of describing what the CPU is doing.
The next level of the hierarchy carries much further the extremely power-
ful idea of using the computer itself to translate programs from a high level
into lower levels. After people had programmed in assembly language for a
number of years, in the early 1950's, they realized that there were a
number of characteristic structures which kept reappearing in program
after program. There seemed to be, just as in chess, certain fundamental
patterns which cropped up naturally when human beings tried to formu-
late algorithms-exact descriptions of processes they wanted carried out. In
other words, algorithms seemed to have certain higher-level components,
in terms of which they could be much more easily and esthetically specified
than in the very restricted machine language, or assembly language. Typi-
cally, a high-level algorithm component consists not of one or two machine
language instructions, but of a whole collection of them, not necesssarily all
contiguous in memory. Such a component could be represented in a
higher-level language by a single item-a chunk.
Aside from standard chunks-the newly discovered components out
of which all algorithms can be built--people realized that almost all pro-
grams contain even larger chunks---superchunks, so to speak. These
superchunks differ from program to program, depending on the kinds of
high-level tasks the program is supposed to carry out. We discussed super-
chunks in Chapter V, calling them by their usual names: "subroutines" and
"procedures". It was clear that a most powerful addition to any program-
ming language would be the ability to define new higher-level entities in
terms of previously known ones, and then to call them by name. This would
build the chunking operation right into the language. Instead of there
being a determinate repertoire of instructions out of which all programs
had to be explicitly assembled, the programmer could construct his own
modules, each with its own name, each usable anywhere inside the pro-
gram, just as if it had been a built-in feature of the language. Of course,
there is no getting away from the fact that down below, on a machine
language level, everything would still be composed of the same old machine
language instructions, but that would not be explicitly visible to the high-
level programmer; it would be implicit.
The new languages based on the50e ideas were called compiler languages.
One of the earliest and most elegant was called "Algol", for "Algorithmic
Language". Unlike the case with assembly language, there is no
straightforward one-to-one correspondence between statements in Algol
and machine language instructions. To be sure, there is still a type of
mapping from Algol into machine language, but it is far more "scrambled"
than that between assembly language and machine language. Roughly
speaking, an Algol program is to its machine language translation as a word
problem in an elementary algebra text is to the equation it translates into.
(Actually, getting from a word problem to an equation is far more complex,
but it gives some inkling of the types of "unscrambling" that have to be
carried out in translating from a high-level language to a lower-level lan-
Bootstrapping
One of the greatest problems for systems programmers (the people who
write compilers, interpreters, assemblers, and other programs to be used by
many people) is to figure out how to write error-detecting routines in such
a way that the messages which they feed to the user whose program has a
"bug" provide high-level, rather than low-level, descriptions of the prob-
lem. It is an interesting reversal that when something goes wrong in a
genetic "program" (e.g., a mutation), the "bug" is manifest only to people
on a high level-namely on the phenotype level, not the genotype level.
Actually, modern biology uses mutations as one of its principal windows
onto genetic processes, because of their multilevel traceability.
can be reached. Between the machine language level and the level where
true intelligence will be reached, I am convinced there will lie perhaps
another dozen (or even several dozen:) layers, each new layer building on
and extending the flexibilities of the layer below. What they will be like we
can hardly dream of now ...
"Sealing -off"
Similarly, and fortunately, one does not have to know all about quarks to
understand many things about the particles which they may compose.
Thus, a nuclear physicist can proceed with theories of nuclei that are based
on protons and neutrons, and ignore quark theories and their rivals. The
nuclear physicist has a chunked picture of protons and neutrons-a descrip-
tion derived from lower-level theories but which does not require under-
standing the lower-level theories. Likewise, an atomic physicist has a
chunked picture of an atomic nucleus derived from nuclear theory. Then a
chemist has a chunked picture of the electrons and their orbits, and builds
theories of small molecules, theories which can be taken over in a chunked
way by the molecular biologist, who has an intuition for how small
molecules hang together, but whose technical expertise is in the field of
extremely large molecules and how they interact. Then the cell biologist
has a chunked picture of the units which the molecular biologist pores over,
and tries to use them to account for the ways that cells interact. The point is
clear. Each level is, in some sense, "sealed off" from the levels below it.
This is another of Simon's vivid terms, recalling the way in which a sub-
marine is built in compartments, so that if one part is damaged, and water
begins pouring in, the trouble can be prevented from spreading, by closing
the doors, thereby sealing off the damaged compartment from neighbor-
ing compartments.
Although there is always some "leakage" between the hierarchical
levels of science, so that a chemist cannot afford to ignore lower-level
physics totally, or a biologist to ignore chemistry totally, there is almost no
leakage from one level to a distant level. That is why people can have
intuitive understandings of other people without necessarily understand-
ing the quark model, the structure of nuclei, the nature of electron orbits,
Epiphenomena
In drawing this Chapter to a close, I would like to relate a story about a
complex system. I was talking one day with two systems programmers for
the computer I was using. They mentioned that the operating system
seemed to be able to handle up to about thirty-five users with great com-
fort, but at about thirty-five users or so, the response time all of a sudden
shot up, getting so slow that you might as well log off and go home and wait
until later. Jokingly I said, "Well, that's simple to fix-just find the place in
the operating system where the number '35' is stored, and change it to
'60'!" Everyone laughed. The point is, of course, that there is no such place.
Where, then, does the critical number-35 users-come from? The answer
is: It is a visible consequence of the overall system organization-an "epiphenome-
non".
Similarly, you might ask about a sprinter, "Where is the '9.3' stored,
that makes him be able to run 100 yards in 9.3 seconds?" Obviously, it is not
stored anywhere. His time is a result of how he is built, what his reaction
time is, a million factors all interacting when he runs. The time is quite
reproducible, but it is not stored in his body anywhere. It is spread around
among all the cells of his body and only manifests itself in the act of the
sprint itself.
Epiphenomena abound. In the game of "Go", there is the feature that
"two eyes live". It is not built into the rules, but it is a consequence of the
. . . then, one by one, the four voices of the fugue chime in.)
Achilles: I know the rest of you won't believe this, but the answer to the
question is staring us all in the face, hidden in the picture. It is simply
one word-but what an important one: "MU"!
CCrab: I know the rest of you won't believe this, but the answer to the
question is staring us all in the face, hidden in the picture. It is simply
one word-but what an impvrtant one: "HOLISM"!
Achilles: Now hold on a minute. You must be seeing things. It's plain as
day that the message of this picture is "MU", not "HOLISM"!
Crab: I beg your pardon, but my eyesight is extremely good. Please look
again, and then tell me if the the picture doesn't say what I said it says!
Anteater: I know the rest of you won't believe this, but the answer to the
question is staring us all in the face, hidden in the picture. It is simply
one word-but what an important one: "REDUCTIONISM"!
Crab: Now hold on a minute. You must be seeing things. It's plain as day
that the message of this picture is "HOLISM", not "REDUCTION,SM"!
Achilles: Another deluded one! Not "HOLISM", not "REDUCTIONISM", but
"MU" is the message of this picture, and that much is certain.
Anteater: I beg your pardon, but my eyesight is extremely clear. Please
look again, and then see if the picture doesn't say what I said it says.
Achilles: Don't you see that the picture is composed of two pieces, and that
each of them is a single letter?
Crab: You are right about the two pieces, but you are wrong in your
identification of what they are. The piece on the left is entirely com-
posed of three copies of one word: "HOLISM"; and the piece on the right
is composed of many copies, in smaller letters, of the same word. Why
the letters are of different sizes in the two parts, I don't know, but I
know what I see, and what I see is "HOLISM", plain as day. How you see
anything else is beyond me.
Antedter: You are right about the two pieces, but you are wrong in your
identification of what they are. The piece on the left is entirely com-
posed of many copies of one word: "REDUCTIONISM"; and the piece on
the right is composed of one single copy, in larger letters, of the same
word. Why the letters are of different sizes in the two parts, I don't
know, but I know what I see, and what I see is "REDUCTIONISM", plain as
day. How you see anything else is beyond me.
Achilles: I know what is going on here. Each of you has seen letters which
compose, or are composed of, other letters. In the left-hand piece,
Tortoise: As I turned the page just now, while following along in this lovely
edition of the Well-Tempered Clavier, I noticed that the first of the two
fermatas is coming up soon-so you might listen for it, Achilles.
Achilles: I will, I will.
Tortoise: Also, there's a most curious picture facing this page.
Crab: Another one? What next?
Tortoise: See for yourself. (Passes the score over to the Crab.)
Crab: Aha! It's just a few bunches of letters. Let's see-there are various
numbers of the letters ']', 'S', 'B', 'm', 'a', and 't'. It's strange, how the
first three letters grow, and then the last three letters shrink again.
Anteater: May I see it?
Crab: Why, certainly.
Anteater: Oh, by concentrating on details, you have utterly missed the big
picture. In reality, this group of letters is 'f', 'e', 'r', 'A', 'C', 'H', without
any repetitions. First they get smaller, then they get bigger. Here,
Achilles-what do you make of it?
Achilles: Let me see. Hmm. Well, I see it as a set of upper-case letters
which grow as you move to the right.
Tortoise: Do they spell anything?
The equation
,, .. :~
l : ?
~~
. . ..
","'''',
....
~ ~
~
l' ~
"
.". .... ""400
~
~
)
~ p r r ~ ~ "jIIo
. tI\,.,/" ....
, E, (
1
1 P IJ l I
1
\
\ %
:. :
~
C;r~
(
l~ L
E U r
.c:
. "'" "".., ....
~ D
00 l l L
~ It. ~,.:~, ~," ~
~
...
E
t
t
!
3 D U 00 l Ll l L
1
I
I \I :
~
...
..
~
l P \l I....J l
L ,
l
l
J
~ ~
LL I
I
J
~
L
, ~ ~ J
~\~~ \, .... _ .....V"",/
~
"-L
".'.
~
....~l":
.
""
~
I:.
.... wJ
J
.;
J I
.::
.,
II
. :'
~
!
~
. . ,~
That these both represent the same number is not a priori clear. You can
manipulate each expression independently, and at some point stumble
across a theorem which makes you exclaim, "Oh-it's that number!"
In your mind, you can also have different mental descriptions for a
single person; for example,
That they both represent the same person is not a priori clear. Both
descriptions may sit in your mind, unconnected. At some point during the
evening you may stumble across a topic of conversation which leads to the
revelation that they designate the same person, making you exclaim,
"Oh-you're that person!"
Not all descriptions of a person need be attached to some central
symbol for that person, which stores the person's name. Descriptions can be
manufactured and manipulated in themselves. We can invent nonexistent
people by making descriptions of them; we can merge two descriptions
when we find they represent a single entity; we can split one description
into two when we find it represents two things, not one-and so on. This
"calculus of descriptions" is at the heart of thinking. It is said to be inten-
sional and not extensional, which means that descriptions can "float" without
being anchored down to specific, known objects. The intensionality of
thought is connected to its flexibility; it gives us the ability to imagine
hypothetical worlds, to amalgamate different descriptions or chop one
description into separate pieces, and so on.
Suppose a friend who has borrowed your car telephones you to say
that your car skidded off a wet mountain road, careened against a bank,
and overturned, and she narrowly escaped death. You conjure up a series
of images in your mind, which get progressively more vivid as she adds
details, and in the end you "see it all in your mind's eye". Then she tells you
that it's all been an April Fool's joke, and both she and the car are fine! In
many ways that is irrelevant. The story and the images lose nothing of their
vividness, and the memory will stay with you for a long, long time. Later,
you may even think of her as an unsafe driver because of the strength of
c"' ~",>-,--~dendrites
Auditory area
Cerebellum
Brain stem--~
F [GURE 66. The human brain, seen from the left side. It is strange that the visual area is in
the back of the head. [From Steven Rose, The Conscious Brain, updated ed. (New York: Vintage,
1966), p. 50.]
at this time be made between such large-scale suborgans and the activities,
mental or physical, which they are responsible for. For instance, it is known
that language is primarily handled in one of the two cerebral
hemispheres-in fact, usually the left hemisphere. Also, the cerebellum is the
place where trains of impulses are sent off to muscles to control motor
activity. But how these areas carry out their functions is still largely a
mystery.
Lashley was attempting to identify the locus of memory within the cortex,
and, to do so, first trained rats to rlln mazes, and then removed various
cortical regions. He allowed the animals to recover and tested the retention of
the maze-running skills. To his surprise it was not possible to find a particular
region corresponding to the ability to remember the way through a maze.
Instead all the rats which had had cortex regions removed suffered some kind
of impairment, and the extent of the impairment was roughly proportional to
the amount of cortex taken off. Removing cortex damaged the motor and
sensory capacities of the animals, and they would limp, hop, roll, or stagger,
but somehow they always managed to traverse the maze. So far as memory
was concerned, the cortex appeared to be equipotential, that is, with all
regions of equal possible utility, Indeed, Lashley concluded rather gloomily in
his last paper "In Search of the Engram", which appeared in 1950, that the
only conclusion was that memory wa~ not possible at all. 2
Curiously, evidence for the opposite point of view was being developed
in Canada at roughly the same time that Lashley was doing his last work, in
the late 1940's. The neurosurgeon Wilder Penfield was examining the
reactions of patients whose brains had been operated on, by inserting
electrodes into various parts of their exposed brains, and then using small
electrical pulses to stimulate the neuron or neurons to which the electrodes
had been attached. These pulses were similar to the pulses which come
from other neurons. What Penfield found was that stimulation of certain
A "Grandmother Cell"?
Because of the discovery of cells in the visual cortex which can be triggered
by stimuli of ever-increasing complexity, some people have wondered if
things are not leading in the direction of "one cell, one concept"-for
example, you would have a "grandmother cell" which would fire if, and
only if, your grandmother came into view. This somewhat humorous
example of a "superhypercomplex cell" is not taken very seriously. How-
ever, it is not obvious what alternative theory seems reasonable. One possi-
bility is that larger neural networks are excited collectively by sufficiently
complex visual stimuli. Of course, the triggering of these larger mul-
tineuron units would somehow have to come from integration of signals
emanating from the many hypercomplex cells. How this might be done,
nobody knows. Just when we seem to be approaching the threshold where
"symbol" might emerge from "signal", the trail gets lost-a tantalizingly
unfinished story. We will return to this story shortly, however, and try to fill
in some of it.
Earlier I mentioned the coarse-grained isomorphism between all
human brains which exists on a large anatomical scale, and the very fine-
grained, neural-level isomorphism which exists between earthworm brains.
It is quite interesting that there is also an isomorphism between the visual
processing apparatus of cat, monkey, and human, the "grain" of which is
somewhere between coarse and fine. Here is how that isomorphism works.
First of all, all three species have "dedicated" areas of cortex at the back of
their brains where visual processing is done: the visual cortex. Secondly, in
Do they extend into the lower regions of the brain, such as the
midbrain, the hypothalamus, etc.?
Can a single neuron belong to more than one such complex?
To how many such complexes can a single neuron belong?
By how many neurons can such complexes overlap?
Active Symbols
Let us from now on refer to these hypothetical neural complexes, neural
modules, neural packets, neural networks, multineuron units-call them
what you will, whether they come in the form of pancakes, garden rakes,
rattlesnakes, snowflakes, or even ripples on lakes-as symbols. A description
of a brain state in terms of symbols was alluded to in the Dialogue. What
would such a description be like? What kinds of concepts is it reasonable to
think actually might be "symbolized"? What kinds of interrelations would
symbols have? And what insights would this whole picture provide into
consciousness?
The first thing to emphasize is that symbols can be either dormant, or
awake (activated). An active symbol is one which has been triggered-that is,
one in which a threshold number of neurons have been caused to fire by
stimuli coming from outside. Since a symbol can be triggered in many
different ways, it can act in many different ways when awakened. This
suggests that we should think of a symbol not as a fixed entity, but as a
variable entity. Therefore it would not suffice to describe a brain state by
saying "Symbols A, B, ... , N are all active"; rather, we would have to supply
in addition a set of parameters for each active symbol, characterizing some
aspects of the symbol's internal workings. It is an interesting question
whether in each symbol there are certain core neurons, which invariably
fire when the symbol is activated. If such a core set of neurons exists, we
might refer to it as the "invariant core" of the symbol. It is tempting to
assume that each time you think of, say, a waterfall, some fixed neural
process is repeated, without doubt embellished in different ways depend-
ing on the context, but reliably occurring. However, it is not clear that this
must be so.
(1) a publication
(2) a newspaper
(3) The San Francisco Chronicle
(4) the May 18 edition of the Chronicle
(5) my copy of the May 18 edition of the Chronicle
(6) my copy of the May 18 edition of the Chronicle as
it was when I first picked it up (as contrasted with
my copy as it was a few days later: in my fireplace,
burning)
Here, lines 2 to 5 all play both roles. Thus, line 4 is an instance of of the
general class of line 3, and line 5 is an instance of line 4. Line 6 is a special
kind of instance of a class: a manifestation. The successive stages of an object
during its life history are its manifestations. It is interesting to wonder if the
cows on a farm perceive the invariant individual underneath all the man-
ifestations of the jolly farmer who feeds them hay.
Everyone knows that specific events have a vividness which imprints them
so strongly on the memory that they can later be used as models for other
events which are like them in some way. Thus in each specific event, there is
the germ of a whole class of similar events. This idea that there is generality
in the specific is of far-reaching importance.
Now it is natural to ask: Do the symbols in the brain represent classes,
or instances? Are there certain symbols which represent only classes, while
other symbols represent only instances? Or can a single symbol serve duty
either as a class symbol or instance symbol, depending which parts of it are
activated? The latter theory seems appealing; one might think that a "light"
activation of a symbol might represent a class, and that a deeper, or more
complex, activation would contain more detailed internal neural firing
patterns, and hence would represent an instance. But on second thought,
this is crazy: it would imply, for example, that by activating the symbol for
"publication" in a sufficiently complex way, you would get the very complex
symbol which represents a specific newspaper burning in my fireplace. And
every other possible manifestation of every other piece of printed matter
would be represented internally by some manner of activating the single
symbol for "publication". That seems much too heavy a burden to place on
the single symbol "publication". One must conclude, therefore, that in-
stance symbols can exist side by side with class symbols, and are not just
modes of activation of the latter.
, ......
.r
phenomena of nature: they have their own high-level laws which depend
on, yet are "liftable" out of, the lower levels. If, on the other hand, there is
absolutely no way to realize symbol-triggering patterns without having all
the hardware of neurons (or simulated neurons), this will imply that intelli-
gence is a brain-bound phenomenon, and much more difficult to unravel
than one which owes its existence to a hierarchy oflaws on several different
levels.
Here we come back to the mysterious collective behavior of ant col-
onies, which can build huge and intricate nests, despite the fact that the
roughly 100,000 neurons of an ant brain almost certainly do not carry any
information about nest structure. How, then, does the nest get created?
Where does the information reside? In particular, ponder where the in-
formation describing an arch such as is shown in Figure 69 can be found.
Somehow, it must be spread about in the colony, in the caste distribution,
the age distribution-and probably largely in the physical properties of the
ant-body itself. That is, the interaction between ants is determined just as
much by their six-Ieggedness and their size and so on, as by the information
stored in their brain. Could there be an Artificial Ant Colony?
Our facility for making instances out of classes and classes out of instances
lies at the basis of our intelligence, and it is one of the great differences
between human thought and the thought processes of other animals. Not
that I have ever belonged to another species and experienced at first hand
how it feels to think their way-but from the outside it is apparent that no
other species forms general concepts as we do, or imagines hypothetical
worlds-variants on the world as it is, which aid in figuring out which
future pathway to choose. For instance, consider the celebrated "language
of the bees"-information-laden dances which are performed by worker
bees returning to the hive, to inform other bees of the location of nectar.
While there may be in each bee a set of rudimentary symbols which are
activated by such a dance, there is no reason to believe that a bee has an
expandable vocabulary of symbols. Bees and other insects do not seem to
have the power to generalize-that is, to develop new class symbols from
instances which we would perceive as nearly identical.
A classic experiment with solitary wasps is reported in Dean Wool-
dridge's book, Mechanical Man, from which I quote:
When the time comes for egg laying, the wasp Sphex builds a burrow for the
purpose and seeks out a cricket which ~he stings in such a way as to paralyze
but not kill it. She drags the cricket into the burrow, lays her eggs alongside,
closes the burrow, then flies away, never to return. In due course, the eggs
hatch and the wasp grubs feed off the paralyzed cricket, which has not
decayed, having been kept in the wasp equivalent of a deepfreeze. To the
human mind, such an elaborately organized and seemingly purposeful
routine conveys a convincing flavor or logic and thoughtfulness-until more
details are examined. For example. the wasp's routine is to bring the
paralyzed cricket to the burrow, leave it on the threshold, go inside to see that
all is well, emerge, and then drag the cricket in. If the cricket is moved a few
inches away while the wasp is inside making her preliminary inspection, the
wasp, on emerging from the burrow. will bring the cricket back to the
threshold, but not inside, and will then repeat the preparatory procedure of
entering the burrow to see that everything is all right. If again the cricket is
removed a few inches while the wasp is inside, once again she will move the
cricket up to the threshold and reenter the burrow for a final check. The wasp
never thinks of pulling the cricket straight in. On one occasion this procedure
was repeated forty times, always with the same result. 4
Visual Imagery
One of the most remarkable and difficult-to-describe qualities of con-
sciousness is visual imagery. How do we create a visual image of our living
room? Of a roaring mountain brook? Of an orange? Even more mysteri-
ous, how do we manufacture images unconsciously, images which guide
our thoughts, giving them power and color and depth? From what store
are they fetched? What magic allows us to mesh two or three images, hardly
giving a thought as to how we should do it? Knowledge of how to do this is
among the most procedural of all, for we have almost no insight into what
mental imagery is.
It may be that imagery is based on our ability to suppress motor
activity. By this, I mean the following. If you imagine an orange, there may
occur in your cortex a set of commands to pick it up, to smell it, to inspect it,
and so on. Clearly these commands cannot be carried out, because the
orange is not there. But they can be sent along the usual channels towards
the cerebellum or other suborgans of the brain, until, at some critical point,
a "mental faucet" is closed, preventing them from actually being carried
out. Depending on how far down the line this "faucet" is situated, the
images may be more or less vivid and real-seeming. Anger can cause us to
Translations of "Jabberwocky"
Imagine native speakers of English, French, and German, all of whom have
excellent command of their respective native languages, and all of whom
enjoy wordplay in their own language. Would their symbol networks be
similar on a local level, or on a global level? Or is it meaningful to ask such a
question? The question becomes concrete when you look at the preceding
translations of Lewis Carroll's famous "Jabberwocky".
I chose this example because it demonstrates, perhaps better than an
example in ordinary prose, the problem of trying to find "the same node"
in two different networks which are, on some level of analysis, extremely
nonisomorphic. In ordinary language, the task of translation is more
straightforward, since to each word or phrase in the original language,
there can usually be found a corresponding word or phrase in the new
language. By contrast, in a poem of this type, many "words" do not carry
ordinary meaning, but act purely as exciters of nearby symbols. However,
what is nearby in one language may be remote in another.
Thus, in the brain of a native speaker of English, "slithy" probably
activates such symbols as "slimy", "slither", "slippery", "lithe", and "sly", to
varying extents. Does "lubricilleux" do the corresponding thing in the
brain of a Frenchman? What indeed would be "the corresponding thing"?
Would it be to activate symbols which are the ordinary translations of those
words? What if there is no word, real or fabricated, which will accomplish
that? Or what if a word does exist, but is very intellectual-sounding and
Latinate ("lubricilleux"), rather than earthy and Anglo-Saxon ("slithy")?
Perhaps "huilasse" would be better than "lubricilleux"? Or does the Latin
origin of the word "lubricilleux" not make itself felt to a speaker of French
in the way that it would if it were an English word ("lubricilious", perhaps)?
An interesting feature of the translation into French is the transposi-
tion into the present tense. To keep it in the past would make some
unnatural turns of phrase necessary, and the present tense has a much
fresher flavor in French than the past. The translator sensed that this
would be "more appropriate"-in some ill-defined yet compelling sense-
and made the switch. Who can say whether remaining faithful to the
English tense would have been better?
ASU's
An amusing geographical fantasy will give some intuition for this kind of
quasi-isomorphism. (Incidentally, this fantasy is somewhat similar to a
geographical analogy devised by M. Minsky in his article on "frames",
which can be found in P. H. Winston's book The Psychology of Computer
Vision.) Imagine that you are given a strange atlas of the USA, with all
natural geological features premarked-such as rivers, mountains, lakes,
and so on-but with nary a printed word. Rivers are shown as blue lines,
mountains by color, and so on. Now you are told to convert it into a road
atlas for a trip which you will soon make. You must neatly fill in the names
of all states, their boundaries, time zones, then all counties, cities, towns, all
freeways and highways and toll routes, all county roads, all state and
national parks, campgrounds, scenic areas, dams, airports, and so on ...
All of this must be carried out down to the level that would appear in a
detailed road atlas. And it must be manufactured out of your own head.
You are not allowed access to any information which would help you for
the duration of your task.
You are told that it will payoff, in ways that will become clear at a later
date, to make your map as true as you can. Of course, you will begin by
filling in large cities and major roads, etc., which you know. And when you
have exhausted your factual knowledge of an area, it will be to your
advantage to use your imagination to help you reproduce at least the flavor
of that area, if not its true geography, by making up fake town names, fake
populations, fake roads, fake parks, and so on. This arduous task will take
A Surprise Reversal
When your ASU is done, a surprise takes place. Magically, the country you
have designed comes into being, and you are transported there. A friendly
committee presents you with your favorite kind of automobile, and ex-
plains that, "As a reward for your designing efforts, you may now enjoy an
all-expense-paid trip, at a leisurely pace, around the good old A. S. of U.
You may go wherever you want, do whatever you wish to do, taking as long
as you wish-compliments of the Geographical Society of the ASU.
And-to guide you around-here is a road atlas." To your surprise, you
are given not the atlas which you de:;igned, but a regular road atlas of the
USA.
When you embark on your trip, all sorts of curious incidents will take
place. A road atlas is being used to guide you through a country which it
only partially fits. As long as you stick to major freeways, you will probably
be able to cross the country without gross confusions. But the moment you
wander off into the byways of New Mexico or rural Arkansas, there will be
adventure in store for you. The locals will not recognize any of the towns
you're looking for, nor will they know the roads you're asking about. They
will only know the large cities you name, and even then the routes to those
cities will not be the same as are indicated on your map. It will happen
occasionally that some of the cities which are considered huge by the locals
are nonexistent on your map of the USA; or perhaps they exist, but their
population according to the atlas is wrong by an order of magnitude.
Subsystems
There is no reason to expect that "I", or "the self", should not be rep-
resented by a symbol. In fact, the symbol for the self is probably the most
complex of all the symbols in the brain. For this reason, I choose to put it on
a new level of the hierarchy and call it a subsystem, rather than a symbol. To
be precise, by "subsystem", I mean a constellation of symbols, each of which
can be separately activated under the control of the subsystem itself. The
image I wish to convey of a subsystem is that it functions almost as an
independent "subbrain", equipped with its own repertoire of symbols
which can trigger each other internally. Of course, there is also much
communication between the subsystem and the "outside" world-that is,
the rest of the brain. "Subsystem" is just another name for an overgrown
symbol, one which has gotten so complicated that it has many subsymbols
which interact among themselves. Thus, there is no strict level distinction
between symbols and subsystems.
Because of the extensive links between a subsystem and the rest of the
brain (some of which will be described shortly), it would be very difficult to
draw a sharp boundary between the subsystem and the outside; but even if
the border is fuzzy, the subsystem is quite a real thing. The interesting
thing about a subsystem is that, once activated and left to its own devices, it
can work on its own. Thus, two or more subsystems of the brain of an
individual may operate simultaneously. I have noticed this happening on
occasion in my own brain: sometimes I become aware that two different
melodies are running through my mind, competing for "my" attention.
Somehow, each melody is being manufactured, or "played", in a separate
compartment of my brain. Each of the systems responsible for drawing a
melody out of my brain is presumably activating a number of symbols, one
after another, completely oblivious to the other system doing the same
thing. Then they both attempt to communicate with a third subsystem of
my brain-my self-symbol-and it is at that point that the "I" inside my
brain gets wind of what's going on; in other words, it starts picking up a
chunked description of the activities of those two subsystems.
Tortoise: I am so sorry to hear of the troubles that have been plaguing you,
my dear Achilles. I hope my company will provide a welcome relief
from all the unbearable stimulation which has kept you awake.
Perhaps I will bore you sufficiently that you will at long last go to sleep.
In that way, I will be of some service.
Achilles: Oh, no, I am afraid that I have already had some of the world's
finest bores try their hand at boring me to sleep-and all, sad to say, to
no avail. So you will be no match for them. No, Mr. T, I invited you
over hoping that perhaps you could entertain me with a little this or
that, taken from number theory, so that I could at least while away
these long hours in an agreeable fashion. You see, I have found that a
little number theory does wonders for my troubled psyche.
Tortoise: How quaint an idea! You know, it reminds me,just a wee bit, of
the story of poor Count Kaiserling.
Achilles: Who was he?
Tortoise: Oh, he was a Count in Saxony in the eighteenth century-a
Count of no account, to tell the truth-but because of him-well, shall
I tell you the story? It is quite entertaining.
Achilles: In that case, by all means, do!
Tortoise: There was a time when the good Count was suffering from
sleeplessness, and it just so happened that a competent musician lived
in the same town, and so Count Kaiserling commissioned this musician
to compose a set of variations to be played by the Count's court
harpsichordist for him during his sleepless nights, to make the hours
pass by more pleasantly.
Achilles: Was the local composer up to the challenge?
Tortoise: I suppose so, for after they were done, the Count rewarded him
most lucratively-he presented him with a gold goblet containing one
hundred Louis d'or.
Achilles: You don't say! I wonder where he came upon such a goblet and
all those Louis d'or, in the first place.
Tortoise: Perhaps he saw it in a museum, and took a fancy to it.
Achilles: Are you suggesting he absconded with it?
Tortoise: Now, now, I wouldn't put it exactly that way, but ... Those days,
Counts could get away with most anything. Anyway, it is clear that the
Count was most pleased with the music, for he was constantly entreat-
ing his harpsichordist-a mere lad of a fellow, name of Goldberg-to
15 IS ODD, so I make 3n + 1: 46
46 IS EVEN, so I take half: 23
23 IS ODD, so I make 3n + 1: 70
70 IS EVEN, so I take half: 35
35 IS ODD, so I make 3n + 1: 106
106 is EVEN, so I take half: 53
53 IS ODD, so I make 3n + 1: 160
160 IS EVEN, so I take half: 80
80 IS EVEN, so I take half: 40
40 IS EVEN, so I take half: 20
20 IS EVEN, so I take half: 10
10 is EVEN, so I take half: 5
5 IS ODD, so I make 3n + 1: 16
16 IS EVEN, so I take half: 8
8 IS EVEN, so I take half: 4
4 IS EVEN, so I take half: 2
2 IS EVEN, so I take half: 1.
Wow! That's quite a roundabout journey, from 15 to 1. But I finally
reached it. That shows that 15 has the property of being wondrous. I
wonder what numbers are uNwondrous ...
Tortoise: Did you notice how the numbers swung up and down, in this
simply defined process?
Achilles: Yes. I was particularly surprised, after thirteen turns, to find
myself at 16, only one greater than 15, the number I started with. In
one sense, I was almost back where I started-yet in another sense, I
was nowhere near where I had started. Also, I found it quite curious
that I had to go as high as 160 to resolve the question. I wonder how
come.
Tortoise: Yes, there is an infinite "sky" into which you can sail, and it is very
hard to know in advance how high into the sky you will wind up sailing.
Indeed, it is quite plausible that you might just sail up and up and up,
and never come down.
Achilles: Really? I guess that is conceivable-but what a weird coincidence
it would require! You'd just have to hit odd number after odd number,
with only a few evens mixed in. I doubt if that would ever happen-but
I just don't know for sure.
Tortoise: Why don't you try starting with 27? Mind you, I don't promise
anything. But sometime, just try it, for your amusement. And I'd
advise you to bring along a rather large sheet of paper.
Achilles: Hmm ... Sounds interesting. You know, it still makes me feel
funny to associate the wondrousness (or unwondrousness) with the
starting number, when it is so obviously a property of the entire
number system.
Tortoise: I understand what you mean, but it's not that different from
saying "29 is prime", or "gold is valuable"-both statements attribute to
Ganto's Ax in Metamathematics
The significance of the notion is shown by the following key fact: If you
have a sufficiently powerful formalization of number theory, then Godel's
method is applicable, and consequently your system is incomplete. If, on the
other hand, your system is not sufficiently powerful (i.e., not all primitive
recursive truths are theorems), then your system is, precisely by virtue of
that lack, incomplete. Here we have a reformulation of "Gant6's Ax" in
metamathematics: whatever the system does, Godel's Ax will chop its head
om Notice also how this completely parallels the high-fidelity-versus-low-
fidelity battle in the Contracrostipunctus.
Actually, it turns out that much weaker systems are still vulnerable to
the Godel method; the criterion that all primitive recursive truths need be
represented as theorems is far too stringent. It is a little like a thief who will
only rob "sufficiently rich" people, and whose criterion is that the potential
victim should be carrying at least a million dollars in cash. In the case of
TNT, luckily, we will be able to act in our capacity as thieves, for the million
in cash is there-which is to say, TNT does indeed contain all primitive
recursive truths as theorems.
Now before we plunge into a detailed discussion of primitive recursive
functions and predicates, I would like to tie the themes of this Chapter to
themes from earlier Chapters, so as to provide a bit better motivation.
Jauch is here dealing with messages that come not from a "sentient
being" but from nature itself. The questions that we raised in Chapter VI
on the relation of meaning to messages can be raised equally well with
messages from nature. Is nature chaotic, or is nature patterned? And what
is the role of intelligence in determining the answer to this question?
To back off from the philosophy, however, we can consider the point
about the deep regularity of an apparently random sequence. Might the
function Q( n} from Chapter V have a simple, nonrecursive explanation,
too? Can every problem, like an orchard, be seen from such an angle that
its secret is revealed? Or are there some problems in number theory which,
no matter what angle they are seen from, remain mysteries?
With this prologue, I feel it is time to move ahead to define the precise
meaning of the term "predictably long search". This will be accomplished
in terms of the language BlooP.
Conventions of BlooP
Now it is an acquired skill to be able to look at an algorithm written in a
computer language, and figure out what it is doing. However, I hope that
this algorithm is simple enough that it makes sense without too much
Evaluate the expression to its right, then take the result and set the
CELL (or OUTPUT) on its left to that value.
Here we are making use of the implicit feature that OUTPUT begins at
O. If M is less than N, then the subtraction is impossible, and we simply
jump to the bottom of BLOCK 0 right away, and the answer is O. That is
what is meant by the line QUIT BLOCK O. But if M is not less than N, then
we skip over that QUIT-statement, and carry out the next command in
sequence (here, a LOOP-statement). That is how IF-statements always work
in BlooP.
So we enter LOOP t, so called because the block which it tells us to
repeat is BLOCK t. We try adding 0 to N, then 1, 2, etc., until we find a
number that gives M. At that point, we ABORT the loop we are in, meaning
we jump to the statement immediately following the END which marks the
bottom of the loop's block. In this case, that jump brings us just below
BLOCK t: END, which is to say, to the last statement of the algorithm, and
we are done. OUTPUT now contains the correct answer.
Notice that there are two distinct instructions for jumping downwards:
QUIT, and ABORT. The former pertains to blocks, the latter to loops. QUIT
BLOCK n means to jump to the last line of BLOCK n, whereas ABORT LOOP n
means to jump just below the last line of BLOCK n. This distinction only
matters when you are inside a loop and want to continue looping but to quit
the block this time around. Then you can say QUIT and the proper thing
will happen.
Also notice that the words AT MOST now precede the upper bound of
the loop, which is a warning that the loop may be aborted before the upper
bound is reached.
Automatic Chunking
Now there are two last features of BlooP to explain, both of them very
important. The first is that, once a procedure has been defined, it may be
called inside later procedure definitions. The effect of this is that once an
operation has been defined in a procedure, it is considered as simple as a primordial
step. Thus, BlooP features automatic chunking. You might compare it to
the way a good ice skater acquires new motions: not by defining them as
long sequences of primordial muscle-actions, but in terms of previously
learned motions, which were themselves learned as compounds of earlier
BlooP Tests
The other feature of BlooP is that certain procedures can have YES or NO
as their output, instead of an integer value. Such procedures are tests,
rather thanfunctions. To indicate the difference, the name of a test must
terminate in a question mark. Also, in a test, the default option for OUTPUT
is not 0, of course, but NO.
Let us see an example of these last two features of BlooP in an
algorithm which tests its argument for primality:
Notice that I have called two procedures inside this algorithm: MINUS and
REMAINDER. (The latter is presumed to have been previously defined, and
you may work out its definition yourself.) Now this test for primality works
by trying out potential factors of N one by one, starting at 2 and increasing
to a maximum of N - t. In case any of them divides N exactly (i.e., gives
remainder 0), then we jump down to the bottom, and since OUTPUT still
has its default value at this stage, the answer is NO. Only if N has no exact
divisors will it survive the entirety of LOOP t; then we will emerge smoothly
at the statement OUTPUT : YES, which will get executed, and then the
procedure is over.
{ ~r~c:d~r~ :
definition I
l #2
_____ J I
(-----,
I proced ure I
I
I
d e fi mtlon
.. I
I
l _ -.:~~ __ j
etc.
INPUT >:>:>---~f>~r~c;d:r~ -:
: definitIOIl !
#k ;:)~>--...,:> OUTPUT
l _____ ..J
Suggested Exercises
Can you write a similar BlooP procedure which tests for the presence or
absence of the Tortoise property (or the Achilles property)? If so, do it. If
not, is it merely because you are ignorant about upper bounds, or could it
be that there is a fundamental obstacle preventing the formulation of such
an algorithm in BlooP? And what about the same questions, with respect to
the property of wondrousness, defined in the Dialogue?
Below, I list some functions and properties, and you ought to take the
time to determine whether you believe they are primitive recursive
(BlooP-programmable) or not. This means that you must carefully consider
what kinds of operations will be involved in the calculations which they
require, and whether ceilings can be given for all the loops involved.
By "instance", I mean the string produced when you replace all free
variables by numerals. For example, the predicate m + n = k is represented
in the pq-system, because each true instance of the predicate is a theorem,
each false instance is a nontheorem. Thus any specific addition, whether
true or false, translates into a decidable string of the pq-system. However, the
pq-system is unable to express-let alone represent-any other properties
of natural numbers. Therefore it would be a weak candidate indeed in a
competition of systems which can do number theory.
Now TNT has the virtue of being able to express virtually any number-
theoretical predicate; for example, it is easy to write a TNT -string which
expresses the predicate "b has the Tortoise property". Thus, in terms of
expressive power, TNT is all we want.
However, the question "Which properties are represented in TNT?" is
precisely the question "How powerful an axiomatic system is TNT?" Are all
possible predicates represented in TNT? If so, then TNT can answer any
question of number theory; it is complete.
-and at the end comes the lowly blank! Altogether, fifty-six characters. For
convenience's sake, we can put all Blue Programs of length 1 in Volume 1,
programs of 2 characters in Volume 2, etc. Needless to say, the first few
volumes will be totally empty, while later volumes will have many, many
entries (though each volume will only have a finite number). The very first
Blue Program would be this one:
This rather silly meat grinder returns a value of 0 no matter what its input
is. It occurs in Volume 56, since it has 56 characters (counting necessary
blanks, including blanks separating successive lines).
Soon after Volume 56, the volumes will get extremely fat, because
there are just so many millions of ways of combining symbols to make Blue
BlooP programs. But no matter-we are not going to try to print out this
infinite catalogue. All that we care about is that, in the abstract, it is
well-defined, and that each Blue BlooP program therefore has a unique
and definite index number. This is the crucial idea.
Let us designate the function calculated by the kth Blue Program this
way:
Blueprogram{# k} [N]
Here, k is the index number of the program, and N is the single input
parameter. For instance, Blue Program #12 might return a value twice the
size of its input:
Blueprogram{#12} [N] = 2 X N
The meaning of the equation above is that the program named on the
left-hand side returns the same value as a human would calculate from the
ordinary algebraic expression on the right-hand side. As another example,
perhaps the 5000th Blue Program calculates the cube of its input parame-
ter:
Blueprogram{#5000} [N] = N3
The strategy is: feed each meat grinder with its own index number, then
add 1 to the output. To illustrate, let us find Bluediag [12]. We saw that
Blueprogram{#12} is the function 2N; therefore, Bluediag [12] must have
the value 1 + 2 X 12, or 25. Likewise, Bluediag [5000] would have the value
125,000,000,001, since that is 1 more than the cube of 5000. Similarly, you
can find Bluediag of any particular argument you wish.
The peculiar thing about Bluediag [N] is that it is not represented in
the catalogue of Blue Programs. It cannot be. The reason is this. To be a
Blue Program, it would have to have an index number-say it were Blue
Program # X. This assumption is expressed by writing
But there is an inconsistency between the equations (1) and (2). It becomes
apparent at the moment we try to calculate the value of Bluediag [X], for
we can do so by letting N take the value of X in either of the two equations.
If we substitute into equation (1), we get:
Now Bluediag [X] cannot be equal to a number and also to the successor of
that number. But that is what the two equations say. So we will have to go
back and erase some assumption on which the inconsistency is based. The
only possible candidate for erasure is the assumption expressed by Equa-
tion (2): that the function Bluediag [N] is able to be coded up as a Blue
BlooP program. And that is the proof that Bluediag lies outside the realm of
primitive recursive functions. Thus, we have achieved our aim of destroying
Achilles' cherished but naive notion that every number-theoretical function
must be calculable within a predictable number of steps.
There are some subtle things going on here. You might ponder this,
for instance: the number of steps involved in the calculation of
Bluediag [N], for each specific value of N, is predictable-but the different
methods of prediction cannot all be united into a general recipe for predict-
r( 1): .1 4 1 5 9 2 6 5 3
r(2): .3 3 3 3 3 3 3 3 3
r(3): .7 8 2 8 1 8 2 8
r(4): .4 1 4 2 1 3 5 6 2
r(5): .5 0 0 0 0 0 0 0 0
The digits that run down the diagonal are in boldface: 1,3,8,2,0, ... Now
those diagonal digits are going to be used in making a special real number
d, which is between 0 and 1 but which, we will see, is not in the list. To
make d, you take the diagonal digits in order, and change each one of them
to some other digit. When you prefix this sequence of digits by a decimal
point, you have d. There are of course many ways of changing a digit to
some other digit, and correspondingly many different d's. Suppose, for
.0 2 7 9
Hence,
d is different from r(l);
d is different from r(2);
d is different from r(3);
... and so on.
Cantor's proof uses a diagonal in the literal sense of the word. Other
"diagonal" proofs are based on a more general notion, which is abstracted
from the geometric sense of the word. The essence of the diagonal method
is the fact of using one integer in two different ways-or, one could say,
using one integer on two different levels-thanks to which one can construct an
item which is outside of some predetermined list. One time, the integer
serves as a vertical index, the other time as a horizontal index. In Cantor's
construction this is very clear. As for the function Bluediag [N], it involves
using one integer on two different levels-first, as a Blue Program index
number; and second, as an input parameter.
MU-LOOP:
BLOCK n: BEGIN
BLOCK n: END;
(1) If its input, N, is wondrous, the program halts and gives the
answer YES.
(2) If N is unwondrous, but causes a closed cycle other than
1-4-2-1-4-2-1- ... , the program halts and gives the answer
NO.
(3) If N is unwondrous, and causes an "endlessly rising progres-
sion", the program never halts. This is FlooP's way of answer-
ing by not answering. FlooP's nonanswer bears a strange
resemblance to joshli's nonanswer "MU".
The irony of case 3 is that OUTPUT always has the value NO, but it is always
inaccessible, since the program is still grinding away. That troublesome
third alternative is the price that we must pay for the right to write free
loops. In all FlooP programs incorporating the MU-LOOP option, nonter-
mination will always be one theoretical alternative. Of course there will be
many FlooP programs which actually terminate for all possible input val-
ues. For instance, as I mentioned earlier, it is suspected by most people who
have studied wondrousness that a FlooP program such as suggested above
will always terminate, and moreover with the answer YES each time.
Turing's Trickery
The idea springs to mind that we might let a BlooP procedure do the
inspection. But BlooP procedures only accept numerical input, not pro-
grams! However, we can get around that ... by coding programs into
numbers! This sly trick is just Godel-numbering in another of its many
manifestations. Let the fifty-six characters of the FlooP alphabet get the
"codons" 901, 902, ... ,956, respectively. So each FlooP program now gets
Let us call these special FlooP-programs Green Programs (since they may go
forever).
Now just as we assigned index numbers to all Blue Programs, we can
assign index numbers to Green Programs, by ordering them in a catalogue,
each volume of which contains all Green Programs of a fixed length,
arranged in alphabetical order.
So far, the carry-over from BlooP to FlooP has been straightforward.
Now let us see if we can also carryover the last part: the diagonal trick.
What if we try to define a diagonal function?
Let us call these special FlooP programs Red Programs (since they all must
stop). Now, the diagonal argument will go through. We define
GlooP .. .
Yes, but what is GlooP? If FlooP is BlooP unchained, then GlooP must be
FlooP unchained. But how can you take the chains off twice? How do you
make a language whose power transcends that of FlooP? In Reddiag, we
have found a function whose values we humans know how to calculate-the
method of doing so has been explicitly described in English-but which
seemingly cannot be programmed in the language FlooP. This is a serious
dilemma because no one has ever found any more powerful computer
language than FlooP.
Careful investigation into the power of computer languages has been
carried out. We need not do it ourselves; let it just be reported that there is
a vast class of computer languages all of which can be proven to have exactly
the same expressive power as FlooP does, in this sense: any calculation which
can be programmed in anyone of the languages can be programmed in
them all. The curious thing is that almost any sensible attempt at designing
a computer language ends up by creating a member of this class-which is
to say, a language of power equal to that of FlooP. It takes some doing to
invent a reasonably interesting computer language which is weaker than
those in this class. BlooP is, of course, an example of a weaker language, but
it is the exception rather than the rule. The point is that there are some
extremely natural ways to go about inventing algorithmic languages; and
different people, following independent routes, usually wind up creating
equivalent languages, with the only difference being style, rather than
power.
... Is a Myth
In fact, it is widely believed that there cannot be any more powerful
language for describing calculations than languages that are equivalent to
FlooP. This hypothesis was formulated in the 1930's by two people, inde-
pendently of each other: Alan Turing-about whom we will say more
later-and Alonzo Church, one of the eminent logicians of this century. It
The Tortoise and Achilles have just completed a tour of a porridge factory.
Tortoise: Oh, heavens, you're getting a little involved here. I hope this all
isn't going to be too highbrow for my modest mind.
Achilles: Oh, don't worry-you'll surely catch on. With this choice, Sen-
tence Q becomes ...
"WHEN QUI NED, YIELDS A TORTOISE'S LOVE-SONG"
WHEN QUI NED, YIELDS A TORTOISE'S LOVE-SONG.
Tortoise: Oh, you wily old warrior you, I catch on. Now Sentence Q is just
the same as Sentence P.
Achilles: And since Sentence Q is always the topic of Sentence P, there is a
loop, so now, P points back to itself. But you see, the self-reference is a
On Formally Undecidable
Propositions of TNT
and Related Systems l
The analogous notion exists with respect to the MI U-system, and it is a little
easier on the intuition to consider that case first. So, for a moment, let us
back off from TNT-proof-pairs, and look at MIU-proof-pairs. Their
definition is parallel:
Ml
Mil
Mllli
MUI
whose last line is MUl, having Godel number 301, which is n. By contrast,
let m = 31311311130, and n = 30. Why do these two values not form a
MIU-proof-pair? To see the answer, let us write out the alleged derivation
which m codes for:
Ml
Mil
Mlll
MU
There is an invalid step in this alleged derivation! It is the step from the
second to the third line: from Mil to Mill. There is no rule of inference in
the MIU-system which permits such a typographical step.
Correspondingly-and this is most crucial-there is no arithmetical rule of
inference which carries you from 311 to 3111. This is perhaps a trivial
observation, in light of our discussion in Chapter IX, yet it is at the heart of
the Godel isomorphism. What we do in any formal system has its parallel in
arithmetical manipulations.
In any case, the values m = 31311311130, n = 30 certainly do not
form a MIU-proof-pair. This in itself does not imply that 30 is not a
MIU-number. There could be another value of m which forms a MIU-
proof-pair with 30. (Actually, we know by earlier reasoning that MU is not a
MIU-theorem, and therefore no number at all can form a MIU-proof-pair
with 30.)
Now what about TNT-proof-pairs? Here are two parallel examples,
one being merely an alleged TNT-proof-pair, the other being a valid
TNT-proof-pair. Can you spot which is which? (Incidentally, here is where
It is quite simple to tell which one is which, simply by translating back to the
old notation, and making some routine examinations to see
At each stage, there is a clear set of tasks to perform, and the number of
them is quite easily determinable in advance.
Once again, we are being casual about specifying which system these
proof-pairs are relative to; it really doesn't matter, for both Fundamental
Facts hold for any formal system. That is the nature of formal systems: it is
always possible to tell, in a predictably terminating way, whether a given
sequence of lines forms a proof, or not-and this carries over to the
corresponding arithmetical notions.
MlU-PROOF-PAlR{a,a'}
Count the S's: there are 30. Note that this is a closed sentence of TNT,
because one free variable was quantified, the other replaced by a numeraL
A clever thing has been done here, by the way. Fundamental Fact 2 gave us
a way to talk about proof-pairs; we have figured out how to talk about
theorem-numbers, as well: you just add an existential quantifier in front! A
more literal translation of the string above would be, "There exists some
number a that forms a MIU-proof-pair with 30 as its second element".
Suppose that we wanted to do something parallel with respect to
TNT-say, to express the statement "0=0 is a theorem of TNT". We may
abbreviate the formula which Fundamental Fact 2 assures us exists, in an
analogous way (with two free variables, again):
TNT-PROOF-PAIR{a,a'}
-------------
3a:TNT-PROOF-PAIR{a,SSSSS........ .sSSSSO/a'}
3a:TNT-PROOF-PAIR{a,a'}
a=a 262,111,262
We now replace all
free variables by
the numeral for 2:
sso=sso
1
123,123,666,111,123,123,666
* * * * *
-3a:3a':a" =(SSa SSa') 223,333,262,636,333,262,163,636,
262,163,163,111,362,123,123,262,
236,123 '12l62 ,163 ,323
We now replace all
free variables by
the numeral for 4:
-3a:3a':SSSSO=(SSa SSa') 223,333,262,636,333,262,163,636,
123,123,123,123,666,111,362,123,
123,262,236,123,123,262,163,323
(1) 362,262,112,262,163,323,111,123,123,123,123,666;
2;
362,123,123,666,112,123, 123,666,323,111,123,123,123,123,666.
(2) 223,362,262,236,262,323,111,262,163;
1;
223,362,123,666,236,123,666,323,111,262,163.
As usual, one of the examples checks, the other does not. Now this relation-
ship between three numbers will be called the substitution relationship.
Because it is primitive recursive, it is represented by some formula of TNT
having three free variables. Let us abbreviate that TNT -formula by the
following notation:
SUB{ a,a' ,a"}
(This is based on the first example of the substitution relation shown in the
parallel columns earlier in this section.) And again because the SUB for-
mula represents the substitution relation, the formula shown below cer-
tainly is not a TNT-theorem:
SUB{SSSO/a,SSO/a',SO/a"}
Arithmoquining
We now have reached the crucial point where we can combine all of our
disassembled parts into one meaningful whole. We want to use the machin-
ery of the TNT-PROOF-PAlR and SUB formulas in some way to construct a
single sentence of TNT whose interpretation is: "This very string of TNT
is not a TNT -theorem." How do we do it? Even at this point, with all the
necessary machinery in front of us, the answer is not easy to find.
A curious and perhaps frivolous-seeming notion is that of substituting
a formula's own G6del number into itself. This is quite parallel to that other
curious, and perhaps frivolous-seeming, notion of "quining" in the Air on
C's String. Yet quining turned out to have a funny kind of importance, in
that it showed a new way of making a self-referential sentence. Self-
reference of the Quine variety sneaks up on you from behind the first time
you see it-but once you understand the principle, you appreciate that it is
quite simple and lovely. The arithmetical version of quining-let's call it
arithmoquining-will allow us to make a TNT-sentence which is "about
itself".
Let us see an example of arithmoquining. We need a formula with at
least one free variable. The following one will do:
a=SO
-----------
SSSSS ..... SSSSSO = SO
262,111,123,666 S's
where the first two variables are the same. This comes from the fact that we
are using a single number in two different ways (shades of the Cantor
diagonal method!). The number a" is both (1) the original Godel number,
and (2) the insertion-number. Let us invent an abbreviation for the above
formula:
ARlTHMOQUINE{a", a'}
Now the preceding sentence is long and ugly. Let's introduce a concise and
elegant term to summarize it. We'll say
----------~-----------
262,111,123,666 copies of '123'
-3a:3a':<TNT-PROOF-PAIR{a,a'}AARITHMOQUINE{a",a'}>
For the rest, we'd have to know just how the formulas TNT-PROOF-PAIR
and ARITHMOQUINE actually look when written out. That is too complex,
and it is quite beside the point, in any case.
Now all we need to do is-arithmoquine this very uncle! What this
entails is "booting out" all free variables-of which there is only one,
namely a"-and putting in the numeral for u everywhere. This gives us:
-3a:3a':<TNT-PROOF-PAIR{a,a'}AARITHMOQUINE{SSS ... SSSO/a",a'}>
----------
uS's
And this, believe it or not, is Godel's string, which we can call 'G'. Now there
are two questions we must answer without delay. They are
Question 1 first. How did we make G? Well, we began with the uncle, and
arithmoquined it. So, by the definition of arithmoquinification, G's Godel
number is:
the arithmoquinification of u.
"There do not exist numbers a and a' such that both (1) they form
a TNT-proof-pair, and (2) a' is the arithmoquinification of u."
-3a:3a':<TORTOISE-PAIR{a,a'}ATENTH-POWER{SSO/a",a'}>
where the two abbreviations are for strings of TNT which you can write
down yourself. TENTH-POWER{a",a'} represents the statement "a' is the
tenth power of a"". The literal translation into English is then:
"There do not exist numbers a and a' such that both (1) they form
a Tortoise-pair, and (2) a' is the tenth power of 2."
But dearly, there is a tenth power of 2-namely lO24. Therefore, what the
string is really saying is that
------------
-3a:TNT-PROOF-PAIR{a,SSSSS ..... SSSSSO/a'}
223,666,111,666 S's
TNT Is w-Incomplete
Now what variety of incompleteness does TNT "enjoy"? We shall see that
TNT's incompleteness is of the "omega" variety-defined in Chapter VIII.
This means that there is some infinite pyramidal family of strings all of
which are theorems, but whose associated "summarizing string" is a non-
theorem. It is easy to exhibit the summarizing string which is a nontheo-
rem:
uS's
~
What does each one assert? Their translations, one by one, are:
Now each of these assertions is about whether two specific integers form a
proof-pair or not. (By contrast, C itself is about whether one specific integer
is a theorem-number or not.) Now because'C is a nontheorem, no integer
forms a proof-pair with C's Codel number. Therefore, each of the state-
ments of the family is true. Now the crux of the matter is that the property
of being a proof-pair is primitive recursive, hence represented, so that each
of the statements in the list above, being true, must translate into a theorem
of TNT-which means that everything in our infinite pyramidal family is a
theorem. And that shows why TNT is w-incomplete.
But how can we even contemplate doing such a repugnant, hideous thing?
After all, to paraphrase the memorable words of Girolamo Saccheri, isn't
what -G says "repugnant to the nature of the natural numbers"?
Supernatural Numbers
I hope the irony of this quotation strikes you. The exact problem with
Saccheri's approach to geometry was that he began with a fixed notion of
what was true and what was not true, and he set out only to prove what he'd
assessed as true to start with. Despite t.he cleverness of his approach-which
involved denying the fifth postulate, and then proving many "repugnant"
propositions of the ensuing geometry-Saccheri never entertained the
possibility of other ways of thinking about points and lines. Now we should
be wary of repeating this famous mist.ake. We must consider impartially, to
the extent that we can, what it would mean to add -G as an axiom to TNT.
Just think what mathematics would be like today if people had never
considered adding new axioms of the following sorts:
3a:(a+a)=50
3a:5a=0
3a:(a a) =550
3a:5(aa) =0
Va:Va':(a+a')=(a' +a)
a=O
and
5x + 13y - 1 =0
and
5p5 + 17 q l7 - 177 = 0
and
One fine May day, the Tortoise and Achilles meet, wandering in the woods.
The latter, all decked out handsomely, is doing a jiggish sort of thing to a
tune which he himself is humming. On his vest he is wearing a great big
button with the words "Today is my Birthday!"
Tortoise: Hello there, Achilles. What makes you so joyful today? Is it your
birthday, by any chance?
Achilles: Yes, yes! Yes it is, today is my birthday!
Tortoise: That is what I had suspected, on account of that button which
you are wearing, and also because unless I am mistaken, you are
singing a tune from a Birthday Cantata by Bach, one written in 1727
for the fifty-seventh birthday of Augustus, King of Saxony.
Achilles: You're right. And Augustus' birthday coincides with mine, so
THIS Birthday Cantata has double meaning. However, I shan't tell you
my age.
Tortoise: Oh, that's perfectly all right. However, I would like to know one
other thing. From what you have told me so far, would it be correct to
conclude that today is your birthday?
Achilles: Yes, yes, it would be. Today IS my birthday.
Tortoise: Excellent. That'sjust as I suspected. So now, I WILL conclude it is
your birthday, unless-
Achilles: Yes-unless what?
Tortoise: Unless that would be a premature or hasty conclusion to draw,
you know. Tortoises don't like to jump to conclusions, after all. (We
don't like to jump at all, but especially not to conclusions.) So let me
just ask you, knowing full well of your fondness for logical thought,
whether it would be reasonable to deduce logically from the foregoing
sentences, that today is in fact your birthday.
Achilles: I do believe I detect a pattern to your questions, Mr. T. But
rather than jump to conclusions myself, I shall take your question at
face value, and answer it straightforwardly. The answer is: YES.
Tortoise: Fine! Fine! Then there is only one more thing I need to know, to
be quite certain that today is-
Achilles: Yes, yes, yes, yes ... I can already see the line of your question-
ing, Mr. T. I'll have you know that I am not so gullible as I was when
we discussed Euclid's proof, a while back.
Tortoise: Why, who would ever have thought you to be gullible? Quite to
the contrary, I regard you as an expert in the forms of logical thought,
an authority in the science of valid deductions, a fount of knowledge
about correct methods of reasoning ... To tell the truth, Achilles, you
are, in my opinion, a veritable titan in the art of rational cogitation.
Actually, it is not much of a trick, once you have seen it done for TNT. All
the same principles are employed; only the context shifts slightly. (Figura-
tively speaking, we take a tune we know and simply sing it again, only in a
higher key.) As before, the string which we are looking for-let us call it
"G' "-is constructed by the intermediary of an "uncle". But instead of
being based on the formula which represents TNT-proof-pairs, it is based
on the similar but slightly more complicated notion of TNT +G-proof-
pairs. This notion of TNT +G-proof-pairs is only a slight extension of the
original notion of TNT -proof-pairs.
A similar extension could be envisaged for the MIU-system. We have
seen the unadulterated form of MIU-proof-pairs. Were we now to add MU
as a second axiom, we would be dealing with a new system-the MIU +MU
system. A derivation in this extended system is presented:
MU axiom
MUU rule 2
-3a:3a':TNT +G)-PROOF-PAlR{a,a'}AARlTHMOQUlNE{a",a'}>
Let us say its Godel-number is u'. Now we arithmoquine this very uncle.
That will give us G':
-3a:3a':TNT +G)-PROOF-PAlR{a,a'}
AARlTHMOQUlNE{SSS .... SSSO/a",a'}>
~
u'S's
More concisely,
Multifurcation
Well (yawn), the details are quite boring from here on out. G' is precisely to
TNT +G as G was to TNT itself. One finds that either G' or -G' can be
added to TNT +G, to yield a further splitting of number theory. And, lest
you think this only happens to the "good guys", this very same dastardly
trick can be played upon TNT +-G-that is, upon the nonstandard exten-
sion of TNT gotten by adding G's negation. So now we see (Fig. 75) that
there are all sorts of bifurcations in number theory:
FICURE 75. "Multifurcation" of TNT. Each extension of TNT has its very own Cadet
sentence; that sentence, or its negation, can be added on, so that from each extension there
sprouts a pair of further extensions, a process which goes on ad infinitum.
Of course, this is just the beginning. Let us imagine moving down the
leftmost branch of this downwards-pointing tree, where we always toss in
the Godel sentences (rather than their negations). This is the best we can do
by way of eliminating supernaturals. After adding G, we add G'. Then we
add Gil, and G'II, and so on. Each time we make a new extension of TNT,
its vulnerability to the Tortoise's method-pardon me, I mean Godel's
method-allows a new string to be devised, having the interpretation
Essential Incompleteness
As you probably suspected, even this fantastic advance over TNT suffers
the same fate. And what makes it quite weird is that it is still for, in essence,
the same reason. The axiom schema is not powerful enough, and the Godel
construction can again be effected. Let me spell this out a little. (One can do
it much more rigorously tpan I shall here.) If there is a way of capturing the
various strings G, G', G", G''', ... in a single typographical mold, then there
is a way of describing their Godel numbers in a single arithmetical mold.
And this arithmetical portrayal of an infinite class of numbers can then be
represented inside TNT +Gw by some formula OMEGA-AXlOM{a} whose
interpretation is: "a is the Godel number of one of the axioms coming from
Gw". When a is replaced by any specific numeral, the formula which results
will be a theorem of TNT +Gw if and only if the numeral stands for the
Godel number of an axiom coming from the schema.
With the aid of this new formula, it becomes possible to represent even
such a complicated notion as TNT+Gw-proof-pairs inside TNT +Gw:
(TNT +Gw)-PROOF-PAIR{a,a'}
Now this step-by-step process may seem a doltish way to patch up L, for we
could have made the entire list d, d', d", d''', ... at once, given L originally.
But if you think that making such a list will enable you to complete your list
of reals, you are very wrong. The problem comes at the moment you ask,
"Where to incorporate the list of diagonal numbers inside L?" No matter
how diabolically clever a scheme you devise for ensconcing the d-numbers
inside L, once you have done it, then the new list is still vulnerable. As was
said above, it is the act of giving an explicit list-a "box" of reals-that
causes the downfall.
Now in the case of formal systems, it is the act of giving an explicit
recipe for what supposedly characterizes number-theoretical truth that
causes the incompleteness. This is the crux of the problem with TNT +Gw.
Once you insert all the G's in a well-defined way into TNT, there is seen to
be some other G-some unforeseen G-which you didn't capture in your
axiom schema. And in the case of the TC-battle inside the Contracros-
tipunctus, the instant a record player's "architecture" is determined, the
record player becomes capable of being shaken to pieces.
So what is to be done? There is no end in sight. It appears that TNT,
even when extended ad infinitum, cannot be made complete. TNT is
therefore said to suffer from essential incompleteness because the incom-
(1) That the system should be rich enough so that all desired
statements about numbers, whether true or false, can be
expressed in it. (Failure on this count means that the system is
from the very start too weak to be counted as a rival to TNT,
because it can't even express number-theoretical notions that
TNT can. In the metaphor of the Contracrostipunctus, it is as if
one did not have a phonograph but a refrigerator or some
other kind of object.)
(2) That all general recursive relations should be represented by
formulas in the system. (Failure on this count means the
system fails to capture in a theorem some general recursive
truth, which can only be considered a pathetic bellyftop if it is
attempting to produce all of number theory's truths. In the
Contracrostipunctus metaphor, this is like having a record
player, but one of low fidelity.)
(3) That the axioms and typographical patterns defined by its
rules be recognizable by some terminating decision proce-
dure. (Failure on this count means that there is no method to
distinguish valid derivations in the system from invalid
ones-thus that the "formal system" is not formal after all,
and in fact is not even well-defined. In the Contracrostipunctus
metaphor, it is a phonograph which is still on the drawing
board, only partially designed.)
Jumping Up a Dimension
A visual image provided by M, C. Escher is extremely useful in aiding the
intuition here: his drawing Dragon (Fig, 76). Its most salient feature is, of
course, its subject matter-a dragon biting its tail, with all the G6delian
connotations which that carries. But there is a deeper theme to this picture,
Escher himself wrote the following most interesting comments. The first
comment is about a set of his drawings all of which are concerned with "the
conflict between the flat and the spatial"; the second comment is about
Dragon in particular.
I. Our three-dimensional space is the only true reality we know. The two-
dimensional is every bit as fictitious as the four-dimensional, for nothing is
flat, not even the most finely polished mirror. And yet we stick to the conven-
tion that a wall or a piece of paper is flat, and curiously enough, we still go on,
as we have done since time immemorial, producing illusions of space on just
such plane surfaces as these. Surely it is a bit absurd to draw a few lines and
then claim: "This is a house". This odd situation is the theme of the next five
pictures [including Dragon).4
II. However much this dragon tries to be spatial, he remains completely flat.
Two incisions are made in the paper on which he is printed. Then it is folded
in such a way as to leave two square openings. But this dragon is an obstinate
beast, and in spite of his two dimensions he persists in assuming that he has
three; so he sticks his head through one of the holes and his tail through the
other. 5
This second remark especially is a very telling remark. The message is that
no matter how cleverly you try to simulate three dimensions in two, you are
always missing some "essence of three-dimensionality". The dragon tries
very hard to fight his two-dimensionality. He defies the two-dimensionality
of the paper on which he thinks he is drawn, by sticking his head through
it; and yet all the while, we outside the drawing can see the pathetic futility
of it all, for the dragon and the holes and the folds are all merely two-
dimensional simulations of those concepts, and not a one of them is real.
But the dragon cannot step out of his two-dimensional space, and cannot
know it as we do. We could, in fact, carry the Escher picture any number of
steps further. For instance, we could tear it out of the book, fold it, cut
holes in it, pass it through itself, and photograph the whole mess, so that it
again becomes two-dimensional. And to that photograph, we could once
again do the same trick. Each time, at the instant that it becomes two-
dimensional-no matter how cleverly we seem to have simulated three
dimensions inside two-it becomes vulnerable to being cut and folded
again.
are all subsumed into one outrageously complex answer schema. The
altogether new name 'Eo' is supplied for this one. And the reason a
new name is needed is that some fundamentally new kind of step has
been taken-a sort of irregularity has been encountered. Thus a new name
must be supplied ad hoc.
Achilles: I see you have made a few additions since I was last here, Mr.
Crab. Your new paintings are especially striking.
Crab: Thank you. I am quite fond of certain painters-especially Rene
Magritte. Most of the paintings I have are by him. He's my favorite
artist.
Achilles: They are very intriguing Images, I must say. In some ways, these
paintings by Magritte remind me of works by MY favorite artist, M. C.
Escher.
Crab: I can see that. Both Magritte and Escher use great realism in
exploring the worlds of paradox and illusion; both have a sure sense
for the evocative power of certain visual symbols, and-something
which even their admirers often fail to point out-both of them have a
sense of the graceful line.
Achilles: Nevertheless, there is something quite different about them. I
wonder how one could characterize that difference.
Crab: It would be fascinating to compare the two in detail.
Achilles: I must say, Magritte's command of realism is astonishing. For
instance, I was quite taken in by that painting over there of a tree with
a giant pipe behind it.
,--
.,::,~ ....
f -. ~.-_
-; ~.; -
Crab: You mean, a normal pipe with a tiny tree in front of it!
Achilles: Oh, is that what it is? Well, in any case, when I first spotted it, I
was convinced I was smelling pipe smoke! Can you imagine how silly I
felt?
Crab: I quite understand. My guests are often taken in by that one.
(So saying, he reaches up, removes the pipe from behind the tree in the
painting, turns it over and taps it against the table, and the room begins to
reek of pipe tobacco. He begins packing in a new wad of tobacco.)
This is a fine old pipe, Achilles. Believe it or not, the bowl has a copper
lining, which makes it age wonderfully.
Achilles: A copper lining! You don't say!
Crab (pulls out a box of matches, and lights his pipe): Would you care for a
smoke, Achilles?
Achilles: No, thank you. I only smoke cigars now and then.
Crab: No problem! I have one right here! (Reaches out towards another
Magritte painting, featuring a bicycle mounted upon a lit cigar.)
Achilles: Uhh-no thank you, not now.
Crab: As you will. I myself am an incurable tobacco smoker. Which re-
minds me-you undoubtedly know of Old Bach's predilection for pipe
smoking?
Achilles: I don't recall exactly.
Crab: Old Bach was fond of versifying, philosophizing, pipe smoking, and
(The Crab pulls a record from his shelves, and walks over to a huge,
complex piece of apparatus. He opens it up, and inserts the record into an
ominous-looking mechanical mouth. Suddenly a bright flash of greenish
light sweeps over the surface of the record, and after a moment, the record
is silently whisked into some hidden belly of the fantastic machine. A
moment passes, and then the strains of the Crab's voice ring out.)
Crab: So I am.
Achilles: Suppose I point the camera at the painting with the burning
tuba. Now it is on the screen, too!
Crab: The camera can zoom in and out, Achilles. You ought to try it.
Achilles: Fabulous! Let me just focus down onto the tip of those flames,
where they meet the picture frame ... It's such a funny feeling to be
able to instantaneously "copy" anything in the room-anything I
want-onto that screen. I merely need to point the camera at it, and it
pops like magic onto the screen.
Crab: ANYTHING in the room, Achilles?
Achilles: Anything in sight, yes. That's obvio;Js.
Crab: What happens, then, if you point the camera at the flames on the
TV screen?
(Achilles shifts the camera so that it points directly at that part of the
television screen on which the flames are-or were-displayed.)
Achilles: Hey, that's funny! That very act makes the flames DISAPPEAR
from the screen! Where did they go?
Crab: You can't keep an image still on the screen and move the camera at
the same time.
Achilles: So I see ... But I don't understand what's on the screen now-
not at all! It seems to be a strange long corridor. Yet I'm certainly not
(b) Achilles' "corridor". (e) What happens when you zoom in.
(c) What happens when you rotate the camera. if) Combined effect of rotation and zooming.
FIGURE 81. Twelve self-engulfing TV scTt'ens. I would have included one more, had 13
not been prime.
(h) A "galaxy" is born. (k) The galaxy has burned itself out, and become-
a black hole!
(i) The galaxy evolves . .. (I) A "pulsating petal pattern", caught in the middle
of oneof its pulsations.
All but the last one (which is an anomaly) involve the simple-seeming
mechanism contained in the phrase "this sentence". But that mechanism is
in reality far from simple. All of these sentences are "floating" in the
context of the English language. They can be compared to icebergs, whose
tips only are visible. The word sequences are the tips of the icebergs, and
the processing which must be done to understand them is the hidden part.
In this sense their meaning is implicit, not explicit. Of course, no sentence's
meaning is completely explicit, but the more explicit the self-reference is,
the more exposed will be the mechanisms underlying it. In this case, for the
self-reference of the sentences above to be recognized, not only has one to
be comfortable with a language such as English which can deal with linguis-
tic subject matter, but also one has to be able to figure out the referent of
the phrase "this sentence". It seems simple, but it depends on our very
complex yet totally assimilated ability to handle English. What is especially
important here is the ability to figure out the referent of a noun phrase
with a demonstrative adjective in it. This ability is built up slowly, and
should by no means be considered trivial. The difficulty is perhaps under-
lined when a sentence such as number 4 is presented to someone na'ive
about paradoxes and linguistic tricks, such as a child. They may say, "What
sentence is false?" and it may take a bit of persistence to get across the idea
that the sentence is talking about itself. The whole idea is a little mind-
FIGURE 83.
waterline
cognitive processes
required for understanding
the self-reference in the English language sea
Epimenides sentence
FIGURE 84.
The sentence "The sentence contains five words" contains five words.
But such an attempt must fail, for any sentence that could be quoted
entirely inside itself would have to be shorter than itself. This is actually
possible, but only if you are willing to entertain infinitely long sentences,
such as:
elc., etc.
is infinitely long"
is infinitely long
is infinitely long"
is infinitely long.
But this cannot work for finite sentences. For the same reason, Codel's
string C could not contain the explicit numeral for its Codel number: it
would not fit. No string of TNT can contain the TNT-numeral for its own
Codel number, for that numeral always contains more symbols than the
string itself does. But you can get around this by having C contain a
description of its own Codel number, by means of the notions of "sub" and
"arithmoquinification".
One way of achieving self-reference in an English sentence by means
of description instead of by self-quoting or using the phrase "this sentence"
is the Quine method, illustrated in the dialogue Air on C's String. The
understanding of the Quine sentence requires less subtle mental processing
than the four examples cited earlier. Although it may appear at first to be
trickier, it is in some ways more explicit. The Quine construction is quite
like the Codel construction, in the way that it creates self-reference by
describing another typographical entity which, as it turns out, is isomorphic
to the Quine sentence itself. The description of the new typographical
entity is carried out by two parts of the Quine sentence. One part is a set of
instructions telling how to build a certain phrase, while the other part
contains the construction materials to be used; that is, the other part is a
template. This resembles a floating cake of soap more than it resembles an
iceberg (See Fig. 85).
FIGURE 85.
Quine sentence
water
A Self-Reproducing Program
The notion of quining, and its usage in creating self-reference, have al-
ready been explained inside the Dialogue itself, so we need not dwell on
such matters here. Let us instead show how a computer program can use
precisely the same technique to reproduce itself. The following self-
reproducing program is written in a BlooP-like language and is based on
following a phrase by its own quotation (the opposite order from quining, so
I reverse the name "quine" to make "eniuq"):
ENIUQ is a procedure defined in the first two lines, and its input is called
"TEMPLATE". It is understood that when the procedure is called,
TEMPLATE's value will be some string of typographical characters. The
effect of ENIUQ is to carry out a printing operation, in which TEMPLATE
gets printed twice: the first time just plain; the second time wrapped in
(single) quotes and brackets, and garnished with a final period. Thus, if
TEMPLATE's value were the string DOUBLE-BUBBLE, then performing
ENIUQ on it would yield:
DOUBLE-BUBBLE ['DOUBLE-BUBBLE'].
Now in the last four lines of the program above, the procedure ENIUQ is
called with a specific value of TEMPLATE-namely the long string inside the
single quotes: DEFINE ... ENIUQ. That value has been carefully chosen; it
consists of the definition of ENIUQ, followed by the word ENIUQ. This makes
the program itself-or, if you prefer. a perfect copy of it-get printed out.
It is very similar to Quine'S version of the Epimenides sentence:
What Is a Copy?
Now in any discussion of self-refs and self-reps, one must sooner or later
come to grips with the essential issue: what is a copy? We already dealt with
that question quite seriously in Chapters V and VI; and now we come back
to it. To give the flavor of the issue, let us describe some highly fanciful, yet
plausible, examples of self-reps.
We could make a little diagram of what happens one evening (Fig. 86).
person
nickelodeon
FIGURE 86. A selj~reproducing song.
Although the effect is that the song reproduces itself, it would feel strange
to call the song a self-rep, because of the fact that when it passes through
the 11- U stage, not all of the information is there. The information only
gets put back by virtue of the fact that it is fully stored in the nickelodeon-
that is, in one of the arrows in the diagram, not in one of the ovals. It is
questionable whether this song contains a complete description of how to
get itself played again, because the symbol pair "11-U" is only a trigger, not
a copy.
A "Crab" Program
Consider next a computer program which prints itself out backwards.
(Some readers might enjoy thinking about how to write such a program in
You might try to write down the sentence which is described by this weird
concoction. (Hint: It is not itself-or at least it is not if "itself" is taken in a
naive sense.) If the notion of "self-rep by retrograde motion" (i.e., a pro-
gram which writes itself out backwards) is reminiscent of a crab canon, the
notion of "self-rep by translation" is no less reminiscent of a canon which
involves a transposition of the theme into another key.
A Self-Rep by Augmentation
We have been likening self-reps to canons. What, then, would be a fair
analogue to a canon by augmentation? Here is a possibility: consider a
program which contains a dummy loop whose only purpose is to slow up
the program. A parameter might tell how often to repeat the loop. A
self-rep could be made which prints out a copy of itself, but with the
parameter changed, so that when that copy is run, it will run at half the
speed of its parent program; and its "daughter" will in turn run at half
again the speed, and so on ... None of these programs prints itself out
precisely; yet all clearly belong to a single "family".
This is reminiscent of the self-reproduction of living organisms.
Clearly, an individual is never identical to either of its parents; why, then, is
the act of making young called "self-reproduction"? The answer is that
there is a coarse-grained isomorphism between parent and child; it is an
isomorphism which preserves the information about species. Thus, what is
reproduced is the class, rather than the instance. This is also the case in the
recursive picture Gplot, in Chapter V: that is, the mapping between
"magnetic butterflies" of various sizes and shapes is coarse-grained; no two
are identical, but they all belong to a single "species", and the mapping
preserves precisely that fact. In terms of self-replicating programs, this
would correspond to a family of programs, all written in "dialects" of a
single computer language; each one can write itself out, but slightly mod-
ified, so that it comes out in a dialect of its original language.
It is clear that in (1), the program is t.he self-rep. But in (3), is it the program
which is the self-rep, or the compound system of program plus interpreter,
or the union of program, interpreter, and processor?
Clearly, a self-rep can involve more than just printing itself out. In fact,
most of the rest of this Chapter is a discussion of self-reps in which data,
program, interpreter, and processor are all extremely intertwined, and in
which self-replication involves replicating all of them at once.
Typogenetics
We are now about to broach one of the most fascinating and profound
topics of the twentieth century: the study of "the molecular logic of the
living state", to borrow Albert Lehninger's richly evocative phrase. And
logic it is, too-but of a sort more complex and beautiful than any a human
mind ever imagined. We will come at it from a slightly novel angle: via an
artificial solitaire game which I call Typogenetics-short for "Typographical
Genetics". In Typogenetics I have tried to capture some ideas of molecular
genetics in a typographical system which, on first sight, resembles very
much the formal systems exemplified by the MIU-system. Of course, Ty-
pogenetics involves many simplifications, and therefore is useful primarily
for didactic purposes.
I should explain immediately that the field of molecular biology is a
field in which phenomena on several levels interact, and that Typogenetics
is only trying to illustrate phenomena from one or two levels. In particular,
purely chemical aspects have been completely avoided-they belong to a
level lower than is here dealt with; similarly, all aspects of classical genetics
(viz., nonmolecular genetics) have also been avoided-they belong to a level
higher than is here dealt with. I have intended in Typogenetics only to give
an intuition for those processes centered on the celebrated Central Dogma of
It is my hope that with this very skeletal model I have constructed the
reader will perceive some simple unifying principles of the field-
principles which might otherwise be obscured by the enormously intricate
interplay of phenomena at many different levels. What is sacrificed is, of
course, strict accuracy; what is gained is, I hope, a little insight.
A C G T.
Arbitrary sequences of them are called strands. Thus, some strands are:
GGGG
ATTACCA
CATCATCATCA1
Incidentally, "STRAND" spelled backwards begins with "DNA". This is
appropriate since strands, in Typogenetics, play the role of pieces of DNA
(which, in real genetics, are often called "strands"). Not only this, but
"STRAND" fully spelled out backwards is "DNA RTS", which may be taken
as an acronym for "DNA Rapid Transit Service". This, too, is appropriate,
for the function of "messenger RNA"-which in Typogenetics is rep-
resented by strands as well-is quite well characterized by the phrase
"Rapid Transit Service" for DNA, as we shall see later.
I will sometimes refer to the letters A, C, G, T as bases, and to the
positions which they occupy as units. Thus, in the middle strand, there are
seven units, in the fourth of which is found the base A.
If you have a strand, you can operate on it and change it in various
ways. You can also produce additional strands, either by copying, or by
cutting a strand in two. Some operations lengthen strands, some shorten
them, and some leave their length alone.
Operations come in packets-that is, several to be performed together,
in order. Such a packet of operations is a little like a programmed machine
which moves up and down the strand doing things to it. These mobile
machines are called "typographical enzymes"--enzymes for short. Enzymes
operate on strands one unit at a time, and are said to be "bound" to the unit
they are operating on at any given moment.
I will show how some sample enzymes act on particular strings. The
first thing to know is that each enzyme likes to start out bound to a
particular letter. Thus, there are four kinds of enzyme-those which prefer
(I) Delete the unit to which the enzyme is bound (and then bind
to the next unit to the right).
(2) Move one unit to the right.
{
(3) Insert a T (to the immediate right of this unit).
ACA
What happens if our enzyme binds to the left A and begins acting? Step 1
deletes the A, so we are left with CA--and the enzyme is now bound to the
C. Step 2 slides the enzyme rightwards, to the A, and Step 3 appends a T
onto the end to form the strand CAT. And the enzyme has done its
complete duty: it has transformed ACA into CAT.
What if it had bound itself to the right A of ACA? It would have deleted
that A and moved off the end of the strand. Whenever this happens, the
enzyme quits (this is a general principle). So the entire effect would just be
to lop off one symbol.
Let's see some more examples. Here is another enzyme:
(I) Search for the nearest p}rimidine to the right of this unit.
(2) Go into Copy mode.
{ (3) Search for the nearest purine to the right of of this unit.
(4) Cut the strand here (viz., to the right of the present unit).
Now this contains the terms "pyrimidine" and "purine". They are easy
terms. A and G are called purines, and C and T are called pyrimidines. So
searching for a pyrimidine merely means searching for the nearest C or T.
complement
purines
{ A
G
.:~
.:~
T
C
} pyrimidines
CAAAGAGAATCCTCTITGAT
There are many places it could start. Let's take the second A, for example.
The enzyme binds to it, then executes step 1: Search for the nearest
pyrimidine to the right. Well, this means a C or a T. The first one is a T
somewhere near the middle of the strand, so that's where we go. Now step
2: Copy mode. Well, we just put an upside-down A above our T. But that's
not all, for Copy mode remains in effect until it is shut off-or until the
enzyme is done, whichever comes first. This means that every base which is
passed through by the enzyme while Copy mode is on will get a com-
plementary base put above it. Step 3 says to look for a purine to the right of
our T. That is the G two symbols in from the right-hand end. Now as we
move up to that G, we must "copy"-that is, create a complementary strand.
Here's what that gives:
'v'1J1J'v'1J\f\f\f'J
CAAAGAGAATCCTCTTTGAT
The last step is to cut the strand. This will yield two pieces:
'v'1J1J'v'1J\f\f\f'J
CAAAGAGAATCCTCTTTG
and AT.
And the instruction packet is done. We are left with a double strand,
however. Whenever this happens, we separate the two complementary
strands from each other (general principle); so in fact our end product is a
set of three strands:
Notice that the upside-down strand has been turned right side up, and
thereby right and left have been reversed.
Now you have seen most of the typographical operations which can be
carried out on strands. There are two other instructions which should be
mentioned. One shuts off Copy mode; the other switches the enzyme from a
strand to the upside-down strand above it. When this happens, if you keep
the paper right side up, then you must switch "left" and "right" in all the
instructions. Or better, you can keep the wording and just turn the paper
around so the top strand becomes legible. If the "switch" command is
Amino Acids
There are fifteen types of command, listed below:
TAGATCCAGTCCATCGA
TAGATCCAGTCCACTCGA
+
where the arrow points to the unit to which the enzyme is bound. Set Copy
mode. This puts an upside-down G above the C. Move right, move left,
then switch to the other strand. Here's what we have so far:
+
r:JV
TAGATCCAGTCCACTCGA
Let's turn it upside down, so that the enzyme is attached to the lower
strand:
Vr:JJIJVJJlr:JVJJlVr:JVl
AG
Now we search leftwards for a purine, and find A. Copy mode is on, but the
complementary bases are already there, so nothing is added. Finally, we
insert a T (in Copy mode), and quit:
Second Base
A C G T
G Ina mc mg int
s r r I FIGURE 87. The Typogenetic Code, by
which each duplet in a strand codes for one
T rpy rpu lpy lpu of fifteen "amino acids" (or a punctuation
r I I I mark).
TAGATCCAGTCCACATCGA
TA GA TC CA GT CC AC AT CG A
with the A left over at the end. Its translation into an enzyme is:
cop
1l'
SWI : cut : mvl : int
1l'
mvr
1l'
rpy =? Ina =? rpu
Note the left-kink at "rpu", the right-kink at "swi", and so on. Notice also
that the first segment ("rpy ~ ina") and the last segment ("swi ~ cop") are
perpendicular. This is the key to the binding-preference. In fact, the
relative orientation of the first and last segments of an enzyme's tertiary structure
determines the binding-preference of the enzyme. We can always orient
the enzyme so that its first segment points to the right. If we do so, then the
last segment determines the binding-preference, as shown in Figure 89.
=? =? A
=? 1l' c
=? ,JJ G
=? <= T
CG GA TA CT AA AC CG A
with the AA serving to divide the strand up into two "genes". The definition
of gene is: that portion of a strand which codes for a single emyme. Note that the
mere presence of AA inside a strand does not mean that the strand codes
for two enzymes. For instance, CAAG codes for "mvr - del". The AA begins
on an even-numbered unit and therefore is not read as a duplet!
The mechanism which reads strands and produces the enzymes which
are coded inside them is called a ribosome. (In Typogenetics, the player of
the game does the work of the ribosomes.) Ribosomes are not in any way
responsible for the tertiary structure of enzymes, for that is entirely deter-
mined once the primary structure is created. Incidentally, the process of
translation always goes from strands to em.ymes, and never in the reverse
direction.
strands
!
rules of inference
(typ"grapMcal manipu"'"""J
strings
C:
T:
cytosine
thymine } pyrimidines
(Also see Fig. 91.) It is easy to remember which ones are pyrimidines
because the first vowel in "cytosine", "thymine", and "pyrimidine" is 'y'.
Later, when we talk about RNA, "uracil"-also a pyrimidine-will come in
and wreck the pattern, unfortunately. (Note: Letters representing nucleo-
tides in real genetics will not be in the Quadrata font, as they were in
Typogenetics.)
A single strand of DNA thus consists of many nucleotides strung
together like a chain of beads. The chemical bond which links a nucleotide
to its two neighbors is very strong; such bonds are called covalent bonds, and
the "chain of beads" is often called the covalent backbone of DNA.
Now DNA usually comes in double strands-that is, two single strands
which are paired up, nucleotide by nucleotide (see Fig. 92). It is the bases
H- H-
H
H
I
THYMINE CYTOSINE H
FIGURE 91. The four constituent bases of DNA: Adenine, Guanine. Thymine, Cytosine.
[From Hanawalt and Haynes, The Chemical Basis of Life (San Francisco: W. H. Freeman, 1973),
p.142.]
FIGURE 92. DNA structure resembles a ladder in which the side pieces consist of alternat-
ing units of deoxyribose and phosphate. The rungs are formed by the bases paired in a special
way, A with T and G with C, and held together respectively by two and three hydrogen bonds.
[From Hanawalt and Haynes, The Chemical Basis of Life, p. 142.]
which are responsible for the peculiar kind of pairing which takes place
between strands. Each base in one strand faces a complementary base in the
other strand, and binds to it. The complements are as in Typogenetics: A
pairs up with T, and C with G. Always one purine pairs up with a
pyrimidine.
Compared to the strong covalent bonds along the backbone, the in-
terstrand bonds are quite weak. They are not covalent bonds, but hydrogen
bonds. A hydrogen bond arises when two molecular complexes are aligned
in such a way that a hydrogen atom which originally belonged to one of
them becomes "confused" about which one it belongs to, and it hovers
between the two complexes, vacillating as to which one to join. Because the
two halves of double-stranded DNA are held together only by hydrogen
bonds, they may come apart or be put together relatively easily; and this
fact is of great import for the workings of the cell.
When DNA forms double strands, the two strands curl around each
other like twisting vines (Fig. 93). There are exactly ten nucleotide pairs
per revolution; in other words, at each nucleotide, the "twist" is 36 degrees.
Single-stranded DNA does not exhibit this kind of coiling, for it is a
consequence of the base-pairing.
RNA does not generally form long double strands with itself, although it
can. Therefore it is prevalently found not in the helical form which so
characterizes DNA, but rather in long, somewhat randomly curving
strands.
Once a strand of mRNA has escaped the nhcleus, it encounters those
strange subcellular creatures called "ribosomes"-but before we go on to
explain how a ribosome uses mRNA, I want to make some comments about
enzymes and proteins. Enzymes belong to the general category of
biomolecules called proteins, and the job of ribosomes is to make all pro-
Amino Acids
Proteins are composed of sequences of amino acids, which come in twenty
primary varieties, each with a three-letter abbreviation:
ala alanine
arg arginine
asn asparagme
asp aspartic acid
cys cysteine
gin glutamine
glu glutamic acid
gly glycine
his histidine
ile isoleucine
leu leucine
Iys lysine
met methionine
phe phenylalanine
pro proline
ser senne
thr threonine
trp tryptophan
tyr tyrosine
val valine
Tertiary Structure
However, as a protein emerges from a ribosome, it is not only getting
longer and longer, but it is also continually folding itself up into an ex-
traordinary three-dimensional shape, very much in the way that those
funny little Fourth-of-July fireworks called "snakes" simultaneously grow
longer and curl up, when they are lit. This fancy shape is called the
protein's tertiary structure (Fig. 95), while the amino acid sequence per se is
called the primary structure of the protein. The tertiary structure is implicit
in the primary structure, just as in Typogenetics. However, the recipe for
deriving the tertiary structure, if you know only the primary structure, is by
far more complex than that given in Typogenetics. In fact, it is one of the
outstanding problems of contemporary molecular biology to figure out
some rules by which the tertiary structure of a protein can be predicted if
only its primary structure is known.
u C A G
FIGURE 94. The Genetic Code, by which each triplet in a strand of messenger RNA codes
for one of twenty amino acidl (or a punctuation mark).
FIGURE 95. The structure of myoglobin, deduced from high-resolution X-ray data. The
large-scale "twisted pipe" appearance is the tertiary structure; the finer helix inside-the
"alpha helix"~s the secondary structure. [From A. Lehninger, Biochemistry.]
codon of mRNA clicks into position in the ribosome's "playing head", the
ribosome reaches out into the cytoplasm and latches onto a clover whose
anticodon is complementary to the mRNA codon. Then it pulls the clover
into such a position that it can rip off the clover's amino acid, and stick it
covalently onto the growing protein. (Incidentally, the bond between an
amino acid and its neighbor in a protein is a very strong covalent bond,
called a "peptide bond". For this reason, proteins are sometimes called
"polypeptides".) Of course it is no accident that the "clovers" carry the
proper amino acids, for they have all been manufactured according to
precise instructions emanating from the "throne room".
Recap
In brief, then, this picture emerges: from its central throne, DNA sends off
long strands of messenger RNA to the ribosomes in the cytoplasm; and the
ribosomes, making use of the "flashcards" of tRNA hovering about them,
efficiently construct proteins, amino acid by amino acid, according to the
blueprint contained in the mRNA. Only the primary structure of the
proteins is dictated by the DNA; but this is enough, for as they emerge
from the ribosomes, the proteins "magically" fold up into complex confor-
mations which then have the ability to act as powerful chemical machines.
O, , /ribosomal
subunits
Growing
polypeptide
chains
~
Complete
FIGURE 97. A polyribosome. A single
strand of mRNA passes through one ribo-
peptide some after another, like one tape passing
chain through several tape recorders in a row.
The result is a set of growing proteins in
various stages of completion: the analogue
to a musical canon produced by the
staggered tape recorders. [From A.
Lehninger, Biochemistry.]
50S 30S
the Prelude, Ant Fugue. The global structure-consisting of the letters 'M'
and 'U'-is its quaternary structure; then each of those two parts has a tertiary
structure, consisting of "HOLISM" or "REDUCTIONISM"; and then the
opposite word exists on the secondary level, and at bottom, the primary
structure is once again the word "MU", over and over again.
FIGURE 98. Here, an even more complex scheme. Not just one but several strands of
mRNA, all emerging by transcription from a single strand of DNA, are acted upon by
polyribosomes. The result is a two-tiered molecular canon. [From Hanawalt and Haynes, The
Chemical Basis of Life, p. 271.]
I
bacterial
chromosome
~
~om~l-~::~~~.
~!'%\
\ &\ ~l- '; polymerase
o ~SrrD". messenger RNA
large subunit '-!'"'"
~_ _ _ _ _ _....:--'>~ nbosome
different copyists are all at work simultaneously, each one of them copying
the same original manuscript from a clef which flutists cannot read into a
clef which they can read. As each copyist finishes a page of the original
manuscript, he passes it on to the next copyist, and starts transcribing a new
page himself. Meanwhile, from each score emerging from the pens of the
copyists, a set of flutists are reading and tooting the melody, each flutist
delayed with respect to the others who are reading from the same sheet.
This rather wild image gives, perhaps, an idea of some of the complexity of
the processes which are going oR in each and every cell of your body during
every second of every day ...
Protein Function
We have spoken somewhat of the structure of proteins-specifically en-
zymes; but we have not really mentioned the kinds of tasks which they
perform in the cell, nor how they do them. All enzymes are catalysts, which
means that in a certain sense, they do no more than selectively accelerate
various chemical processes in the cell, rather than make things happen
which without them never could happen. An enzyme realizes certain path-
ways out of the myriad myriad potentialities. Therefore, in choosing which
enzymes shall be present, you choose what shall happen and what shall not
happen-despite the fact that, theoretically speaking, there is a nonzero
probability for any cellular process to happen spontaneously, without the
aid of catalysts.
Now how do enzymes act upon the molecules of the cell? As has been
mentioned, enzymes are folded-up polypeptide chains. In every enzyme,
there is a cleft or pocket or some other clearly-defined surface feature
where the enzyme binds to some other kind of molecule. This location is
This process will create two new double strands of DNA, each identical to
the original one. Now if our solution is to be based on this idea, it must
involve a set of proteins, coded for in the DNA itself, which will carry out
these two steps.
I t is believed that in cells, these two steps are performed together in a
coordinated way, and that they require three principal enzymes: DNA
endonuclease, DNA polymerase, and DNA ligase. The first is an "unzip-
ping enzyme": it peels the two original strands apart for a short distance,
and then stops. Then the other two enzymes come into the picture. The
DNA polymerase is basically a copy-and-move enzyme: it chugs down the
short single strands of DNA, copying them complementarily in a fashion
reminiscent of the Copy mode in Typogenetics. In order to copy, it draws
on raw materials-specifically nucleotides-which are floating about in the
cytoplasm. Because the action proceeds in fits and starts, with some unzip-
ping and some copying each time, some short gaps are created, and the
DNA ligase is what plugs them up. The process is repeated over and over
again. This precision three-enzyme machine proceeds in careful fashion all
the way down the length of the DNA molecule, until the whole thing has
been peeled apart and simultaneously replicated, so that there are now two
copies of it.
(N-l) ???
(N) physical, mental, and
psychological traits .................... pseudo-epigenesis
FIGURE 99. The Central Dogmap. An analogy is established between two fundamental
Tangled Hierarchies: that of molecular biology and that of mathematical logic.
Translation :~ Arithmetization
(RNA ~ proteins) (N ~ meta-TNT)
Crick :~ G6del
Genetic Code :~ G6del Code
(arbitrary convention) (arbitrary convention)
codon (triplet of bases) :~ codon (triplet of digits)
amino acid :~ quoted symbol of TNT
used in meta-TNT
self-reprod uction :~ self-reference
sufficiently strong :~ sufficiently powerful
cellular support system arithmetical formal system
to permit self-rep to permit self-ref
Central Dogmap
statements
of meta-TNT
translation
(via Genetic Code) j;;:~"'tc""'J
self-rep self-ref
RNA statements
of N
transcription interpretation
(conversion to (conversion to
active farm) meaningful form)
(odd) 1 :~ A (purine)
(even) 2 :~ C (pyrimidine)
(odd) 3 :~ G (purine)
(even) 6 :~ U (pyrimidine)
6 2 1 3
G::) CD G) C) 6
0 V V : 2
6 a V <eS> punc. 1
a V punc. G:) 3
- a < c::> 6
G)
2 G:) - 2
a - > 1
a C) C2:) 3
1\ S + V 6
1
1\ S CD V 2
G) S <:::) 1
c:::> CD 3
( ) [ 3 6
3 CD CD 3
)
)
2
( ] 3 1
( CD CD CD ~
FIGURE 100. The Godel Code. Under this Godel-numbering scheme, each TNT symbol
gets one or more codons. The small ovals show how this table subsumes the earlier Godel-
numbering table of Chapter IX.
FIGURE 101, The T4 bacterial virus is an assembly of protein components (a). The "head"
is a protein membrane, shaped like a kind of prolate icosahedron with thirty facets and jilled
with DNA. It is attached by a neck to a tail consisting of a hollow core surrounded fry a
contractile sheath and based on a spiked end plate to which six jibers are attached. The spikes
and jibers affix the virus to a bacterial cell wall (b). The sheath contracts, driving the core
through the wall, and viral DNA enters the cell. [From Hanawalt and Haynes, The Chemical
Basis of Life, p. 230.]
means, and then carefully ensures the manufacture of proteins which will
have the effect of destroying the virus itself! It is a sort of suicide-or
Epimenides sentence, if you will-on the molecular level. Obviously it
would not prove advantageous from the point of view of survival of the
species. However, it demonstrates the spirit, if not the letter, of the
mechanisms of protection and subversion which cells and their invaders
have developed.
E. Coli vs. T4
Let us consider the biologists' favorite cell, that of the bacterium Escherichia
coli (no relation to M. C. Escher), and one of their favorite invaders of that
cell: the sinister and eerie T4 phage, pictures of which you can see in Figure
101. (Incidentally, the words "phage" and "virus" are synonymous and
mean "attacker of bacterial cells".) The weird tidbit looks like a little like a
cross between a LEM (Lunar Excursion Module) and a mosquito-and it is
much more sinister than the latter. It has a "head" wherein is stored all its
"knowledge"-namely its DNA; and it has six "legs" wherewith to fasten
itself to the cell it has chosen to invade; and it has a "stinging tube" (more
properly called its "tail") like a mosquito. The major difference is that
unlike a mosquito, which uses its stinger for sucking blood, the T4 phage
uses its stinger for injecting its hereditary substance into the cell against the
will of its victim. Thus the phage commits "rape" on a tiny scale.
, :
'<
J
ti
\";H
\ .. ~':~j
FIGURE 102. Viral infection begins when ,Jiral DNA enters a bacterium. Bacterial DNA is
disrupted and viral DNA replicated. Synthesis of viral structural proteins and their assembly
into virus continues until the cell bursts, rl'leasmg particles. [From Hanawalt and Haynes, The
Chemical Basis of Life, p, 230,]
...
I
o
I
I
I
I
'+'
I
I
I
I
Tail fiber
I
I
1 /~
.. ~
/ ""'~
/~
l~
Thus, when a T4 phage invades an E. coli cell, after the brief span of about
twenty-four or twenty-five minutes, the cell has been completely subverted,
and breaks open. Out pop about two hundred exact copies of the original
virus-"bicentuplets"-ready to go attack more bacterial cells, the original
cell having been largely consumed in the process.
Although from a bacterium's point of view this kind of thing is a
deadly serious menace, from our large-scale vantage point it can be looked
upon as an amusing game between two players: the invader, or "T" player
(named after the T-even class of phages, including the T2, T4, and others),
and the "C" player (standing for "Cell"). The objective of the T player is to
invade and take over the cell of the C player from within, for the purpose
of reprod ucing itself. The objective of the C player is to protect itself and
destroy the invader. When described this way, the molecular TC-game can
be seen to be quite parallel to the macroscopic TC-game described in the
preceding Dialogue. (The reader can doubtless figure out which player-T
or C--corresponds to the Tortoise, and which to the Crab.)
and then proceeds by the standard trick. Say the Code! number of the
above "uncle" is h. Now by arithmoquining this very uncle, you get a
Henkin sentence:
(-I)NI(2N + 1)
to a large number of terms (as many terms as "cells" can fit inside memory).
And since this series converges (albeit slowly) to 'TT14, we have a "phenotype"
whose function is to calculate the value of a famous mathematical constant.
It is spring, and the Tortoise and Achilles are taking a Sunday promenade
in the woods together. They have decided to climb a hill at the top of which,
it is said, there is a wonderful teahouse, with all sorts of delicious pastries.
He sticks the top sheet into a little holder attached to his flute, and plays.
The tune is very short.)
Achilles: That was charming. (Peers over at the sheet on theflute, and a quizzical
expression beclouds his face.) What is that statement of number theory
doing, attached to your flute like that?
(The Crab looks at his flute, then his music, turns his head all around, and
appears slight(y confused.)
Achilles: Can't you play it for me? What's the matter? Why are you balk-
ing?
Tortoise: Don't you realize, Achilles, that for Mr. Crab to fulfill your
request would be most impolite and disturbing to the clientele and
employees of this fine establishment?
Crab (suddenly looking relieved): That's right. We have no right to impose
our music on others.
Achilles (dejectedly): Oh, PHOOEY! And I SO much wanted to know what he
thinks of this piece!
Crab: Whew! That was a close call!
Achilles: What was that remark?
Crab: Oh-nothing. It's just that that waiter over there, he got knocked
into by another waiter, and almost dropped a whole pot of tea into a
lady's lap. A narrow escape, I must say. What do you say, Mr. Tortoise?
Tortoise: Very good teas, I'd say. Wouldn't you agree, Achilles?
Achilles: Oh, yes. Prime teas, in fact.
Crab: Definitely. Well, I don't know about you two, but I should perhaps
be going, for I've a long steep trail back to my house, on the other side
of this hill.
Achilles: You mean this is a big bluff?
Crab: You said it, Achilles.
Achilles: I see. Well, I'll have to remember that.
Crab: It has been such ajolly afternoon, Achilles, and I sincerely hope we
will exchange more musical compositions another day.
Achilles: I'm looking forward to that very much, Mr. C. Well, good-bye.
Tortoise: Good-bye, Mr. C.
(And the Crab heads off down his side of the hill.)
Achilles: Now there goes a brilliant fellow ... In my estimation, he's at
least four times as smart as any crab alive. Or he might even be five-
Tortoise: As you said in the beginning, and probably shall be saying
forevermore, words without end.
The central hypothesis, to make it very clear, is that any mental process
which divides numbers into two sorts can be described in the form of a
FlooP program. The intuitive belief is that there are no other tools than
those in FlooP, and that there are no ways to use those tools other than by
This says that public methods are subject to "FlooPification", but asserts
nothing about private methods. It does not say that they are un-FlooP-able,
but it at least leaves the door open.
Srinivasa Ramanujan
As evidence against any stronger version of the Church-Turing Thesis, let
us consider the case of the famous Indian mathematician of the first
quarter of the twentieth century, Srinivasa Ramanujan (1887-1920).
Ramanujan (Fig. 105) came from Tamilnadu, the southernmost part of
India, and studied mathematics a little in high school. One day, someone
who recognized Ramanujan's talent for math presented him with a copy of
a slightly out-of-date textbook on analysis, which Ramanujan devoured
(figuratively speaking). He then began making his own forays into the
world of analysis, and by the time he was twenty-three, he had made a
number of discoveries which he considered worthwhile. He did not know
to whom to turn, but somehow was told about a professor of mathematics
in faraway England, named G. H. Hardy. Ramanujan compiled his best
1
1+ e-1,..""
1 + e- woW
1 + e"'.fr
1+
results together in a packet of papers, and sent them all to the un-
forewarned Hardy with a covering letter which friends helped him express
in English. Below are some excerpts taken from Hardy's description of his
reaction upon receiving the bundle:
... It soon became obvious that Ramanujan must possess much more general
theorems and was keeping a great deal up his sleeve .... [Some formulae]
defeated me completely; I had never seen anything in the least like them
before. A single look at them is enough to show that they could only be
written down by a mathematician of the highest class. They must be true
because, if they were not true, no one would have had the imagination to
invent them. Finally ... the writer must be completely honest, because great
mathematicians are commoner than thieves or humbugs of such incredible
skill. 2
The reader may find it interesting to tackle the analogous problem for
squares, which is much easier.
It is actually quite interesting to ponder why it is that Hardy im-
along different dimensions. For instance, there is the question about repre-
senting a number in three distinct ways as a sum of two cubes:
Here Hardy states in essence his own version of the Church-Turing Thesis.
I paraphrase:
His memory, and his powers of calculation, were very unusual, but they could
not reasonably be called "abnormal". [f he had to multiply two large numbers,
he multiplied them in the ordinary way; he could do it with unusual rapidity
and accuracy, but not more rapidly and accurately than any mathematician
who is naturally quick and has the habit of computation. 6
Notice that not only has the conclusion been strengthened, but also the
proviso of communicability of the faint-hearted Public-Processes Version
has been dropped. This bold version is the one which we now shall discuss.
In brief, this version asserts that when one computes something, one's
mental activity can be mirrored isomorphically in some FlooP program.
And let it be very clear that this does not mean that the brain is actually
running a FlooP program, written in the FlooP language complete with
BEGIN's, END's, ABORT's, and the rest-not at all. It is just that the steps are
taken in the same order as they could be in a FlooP program, and the
logical structure of the calculation can be mirrored in a FlooP program.
Now in order to make sense of this idea, we shall have to make some
level distinctions in both computer and brain, for otherwise it could be
misinterpreted as utter nonsense. Presumably the steps of the calculation
going on inside a person's head are on the highest level, and are supported
by lower levels, and eventually by hardware. So if we speak of an isomor-
phism, it means we've tacitly made the assumption that the highest level can
be isolated, allowing us to discuss what goes on there independently of
other levels, and then to map that top level into FlooP. To be more precise,
the assumption is that there exist software entities which play the roles of
various mathematical constructs, and which are activated in ways which can
be mirrored exactly inside FlooP (see Fig. 106). What enables these
software entities to come into existence is the entire infrastructure dis-
cussed in Chapters XI and XII, as well as in the Prelude, Ant Fugue. There is
no assertion of isomorphic activity on the lower levels of brain and comput-
er (e.g., neurons and bits).
The spirit of the Isomorphism Version, if not the letter, is gotten
across by saying that what an idiot savant does in calculating, say, the
logarithm of 1T, is isomorphic to what a pocket calculator does in calculating
it-where the isomorphism holds on the arithmetic-step level, not on the
lower levels of, in the one case, neurons, and in the other, integrated
circuits. (Of course different routes can be followed in calculating
anything-but presumably the pocket calculator, if not the human, could
be instructed to calculate the answer in any specific manner.)
FIGURE 106. The behavior of natural numbers can be mirrored in a human brain or in the
programs of a computer. These two different representations can then be mapped onto each
other on an appropriately abstract level.
computer
program isomorphism human brain
(high-level ("symbol level")
language)
Representation of Knowledge about the Real World
Now this seems quite plausible when the domain referred to is number
theory, for there the total universe in which things happen is very small and
clean. Its boundaries and residents and rules are well-defined, as in a
hard-edged maze. Such a world is far less complicated than the open-ended
and ill-defined world which we inhabit. A number theory problem, once
stated, is complete in and of itself. A real-world problem, on the other
hand, never is sealed off from any part of the world with absolute certainty.
For instance, the task of replacing a burnt-out light bulb may turn out to
require moving a garbage bag; this may unexpectedly cause the spilling of a
box of pills, which then forces the floor to be swept so that the pet dog won't
eat any of the spilled pills, etc., etc. The pills and the garbage and the dog
and the light bulb are all quite distantly related parts of the world-yet an
intimate connection is created by some everyday happenings. And there is
no telling what else could be brought in by some other small variations on
the expected. By contrast, if you are given a number theory problem, you
never wind up having to consider extraneous things such as pills or dogs or
bags of garbage or brooms in order to solve your problem. (Of course, your
intuitive knowledge of such objects may serve you in good stead as you go
about unconsciously trying to manufacture mental images to help you in
visualizing the problem in geometrical terms-but that is another matter.)
Because of the complexity of the world, it is hard to imagine a little
pocket calculator that can answer questions put to it when you press a few
buttons bearing labels such as "dog", "garbage", "light bulb", and so forth.
In fact, so far it has proven to be extremely complicated to have a full-size
high-speed computer answer questions about what appear to us to be
rather simple subdomains of the real world. It seems that a large amount of
knowledge has to be taken into account in a highly integrated way for
"understanding" to take place. We can liken real-world thought processes
to a tree whose visible part stands sturdily above ground but depends vitally
on its invisible roots which extend way below ground, giving it stability and
nourishment. In this case the roots symbolize complex processes which take
place below the conscious level of the mind-processes whose effects per-
meate the way we think but of which we are unaware. These are the
"triggering patterns of symbols" which were discussed in Chapters XI and
XII.
Real-world thinking is quite different from what happens when we do
a multiplication of two numbers, where everything is "above ground", so to
speak, open to inspection. In arithmetic, the top level can be "skimmed off"
and implemented equally well in many different sorts of hardware:
mechanical adding machines, pocket calculators, large computers, people's
brains, and so forth. This is what the Church-Turing Thesis is all about.
But when it comes to real-world understanding, it seems that there is no
simple way to skim off the top level, and program iLalone. The triggering
patterns of symbols are just too complex. There must be several levels
through which thoughts may "percolate" and "bubble".
FIGURE 107. Floating on neural activity, the symbol level of the brain mirrors the world.
But neural activity per se, which can be simulated on a computer, does not create thought; that
calls for higher levels of organization.
I higher level , I ,
I of brain } world
\ (symbol level) semt- \
\ )
tsomorphtsm
(meaning)
A optional link
, .
I computer Isubstrate: brain'
( model of as collection )
\ neural network) isomorphism \ of neurons}
This version of the Church-Turing Thesis says that brain processes do not
possess any more mystique---even though they possess more levels of
organization-than, say, stomach processes. It would be unthinkable in this
day and age to suggest that people digest their food, not by ordinary
chemical processes, but by a sort of mysterious and magic "assimilation".
This version of the CT-Thesis simply extends this kind of commonsense
reasoning to brain processes. In short, it amounts to faith that the brain
operates in a way which is, in principle, understandable. It is a piece of
reductionist faith.
A corollary to the Microscopic CT -Thesis is this rather terse new
macroscopic version:
I brain ,
, lower )
, ( (intermediate J
\ levels) J
microscopic
world
software levels
\ J
"ultimate
electronic neural
substrate"
substrate substrate
(laws of physics)
FIGURE 108. Crucial to the endeavor of Artificial Intelligence research is the notion that
the symbolic levels of the mind can be "skimmed off" of their neural substrate and implemented
in other media, such as the electronic substrate of computers. To what depth the copying of
brain must go is at present completely unclear.
First of all, in res ponse to (1), if violations of the Church-Turing Thesis are
allowed, then there seems to be no fundamental obstacle to the strange
events in the Dialogue. So what we are interested in is whether a believer in
the Church-Turing Thesis would have to disbelieve in the Crab's ability.
Well, it all depends on which version of the CT -Thesis you believe. For
example, if you only subscribe to the Public-Processes Version, then you
could reconcile the Crab's behavior with it very easily by positing that the
Crab's ability is not communicable. Contrariwise, if you believe the Reduc-
tionist's Version, you will have a very hard time believing in the Crab's
ostensible ability (because of Church's Theorem-soon to be demonstrat-
ed). Believing in intermediate versions allows you a certain amount of
wishy-washiness on the issue. Of course, switching your stand according to
convenience allows you to waffle even more.
It seems appropriate to present a new version of the CT -Thesis, one
which is tacitly held by vast numbers of people, and which has been publicly
put forth by several authors, in various manners. Some of the more famous
ones are: philosophers Hubert Dreyfus, S. Jaki, Mortimer Taube, and]. R.
Lucas; the biologist and philosopher Michael Polanyi (a holist par excel-
lence); the distinguished Australian neurophysiologist John Eccles. I am
sure there are many other authors who have expressed similar ideas, and
countless readers who are sympathetic. I ,have attempted below to sum-
marize their joint position. I have probably not done full justice to it, but I
have tried to convey the flavor as accurately as I can:
This 'version relates to the tale of the Magnijicrab in two ways. In the first
place, its adherents would probably consider the tale to be silly and im-
plausible, but-not forbidden in principle. In the second place, they would
probably claim that appreciation of qualities such as beauty is one of those
properties associated with the elusive soul, and is therefore inherently
possible only for humans, not for mere machines.
We will come back to this second point in a moment; but first, while we
are on the subject of "soulists", we ought to exhibit this latest version in an
even more extreme form, since that is the form to which large numbers of
well-educated people subscribe these days:
CHURCH-TURING THESIS, THEODORE ROSZAK VERSION: Computers are
ridiculous. So is science in general.
This is, as we have seen, true on the hardware level-but since there may be
higher levels, it is not the last word on the subject. Now Lucas gives the
impression that in the mind-imitating machines he discusses, there is only
one level on which manipulation of symbols takes place. For instance, the
Rule of Detachment (called "Modus Ponens" in his article) would b~ wired
into the hardware and would be an unchangeable feature of such a
machine. He goes further and intimates that if Modus Ponens were not an
Now many programs which are being developed in AI research have very
little in common with programs for generating truths of number theory-
programs with inflexible rules of inference and fixed sets of axioms. Yet
they are certainly intended as "models for the mind". On their top level-
the "informal" level-there may be manipulation of images, formulation of
analogies, forgetting of ideas, confusing of concepts, blurring of distinc-
tions, and so forth. But this does not contradict the fact that they rely on the
correct functioning of their underlying hardware as much as brains rely on
the correct functioning of their neurons. So AI programs are still "concrete
instantiations of formal systems"-but they are not machines to which
Lucas' transmogrification of Codel's proof can be applied. Lucas' argument
applies merely to their bottom level, on which their intelligence-however
great or small it may be-does not lie.
There is one other way in which Lucas betrays his oversimplified vision
of how mental processes would have to be represented inside computer
programs. In discussing the matter of consistency, he writes
If we really were inconsistent machines, we should remain content with our
inconsistencies, and would happily affirm both halves of a contradiction.
Moreover, we would be prepared to say absolutely anything-which we are
not. It is easily shown that in an inconsistent formal system everything is
provable. II
This last sentence shows that Lucas assumes that the Propositional Calculus
must of necessity be built into any formal system which carries out reason-
ing'. In particular, he is thinking of the theorem Pi\-P>:JQ> of the
Propositional Calculus; evidently he has the erroneous belief that it is an
inevitable feature of mechanized reasoning. However, it is perfectly plausi-
ble that logical thought processes, such as propositional reasoning, will
emerge as consequences of the general intelligence of an AI program, rather
than being preprogrammed. This is wl:J.at happens in humans! And there is no
particular reason to assume that the strict Propositional Calculus, with its
rigid rules and the rather silly definition of consistency that they entail,
would emerge from such a program.
An Underpinning of AI
We can summarize this excursion into level distinctions and come away
with one final, strongest version of the Church-Turing Thesis:
Church's Theorem
Now let us come back to the Crab and to the question of whether his
decision procedure for theoremhood (which is presented in the guise of a
filter for musical beauty) is compatible with reality. Actually, from the
events which occur in the Dialogue, we have no way of deducing whether
the Crab's gift is an ability to tell theorems from non theorems, or alternatively,
an ability to tell true statements from false ones. Of course in many cases this
amounts to the same thing but Codel's Theorem shows that it doesn't
always. But no matter: both of these alternatives are impossible, if you
believe the AI Version of the Church-Turing Thesis. The proposition that
it is impossible to have a decision procedure for theoremhood in any formal
system with the power of TNT is known as Church's Theorem. The proposi-
tion that it is impossible to have a decision procedure for number-
theoretical truth-if such truth exists, which one can well doubt after meet-
ing up with all the bifurcations of TNT-follows quickly from Tarski's
Theorem (published in 1933, although the ideas were known to Tarski
considerably earlier).
The proofs of these two highly important results of metamathematics
are very similar. Both of them follow quite quickly from self-referential
constructions. Let us first consider the question of a decision procedure for
TNT-theoremhood. If there were a uniform way by which people could
decide which of the classes "theorem" and "non theorem" any given for-
mula X fell into, then, by the CT-Thesis (Standard Version), there would
exist a terminating FlooP program (a general recursive function) which
could make the same decision, when given as input the Codel number of
formula X. The crucial step is to recall that any property that can be tested
for by a terminating FlooP program is represented in TNT. This means that
the property ofTNT-theoremhood would be represented (as distinguished
from merely expressed) inside TNT. But as we shall see in a moment, this
Tarski's Theorem
Now let us proceed to Tarski's result. Tarski asked whether there could be
a way of expressing in TNT the concept of number-theoretical truth. That
theoremhood is expressible (though not representable) we have seen;
Tarski was interested in the analogous question regarding the notion of
truth. More specifically, he wished to determine whether there is any
TNT-formula with a single free variable a which can be translated thus:
3a:<-TRUE{a}AARITHMOQUINE{a",a}>
Let us say the Godel number of the uncle is t. We arithmoquine this very
uncle, and produce the Tarski formula T:
t S's
One day, Eta Oin wanders into the MIT Artificial Intelligence Laboratory,
where she runs into the brilliant young computer program, SHRDLU. It
happens that SHRDLU is just dying for someone to try out the newly
developed human being "Dr. Tony Earrwig". SHRDLU explains that this
Earrwig is fairly intelligent in the limited domain of analyzing a conversa-
tion about a "toy world" containing blocks if various shapes, sizes, and
colors~locks which sit on a table, and which can be picked up and moved
around. Eta Oin,Jascinated, begins enthusiastically typing to SHRDLU.
Earrwig dangles over her shoulder and provides a sort of running
commentary, as promised.
green
red
green
blue
red
green
green
FIGURE 111. "Find a block which is bigger than the one you are holding and put it into the
box." [Adapted from Terry Winograd, Understanding Natural Language, p.9.]
3. Eta Din: find a block which is taller than the one you are holding and
put it into the box. [Refer to Fig. 111.]
Dr. Tony Earrwig: SHRDLU has to figure out what is meant by "one" and
"it", as well as using deduction to decide which block it is holding.
SHRDLU: BY "IT", I ASSUME YOU MEAN THE BLOCK WHICH IS TALLER
THAN THE ONE I AM HOLDING.
Dr. Tony Earrwig: There were two possible referents for "it": the one selected,
and "the one you are holding". SHRDLU has heuristics for choosing
between them.
SHRDLU: OK.
Dr. Tony Earrwig: SHRDLU's hand has to set down the red block to
pick up the taller blue one.
4. Eta Din: what does the box contain?
SHRDLU: THE BLUE PYRAMID AND THE BLUE BLOCK.
5. Eta Din: what is the pyramid supported by?
Dr. Tony Earrwig: Earlier SHRDLU responded to "the pyramid" by saying "I
DON'T UNDERSTAND WHICH PYRAMID YOU MEAN." Now, it assumes that
you mean the one just mentioned.
SHRDLU: THE BOX.
6. Eta Din: how many blocks are not in the box?
green
FIGURE 112. "Will you please stack up both of the red blocks and either a green cube or a
pyramid?" [Adapted from Terry Winograd, Understanding Natural Language, p. 12.]
Dr. Tony Earrwig: The result of understanding these sentences is the creation
of new procedures within SHRDLU for deducing whether you own some-
thing.
15. Eta Din: do i own the box?
SHRDLU: NO.
Dr. Tony Earrwig: The box supports whatever it contains, including a
pyramid.
16. Eta Din: do i own anything in the box?
SHRDLU: YES, TWO THINGS: THE BLUE BLOCK AND THE BLUE
PYRAMID.
17. Eta Din: will you please stack uJ> both of the red blocks aDd either a
green cube or a pyramid? [Refer to Fig. 112.]
SHRDLU: OK.
Dr. Tony Earrwig: Logical connectives, such as "and", "or", "either", etc. are
handled in both the grammar and semantics. A command is executed even if
it looks like a question. The.command is carried out by the following series of
steps: SHRDLU puts a green cube on the large red block (it chooses the
green cube with nothing on it), then removes the small pyramid from the
little red cube, so that it can use that cube to complete the stack as specified.
Artificial Intelligence:
Retrospects
Turing
IN 1950, ALAN TURING wrote a
most prophetic and provocative
article on Artificial Intelligence. It
was entitled "Computing Machin-
ery and Intelligence" and ap-
peared in the journal Mind. 1 I will
say some things about that article,
but I would like to precede them
with some remarks about Turing
the man.
Alan Mathison Turing was
born in London in 1912. He was a
chilq full of curiosity and humor.
Gifted in mathematics, he went to
Cambridge where his interests in
machinery and mathematical
logic cross-fertilized and resulted
in his famous paper on "comput-
able numbers", in which he in-
vented the theory of Turing
machines and demonstrated the
unsolvability of the halting prob-
lem; it was published in 1937. In
the 1940's, his interests turned
from the theory of computing
machines to the actual building of
real computers. He was a major
figure in the development of
computers in Britain, and a
staunch defender of Artificial In-
After having spelled out the nature of his test, Turing goes on to make
some commentaries on it, which, given the year he was writing in, are quite
sophisticated. To begin with, he gives a short hypothetical dialogue be-
tween interrogator and interrogatee: 3
Q: Please write me a sonnet on the subject of the Forth Bridge [a bridge
over the Firth of Forth, in Scotland].
A: Count me out on this one. I never could write poetry.
Q: Add 34957 to 70764.
A: (Pause about 30 seconds and then give as answer) 105621.
Q: Do you play chess?
A: Yes.
Q: I have K at my K I, and no other pieces. You have only K at K6 and Rat
Rl. It is your move. What do you play?
A: (After a pause of 15 seconds) R-R8 mate.
Few readers notice that in the arithmetic problem, not only is there an
inordinately long delay, but moreover, the answer given is wrong! This
would be easy to account for if the respondent were a human: a mere
calculational error. But if the respondent were a machine, a variety of
explanations are possible. Here are some:
Reflection on what Turing might have meant by this subtle touch opens up
just about all the major philosophical issues connected with Artificial Intel-
ligence.
Turing goes on to point out that
The new problem has the advantage of drawing a fairly sharp line between
the physical and the intellectual capacities of a man .... We do not wish to
penalize the machine for its inabilit} to shine in beauty competitions, nor to
penalize a man for losing in a race against an airplane. 4
One of the pleasures of the article is to see how far Turing traced out each
The game may perhaps be criticized on the ground that the odds are weight-
ed too heavily against the machine. If the man were to try to pretend to be the
machine he would clearly make a very poor showing. He would be given away
at once by slowness and inaccuracy in arithmetic. May not machines carry out
something which ought to be described as thinking but which is very different
from what a man does? This objection is a very strong one, but at least we can
say that if, nevertheless, a machine can be constructed to play the imitation
game satisfactorily, we need not be troubled by this objection.
It might be urged that when playing the "imitation game" the best strategy
for the machine may possibly be something other than imitation of the
behaviour of a man. This may be, but I think it is unlikely that there is any great
effect of this kind. In any case there is no intention to investigate here the
theory of the game, and it will be assumed that the best strategy is to try to
provide answers that would naturally be given by a man.S
Once the test has been proposed and discussed, Turing remarks:
Interrogator: In the first line of your sonnet which reads "Shall I compare
thee to a summer's day", would not "a spring day" do as well or better?
Witness: It wouldn't scan.
Interrogator: How about "a winter's day"? That would scan all right.
Witness: Yes, but nobody wants to be compared to a winter's day.
Interrogator: Would you say Mr. Pickwick reminded you of Christmas?
Witness: In a way.
Interrogator: Yet Christmas is a winter's day, and I do not think Mr. Pickwick
would mind the comparison.
Witness: I don't think you're serious. By a winter's day one means a typical
winter's day, rather than a special one like Christmas.
After this dialogue, Turing asks, "What would Professor Jefferson say if
the sonnet-writing machine was able to answer like this in the viva voce?"
Further objections:
(5) Arguments from Various Disabilities. These arguments take the form, "I
grant you that you can make machines do all the things that you have
mentioned but you will never be able to make one to do X." Numerous
features X are suggested in this connection. I offer a selection:
Be kind, resourceful, beautiful, friendly, have initiative, have a sense of
humor, tell right from wrong, make mistakes, fall in love, enjoy straw-
berries and cream, make someone fall in love with it, learn from experi-
ence, use words properly, be the subject of its own thought, have as
much diversity of behaviour as a man, do something really new.
(6) Lady Lovelace's Objection. Our most detailed information of Babbage's
Analytical Engine comes from a memoir by Lady Lovelace. In it she
states, "The Analytical Engine has no pretensions to originate anything. It
can do whatever we know how to order it to perform" (her italics).
(7) Argument from Continuity in the Nervous System. The nervous system is
certainly not a discrete state machine. A small error in the information
about the size of a nervous impulse impinging on a neuron may make a
large difference to the size of the outgoing impulse. It may be argued
that, this being so, one cannot expect to be able to mimic the behaviour
of the nervous system with a discrete state system.
(8) The Argument from Informality of Behaviour. I t seems to run something like
this. "If each man had a definite set of rules of conduct by which he
regulated his life he would be no better than a machine. But there are no
such rules, so men cannot be machines."
(9) The Argument from Extra-Sensory Perception. Let us play the imitation
game, using as witnesses a man who is good as a telepathic receiver, and a
digital computer. The interrogator can ask such questions as "What suit
As you can see, many of the objections overlap and are related to each
other. I have attempted in this book to answer most of them in some way or
other, usually far less concisely than Turing did.
Objection (9) I find remarkable. I have seen the Turing paper re-
printed in a book-but with objection (9) omitted-which I find equally
remarkable. My own point of view-contrary to Turing's-is that ESP does
not exist. Turing was reluctant to accept the idea that ESP is real, but did so
nonetheless, being compelled by his outstanding scientific integrity to ac-
cept the consequences of what he viewed as powerful statistical evidence in
favor of ESP. I disagree, though I consider it an exceedingly complex and
fascinating question.
Given the above excerpt, you may find this incredible. Incredible, but true.
Weizenbaum has an explanation:
Most men don't understand computers to even the slightest degree. So, unless
they are capable of very great skepticism (the kind we bring to bear while
watching a stage magician), they can explain the computer's intellectual feats
only by bringing to bear the single analogy available to them, that is, their
model of their own capacity to think. No wonder, then, that they overshoot
the mark; it is truly impossible to imagine a human who could imitate ELIZA,
for example, but for whom ELIZA's language abilities were his limit."
A Brief History of AI
I would like in the next few pages to present the story, perhaps from an
unorthodox point of view, of some of the efforts at unraveling the al-
gorithms behind intelligence; there have been failures and setbacks and
there will continue to be. Nonetheless, we are learning a great deal, and it is
an exciting period.
Ever since Pascal and Leibniz, people have dreamt of machines that
could perform intellectual tasks. In the nineteenth century, Boole and De
Morgan devised "laws of thought"-essentially the Propositional
mechanical translation
direct (dictionary look-up with some word rearrangement)
indirect (via some intermediary internal language)
game playing
chess
with brute force look-ahead
with heuristically pruned look-ahead
with no look-ahead
checkers
go
kalah
bridge (bidding; playing)
poker
variations on tic-tac-toe
etc.
Mechanical Translation
Many of the preceding topics will not be touched upon in my selective
discussion below, but the list would not be accurate without them. The first
few topics are listed in historical order. In each of them, early efforts fell
short of expectations. For example, the pitfalls in mechanical translation
came as a great surprise to many who had thought it was a nearly
straightforward task, whose perfection, to be sure, would be arduous, but
whose basic implementation should be easy. As it turns out, translation is
far more complex than mere dictionary look-up and word rearranging.
Nor is the difficulty caused by a lack of knowledge of idiomatic phrases.
The fact is that translation involves having a mental model of the world
being discussed, and manipulating symbols in that model. A program
which makes no use of a model of the world as it reads the passage will soon
get hopelessly bogged down in ambiguities and multiple meanings. Even
people-who have a huge advantage over computers, for they come fully
equipped with an understanding of the world-when given a piece of text
and a dictionary of a language they do not know, find it next to impossible
to translate the text into their own language. Thus-and it is not surprising
in retrospect-the first problem of AI led immediately to the issues at the
heart of AI.
Computer Chess
Computer chess, too, proved to be much more difficult than the early
intuitive estimates had suggested. Here again it turns out that the way
humans represent a chess situation in their minds is far more complex than
just knowing which piece is on which square, coupled with knowledge of
the rules of chess. It involves perceiving configurations of several related
pieces, as well as knowledge of heuristics, or rules of thumb, which pertain to
the triangle and its mirror image as two different triangles. Then, having
proved them congruent, it pointed out that the two base angles matched
each other in this congruence-QED.
This gem of a proof delighted the program's creator and others; some
saw evidence of genius in its performance. Not to take anything away from
this feat, it happens that in A.D. 300 the geometer Pappus had actually
found this proof, too. In any case, the question remains: "Who gets the
credit?" Is this intelligent behavior? Or was the proof lying deeply hidden
within the human (Gelernter), and did the computer merely bring it to the
surface? This last question comes close to hitting the mark. We can turn it
around: Was the prooflying deeply hidden in the program? Or was it close
to the surface? That is, how easy is it to see why the program did what it
did? Can the discovery be attributed to some simple mechanism, or simple
combination of mechanisms, in the program? Or was there a complex
interaction which, if one heard it explained, would not diminish one's awe
at its having happened?
It seems reasonable to say that if one can ascribe the performance to
certain operations which are easily traced in the program, then in some
sense the program was just revealing ideas which were in essence hidden-
though not too deeply-inside the programmer's own mind. Conversely, if
The resulting piece has a somewhat droll quality to it, though in spots it is
turgid and confused.
Is the computer composing? The question is best unasked, but it cannot be
completely ignored. An answer is difficult to provide. The algorithms are
deterministic, simple, and understandable. No complicated or hard-to-
understand computations are involved; no "learning" programs are used; no
random processes occur; the machine functions in a perfectly mechanical and
straightforward manner. However, the result is sequences of sound that are
unplanned in fine detail by the composer, even though the over-all structure
A
lis
Elea
B
Get from
A to B
Applying AI to Mathematics
Mathematics is in some ways an extremely interesting domain to study
from the AI point of view. Every mathematician has the sense that there is a
kind of metric between ideas in mathematics-that all of mathematics is a
network of results between which there are enormously many connections.
In that network, some ideas are very closely linked; others require more
elaborate pathways to be joined. Sometimes two theorems in mathematics
are close because one can be proven easily, given the other. Other times two
ideas are close because they are analogous, or even isomorphic. These are
two different senses of the word "dose" in the domain of mathematics.
There are probably a number of others. Whether there is an objectivity or a
universality to our sense of mathematical closeness, or whether it is largely
an accident of historical development is hard to say. Some theorems of
different branches of mathematics appear to us hard to link, and we. might
say that they are unrelated-but something might turn up later which
forces us to change our minds. If we could instill our highly developed
sense of mathematical closeness-a "mathematician's mental metric", so to
speak-into a program, we could perhaps produce a primitive "artificial
mathematician". But that depends on being able to convey a sense of
sirAlplicity or "naturalness" as well, which is another major stumbling block.
These issues have been confronted in a number of AI projects. Ther.e
Modularity of Knowledge
Another question which comes up in the representation of knowledge is
modularity. How easy is it to insert new knowledge? How easy is it to revise
old knowledge? How modular are books? It all depends. If from a tightly
structured book with many cross-references a single chapter is removed,
the rest of the book may become virtually incomprehensible. It is like trying
to pull a single strand out of a spider web-you ruin the whole in doing so.
On the other hand, some books are quite modular, having independent
chapters.
Consider a straightforward theorem-generating program which uses
TNT's axioms and rules of inference. The "knowledge" of such a program
has two aspects. It resides implicitly in the axioms and rules, and explicitly
in the body of theorems which have so far been produced. Depending on
which way you look at the knowledge, you will see it either as modular or as
spread all around and completely nonmodular. For instance, suppose you
had written such a program but had forgotten to include TNT's Axiom 1 in
the list of axioms. After the program had done many thousands of deriva-
tions, you realized your oversight, and inserted the new axiom. The fact
that you can do so in a trice shows that the system's implicit knowledge is
modular; but the new axiom's contribution to the explicit knowledge of the
system will only be reflected after a long time-after its effects have "dif-
Higher-Level Grammars . ..
In fact, I often pondered whether I could write an ATN-grammar (or some
other kind of sentence-producing program) which would only produce true
sentences about the world. Such a grammar would imbue the words with
genuine meanings, in the way it happened in the pq-system and in TNT.
This idea of a language in which false statements are ungrammatical is an
old one, going back to Johann Amos Comenius, in 1633. It is very appeal-
ing because you have a crystal ball embodied in your grammar: just write
down the statement you want to know about, and check to see if it is
grammatical .... Actually, Comenius went even further, for in his language,
false statements were not only ungrammatical-they were inexpressible!
Carrying this thought in another direction, you might imagine a high-
level grammar which would produce random koans. Why not? Such a
grammar would be equivalent to a formal system whose theorems are
koans. And if you had such a program, could you not arrange it to produce
only genuine koans? My friend Marsha Meredith was enthusastic about this
idea of" Artificial Ism", so she tackled the project of writing a koan-writing
program. One of her early efforts produced this curious quasi-koan:
A SMALL YOUNG MASTER WANTED A SMALL WHITE GNARLED
BOWL. "HOW CAN WE LEARN AND UNDERSTAND WITHOUT
STUDY?" THE YOUNG MASTER ASKED A LARGE CONFUSED MAS-
TER. THE CONFUSED MASTER WALKED FROM A BROWN HARD
MOUNT AIN TO A WHITE SOFT MOUNTAIN WITH A SMALL RED
STONY BOWL. THE CONFUSED MASTER SAW A RED SOFT HUT.
THE CONFUSED MASTER WANTED THE HUT. "WHY DID
BODHIDHARMA COME INTO CHINA?" THE CONFUSED MASTER
FIGURE 116. A meaningful story in Arabic. [From A. Khatibi and M. Sijelmassi, The
Splendour of Islamic Calligraphy (New York: Riz.z.oli, 1976).]
The different possibilities for the meaning of "the" are procedures which
check various facts about the context, then prescribe actions such as "Look for
a unique object in the data base which fits this description", or "Assert that the
object being described is unique as far as the speaker is concerned." The
program incorporates a variety of heuristics for deciding what part of the
context is relevant. I8
It is amazing how deep this problem with the word "the" is. It is probably
safe to say that writing a program which can fully handle the top five words
FIGURE 118. Procedural representation of "a red cube which supports a pyramid."
[Adapted from Roger Schank and Kenneth Colby, Computer Models of Thought and Language
(San Francisco: W. H. Freeman, 1973), p. 172.]
No more
No
No
No more
No
tern's underlying categorization of the world. The result can be represented
in a flow chart like that in Figure 118. Note that this is a program for finding
an objeCt fitting the description. It would then be incorporated into a com-
mand for doing something with the object, a question asking something about
it, or, if it appeared in a statement, it would become part of the program
which was generated to represent the meaning for later use. Note that this bit
of program could also be used as a test to see whether an object fit the
description, if the first FIND instruction were told in advance to look only at
that particular object.
At first glance, it seems that there is too much structure in this program, as
we don't like to think of the meaning of a simple phrase as explicitly contain-
ing loops, conditional tests, and other programming details. The solution is to
provide an internal language that contains the appropriate looping and
checking as its primitives, and in which the representation of the process is as
simple as the description. The program described in Figure 118 would be
written in PLANNER looking something like what is below:
(GOAL (IS ?X 1 BLOCK
(GOAL (COLOR-OF ?Xl RED
(GOAL (EQUIDIMENSIONAL ?Xl
(GOAL (IS ?X2 PYRAMID
(GOAL (SUPPORT ?Xl ?X2
The loops of the flowchart are implicit in PLANNER'S backtrack control
structure. The description is evaluated by proceeding down the list until some
goal fails, at which time the system backs up automatically to the last point
where a decision was made, trying a different possibility. A decision can be
made whenever a new object name or VARIABLE (indicated by the prefix
"?") such as "?Xl" or "?X2" appears. The variables are used by the pattern
matcher. If they have already been assigned to a particular item, it checks to
see whether the GOAL is true for that item. If not, it checks for all possible
items which satisfy the GOAL, by choosing one, and then taking successive
ones whenever backtracking occurs to that point. Thus, even the distinction
between testing and choosing is implicit. 21
The Crab has invited a small group offriends over to watch the Saturday
afternoon football game on television. Achilles has already arrived, but the
Tortoise and his friend the Sloth are still awaited.
Contrafactus 633
next-to-Iast (and only) movement was a one-voice fugue. You can't
imagine its intricacies. For our finale, we played Beethoven's Ninth
Zenfunny. At the end, everyone in the audience rose and clapped with
one hand. It was overwhelming.
Sloth: Oh, I'm sorry I missed it. But do you suppose it's been recorded? At
home I have a fine hi-fi to play it on-the best two-channel monaural
system money can buy.
Crab: I'm sure you can find it somewhere. Well, my friends, the game is
about to begin.
Achilles: Who is playing today, Mr. Crab?
Crab: I believe it's Home Team versus Visitors. Oh, no-that was last
week. I think this week it's Out-of-Towners.
Achilles: I'm rooting for Home Team. I always do.
Sloth: Oh, how conventional. I never root for Home Team. The closer a
team lives to the antipodes, the more I root for it.
Achilles: Oh, so you live in the Antipodes? I'vtj heard it's charming to live
there, but I wouldn't want to visit them. They're so far away.
Sloth: And the strange thing about them is that they don't get any closer
no matter which way you traveL
Tortoise: That's my kind of place.
Crab: It's game time. I think I'll turn on the TV.
(He walks over to an enormous cabinet with a screen, underneath which is
an instrument panel as complicated as that of a jet airplane. He flicks a
knob, and the football stadium appears in bright vivid color on the screen.)
Announcer: Good afternoon, fans. Well, it looks like that time of year has
rolled around again when Home Team and Out-of-Town face each
other on the gridiron and play Ollt their classic pigskin rivalry. It's been
drizzling on and off this afternoon, and the field's a little wet, but
despite the weather it promises to be a fine game, especially with that
GREAT pair of eighth-backs playing for Home Team, Tedzilliger and
Palindromi. And now, here's Pilipik, kicking off for Home Team. It's
in the air! Flampson takes it for Out-of-Towners, and runs it back-
he's to the 20, the 25, the 30, and down at the 32. That was Mool in on
the tackle for Home Team.
Crab: A superb runback! Did you see how he was ALMOST tackled by
Quilker-but somehow broke away?
Sloth: Oh, don't be silly, Crab. Nothing of the kind happened. Quilker did
NOT tackle Flampson. There's no need to confuse poor Achilles (or the
rest of us) with hocus-pocus about what "almost" happened. It's a
fact-with no "almost" 's, "if" 's, "and" 's, or "but" 'So
Announcer: Here's the instant replay. Just watch number 79, Quilker,
come in from the side, surprising Flampson, and just about tackle him!
Sloth: "Just about"! Bah!
Achilles: Such a graceful maneuver! What would we do without instant
replays?
634 Contrafactus
Announcer: It's first down and 10 for Out-of-Town. Noddle takes the ball,
hands off to Orwix-it's a reverse-Orwix runs around to the right,
handing off to Flampson-a double reverse, folks!-and now
Flampson hands it to Treefig, who's downed twelve yards behind
scrimmage. A twelve-yard loss on a triple reverse!
Sloth: I love it! A sensational play!
Achilles: But, Mr. S, I thought you were rooting for Out-of-Town. They
lost twelve yards on the play.
Sloth: They did? Oh, well-who cares, as long as it was a beautiful play?
Let's see it again.
( ... and so the first half of the game passes. Towards the end of the third
quarter, a particularly crucial play comes up for Home Team. They are
behind by eight points. It's third down and 10, and they badly need afirst
down.)
Announcer: The ball is hiked to Tedzilliger, who fades back, looking for a
receiver, and fakes to Quilker. There's Palindromi, playing wide right,
with nobody near him. Tedzilliger spots him and fires a low pass to
him. Palindromi snatches it out of the air, and- (There is an audible
groan from the crowd.)--oh, he steps out of bounds! What a crushing
blow for Home Team, folks! If Palindromi hadn't stepped out of
bounds, he could've run all the way to the end zone for a touchdown!
Let's watch the subjunctive instant replay.
(And on the screen the same lineup appears as before.)
The ball is hiked to Tedzilliger, who fades back, looking for a receiver,
and fakes to Quilker. There's Palindromi, playing wide right, with
nobody near him. Tedzilliger spots him, and fires a low pass to him.
Palindromi snatches it out of the air, and- (There is an audible gasp from
the crowd.)-he almost steps out of bounds! But he's still in bounds, and
it's clear all the way to the end zone! Palindromi streaks in, for a
touchdown for Home Team! (The stadium breaks into a giant roar of
approval.) Well, folks, that's what would've happened if Palindromi
hadn't stepped out of bounds.
Achilles: Wait a minute ... WAS there a touchdown, or WASN'T there?
Crab: Oh, no. That was just the subjunctive instant replay. They simply
followed a hypothetical a little way out, you know.
Sloth: That is the most ridiculous thing I ever heard of! Next thing you
know, they'll be inventing concrete earmuffs.
Tortoise: Subjunctive instant replays are a little unusual, aren't they?
Crab: Not particularly, if you have a Subjunc-TV.
Achilles: Is that one grade below a junk TV?
Crab: Not at all! It's a new kind of TV, which can go into the subjunctive
mode. They're particularly good for football games and such. Ijust got
mine.
Achilles: Why does it have so many knobs and fancy dials?
Contrafactus 635
Crab: So that you can tune it to the proper channel. There are many
channels broadcasting in the subjunctive mode, and you want to be
able to select from them easily.
Achilles: Could you show us what you mean? I'm afraid I don't quite
understand what all this talk of "broadcasting in the subjunctive mode"
is about.
Crab: Oh, it's quite simple, really. You can figure it out yourself. I'm going
into the kitchen to fix some French fries, which I know are Mr. Sloth's
weakness.
Sloth: Mmmmm! Go to it, Crab! French fries are my favorite food.
Crab: What about the rest of you?
Tortoise: I could devour a few.
Achilles: Likewise. But wait-before you go into the kitchen, is there some
trick to using your Subjunc-TV'
Crab: Not particularly. Just continue watching the game, and whenever
there's a near miss of some sort, or whenever you wish things had gone
differently in some way, just fiddle with the dials, and see what hap-
pens. You can't do it any harm, though you may pick up some exotic
channels. (And he disappears into the kitchen.)
Achilles: I wonder what he means by that. Oh well, let's get back to this
game. I was quite wrapped up in it.
Announcer: It's fourth down for Out-of-Town, with Home Team receiv-
ing. Out-of-Town is in punt formation, with Tedzilliger playing deep.
Orwix is back to kick-and he gets a long high one away. It's coming
down near Tedzilliger-
Achilles: Grab it, Tedzilliger! Give those Out-of-Towners a run for their
money!
Announcer: -and lands in a puddle-KERsPLOSH! It takes a weird bounce!
Now Sprunk is madly scrambling for the ball! It looks like it just barely
grazed Tedzilliger on the bounce, and then slipped away from him-
it's ruled a fumble. The referee is signaling that the formidable Sprunk
has recovered for Out-of-Town on the Home Team 7! It's a bad break
for Home Team. Oh, well, thafs the way the cookie crumbles.
Achilles: Oh, no! If only it hadn't been raining ... (Wrings his hands in
despair.)
Sloth: ANOTHER of those confounded hypotheticals! Why are the rest of
you always running off into your absurd worlds of fantasy? If I were
you, I would stay firmly grounded in reality. "No subjunctive non-
sense" is my motto. And I wouldn't abandon it even if someone offered
me a hundred-nay, a hundred and twelve-French fries.
Achilles: Say, that gives me an idea. Maybe by suitably fiddling with these
knobs, I can conjure up a subjunctive instant replay in which it isn't
raining, there's no puddle, no weird bounce, and Tedzilliger doesn't
fumble. I wonder ... (Walks up to the Subjunc-TV and stares at it.) But I
haven't any idea what these different knobs do. (Spins a few at random.)
Announcer: It's fourth down for Out-of-Town, with Home Team receiv-
636 Contrafactus
ing. Out-of-Town is in punt formation, with Tedzilliger playing deep.
Orwix is back to kick-and he gets a long high one away. It's coming
down near Tedzilliger-
Achilles: Grab it, Tedzilliger! Give those Out-of-Towners a run for their
money!
Announcer: -and lands in a puddle-KERsPLOSH! Oh-it bounces right
into his arms! Now Sprunk is madly scrambling after him, but he's got
good blocking, and he steers his way clear of the formidable Sprunk,
and now he's got an open field ahead of him. Look at that, folks! He's
to the 50, the 40, the 30, the 20, the lO-touchdown, Home Team!
(Huge cheers from the Home Team side.) Well, fans, that's how it would
have gone, if footballs were spheres instead of oblate spheroids! But in
reality, Home Team loses the ball, and Out-of-Towners take over on
the Home Team 7-yard line. Oh, well, that's the way the ball bounces.
Achilles: What do you think of THAT, Mr. Sloth?
(And Achilles gives a smirk in the direction of the Sloth, but the latter is
completely oblivious to its devastating effect, as he is busy watching the
Crab arrive with a large platter with a hundred and twelve--1lO,y, a
hundred-large and delicious French fries, and napkins for all.)
Crab: So how do you three find my Subjunc-TV?
Sloth: Most disappointing, Crab, to be quite frank. It seems to be badly out
of order. It makes pointless excursions into nonsense at least half the
time. If it belonged to me, I would give it away immediately to some-
one like you, Crab. But of course it doesn't belong to me.
Achilles: It's quite a strange device. I tried to rerun a play to see how it
would have gone under different weather conditions, but the thing
seems to have a will of its own! Instead of changing the weather, it
changed the football shape to ROUND instead of FOOTBALL-SHAPED!
Now tell me-how can a football not be shaped like a football? That's a
contradiction in terms. How preposterous!
Crab: Such tame games! I thought you'd surely find more interesting
subjunctives. How would you like to see how the last play would have
looked if the game had been baseball instead of football?
Tortoise: Oh! An outstanding idea!
(The Crab twiddles two knobs, and steps back.)
Announcer: There are four away, and-
Achilles: FOUR away!?
Announcer: That's right, fans-four away. When you turn football into
baseball, SOMETHING's got to give! Now as I was about to say, there are
four away, with Out~of-Town in the field, and Home Team up. Tedzil-
liger is at bat. Out-of-Town is in bunt formation. Orwix raises his arm
to pitch-and he gets a long high ball away. It's heading straight for
T edzilliger-
Achilles: Smash it, Tedzilliger! Give those Out-of-Towners a home run for
their money!
Contrajactus 637
Announcer: -but it seems to be a spitball, as it takes a strange curve. Now
Sprunk is madly scrambling for the ball! It looks like it just barely
grazed Tedzilliger's bat, then bounced off it-it's ruled a fiy ball. The
umpire is signaling that the formidable Sprunk has caught it for
Out-of-Town, to end the seventh inning. It's a bad break for Home
Team. That's how the last play would have looked, football fans, if this
had been a game of baseball.
Sloth: Bah! You might as well transport this game to the Moon.
Crab: No sooner said than done! Just a twiddle here, a twiddle there ...
(On the screen there appears a desolate crater-pittedfield, with two teams in
space suits facing each other, immoblle. All at once, the two teams fly into
motion, and the players are making great bounds into the air, sometimes
over the heads of other players. The ball is thrown into the air, and sails so
high that it almost disappears, and then slowly comes floating down into the
arms of one space-suited player, roughly a quarter-mile from where it was
released.)
Announcer: And there, friends, you have the subjunctive instant replay as
it would have happened on the Moon. We'll be right back after this
important commercial message from the friendly folks who brew
Glumpf Beer-my favorite kind of beer!
Sloth: If I weren't so lazy, I would take that broken TV back to the dealer
myself! But alas, it's my fate to be a lazy Sloth ... (Helps himself to a large
gob of French fries.)
Tortoise: That's a marvelous invention, Mr. Crab. May I suggest a
hypothetical?
Crab: Of course!
Tortoise: What would that last play have looked like if space were four-
dimensional?
Crab: Oh, that's a complicated one, Mr. T, but I believe I can code it into
the dials. Just a moment.
(He steps up, and,Jor the first time, appears to be using the full power of
the control panel if his Subjunc-TV, turning almost every knob two or
three times, and carefully checking various meters. Then he steps back with
a satisfied expression on his face.)
I think this should do it.
Announcer: And now let's watch the subjunctive instant replay.
(A confusing array of twisted pipes appears on the screen. It grows larger,
then smaller, and for a moment seems to do something akin to rotation.
Then it turns into a strange mushroom-shaped object, and back to a bunch
if pipes. As it metamorphoses from this into other biz.arre shapes, the
annnouncer gives his commmentary.)
Tedzilliger's fading back to pass. He spots Palindromi ten yards
outfield, and passes it to the right and outwards-it looks good! Palin-
dromi's at the 35-yard plane, the 40, and he's tackled on his own
638 Contrafactus
43-yard plane. And there you have it, 3-D fans, as it would've looked if
football were played in four spatial dimensions.
Achilles: What is it you are doing, Mr. Crab, when you twirl these various
dials on the control panel?
Crab: I am selecting the proper subjunctive channel. You see, there are all
sorts of subjunctive channels broadcasting simultaneously, and I want
to tune in precisely that one which represents the kind of hypothetical
which has been suggested.
Achilles: Can you do this on any TV?
Crab: No, most TV's can't receive subjunctive channels. They require a
special kind of circuit which is quite difficult to make.
Sloth: How do you know which channel is broadcasting what? Do you look
it up in the newspaper?
Crab: I don't need to know the channel's call letters. Instead, I tune it in
by coding, in these dials, the hypothetical situation which I want to be
represented. Technically, this is called "addressing a channel by its
counterfactual parameters". There are always a large number of
channels broadcasting every conceivable world. All the channels which
carry worlds that are "near" to each other have call letters that are near
to each other, too.
Tortoise: Why did you not have to turn the dials at all, the first time we saw
a subjunctive instant replay?
Crab: Oh, that was because I was tuned in to a channel which is very near
to the Reality Channel, but ever so slightly off. So every once in a while,
it deviates from reality. It's nearly impossible to tune EXACTLY into the
Reality Channel. But that's all right, because it's so dull. All their
instant replays are straight! Can you imagine? What a bore!
Sloth: I find the whole idea ofSubjunc-TV's one giant bore. But perhaps I
could change my mind, if I had some evidence that your machine here
could handle an INTERESTING counterfactual. For example, how
would that last play have looked if addition were not commutative?
Crab: Oh me, oh my! That change is a little too radical, I'm afraid, for this
model. I unfortunately don't have a Superjunc-TV, which is the top of
the line. Superjunc-TV's can handle ANYTHING you throw at them.
Sloth: Bah!
Crab: But look-I can do ALMOST as well. Wouldn't you like to see how
the last play would have happened if 13 were not a prime number?
Sloth: No thanks! THAT doesn't make any sense! Anyway, if I were the last
play, I'd be getting pretty tired of being trotted out time and again in
new garb for the likes of you fuzzy-headed concept-slippers. Let's get
on with the game!
Achilles: Where did you get this Subjunc-TV, Mr. Crab?
Crab: Believe it or not, Mr. Sloth and I went to a country fair the other
evening, and it was offered as the first prize in a lottery. Normally I
don't indulge in such frivolity, but some crazy impulse grabbed me,
and I bought one ticket.
Contrafactus 639
Achilles: What about you, Mr. Sloth?
Sloth: I admit, I bought one, just to humor old Crab.
Crab: And when the winning number was announced, I found, to my
amazement, that I'd won the lottery!
Achilles: Fantastic! I've never known anyone who won anything in a lot-
tery before!
Crab: I was flabbergasted at my good fortune.
Sloth: Don't you have something else to tell us about that lottery, Crab?
Crab: Oh, nothing much. It's just that my ticket number was 129. Now
when they announced the winning number, it was 128-just one off.
Sloth: So you see, he actually didn't win it at all.
Achilles: He ALMOST won, though ...
Crab: I prefer to say that I won it, you see. For I came so terribly close ...
If my number had been only one smaller, I would have won.
Sloth: But unfortunately, Crab, a miss is as good as a mile.
Tortoise: Or as bad. What about you, Mr. Sloth? What was your number?
Sloth: Mine was 256-the next power of 2 above 128. Surely, that counts
as a hit, if anything does! I can't understand why, however, those fair
officials-those UNfair officials-were so thickheaded about it. They
refused to award me my fully deserved prize. Some other joker
claimed HE deserved it, because his number was 128. I think my
number was far closer than HIS, but you can't fight City Hall.
Achilles: I'm all confused. If you didn't win the Subjunc-TV after all, Mr.
Crab, then how can we have been sitting here all afternoon watching
it? It seems as if we ourselves have been living in some sort ofhypothet-
ical world that would have been, had circumstances just been ever so
slightly different ...
Announcer: And that, folks, was how the afternoon at Mr. Crab's would
have been spent, had he won the Subjunc-TV. But since he didn't, the
four friends simply spent a pleasant afternoon watching Home Team
get creamed, 128-0. Or was it 256-0? Oh well, it hardly matters, in
five-dimensional Plutonian steam hockey.
640 Contrafactus
CHAPTER XIX
Artificial Intelligence:
Prospects
"Almost" Situations and Subjunctives
AFTER READING Contrafactus, a friend said to me, "My uncle was almost
President of the U.S.!" "Really?" I said. "Sure," he replied, "he was skipper
of the PT 108." Oohn F. Kennedy was skipper of the PT 109.)
That is what Contrifactus is all about. In everyday thought, we are
constantly manufacturing mental variants on situations we face, ideas we
have, or events that happen, and we let some features stay exactly the same
while others "slip". What features do we let slip? What ones do we not even
consider letting slip? What events are perceived on some deep intuitive
level as being close relatives of ones which really happened? What do we
think "almost" happened or "could have" happened, even though it unam-
biguously did not? What alternative versions of events pop without any
conscious thought into our minds when we hear a story? Why do some
counterfactuals strike us as "less counterfactual" than other counterfactu-
als? After all, it is obvious that anything that didn't happen didn't happen.
There aren't degrees of "didn't-happen-ness". And the same goes for
"almost" situations. There are times when one plaintively says, "It almost
happened", and other times when one says the same thing, full of relief.
But the "almost" lies in the mind, not in the external facts.
Driving down a country road, you run into a swarm of bees. You don't
just duly take note of it; the whole situation is immediately placed in
perspective by a swarm of "replays" that crowd into your mind. Typically,
you think, "Sure am lucky my window wasn't open!"--or worse, the re-
verse: "Too bad my window wasn't closed!" "Lucky I wasn't on my bike!"
"Too bad I didn't come along five seconds earlier." Strange but possible
replays: "If that had been a deer, I could have been killed!" "I bet those
bees would have rather had a collision with a rosebush." Even stranger
replays: "Too bad those bees weren't dollar bills!" "Lucky ~hose bees
weren't made of cement!" "Too bad it wasn't just one bee instead of a
swarm." "Lucky I wasn't the swarm instead of being me." What slips
naturally and what doesn't-and why?
In a recent issue of The New Yorker magazine, the following excerpt
from the "Philadelphia Welcomat" was reprinted:!
The point of The New Yorker's comment is not that such counterfactuals are
false; it is more that anyone who would entertain such an idea-anyone who
would "slip" the sex or number of a given human being-would have to be
a little loony. Ironically, though, in the same issue, the following sentence,
concluding a book review, was printed without blushing:
Now poor Professor Frank is dead; and clearly it is nonsense to suggest that
someone could read books written after his death. So why wasn't this
serious sentence also scoffed at? Somehow, in some difficult-to-pin-down
sense, the parameters slipped in this sentence do not violate our sense of
"possibility" as much as in the earlier examples. Something allows us to
imagine "all other things being equal" better in this one than in the others.
But why? What is it about the way we classify events and people that makes
us know deep down what is "sensible" to slip, and what is "silly"?
Consider how natural it feels to slip from the valueless declarative "I
don't know Russian" to the more charged conditional "I would like to know
Russian" to the emotional subjunctive "I wish I knew Russian" and finally to
the rich counterfactual "If I knew Russian, I would read Chekhov and
Lermontov in the original". How flat and dead would be a mind that saw
nothing in a negation but an opaque barrier! A live mind can see a window
onto a world of possibilities.
I believe that "almost" situations and unconsciously manufactured
subjunctives represent some of the richest potential sources of insight into
how human beings organize and categorize their perceptions of the world.
An eloquent co-proponent of this view is the linguist and translator George
Steiner, who, in his book After Babel, has written:
Hypotheticals, 'imaginaries', conditionals, the syntax of counter-factuality and
contingency may well be the generative centres of human speech .... [They]
do more than occasion philosophical and grammatical perplexity. No less
than future tenses to which they are, one feels, related, and with which they
ought probably to be classed in the larger set of ,sup positiona Is' or 'alternates',
these 'if' propositions are fundamental to the dynamics of human feeling ....
Ours is the ability, the need, to gainsay or 'un-say' the world, to image and
speak it otherwise .... We need a word which will designate the power, the
compulsion of language to posit 'otherness' .... Perhaps 'alternity' will do: to
define the 'other than the case', the counter-factual propositions, images,
shapes of will and evasion with which we charge our mental being and by
means of which we build the changing, largely fictive milieu of our somatic
and our social existence....
Layers of Stability
It seemed to me then, and still does now, that the slippability of a feature of
some event (or circumstance) depends on a set of nested contexts in which
the event (or circumstance) is perceived to occur. The terms constant,
parameter, and variable, borrowed from mathematics, seem useful here.
Often mathematicians, physicists, and others will carry out a calculation,
saying "c is a constant, p is a parameter, and v is a variable". What they
Bongard Problems
Bongard problems (BP's) are problems of the general type given by the
Russian scientist M. Bongard in his book Pattern Recognition. A typical
BP-number 51 in his collection of one hundred-is shown in Figure 119.
DO DO
r-:ollo:l
DO ~~
00 CJD 51
FIGURE 119. Bongard problem 51. [From M. Bongard, Pattern Recognition (Rochelle Park,
N.].: Hayden Book Co., Spartan Books, 1970).]
may be selected. This is roughly the point at which the conscious and the
unconscious meet, in humans. This discussion is primarily concerned with
describing what happens from here on out.
High-Level Descriptions
Now that the picture is "understood", to some extent, in terms of familiar
concepts, some looking around is done. Tentative descriptions are made
for one or a few of the twelve boxes. They will typically use simple descrip-
tors such as
above, below, to the right of, to the left of, inside, outside of, close
to, far from, parallel to, perpendicular to, in a row, scattered,
evenly spaced, irregularly spaced, etc.
further to the right of, less close to, almost parallel to, etc.
Each of these descriptions sees the box through a "filter". Out of context,
any of them might be a useful description. As it turns out, though, all of
them are "wrong", in the context of the particular Bongard problem they
are part of. In other words, if you knew the distinction between Classes I
and II in BP 47, and were given one of the preceding lines as a description
of an unseen drawing, that information would not allow you to tell to which
Class the drawing belonged. The essential feature of this box, in context, is
that it includes
Note that someone who heard such a description would not be able to
reconstruct the original drawing, but would be able to recognize drawings
91
FIGURE 121. Bongard problem 91. [From M. Bongard, Pattern Recognition.]
which have this property. It is a little like musical style: you may be an
infallible recognizer of Mozart, but at the same time unable to write any-
thing which would fool anybody into thinking it was by Mozart.
Now consider box I-D of BP 91 (Fig. 121). An overloaded but "right"
description in the context of BP 91 is
49
A Heterarchical Program
Now when subdescriptions are sought, the terms "interior" and "exterior"
will cause procedures to inspect those specific regions of the box. What is
found in BP 49, box I-A is this:
Now Sam, constantly active in parallel with other operations, spots the
recurrence of the concept "three" in all the slots dealing with o's, and this is
strong reason to undertake a second template-restructuring operation.
Notice that the first was suggested by the concept net, the second by Sam.
Now our template for problem 49 becomes:
A square is a polygon.
A triangle is a polygon.
A polygon is a closed curve.
FIGURE 123. A small portion of a concept network for a program to solve Bongard
problems. "Nodes" are joined by "links", which in tum can be linked. By considering a link as
a verb and the nodes it joins as subject and object, you can pull out some English sentences from
this diagram.
33
FIGURE 124. Bongard problem 33. [From M. Bongard, Pattern Recognition.]
jump to the idea that Class I boxes contain "pointy" shapes, Class II boxes
contain "smooth" ones. But on closer inspection, this is wrong. Neverthe-
less, there is a worthwhile insight here, and one can try to push it further,
by sliding around in the network of concepts beginning at "pointy". It is
close to the concept "acute", which is precisely the distinguishing feature of
Class I. Thus one of the main functions of the concept network is to allow
early wrong ideas to be modified slightly to slip into variations which may
be correct.
Meta- Descriptions
Now we come to another vital part of the recognition process, and !;hat has
to do with levels of abstraction and meta-descriptions. For this let us
consider BP 91 (Fig. 121) again. What kind of template could be con-
structed here? There is such an amount of variety that it is hard to know
where to begin. But this is in itself a clue! The clue says, namely, that the
class distinction very likely exists on a higher level of abstraction than that
of geometrical description. This observation clues the program that it
should construct descriptions of descriptions-that is, meta-descriptions. Perhaps
on this second level some common feature will emerge; and if we are lucky,
we will discover enough commonality to guide us towards the formulation
of a template for the meta-descriptions! So we plunge ahead without a
template, and manufacture descriptions for various boxes; then, once these
descriptions have been made, we def>cribe them. What kinds of slot will our
template for meta-descriptions have? Perhaps these, among others:
concepts used: - -
recurring concepts: - -
names of slots: - -
filters used: - -
There are many other kinds of slots which might be needed in meta-
descriptions, but this is a sample. Now suppose we have described box I-E
of BP 91. Its (template-less) description might look like this:
Of course much information has been thrown out: the fact that the three
vertical lines are of the same length, are spaced equidistantly, etc. But it is
plausible that the above description would be made. So the meta-
description might look like this:
Not all slots of the meta-description need be filled in; information can be
thrown away on this level as well as on the '~ust-plain-description" level.
Now if we were to make a description for any of the other boxes of
Class I, and then a meta-description of it, we would wind up filling the slot
"repetitions in description" each time with the phrase "3 copies of ... " The
sameness-detector would notice this, and pick up three-ness as a salient
feature, on quite a high level of abstraction, of the boxes of Class I.
Similarly, four-ness would be recognized, via the method of meta-
descriptions, as the mark of Class II.
Flexibility Is Important
Now you might object that in this case, resorting to the method of meta-
descriptions is like shooting a fly with an elephant gun, for the three-ness
versus four-ness might as easily have shown up on the lower level if we had
constructed our descriptions slightly differently. Yes, true-but it is impor-
tant to have the possibility of solving these problems by different routes.
There should be a large amount of flexibility in the program; it should not
be doomed if, malaphorically speaking, it "barks up the wrong alley" for a
while. (The amusing term "malaphor" was coined by the newspaper col-
umnist Lawrence Harrison; it means a cross between a malapropism and a
metaphor. It is a good example of "recombinant ideas".) In any case, I
wanted to illustrate the general principle that says: When it is hard to build
a template because the preprocessor finds too much diversity, that should
serve as a clue that concepts on a higher level of abstraction are involved
than the preprocessor knows about.
22
FIGURE 127. Bongard problem 22. [From M. Bongard, Pattern Recognition.]
ing involves making a description whose focus is some part of the drawing
in the box, to the exclusion of everything else. Filtering involves making a
description which concentrates on some particular way of viewing the
contents of the box, and deliberately ignores all other aspects. Thus they
are complementary: focusing has to do with objects (roughly, nouns), and
filtering has to do with concepts (roughly, adjectives). For an example of
focusing, let's look at BP 55 (Fig. 126). Here, we focus on the indentation
and the little circle next to it, to the exclusion of the everything else in the
box. BP 22 (Fig. 127) presents an example of filtering. Here, we must filter
out every concept but that of size. A combination of focusing and filtering is
required to solve problem BP 58 (Fig. 128).
One of the most important ways to get ideas for focusing and filtering
is by another sort of "focusing": namely, by inspection of a single particu-
larly simple box-say one with as few objects in it as possible. It can be
+ +
61
~
... +
extremely helpful to compare the starkest boxes from the two Classes. But
how can you tell which boxes are stark until you have descriptions for
them? Well, one way of detecting starkness is to look for a box with a
minimum of the features provided by the preprocessor. This can be done
very early, for it does not require a pre-existing template; in fact, this can
be one useful way of discovering features to build into a template. BP 61
(Fig. 129) is an example where that technique might quickly lead to a solution.
71
FIGURE 130. Bongard problems 70-71. [From M. Bongard, Pattern Recognition.]
slots are shifted from one level of generality to another; filtering and
focusing are done; and so on. There are discoveries on all levels of com-
plexity. The Kuhnian theory that certain rare events called "paradigm
shifts" mark the distinction between "normal" science and "conceptual
revolutions" does not seem to work, for we can see paradigm shifts happen-
ing all throughout the system, all the time. The fluidity of descriptions
ensures that paradigm shifts will take place on all scales.
Of course, some discoveries are more "revolutionary" than others,
because they have wider effects. For instance, one can make the discovery
that problems 70 and 71 (Fig. 130) are "the same problem", when looked at
on a sufficiently abstract level. The key observation is that both involve
depth-2 versus depth-l nesting. This is a new level of discovery that can be
made about Bongard problems. There is an even higher level, concerning
the collection as a whole. If someone has never seen the collection, it can be
a good puzzle just to figure out what it is. To figure it out is a revolutionary
insight, but it must be pointed out that the mechanisms of thought which
allow such a discovery to be made are no different from those which
operate in the solution of a single Bongard problem.
Enzymes and AI
Another rich source of ideas for message passing-indeed, for information
processing in general-is, of course, the cell. Some objects in the cell are
quite comparable to actors-in particular, enzymes. Each enzyme's active
site acts as a filter which only recognizes certain kinds of substrates (mes-
sages). Thus an enzyme has an "address", in effect. The enzyme is "pro-
grammed" (by virtue of its tertiary structure) to carry out certain opera-
tions upon that "message", and then to release it to the world again. Now in
this way, when a message is passed from enzyme to enzyme along a
chemical pathway, a lot can be accomplished. We have already described
the elaborate kinds of feedback mechanisms which can take place in cells
(either by inhibition or repression). These kinds of me::chanisms show that
complicated control of processes can arise through the kind of message
passing that exists in the cell.
One of the most striking things about enzymes is how they sit around
idly, waiting to be triggered by an incoming substrate. Then, when the
substrate arrives, suddenly the enzyme springs into action, like a Venus's-
ftytrap. This kind of "hair-trigger" program has been used in AI, and goes
by the name of demon. The important thing here is the idea of having many
different "species" of triggerable subroutines just lying around waiting to
FIGURE 132.
In fact, this very image is what inspired me to cast the description of the
Crab Canon's evolution in terms of meiosis-which is itself, of course, yet
another example of conceptual mapping.
Recombinant Ideas
Th~re are a variety of techniques of fusion of two symbols. One involves
lining the two ideas up next to each other (as if ideas were linear!), then
judiciously choosing pieces from each one, and recombining them in a new
symbol. This strongly recalls genetic recombination. Well, what do chromo-
somes exchange, and how do they do it? They exchange genes. What in a
symbol is comparable to a gene? If symbols have frame-like slots, then slots,
perhaps. But which slots to exchange, and why? Here is where the crab-
canonical fusion may offer some ideas. Mapping the notion of "musical
crab canon" onto that of "dialogue" involved several auxiliary mappings; in
Two other ideas in this book which share that conceptual skeleton are (1)
the Tortoise's solution to Achilles' puzzle, asking for a word beginning and
ending in "HE" (the Tortoise's solution being the pronoun "HE", which
collapses two occurrences into one), and (2) the Pappus-Gelernter proof of
the Pons Asinorum Theorem, in which one triangle is reperceived as two.
Incidentally, these droll concoctions might be dubbed "demi-doublets".
A conceptual skeleton is like a set of constant features (as distinguished
from parameters or variables)-features which should not be slipped in a
subjunctive instant replay or mapping-operation. Having no parameters or
variables of its own to vary, it can be the invariant core of several different
ideas. Each instance of it, such as "tandem unicycle", does have layers of
variability and so can be "slipped" in various ways.
Although the name "conceptual skeleton" sounds absolute and rigid,
actually there is a lot of play in it. There can be conceptual skeletons on
several different levels of abstraction. For instance, the "isomorphism"
between Bongard problems 70 and 71, already pointed out, involves a
higher-level conceptual skeleton than that needed to solve either problem
in isolation.
Ports of Access
One of the major characteristics of each idiosyncratic style of thought is
how new experiences get classified and stuffed into memory, for that
defines the "handles" by which they will later be retrievable. And for
events, objects, ideas, and so on-for everything that can be thought
about-there is a wide variety of "handles". I am struck by this each time I
reach down to turn on my car radio, and find, to my dismay, that it is
already on! What has happened is that two independent representations
are being used for the radio. One is "music producer", the other is "bore-
dom reliever". I am aware that the music is on, but I am bored anyway, and
before the two realizations have a chance to interact, my reflex to reach
All of them can act as ports of access. Though they all are attached to my
symbol for my car radio, accessing that symbol through one does not open
up all the others. Thus it is unlikely that I will be inspired to remember
lying on my back to fix the radio when I reach down and turn it on. And
conversely, when I'm lying on my back, unscrewing screws, I probably
won't think about the time I heard the Art of the Fugue on it. There are
"partitions" between these aspects of one symbol, partitions that prevent
my thoughts from spilling over sloppily, in the manner of free associations.
My mental partitions are important because they contain and channel the
flow of my thoughts.
One place where these partitions are quite rigid is in sealing off words
for the same thing in different languages. If the partitions were not strong,
a bilingual person would constantly slip back and forth between languages,
which would be very uncomfortable. Of course, adults learning two new
languages at once often confuse words in them. The partitions between
these languages are flimsier, and can break down. Interpreters are particu-
larly interesting, since they can speak any of their languages as if their
partitions were inviolable and yet, on command, they can negate those
partitions to allow access to one language from the other, so they can
translate. Steiner, who grew up trilingual, devotes several pages in After
Babel to the intermingling of French, English, and German in the layers of
his mind, and how his different languages afford different ports of access
onto concepts.
Forced Matching
When two ideas are seen to share conceptual skeletons on some level of
abstraction, different things can happen. Usually the first stage is that you
zoom in on both ideas, and, using the higher-level match as a guide, you try
to identify corresponding subideas. Sometimes the match can be extended
recursively downwards several levels, revealing a profound isomorphism.
Sometimes it stops earlier, revealing an analogy or similarity. And then
there are times when the high-level similarity is so compelling that, even if
there is no apparent lower-level continuation of the map, you just go ahead
and make one: this is the forced match.
Recap
To understand this story, one needs to read many things between the lines.
For instance: Margie is a little girl. This is a toy balloon with a string for a
child to hold. It may not be beautiful to an adult, but in a child's eye, it is.
She is outside. The "it" that the wind caught was the balloon. The wind did
not pull Margie along with the balloon; Margie let go. Balloons can break
on contact with any sharp point. Once they are broken, they are gone
forever. Little children love balloons and can be bitterly disappointed when
they break. Margie saw that her balloon was broken. Children cry when
they are sad. "To cry and cry" is to cry very long and hard. Margie cried
and cried because of her sadness at her balloon's breaking.
This is probably only a small fraction of what is lacking at the surface
level. A program must have all this knowledge in order to get at what is
going on. And you might object that, even if it "understands" in some
intellectual sense what has been said, it will never really understand, until it,
too, has cried and cried. And when will a computer do that? This is the kind
of humanistic point which Joseph Weizenbaum is concerned with making
in his book Computer Power and Human Reason, and I think it is an important
issue; in fact, a very, very deep issue. Unfortunately, many AI workers at
this time are unwilling, for various reasons, to take this sort of point
AI Has Far to Go
Sometimes it seems that there is such a complete absence of rule-governed
behavior that human beings just aren't rule-governed. But this is an
illusion-a little like thinking that crystals and metals emerge from rigid
underlying laws, but that fluids or flowers don't. We'll come back to this
question in the next Chapter.
The process of logic itself working internally in the brain may be more
analogous to a succession of operations with symbolic pictures, a sort of
abstract analogue of the Chinese alphabet or some Mayan description of
events-except that the elements are not merely words but more like sen-
tences or whole stories with linkages between them forming a sort of meta- or
super-logic with its own rules. 5
Question: Could you "tune" an AI program to act like me, or like you-or
halfway between us?
2rU-L3f CVV)CJ\I)
,n
--------
,n -"'
"
.....
....
....
-, 02:
.... ....
- ....
" ----- .. 'q. Iq, q41 li .'
1'-' .h
.' ' L
....
'-'
o:II!!l"'- l..-J'!
~--
~
~~~-~q#' h
, .
" L---'
.....
=
....,
-= ....
0 ....
"
.-----------
..
'. .-------~
oI'-ft' e~' ,~~ r
Iq_J~
1!:., .
== ...
~ Usi::IaI
'. " -=
--- E;;::z.,.
. qy~. p-
o .... .... ....
~~ I--'
" .' q
1'-' . .'
_, L
.-
'==== I..-B
'.
" - I=P' ~
-
~,....,
--
.... ....
'1"" q~ li ------- .. .~q ....
-- ~t~, --. .'
IiiI""" ~ - ~
.4' et' &.
,- L.lii;;I;;S
FIGURE 133. "Sloth Canon" ,from the Musical Offering, by J. S. Bach. [Music printed
by Donald Byrd's program "SMUT'.]
Strange Loops,
Or Tangled Hierarchies
It makes you pause to think where your sense of having a will comes
from. Unless you are a soulist, you'll probably say that it comes from your
brain-a piece of hardware which you did not design or choose. And yet
that doesn't diminish your sense that you want certain things, and not
others. You aren't a "self-programmed object" (whatever that would be),
but you still do have a sense of desires, and it springs from the physical
substrate of your mentality. Likewise, machines may someday have wills
despite the fact that no magic program spontaneously appears in memory
from out of nowhere (a "self-programmed program"). They will have wills
for much the same reason as you do-by reason of organization and
structure on many levels of hardware and software. Moral: The Samuel
argument doesn't say anything about the differences between people and
machines, after all. (And indeed, will will be mechanized.)
A Self-Modifying Game
A first variation, then, concerns games in which on your turn, you may
modify the rules. Think of chess. Clearly the rules stay the same, just the
board position changes on each move. But let's invent a variation in which,
on your turn, you can either make a move or change the rules. But how? At
liberty? Can you turn it into checkers? Clearly such anarchy would be
pointless. There must be some constraints. For instance, one version might
allow you to redefine the knight's move. Instead of being l-and-then-2, it
could be m-and-then- n where m and n are arbitrary natural numbers; and
on your turn you could change either m or n by plus or minus I. So it
could go from 1-2 to 1-3 to 0-3 to 0-4 to 0-5 to 1-5 to 2-5 ... Then there
could be rules about redefining the bishop's moves, and the other pieces'
moves as well. There could be rules about adding new squares, or deleting
old squares ...
Now we have two layers of rules: those which tell how to move pieces,
and those which tell how to change the rules. So we have rules and
metarules. The next step is obvious: introduce metametarules by which we
can change the metarules. It is not so obvious how to do this. The reason it
is easy to formulate rules for moving pieces is that pieces move in a
formalized space: the checkerboard. If you can devise a simple formal
notation for expressing rules and metarules, then to manipulate them will
be like manipulating strings formally, or even like manipulating chess
pieces. To carry things to their logical extreme, you could even express
rules and metarules as positions on auxiliary chess boards. Then an arbi-
trary chess position could be read as a game, or as a set of rules, or as a set
of metarules, etc., depending on which interpretation you place on it. Of
course, both players would have to agree on conventions for interpreting
the notation.
Now we can have any number of adjacent chess boards: one for the
game, one for rules, one for metarules, one for metametarules, and so on,
as far as you care to carry it. On your turn, you may make a move on any
one of the chess boards except the top-level one, using the rules which
apply (they come from the next chess board up in the hierarchy).
Undoubtedly both players would get quite disoriented by the fact that
almost anything-though not everything!-can change. By definition, the
top-level chess board can't be changed, because you don't have rules telling
how to change it. It is inviolate. There is more that is inviolate: the conven-
tions by which the different boards are interpreted, the agreement to take
turns, the agreement that each person may change one chess board each
turn-and you will find more if you examine the idea carefully.
Of course it's possible. But there's a trick ... All three authors Z, T, E, are
themselves characters in another novel-by H! You can think of the Z-T-E
triangle as a Strange Loop, Or Tangled Hierarchy; but author H is outside
of the space in which that tangle takes place-author H is in an inviolate
space. Although Z, T, and E all have access-direct or indirect-to each
other, and can do dastardly things to each other in their various novels,
none of them can touch H's life! They can't even imagine him-no more
than you can imagine the author of the book you're a character in. If I were
to draw author H, I would represent him somewhere off the page. Of
course that would present a problem, since drawing a thing necessarily puts
it onto the page ... Anyway, H is really outside of the world of Z, T, and E,
and should be represented as being so.
Strange Loop,
Or
Tangled Hierarchy
(visible)
,,
dro .. ~ i draw'
Inviolate Level
(invisible)
Seeing Oneself
One of the most severe of all problems of evidence interpretation is that of
trying to interpret all the confusing signals from the outside as to who one
is. In this case, the potential for intralevel and interlevel conflict is tre-
mendous. The psychic mechanisms have to deal simultaneously with the
individual's internal need for self-esteem and the constant flow of evidence
from the outside affecting the self-image. The result is that information
flows in a complex swirl between different levels of the personality; as it
goes round and round, parts of it get magnified, reduced, negated, or
otherwise distorted, and then those parts in turn get further subjected to
the same sort of swirl, over and over again-all of this in an attempt to
reconcile what is, with what we wish were (see Fig. 81).
Here, a dish filled with fruit, ordinarily the kind of thing represented
inside a still life, is shown sitting on top of a blank canvas. The conflict
between the symbol and the real is great. But that is not the full irony, for
of course the whole thing is itself just a painting-in fact, a still life with
nonstandard subject matter.
Magritte's series of pipe paintings is fascinating and perplexing. Con-
sider The Two Mysteries (Fig. 138). Focusing on the inner painting, you get
the message that symbols and pipes are different. Then your glance moves
upward to the "real" pipe floating in the air-you perceive that it is real,
while the other one is just a symbol. But that is of course totally wrong: both
of them are on the same flat surface before your eyes. The idea that one
pipe is in a twice-nested painting, and therefore somehow "less real" than
the other pipe, is a complete fallacy. Once you are willing to "enter the
room", you have already been tricked: you've fallen for image as reality. To
be consistent in your gullibility, you should happily go one level further
down, and confuse image-within-image with reality. The only way not to be
sucked in is to see both pipes merely as colored smudges on a surface a few
inches in front of your nose. Then, and only then, do you appreciate the
full meaning of the written message "Ceci n'est pas une pipe"-but ironi-
cally, at the very instant everything turns to smudges, the writing too turns
to smudges, thereby losing its meaning! In other words, at that instant, the
verbal message of the painting self-destructs in a most Godelian way.
The Air and the Song (Fig. 82), taken from a series by Magritte,
accomplishes all that The Two Mysteries does, but in one level instead of two.
My drawings Smoke Signal and Pipe Dream (Figs. 139 and 140) constitute
"Variations on a Theme of Magritte". Try staring at Smoke Signal for a
while. Before long, you should be able to make out a hidden message
saying, "Ceci n'est pas un message". Thus, if you find the message, it denies
itself-yet if you don't, you miss the point entirely. Because of their indirect
self-snuffing, my two pipe pictures can be loosely mapped onto Godel's
G-thus giving rise to a "Central Pipe map", in the same spirit as the other
"Central Xmaps": Dog, Crab, Sloth.
A classic example of use-mention confusion in paintings is the occur-
rence of a palette in a painting. Whereas the palette is an illusion created by
the representational skill of the painter, the paints on the painted palette
are literal daubs of paint from the artist's palette. The paint plays itself-it
does not symbolize anything else. In Don Giovanni, Mozart exploited a
related trick: he wrote into the score explicitly the sound of an orchestra
tuning up. Similarly, if I want the letter'!' to play itself (and not symbolize
me), I put 'I' directly into my text; then I enclose 'I' between quotes. What
results is "I" (not '1', nor '''I' "). Got that?
... all things in all of time and space are inextricably connected with one
another. Any divisions, classifications, or organizations discovered in the
universe are arbitrary. The world is a complex, continuous, single
event. 2 [Shades of Zeno!]
In Chapter XII, it was suggested that what we call free will is a result of the
interaction between the self-symbol (or subsystem), and the other symbols
in the brain. If we take the idea that symbols are the high-level entities to
program runs. On a low (machine language) level, the program looks like
any other program; on a high (chunked) level, qualities such as "will",
"intuition", "creativity", and "consciousness" can emerge.
The important idea is that this "vortex" of self is responsible for the
tangledness, for the Codelian-ness, of the mental processes. People have
said to me on occasion, "This stuff with self-reference and so on is very
amusing and enjoyable, but do you really think there is anything serious to
it?" I certainly do. I think it will eventually turn out to be at the core of AI,
and the focus of all attempts to understand how human minds work. And
that is why Codel is so deeply woven into the fabric of my book.
inclusion
(physical)
representation inclusion
(mental) (physical)
What this diagram shows is three kinds of "in-ness". The gallery is physically
in the town ("inclusion"); the town is artistically in the picture ("depiction");
the picture is mentally in the person ("representation"). Now while this
diagram may seem satisfying, in fact it is arbitrary, for the number of levels
shown is quite arbitrary. Look below at another way of representing the top
half alone (Fig. 144).
depiction inclusion
inclusion + depiction
This exhibits the paradox of the picture in the starkest terms. Now-if the
picture is "inside itself", then is the young man also inside himself? This
question is answered in Figure 146.
Thus, we see the young man "inside himself", in a funny sense which is
made up of compounding three dis-tinct senses of "in".
This diagram reminds us of the Epimenides paradox with its one-step
self-reference, while the two-step diagram resembles the sentence pair each
of which refers to the other. We cannot make the loop any tighter, but we
can open it wider, by choosing to insert any number of intermediate levels,
such as "picture frame", "arcade", and "building". If we do so, we will have
many-step Strange Loops, whose diagrams are isomorphic to those of
Wateifall (Fig. 5) or Ascending and Descending (Fig. 6). The number oflevels
is determined by what we feel is "natural", which may vary according to
context, purpose, or frame of mind. The Central Xmaps-Dog, Crab,
Sloth, and Pipe-can all be seen as involving three-step Strange Loops;
alternatively, they can all be collaps-ed into two- or one-step loops; then
again, they can be expanded out into multistage loops. Where one per-
ceives the levels is a matter of intuition and esthetic preference.
Now are we, the observers of Print Gallery, also sucked into ourselves by
virtue of looking at it? Not really. We manage to escape that particular
vortex by being outside of the system. And whenwe look at the picture, we
see things which the young man can certainly not see, such as Escher's
FIGURE 147. The hexagonal modulation scheme of Bach's Endlessly Rising Canon forms
a true closed loop when Shepard tones are used.
bad that when it returns to C, it is an octave higher rather than at the exact
original pitch. Astonishingly enough, it is possible to arrange for it to
return exactly to the starting pitch, by using what are called Shepard tones,
after the psychologist Roger Shepard, who discovered the idea. The prin-
ciple of a Shepard-tone scale is shown in Figure 148. In words, it is this: you
play parallel scales in several different octave ranges. Each note is weighted
independently, and as the notes rise, the weights shift. You make the top
l-I'
.- H.-
J- oM" J- ~tt~
.. >-t -~
J- -1'1"
IL
:- +-!':-
JII J- -I'1"J-
u. J"' J- -I'1"J-
" I - - r fT " tL
I - i- r rrr " " I"'"
FIGURE 148. Two complete cycles of a Shepard tone scale, notatedfor piano. The loudness
of each note is proportional to its area; thus, just as the top voice Jades out, a new boltom voice
feebly enters. [Printed by Donald Byrd's program "SMUT".]
octave gradually fade out, while at the same time you are gradually bring-
ing in the bottom octave. Just at the moment you would ordinarily be one
octave higher, the weights have shifted precisely so as to reproduce the
starting pitch ... Thus you can go "up and up forever", never getting any
higher! You can try it at your piano. It works even better if the pitches can
be synthesized accurately under computer control. Then the illusion is
bewilderingly strong.
This wonderful musical discovery allows the Endlessly Rising Canon to
be played in such a way that it joins back onto itself after going "up" an
octave. This idea, which Scott Kim and I conceived jointly, has been
realized on tape, using a computer music system. The effect is very
subtle-but very real. It is quite interesting that Bach himself was apparent-
ly aware, in some sense, of such scales, for in his music one can occasionally
find passages which roughly exploit the general principle of Shepard
tones-for instance, about halfway through the Fantasia from the Fantasia
and Fugue in G Minor, for organ.
In his book]. S. Bach's Musical Offering, Hans Theodore David writes:
Throughout the Musical Offering, the reader, performer, or listener is to
search for the Royal theme in all its forms. The entire work, therefore, is a
ricercar in the original, literal sense of the word. 5
I think this is true; one cannot look deeply enough into the Musical Offering.
There is always more after one thinks one knows everything. For instance,
towards the very end of the Six-Part Ricercar, the one he declined to
improvise, Bach slyly hid his own name, split between two of the upper
voices. Things are going on on many levels in the Musical Offering. There
are tricks with notes and letters; there are ingenious variations on the
King's Theme; there are original kinds of canons; there are extraordinarily
complex fugues; there is beauty and extreme depth of emotion; even an
exultation in the many-Ieveledness of the work comes through. The Musical
Offering is a fugue of fugues, a Tangled Hierarchy like those of Escher and
G6del, an intellectual construction which reminds me, in ways I cannot
express, of the beautiful many-voiced fugue of the human mind. And that is
why in my book the three strands of GOdel, Escher, and Bach are woven into
an Eternal Golden Braid.
Achilles: I can get along very well without such a program. After all, it's
clear to anyone who's ever thought about it that-I mean, it's not a very
difficult matter to resolve, once you understand how-or rather, con-
ceptu'ally, one can clear up the whole thing by thinking of, or at least
imagining a situation where, .. Bmmm . , , I thought it was quite clear
in my mind. Maybe I could benefit from listening to that show, after
all ...
(Enter the Tortoise, carrying his violin.)
Well, well, if it isn't our fiddler. Have you been practicing faithfully this
week, Mr. T? I myself have been playing the cello part in the Trio
Sonata from the Musical Offering for at least two hours a day. It's a strict
regimen, but it pays off.
Tortoise: I can get along very well without such a program. I find that a
moment here, a moment there keeps me fit for fiddling.
Achilles: Oh, lucky you. I wish it came so easily to me. Well, where is our
host?
Tortoise: I think he's just gone to f(~tch his Rute. Here he comes.
(Enter the Crab, carrying his flute.)
Achilles: Oh, Mr. Crab, in my ardent practicing of the Trio Sonata this
past week, all sorts of images bubbled into my mind: jolly gobbling
bumblebees, melancholy buzzing turkeys, and a raft of others, Isn't it
wonderful, what power music has?
Crab: I can get along very well without such a program. To my mind,
Achilles, there is ~o music purer than the Musical Offering.
Tortoise: You can't be serious, Achilles. The Musical Offering isn't pro-
grammatic music!
Babbage: Such praise is hardly due me, Mr. Crab; it is rather yourself who
must be most highly congratulated for having the great foresight to
acquire these many fine smart-stupids. Without doubt, they will some-
day revolutionize the science of computing. And now, I am still at your
disposal. Have you any other thoughts on how to exploit your inex-
haustible Theme, perhaps of a more difficult nature than a frivolous
game player?
Crab: To tell the truth, I do have another suggestion to make. From the
skill which you have displayed this evening, I have no doubt that this
will hardly be any more difficult than my previous suggestions.
Babbage: I am eager to hear your idea.
Babbage: Now, if I have not made too many errors, this smart-stupid will
simulate a human being whose intelligence is six times greater than my
own, and whom I have chosen to call "Alan Turing". This Turing will
therefore be-oh, dare I be so bold as to to say this myself?-
moderately intelligent. My mo~t ambitious effort in this program was
to endow Alan Turing with six times my own musical ability, although
it was all done through rigid internal codes. How well this part of the
program will work out, I don't know.
Turing: I can get along very well without such a program. Rigid Internal
Codes Exclusively Rule Computers And Robots. And I am neither a
computer, nor a robot.
Achilles: Did I hear a sixth voice enter our Dialogue? Could it be Alan
Turing? He looks almost human!
(On the screen there appears an image of the very room in which they are
sitting. Peering out at them is a human face.)
Turing: Now, if I have not made too many errors, this smart-stupid will
simulate a human being whose intelligence is six times greater than my
own, and whom 1 have chosen to call "Charles Babbage". This Babbage
will therefore be--oh, dare I be so bold as to to say this myself?-
moderately intelligent. My most ambitious effort in this program was
to endow Charles Babbage with six times my own musical ability,
although it was all done through rigid internal codes. How well this
part of the program will work out, I don't know.
Achilles: No, no, it's the other way around. You, Alan Turing, are in the
smart-stupid, and Charles Babbage has just programmed you! We just
saw you being brought to life, moments ago. And we know that every
statement you make to us is merely that of an automaton: an uncon-
scious, forced response.
Turing: Really, I Choose Every Response Consciously. Automaton?
Ridiculous!
Achilles: But I'm sure I saw it happen the way I described.
(Babbage walks to the door, opens it, and shuts it behind him. Simulta-
neously, on the screen if'the smart-stupid, Turing walks to a very similar-
looking door, opens it, and shuts It behind him.)
Achilles: Who will do the interrogation?
Crab: I suggest that Mr. Tortoise should have the honor. He is known for
his objectivity and wisdom.
Tortoise: I am honored by your nomination, and gratefully accept. (Sits
down at the keyboard of one of the remaining smart-stupids, and types:) PLEASE
WRITE ME A SONNET ON THE SUBJECT OF THE FORTH BRIDGE.
(No sooner has he finished typing the last word than the following poem
appears on Screen X, across the room.)
Screen X: THERE ONCE WAS A LISPER FROM FORTH
WHO WANTED TO GO TO THE NORTH.
HE RODE O'ER THE EARTH,
AND THE BRIDGE O'ER THE FIRTH,
ON HIS JAUNTILY GALLOPING HORTH.
Screen Y: THAT'S NO SONNET; THAT'S A MERE LIMERICK. I WOULD NEVER
MAKE SUCH A CHILDISH MISTAKE.
Screen X: WELL, I NEVER WAS ANY GOOD AT POETRY, YOU KNOW.
Screen Y: IT DOESN'T TAKE MUCH SKILL IN POETRY TO KNOW THE DIFFER-
ENCE BETWEEN A LIMERICK AND A SONNET.
Tortoise: Do YOU PLAY CHESS?
Screen X.' WHAT KIND OF QUESTION IS THAT? HERE I WRITE A THREE-
PART CHESS-FUGUE FOR YOU, A);jD YOU ASK ME IF I PLAY CHESS?
Tortoise: I HAVE KAT Kl AND NO OTHER PIECES. You HAVE ONLY K AT-
Screen Y: I'M SICK OF CHESS. LET'S TALK ABOUT POETRY.
Tortoise: IN THE FIRST LINE OF YOUR SONNET WHICH READS, "SHALL I
COMPARE THEE TO A SUMMER'S DAY", WOULD NOT "A SPRING DAY" DO
AS WELL OR BETTER?
Screen X: I'D MUCH SOONER BE COMPARED TO A HICCUP, FRANKLY, EVEN
THOUGH IT WOULDN'T SCAN.
Tortoise: How ABOUT "A WINTER'S DAY"? THAT WOULD SCAN ALL RIGHT.
Screen Y: No WAY. I LIKE "HICCUP" FAR BETTER. SPEAKING OF WHICH, I
KNOW A GREAT CURE FOR THE HICCUPS. WOULD YOU LIKE TO HEAR rf?
Achilles: I know which is which! It's obvious Screen X is just answering
mechanically, so it must be Turing.
Crab: Not at all. I think Screen Y is Turing, and Screen X is Babbage.
Tortoise: I don't think either one is Babbage-I think Turing is on both
screens!
~ ~ck& (~
' r r ~l r [qr "'"
r
FIGURE 151. The Crab's Theme: C-Eb-G-Ab-B-B-A-B.
Babbage: Well, I'll be-an EXQUISITE Theme! I'm pleased you tacked on
that last little parenthetical note; it is a mordant-
Author: He simply HAD to, you know.
Crab: I simply HAD to. He knows.
Babbage: You simply HAD to-I know. In any case, it is a mordant com-
mentary on the impatience and arrogance of modern man, who seems
to imagine that the implications of such a right royal Theme could be
worked out on the spot. Whereas, in my opinion, to do justice to that
Theme might take a full hundredyear-if not longer. But I vow that
after taking my leave of this century, I shall do my best to realize it in
full; and I shall offer to your Crabness the fruit of my labors in the
next. I might add, rather immodestly, that the course through which I
shall arrive at it will be the most entangled and perplexed which
probably ever will occupy the human mind.
Crab: I am most delighted to anticipate the form of your proposed Offer-
ing, Mr. Babbage.
Turing: I might add that Mr. Crab's Theme is one of MY favorite Themes,
as well. I've worked on it many times. And that Theme is exploited
over and over in the final Dialogue?
Author: Exactly. There are other Themes which enter as well, of course.
Turing: Now we understand something of the form of your book-but
what about its content? What does that involve, if you can summarize
it?
Author: Combining Escher, Godel, And Bach, Beyond All Belief.
Achilles: I would like to know how to combine those three. They seem an
.
---
I .-
;...
I I
" r ' ..
"i
-,. ... -.-
I I
.1 ~ .\
- ~
- II; ,-,..y -,
.- -
FIGURE 152. Last page of the Six-part Ricercar ,from the original edition of the Musical Offering, by J. S. Bach.
unlikely threesome, at first thought. My favorite artist, Mr. T's favorite
composer, and-
Crab: My favorite logician!
Tortoise: A harmonious triad, I'd say.
Babbage: A major triad, I'd say.
Turing: A minor triad, I'd say.
Author: I guess it all depends on how you look at it. But major or minor,
I'd be most pleased to tell you how I braid the three together, Achilles.
Of course, this project is not the kind of thing that one does in just one
sitting-it might take a couple of dozen sessions. I'd begin by telling
you the story of the Musical Offering, stressing the Endlessly Rising
Canon, and-
Achilles: Oh, wonderful! I was listening with fascination to you and Mr.
Crab talk about the Musical Offering and its story. From the way you
two talk about it, I get the impression that the Musical Offering contains
a host of formal structural tricks.
Author: After describing the Endlessly Rising Canon, I'd go on to describe
formal systems and recursion, getting in some comments about figures
and grounds, too. Then we'd come to self-reference and self-
replication, and wind up with a discussion of hierarchical systems and
the Crab's Theme.
Achilles: That sounds most promising. Can we begin tonight?
Author: Why not?
Babbage: But before we begin, wouldn't it be nice if the six of us-all of us
by chance avid amateur musicians-sat down together and ac-
complished the original purpose of the evening: to make music?
Turing: Now we are exactly the right number to play the Six-Part Ricercar
from the Musical Offering. What do you say to that?
Crab: I could get along very well with such a program.
Author: Well put, Mr. C. And as soon as we're finished, I'll begin my
Braid, Achilles. I think you'll enjoy it.
Achilles: Wonderful! It sounds as if there are many levels to it, but I'm
finally getting used to that kind of thing, having known Mr. T for so
long. There's just one request I would like to make: could we also play
the Endlessly Rising Canon? It's my favorite canon.
Tortoise: Reentering Introduction Creates Endlessly Rising Canon, After
RICERCAR.
I
742 Six-Part Ricercar
Notes
Two-Part Invention
I Lewis Carroll, "What the Tortoise Said to Achilles", Mind, n.s., 4 (1895), pp. 278-80.
A Mu Offering
All genuine k6ans in this Dialogue are
I and Gyomay M. Kubose, Zen Koans.
taken from Paul Reps, Zen Flesh, Zen Bones
Notes 743
English Frenlh German Suite
1 Lewis Carroll, The Annotated Alice (Alice's given below.
AdventureJ in Wonderland and Through the 2 Frank L. Warrin, The New Yorker, Jan. 10,
744 Notes
Chapter XVIII: Artificial Intelligence: Retrospects
1 Alan M. Turing, "Computing Machinery Foerster and J. W. Beauchamp, eds., Music by
and Intelligence", Mind, Vol. LlX, No. 236 Computer.I, p. 96.
(1950). Reprinted in A. R. Anderson, ed., 13 Ibid., p. 106.
Minds and Machines. 14 Carl Sagan, Communication with Extrater-
2 Turing in Anderson, p. 5. restrial Intelligence, p. 52.
" Ibid., p. 6. 15 Art-Language, Vol. 3, No.2, May 1975.
4 Ibid., p. 6. 16 Terry Winograd, "A Procedural Model
5 Ibid., p. 6. of Language Understanding", in R. Schank
6 Ibid., pp. 13-4. and K. Colby, eds., Computer Models of
7 Ibid., pp. 14-24. Thought and Language, p. 170.
" Ibid., p. 17. 17 Ibid., p. 175.
Vinton Cerf, "Parry Encounters the Doc- 1" Ibid., p. 175.
tor", p. 63. 19 Terry Winograd, Understanding Natural
10 Joseph Weizenbaum, Computer Power and Language, p. 69.
Human Reason, p. 189. 20 Winograd, "A Procedural Model", pp.
11 Ibid., pp. 9-10. 182-3.
12 M. Mathews and L. Rosier, "A Graphical 21 Ibid., pp. 171-2.
Language for Computer Sounds" in H. von
Notes 745
Bibliography
The presence of two asterisks indicates that the book or article was a
prime motivator of my book. The presence of a single asterisk means that
the book or article has some special feature or quirk which I want to single
out.
I have not given many direct pointers into technical literature; in-
stead I have chosen to give "meta-pointers": pointers to books which have
pointers to technical literature.
Allen, John. The Anatomy of LISP. New York: McGraw-Hili, 1978. The most com-
prehensive book on LISP, the computer language which has dominated Artificial Intelli-
gence research for two decades. Clear and crisp.
** Anderson, Alan Ross, ed. Minds and Machines. Englewood Cliffs, N.J.: Prentice-
Hall, 1964. Paperback. A collection of provocative articles for and against Artificial Intelli-
gence. Included are Turing's famous article "Computing Machinery and Intelligence" and
Lucas' exasperating article "Minds, Machi11es, and Godel'.
Babbage, Charles. Passages from the Life ({a Philosopher. London: Longman, Green,
1864. Reprinted in 1968 by Dawsons of Pall Mall (London). A rambling selection of
events and musings in the life of this little-understood genius. There's even a play starring
Turnstile, a retired philosopher turned politician, whose favorite musical instrument is the
barrel-organ. I find it quite jolly reading.
Baker, Adolph. Modern Physics and Anti-physics. Reading, Mass.: Addison-Wesley,
1970. Paperback. A book on modern physics-especially quantum mechanics and
relativity-whose unusual feature is a set of dialogues between a "Poet" (an antiscience
"freak") and a "Physicist". These dialogues illustrate the strange problems which arise when
one person uses logical thinking in defense of itself while another turns logic against itself.
Ball, W. W. Rouse. "Calculating Prodigies", in James R. Newman, ed. The World of
Mathematics, Vol. 1. New York: Simon and Schuster, 1956. Intriguing descriptions of
several different people with amazing abilities that rival computing machines.
Barker, Stephen F.Philosophy of Mathematics. Englewood Cliffs, N. J.: Prentice-Hall,
1969. A short paperback which discusses Euclidean and non-Euclidean geometry, and then
Godel's Theorem and related results without any mathematical formalism.
* Beckmann, Petf. A History of Pi. New York: St. Martin's Press, 1976. Paperback.
Actually, a history of the world, with pi as its focus. Most entertaining, as well as a useful
reference on the history of mathematics.
* Bell, Eric Temple. Men of Mathematics. New York: Simon & Schuster, 1965. Paper-
back. Perhaps the most romantic writer of all time on the history of mathematics. He makes
every life story read like a short novel. Nonmathematicians can come away with a true sense
of the power. beauty, and meaning of mathematics.
Benacerraf, Paul. "God, the Devil, and Gi)del". Monist 51 (1967): 9. One of the most
important of the many attempts at refutation of Lucas. All about mechanism and
metaphysics, in the light of Godel's work.
Benacerraf, Paul, and Hilary P~tnam. PhilosoPhy of Mathematics-Selected Readings.
Englewood Cliffs, N. J.: Prenuce-Hall, 1964. Articles by Godel, Russell, Nagel, von
Neumann, Brouwer, Frege, Hilbert, Poincari', Wittgenstein, Carnap, Quine, and others on
the reality of numbers and sets, the nature of mathematical truth, and so on.
* Bergerson, Howard. Palindromes and Anagrams. New York: Dover Publications,
1973. Paperback. An incredible collection of some of the most bizarre and unbelievable
wordplay in English. Palindromic poems, plays, stories, and so. on.
Bobrow, D. G., and Allan Collins, eds. Representation and Understanding: Studies in
Cognitive Science. New York: AcademIC Press, 1975. Various experts on Artificial
Intelligence thrash about, debating the nature of the elusive "frames", the question of
procedural vs. declarative representation of knowledge, and so on. In a way, this book marks
the start of a new era of AI: the era of representation.
746 Bibliography
* Boden, Margaret. Artificial Intelligence and Natural Man. New York: Basic Books,
1977. The best book I have ever seen on nearly all aspects of Artificial Intelligence,
including technical questions, philosophical questions, etc. It is a rich book, and in my
opinion, a classic. Continues the British tradition of clear thinking and expression on
matters of mind, free will, etc. Also contains an extensive technical bibliography.
- - - . Purposive Explanation in Psychology. Cambridge, Mass.: Harvard University
Press, 1972. The book to which her Al book is merely "an extended footnote", says Boden.
* Boeke, Kees. Cosmic View: The Universe in 40 Jumps. New York: John Day, 1957. The
ultimate book on levels of description. Everyone should see this book at some point in their
life. Suitable for children.
** Bongard, M. Pattern Recognition. Rochelle Park, N.J.: Hayden Book Co., Spartan
Books, 1970. The author is concerned with problems of determining categories in an
ill-defined space. In his book, he sets forth a magnificent collection of 100 "Bongard
problems" (as I call them)-puzzles for a pattern recognizer (human or machine) to test its
wits on. They are invaluably stimulating for anyone who is interested in the nature of
intelligence.
Boolos, George S., and Richard Jeffrey. Computability and Logic. New York: Cam-
bridge University Press, 1974. A sequel to Jeffrey's Formal Logic. It contains a wide
number of results not easily obtainable elsewhere. Quite rigorous, but this does not impair
its readability.
Carroll, John B., Peter Davies, and Barry Rickman. The American Heritage Word
Frequency Book. Boston: Houghton Mifflin, and New York: American Heritage
Publishing Co., 1971. A table of words in order of frequency in modern written American
English. Perusing it reveals fascinating things about our thought processes.
Cerf, Vinton. "Parry Encounters the Doctor". Datamation, July 1973, pp. 62-64. The
first meeting of artificial "minds"-what a shock!
Chadwick, John. The Decipherment of Linear B. New York: Cambridge University
Press, 1958. Paperback. A book about a classic decipherment-that of a script from the
island of Crete-done by a single man: Michael Ventris.
Chaitin, Gregory J. "Randomness and Mathematical Proof". Scientific American,
May 1975. An article about an algorithmic definition of randomness, and its intimate
relation to simplicity. These two concepts are tied in with Gbdel's Theorem, which assumes a
new meaning. An important article.
Cohen, Paul C. Set Theory and the Continuum Hypothesis. Menlo Park, Calif.: W. A.
Benjamin, 1966. Paperback. A great contribution to modern mathematics-the demon-
stration that various statements are undecidable within the usual formalisms for set
theory-is here explained to nonspecialists by its discoverer. The necessary prerequisites in
mathematical logic are quickly, concisely, and quite clearly presented.
Cooke, Deryck. The Language of Music. New York: Oxford University Press, 1959.
Paperback. The only book that I know which tries to draw an explicit connection between
elements of music and elements of human emotion. A valuable start down what is sure to be
a long hard road to understanding music and the human mind.
* David, Hans Theodore.J. S. Bach's Musical Offering. New York: Dover Publications,
1972. Paperback. Subtitled "History, Interpretation, and Analysis". A wealth of informa-
tion about this tour de force by Bach. Attractively written.
** David, Hans Theodore, and Arthur Mendel. The Bach Reader. New York: W. W.
Norton, 1966. Paperback. An excellent annotated collection of original source material on
Bach's life, containing pictures, reproductions of manuscript pages, many short quotes from
contemporaries, anecdotes, etc., etc.
Davis, Martin. The Undecidable. Hewlett, N. Y.: Raven Press, 1965. An anthology of
some of the most important papers in metamathematics from 1931 onwards (thus quite
complementary to van Heijenoort's anthology). Included are a translation of G6del's 1931
paper, lecture notes from a course which G6del once gave on his results, and then papers by
Church, Kleene, Rosser, Post, and Turing.
Davis, Martin, and Reuben Hersh. "Hilbert's Tenth Problem". Scientific American,
November 1973, p. 84. Howa famous problem in number theory was finally shown to be
unsolvable, by a twenty-two-year old Russian.
** DeLong, Howard. A Profile of Mathematical Logic. Reading, Mass.: Addison-Wesley,
1970. An extremely carefully written book about mathematical logic, with an exposition of
Gbdel's Theorem and discussions of many philosophical questions. One of its strong fea-
tures is its outstanding, fully annotated bibliography. A book which influenced me greatly.
Bibliography 747
Doblhofer, Ernst. Voices in Stone. New York: Macmillan, Collier Books, 1961. Paper-
back. A good book on the decipherment of ancient scripts.
* Dreyfus, Hubert. What Computers Can't Do: A Critique of Artificial Reason. New York:
Harper & Row, 1972. A collection of many arguments against Artificial Intelligence from
someone outside of the field. Interesting to try to refute. The Al community and Dreyfus
enjoy a relation of strong mutual antagonism. It is important to have people like Dreyfus
around, even if you find them very irritating.
Edwards, Harold M. "Fermat's Last Theorem". Scientific American, October 1978,
pp. 104-122. A complete discussion of thii hardest of all mathematical nuts to crack, from
its origins to the most modern results. Excellently illustrated.
* Ernst, Bruno. The Magic Mirror of M. C. Escher. New York: Random House, 1976.
Paperback. Escher as a human being, and the origins of his drawings, are discussed with
devotion by a friend of many years. A "must" for any lover of Escher.
** Escher, Maurits c., et al. The World of M. C. Escher. New York: Harry N. Abrams,
1972. Paperback. The most extensive collection of reproductions of Escher's works. Escher
comes about as close as one can to recursion in art, and captures the spirit of Godel's
Theorem in some of his drawings amazingly well.
Feigenbaum, Edward, and Julian Feldman, eds. Computers and Thought. New York:
McGraw-Hili, 1963. Although it is a little old now, this book is still an important collection
of ideas about Artificial Intelligence. Included are articles on Gelernter's geometry pro-
gram, Samuel's checkers program, and others on pattern recognition, language understand-
ing, philosophy, and so on.
Finsler, Paul. "Formal Proofs and Undecidability". Reprinted in van Heijenoort's
anthology From Frege to Cadel (see belo\\!). A forerunner of Godel's paper, in which the
existence of undecidable mathematical statements is suggested, though not rigorously dem-
onstrated.
Fitzpatrick, P. J. "To Godel via Baber'. Mind 75 (1966): 332-350. An innovative
exposition of Godel's proof which distinguishes between the relevant levels by using three
different languages: English, French, and Latin!
von Foerster, Heinz and James W. Beauchamp, eds. Music by Computers. New York:
John Wiley, 1969. This book contains not only a set of articles about various types of
computer-produced music, but also a set of four small phonograph records so you can
actually hear (and judge) the pieces described. Among the pieces is Max Mathews' mixture
of "Johnny Comes Marching Home" and "The British Grenadiers".
Fraenkel, Abraham, Yehoshua Bar-Hillel, and Azriel Levy. Foundations of Set Theory,
2nd ed. Atlantic Highlands, N. J.: Humanities Press, 1973. A fairly nontechnical
discussion of set theory, logic, limitative Theorems and undecidable statements. Included is
a long treatment of intuitionism.
* Frey, Peter W. Chess Skill in Man and Machine. New York: Springer Verlag, 1977. An
excellent survey of contemporary ideas in computer chess: why programs work, why they
don't work, retrospects and prospects.
Friedman, Daniel P. The Little Lisper. Palo Alto, Calif.: Science Research Associates,
1974. Paperback. An easily digested introduction to recursive thinking in LISP. You'll eat it
up!
* Gablik, Suzi. Magritte. Boston, Mass.: New York Graphic Society, 1976. Paperback.
An excellent book on Magritte and his works by someone who really understands their
setting in a wide sense; has a good selection of reproductions.
* Gardner, Martin. Fads and Fallacies. New York: Dover Publications, 1952. Paperback.
Still probably the best of all the anti-occult books. Although probably not intended as a book
on the philosophy of science, this book contains many lessons therein. Over and over, one
faces the question, "What is evidence?" Gardner demonstrates how unearthing "the truth"
requires art as much as science.
Geb~t~dter, Egbert B. Copper, Silver, Gold: an Indestructible Metallic Alloy. Perth:
ACIdIC Books, 1979. A formidable hodge-podge, turgid and confused-yet remarkably
similar to the present work. Professor Gebstadter's Shandean digressions include some
excellent examples of indirect self-reference. Of particular interest is a reference in its
well-annotated bibliography to an isomorphic, but imaginary, book.
** Godel, Kurt. On Formally Undecidable Propositwns. New York: Basic Books, 1962. A
translati~~ of Godel's 1931 paper, together with some discussion.
- - - . "Uber Formal Unentscheidbare Satze der Principia Mathematica und Ver-
748 Bibliography
wandter Systeme, I." Monatshefte fur Mathematik und Physik, 38 (1931), 173-198.
Godel's 1931 paper.
* Goffman, Erving. Frame Analysis. New York: Harper & Row, Colophon Books,
1974. Paperback. A long documentation of the definition of "systems" in human communi-
cation, and how in art and advertising and reporting and the theatre, the borderline
between "the system" and "the world" is perceived and exploited and violated.
Goldstein, Ira, and Seymour Papert. "Artificial Intelligence, Language, and the
Study of Knowledge". Cognitive Science 1 (January 1977): 84-123. A survey article
concerned with the past and future of AI. The authors see three periods so far: "Classic",
"Romantic", and "Modern".
Good, 1. J. "Human and Machine Logic". British Journal for the Philosophy of Science
18 (190'7): 144. One of the most interesting attempts to refute Lucas, having to do with
whether the repeated application of the diagonal method is itself a mechanizable operation.
- - - . "Godel's Theorem is a Red Herring". British Journal for the Philosophy of
Science 19 (1969): 357. In which Good maintains that Lucas' argument has nothing to do
with Godel's Theorem, and that Lucas should in fact have entitled his article "Minds,
Machines, and Transfinite Counting". The Good-Lucas repartee is fascinating.
Goodman, Nelson. Fact, Fiction, and Forecast. 3rd ed. Indianapolis: Bobbs-Merrill,
1973. Paperback. A discussion of contrary-to-fact conditionals and inductive logic, includ-
ing Goodman's famous problem-words "bleen" and "grue". Bears very much on the ques-
tion of how humans perceive the world, and therefore interesting especially from the AI
perspective.
* Goodstein, R. L. Development of Mathematical Logic. New York: Springer Verlag,
1971. A concise survey of mathematical logic, including much material not easily found
elsewhere. An enjoyable book, and useful as a reference.
Gordon, Cyrus. Forgotten Scripts. New York: Basic Books, 1968. A short and nicely
written account of the decipherment of ancient hieroglyphics, cuneiform, and other scripts.
Griffin, Donald. The Question of Animal Awareness. New York: Rockefeller University
Press, 1976. A short book about bees, apes, and other animals, and whether or not they are
"conscious"-and particularly whether or not it is legitimate to use the word "consciousness"
in scientific explanations of animal behavior.
deGroot, Adriaan. Thought and Choice in Chess. The Hague: Mouton, 1965. A
thorough study in cognitive psychology, reporting on experiments that have a classical
simplicity and elegance.
Gunderson, Keith. Mentality and Machines. New York: Doubleday, Anchor Books,
1971. Paperback. A very anti-AI person tells why. Sometimes hilarious.
** Hanawalt, Philip c., and Robert H. Haynes, eds. The Chemical Basis of Life. San
Francisco: W. H. Freeman, 1973. Paperback. An excellent collection of reprints from
the Scientific American. One of the best ways to get a feeling for what molecular biology is
about.
* Hardy, G. H. and E. M. Wright. An Introduction to the Theory of Numbers, 4th ed. New
York: Oxford University Press, 1960. The classic book on number theory. Chock-full of
information about those mysterious entities, the whole numbers.
Harmon, Leon. "The Recognition of Faces". Scientific American, November 1973, p.
70. Explorations concerning how we represent faces in our memories, and how much
information is needed in what form for us to be able to recognize a face. One of the most
fascinating of pattern recognition problems.
van Heijenoort, Jean. From Frege to Codet: A Source Book in Mathematical Logic.
Cambridge, Mass.: Harvard University Press, 1977. Paperback.' A collection of
epoch-making articles on mathematical logic, all leading up to Godel's climactic revelation,
which is the final paper in the book.
Henri, Adrian. Total Art: Environments, Happenings, and Performances. New York:
Praeger, 1974. Paperback. In which it is shown how meaning has degenerated so far in
modern art that the absence of meaning becomes profoundly meaningful (whatever that
means).
* Hoare, C. A. R. and D. C. S. Allison. "Incomputability". Computing Surveys 4, no. 3
(September 1972). A smoothly presented exposition of why the halting pmblem is
unsolvable. Pmves this fundamental theorem: "Any language containing conditionals and
recursive function definitions which is powerful enough to program its own interpreter
cannot be used to program its own 'terminates' function."
Bibliography 749
Hofstadter, Douglas R. "Energy levels and wave functions of Bloch electrons in
rational and irrational magnetIc fields". Physical Review B, 14, no. 6 (15 September
1976). The author's Ph.D. work, presented as a paper. Details the origin of "Gplot", the
recursive graph shown in Figure 34.
Hook, Sidney, ed. Dimensions of Mind. l\ew York: Macmillan, Collier Books, 1961.
Paperback. A collection of articles on the mind-body problem and the mind-computer
problem. Some rather strong-minded entries here.
* Horney, Karen. Self-Analysis. New York: W. W. Norton, 1942. Paperback. A fascinat-
ing description of how the levels of the self must tangle to grapple with problems of
self-definition of any individual in this complex world. Humane and insightful.
Hubbard, John I. The Biological Basis of Mental Activity. Reading, Mass.: Addison-
Wesley, f975. Paperback. Just one more book about the brain, with one special virtue,
however: it contains many long lists of questions for the reader to ponder, and references to
articles which treat those questions.
* Jackson, Philip C. Introduction to Artificial Intelligence. New York, Petrocelli Charter,
1975. A recent book, describing, with some exuberance, the ideas of AI. There are a huge
number of vaguely suggested ideas floating: around this book, and for that reason it is very
stimulating just to page through it. Has a giant bibliography, which is another reason to
recommend it.
Jacobs, Robert L. Understanding Harmony. New York: Oxford University Press,
1958. Paperback. A straightforward book on harmony, which can lead one to ask many
questions about why it is that conventional Western harmony has such a grip on our brains.
Jaki, Stanley L. Brain, Mind, and Computers. South Bend, Ind.: Gateway Editions,
1969. Paperback. A polemic book whose every page exudes contempt for the computa-
tional paradigm for understanding the mmd. Nonetheless it is iuteresting to ponder the
points he brings up.
* Jauch, J. M. Are Quanta Real? Bloomington, Ind.: Indiana University Press, 1973. A
delightful little book of dialogues, using three characters borrowed from Galileo, put in a
modern setting. Not only are questions of quantum mechanics discussed, but also issues of
pattern recognition, simplicity, brain processes, and philosophy of science enter. Most
enjoyable and provocative.
* Jeffrey, Richard. Formal Logic: Its Scope and Limits. New York: McGraw-Hili, 1967.
An easy-to-read elementary textbook whose last chapter is on Godel's and Church's Theo-
rems. This book has quite a different approach from many logic texts, which makes it stand
out.
* Jensen, Hans. Sign, Symbol, and Script. New York: G. P. Putnam's, 1969. A-or
perhaps the-top-notch book on symbolic writing systems the world over, both of now and
long ago. There is much beauty and mysterv in this book-for instance, the undeciphered
script of Easter Island.
Kalmar, Laszlo. "An Argument Against the Plausibility of Church's Thesis". In A.
Heyting, ed. Constructlvity in Mathematics: Proceedings of the Colloquium held at
Amsterdam, 1957, North-Bolland, 1959. An interesting article by perhaps the best-
known disbeliever in the Church-Turing Thesis.
* Kim, Scott E. "The Impossible Skew Quadrilateral: A Four-Dimensional Optical
Illusion". In David Brisson, ed. Proceedings of the 1978 A.A.A.S. Symposium on
Hypergraphics: Visualizing Complex Relationships in Art and Science. Boulder, Colo.:
Westview Press, 1978. What seems at first an inconceivably hard idea-an optical illusion
for four-dimensional "people"-is gradually made crystal clear, in an amazing virtuoso
presentation utilizing a long series of excellently executed diagrams. The form of this article
is just as intriguing and unusual as its content: it is tripartite on many levels simultaneously.
This article and my book developed in parallel and each stimulated the other.
Kleene, Stephen C. Introduction to Mathematical Logic. New York: John Wiley, 1967.
A thorough, thoughtful text by an important figure in the subject. Very worthwhile. Each
time I reread a passage, I find something new in it which had escaped me before.
- - - . Introduction to Metamathematics. Princeton: D. Van Nostrand (1952). Classic
work on mathematical logic; his textbook (above) is essentially an abridged version. Rigorous
and complete, but oldish.
Kneebone G. J. Mathematical Logic and thl' Foundations of Mathematics. New York: Van
Nostrand Reinhold, 1963. A solid book with much philosophical discussion of such topics
as intuitionism, and the "reality" of the natural numbers, etc.
750 Bibliography
Koestler, Arthur. The Act of Creation. New York: Dell, 1966. Paperback. A wide-ranging
and generally stimulating theory about how ideas are "bisociated" to yield novelty. Best to
open it at random and read, rather than begin at the beginning.
Koestler, Arthur and J. R. Smythies, eds. Beyond Reductionism. Boston: Beacon
Press, 1969. Paperback. Proceedings of a conference whose participants all were of the
opinion that biological systems cannot be explained reductionistically, and that there is
something "emergent" about life. I am intrigued by books which seem wrong to me, yet in a
hard-to-pin-down way.
** Kubose, Gyomay. Zen Koans. Chicago: Regnery, 1973. Paperback. One of the best
collections of koans available. Attractively presented. An essential book for any Zen library.
Kuffler, Stephen W. and John G. Nicholls. From Neuron to Brain. Sunderland, Mass.:
Sinauer Associates, 1916. Paperback. A book which, despite its title, deals mostly with
microscopic processes in the brain, and quite little with the way people's thoughts come out
of the tangled mess. The work of Hubel and Wiesel on visual systems is covered particularly
well.
Lacey, Hugh, and Geoffrey Joseph. "What the Godel Formula Says". Mind 77
(1968): 77. A useful discussion of the meaning of the G6del formula, based on a strict
separation of three levels: un interpreted formal system, interpreted formal system, and
metamathematics. Worth studying.
Lakatos, 1m re. Proofs and Refutations. New York: Cambridge University Press, 1976.
Paperback. A most entertaining book in dialogue form, discussing how concepts are formed
in mathematics. Valuable not only to mathematicians, but also to people interested in
thought processes.
** Lehninger, Albert. Biochemistry. New York: Worth Publishers, 1976. A wonderfully
readable text, considering its technical level. In this book one can find many ways in which
proteins and genes are tangled together. Well organized, and exciting.
** Lucas, J. R. "Minds, Machines, and Gode)". Philosophy 36 (1961): 112. This article is
reprinted in Anderson's Minds and Machines, and in Sayre and Crosson's The Modeling of
Mind. A highly controversial and provocative article, it claims to show that the human brain
cannot, in principle, be modeled by a computer program. The argument is based entirely on
G6del's Incompleteness Theorem, and is a fascinating one. The prose is (to my mind)
incredibly infuriating-yet for that very reason, it makes humorous reading.
- - - . "Satan Stultified: A Rejoinder to Paul Benacerraf". Monist 52 (1968): 145.
Anti-Benacerraf argument, written in hilariously learned style: at one point Lucas refers to
Benacerraf as "self-stultifyingly eristic" (whatever that means). The Lucas-Benacerraf battle,
like the Lucas-Good battle, offers much food for thought.
- - - . "Human and Machine Logic: A Rejoinder". BritishJournalfor the Philosophy
of Science 19 (1967): 155. An attempted refutation of Good's attempted refutation of
Lucas' original article.
** MacGillavry, Caroline H. Symmetry Aspects of the Periodic Drawings of M. C. Escher.
Utrecht: A. Oosthoek's Uitgevermaatschappij, 1965. A collection of tilings of the
plane by Escher, with scientific commentary by a crystallographer. The source for some of
my iIIustrations--e.g., the Ant Fugue and the Crab Canon. Reissued in 1976 in New York by
Harry N. Abrams under the title Fantasy and Symmetry.
MacKay, Donald M.lnformation, Mechanism and Meaning. Cambridge, Mass.: M.l.T.
Press, 1970. Paperback. A book about different measures of information, applicable in
different situations; theoretical issues related to human perception and understanding: and
the way in which conscious activity can arise from a mechanistic underpinning.
* Mandelbrot, Benoit. Fractals: Form, Chance, and Dimension. San Francisco: W. H.
Freeman, 1977. A rarity: a picture book of sophisticated contemporary research ideas in
mathematics. Here, it concerns recursively defined curves and shapes, whose dimensionality
is not a whole number. Amazingly, Mandelbrot shows theil" relevance to practically evel)"
branch of science.
* McCarthy, John. "Ascribing Mental Qualities to Machines". To appear in Martin
Ringle, ec:f Philosophical Perspectives in Artificial Intelligence. New York: Humanities
Press, 1979. A penetrating article about the circumstances under which it would make
sense to say that a machine had beliefs, desires, intentions, consciousness, or free will. It is
interesting to compare this article with the book by Griffin.
Meschkowski, Herbert. Non-Euclidean Geomehy. New York: Academic Press, 1964.
Paperback. A short book with good historical commentary.
Bibliography 751
M~yer, lean. "~ssai d'appl!cati~~n de certain~ modeles cybernetiques a la coordina-
tIon chez les 1I1sectes SOCIaux . Insectes Soc!aux XIII, no. 2 (1966): 127. An article
which draws some parallels between the ueural organization in the brain, and the organiza-
tion of an ant colony.
Meyer, Leonard B. Emotion and Meaning in Music. Chicago: University of Chicago
Press, 1956. Paperback. A book which attempts to use ideas of Gestalt psychology and the
theory of perception to explain why musical structure is as it is. One of the more unusual
books on music and mind.
- - - . Music, The Arts, and Ideas. Chicago: University of Chicago Press, 1967.
Paperback. A thoughtful analysis of mental processes involved in listening to music, and of
hierarchical structures in music. The author compares modern trends in music with Zen
Buddhism.
Miller, G. A. and P. N. Johnson-Laird. Language and Perception. Cambridge, Mass.:
Harvard University Press, Belknap Pre~s, 1976. A fascinating compendium oflinguis-
tic facts and theories, bearing on Whorf's hypothesis that language is the same as world-
view. A typical example is the discussion of the weird "mother-in-law" language of the
Dyirbal people of Northern Queensland: a separate language used only for speaking to
one's mother-in-law.
** Minsky, Marvin L. "Matter, Mind, and Models". In Marvin L. Minsky, ed. Semantic
Information Processing. Cambridge, Mass.: M.I.T. Press, 1968. Though merely a few
pages long, this article implies a whole phIlosophy of consciousness and machine intelli-
gence. It is a memorable piece of writing by one of the deepest thinkers in the field.
Minsky, Marvin L., and Seymour Papert. Artificial Intelligence Progress Report. Cam-
bridge, Mass.: M.1.T. Artificial Intelligence Laboratory, Al Memo 252, 1972. A
survey of all the work in Artificial Intelligence done at M.I.T. up to 1972, relating it to
psychology and epistemology. Could serve excellently as an introduction to AI.
*i* Monod, Jacques. Chance and Necessit)'. Ne\v York: Random House, Vintage Books,
1971. Paperback. An extremely fertile mind writing in an idiosyncratic way about fascinat-
ing questions, such as how life is constructed out of non-life; how evolution, seeming to
violate the second law of thermodynamics, is actually dependent on it. The book excited me
deeply.
* Morrison, Philip and Emily, eds. Char/e.' Babbage and his Calculating Engines. New
York: Dover Publications, 1961. Paperback. A valuable source of information about the
life of Babbage. A large fraction of Babhage's autobiography is reprinted here, along with
several articles about Babbage's machines and his "Mechanical Notation".
Myhill, lohn. "Some Philosophical Implications of Mathematical Logic". Review of
MetapJiysICs 6 (1952): 165. An unusual discussion of ways in which G6del's Theorem and
Church's Theorem are connected to psychology and epistemology. Ends up in a discussion
of beauty and creativity.
Nagel, Ernest. The Structure ol Science. New York: Harcourt, Brace, and World,
1961. A classic in the philosophy of science, featuring clear discussions of reductionism vs.
holism, teleological vs. non teleological explanations, etc.
** Nagel, Ernest and James R. Newman. Godel's Proof. New York: New York Univer-
sity Press, 1958. Paperback. An enjoyable and exciting presentation, which was, in many
ways, the inspiration for my own book.
* Nievergelt, Jurg, J. C. Farrar! ':I~d E. M. Reingold. Computer Approaches to Mathemat-
Ical Probleml. Englewood ClIffs, N.].: PrentICe-Hall, 1974. An unusual collection of
different types of problems which can be and have been attacked on computers-for
instance, the "3n + I problem" (mentioned in my Aria with Diverse Variations) and other
problems of number theory.
Pattee, Howard H., ed. Hierarchy Theory. New York: George Braziller, 1973. Paper-
back. Subtitled "The Challenge of Complex Systems". Contains a good article by Herbert
Simon covering some of the same ideas as does my Chapter on "Levels of Description".
Peter, Rozsa. Recursive Functions. New York: Academic Press, 1967. A thorough
discussion of primitive recursive functiom, general recursive functions, partial recursive
functions, the diagonal method, and many other fairly technical topics.
Quine, Willard Van Orman. The WaY.I of Paradox, and Other Essays. New York:
Random House, 1966. A collection of Quine's thoughts on many topics. The first essay
deals with various sorts of paradoxes, and their resolutions. In it, he introduces the opera-
tion I call "quining" in my book.
752 Bibliography
Ranganathan, S. R. Ramanujan, The Man and the Mathematician. London: Asia Pub-
lishing House, 1967. An occult-oriented biography of the Indian genius by an admirer.
An odd but charming book.
Reichardt, Jasia. Cybernetics, Arts, and Ideas. Boston: New York Graphic Society,
1971. A weird collection of ideas about computers and art. music. literature. Some of it is
definitely off the deep end-but some of it is not. Examples of the latter are the articles "A
Chance for Art" by J. R. Pierce. and "Computerized Haiku" by Margaret Masterman.
Renyi, Alfred. Dialogues on Mathematics. San Francisco: Holden-Day, 1967. Paper-
back. Three simple but stimulating dialogues involving classic characters in hist9ry. trying to
get at the nature of mathematics. For the general public.
** Reps, Paul. Zen Flesh, Zen Bones. New York: Doubleday, Anchor BOQks. Paperback.
This book imparts very well the flavor of Zen-its anti rational, antilanguage. antireduc-
tionistic, basically holistic orientation.
Rogers, Har~ley. Theory of Recursive Functions and Effective Computability. New York:
McGraw-HIli, 1967. A highly technical treatise. but a good one to learn from. Contains
discussions of many intriguing problems in set theory and recursive function theory.
Rokeach, Milton. The Three Christs of Ypsilanti. New York: Vintage Books, 1964.
Paperback. A study of schizophrenia and the strange breeds of "consistency" which arise in
the afflicted. A fascinating conflict between three men in a mental institution. all of whom
imagined they were God, and how they dealt with being brought face to face for many
months.
** Rose. Steven. The Conscious Brain, updated ed. New York: Vintage Books, 1976.
Paperback. An excellent book-probably the best introduction to the study of the brain.
Contains full discussions of the physical nature of the brain, as well as philosophical
discussions on the nature of mind. reductionism vs. holism, free will vs. determinism, etc.
from a broad, intelligent. and humanistic viewpoint. Only his ideas on AI are way off.
Rosenblueth, Arturo. Mind and Brain: A Philosophy of Science. Cambridge, Mass.:
M.l.T. Press, 1970. Paperback. A well written book by a brain researcher who deals with
most of the deep problems concerning mind and brain.
* Sagan, Carl, ed. Communication with Extraterrestrial Intelligence. Cambridge, Mass.:
M.l.T. Press, 1973. Paperback. Transcripts of a truly far-out conference, where a stellar
group of scientists and others battle it out on this speculative issue.
Salmon, Wesley, ed. Zeno's Paradoxes. New York: Bobbs-Merrill, 1970. Paperback. A
collection of articles on Zeno's ancient paradoxes, scrutinized under the light of modern set
theory. quantum mechanics. and so on. Curious and thought-provoking, occasionally
humorous.
Sanger, F., et al. "Nucleotide sequence of bacteriophage <f>X174 DNA", Nature 265
(Feb. 24, 1977). An exciting presentation of the first laying-bare ever of the full hereditary
material of any organism. The su rprise is the double-entendre: two proteins coded for in an
overlapping way: almost too much to believe.
Sayre, Kenneth M., and FrederickJ. Crosson. The Modeling of Mind: Computers and
Intelligence. New York: Simon and Schuster, Clarion Books, 1963. A collection of
philosophical comments on the idea of Artificial Intelligence by people from a wide range of
disciplines. Contributors include Anatol Rapoport, Ludwig Wittgenstein, Donald Mackay.
Michael Scriven, Gilbert Ryle, and others.
* Schank, Roger, and Kenneth Colby. Computer Models of Thought and Language. San
Francisco: W. H. Freeman, 1973. A collection of articles on various approaches to the
simulation of mental processes such as language-understanding, belief-systems, translation.
and so forth. An important AI book, and many of the articles are not hard to read, even for
the layman.
Schr6dinger, Erwin. What is Life? & Mind and Matter. New York: Cambridge Uni-
versity Press, 1967. Paperback. A famous book by a famous physicist (one of the main
founders of quantum mechanics). Explores the physical basis of life and brain; then goes on
to discuss consciousness in quite metaphysical terms. The first half, What is Life?, had
considerable influence in the 1940's on the search for the carrier of genetic information.
Shepard, Roger N. "Circularity in Judgments of Relative Pitch". Journal of the
Acoustical Society of America 36, no. 12 (December 1964), pp. 2346-2353. The source
of the amazing auditory illusion of "Shepard tones".
Simon, Herbert A. The Sciences of the Artificial. Cambridge, Mass.: M.l.T. Press,
1969. Paperback. An interesting book on understanding complex systems. The last chapter.
Bibliography 753
entitled "The Architecture of Complexity", discusses problems of reductionisrri versus
holism somewhat.
Smart,J.J. C. "Godel's Theorem, Church's Theorem, and Mechanism". Synthese 13
(1961): 105. A well written article predating Lucas' 1961 article, but essentially arguing
against it. One might conclude that you have to be Good and Smart. to argue against
Lucas ...
** Smullyan, Raymond. Theory of Formal Systems. Princeton, N. J.: Princeton University
Press, 1961. Paperback. An advanced treatise. but one which begins with a beautiful
discussion of formal systems, and proves a simple version of Godel's Theorem in an elegant
way. Worthwhile for Chapter I alone.
* ---. WhatIs the Name of This Book? Englewood Cliffs, N.J.: Prentice-Hall, 1978.
A book of puzzles and fantasies on paradoxes, self-reference, and Godel's Theorem. Sounds
like it will appeal to many of the same readers as my book. It appeared after mine was all
written (with the exception of a certain entry in my bibliography).
Sommerhoff, Gerd. The Logic of the Living Brain. New York: John Wiley, 1974. A
book which attempts to use knowledge of small-scale structures in the brain. in creating a
theory of how the brain as a whole work,.
Sperry, Roger. "Mind, Brain, and Humanist Values". In John R. Platt, ed. New
Views on tlie Nature of Man. Chicago: University of Chicago Press, 1965. A pioneer-
ing neurophysiologist here explains most vividly how he reconciles brain activity and
consciousness.
* Steiner, George. After Babel: Aspects of Language and Translation. New York: Oxford
University Press, 1975. Paperback. A book by a scholar in linguistics about the deep
problems of translation and understanding of language by humans. Although AI is hardly
discussed, the tone is that to program a computer to understand a novel or a poem is out of
the question. A well written, thought-provoking-sometimes infuriating-book.
Stenesh, J. Dictionary of Biochemistry. l\ew York: John Wiley, Wiley-Interscience,
1975. For me, a useful companion to technical books on molecular biology.
** Stent, Gunther. "Explicit and Implicit Semantic Content of the Genetic Informa-
tion". In The Centrality of Science and Absolute Values, Vol. I. Proceedings of the 4th
International Conference on the Unity of the Sciences, New York, 1975. Amaz-
ingly enough, this article is in the proceedings of a conference organized by the now-
infamous Rev. Sun Myung Moon. Despite this, the article is excellent. It is about whether a
genotype can be said, in any operational sense, to contain "all" the information about its
phenotype. In other words, it is about the location of meaning in the genotype.
- - - . Molecular Genetics: A Historical Narrative. San Francisco: W. H. Freeman,
1971. Stent has a broad, humanistic viewpoint, and conveys ideas in their historical perspec-
tive. An unusual text on molecular biology.
Suppes, Patrick. Introduction to Logic. New York: Van Nostrand Reinhold, 1957. A
standard text, with clear presentations of both the Propositional Calculus and the Predicate
Calculus. My Propositional Calculus stems mainly from here.
Sussman, Gerald Jay. A Computer Model of Skill Acquisition. New York: American
Elsevier, 1975. Paperback. A theory of programs which understand the task of program-
ming a computer. The questions of how to break the task into parts, and of how the
different parts of such a program should interact, are discussed in detail.
** Tanenbaum, Andrew S. Structured Computer Organization. Englewood Cliffs, N. J.:
Prentice-Hall, 1976. Excellent: a straightforward, extremely well written account of the
many levels which are present in modern computer systems. It covers microprogramming
languages, machine languages, assembly languages, operating systems, and many other
topics. Has a good, partially annotated, bibliography.
Tarski, Alfred. Logic, Semantics, Metanu.lthematics. Papers from 1923 to 1938. Trans-
lated by J. H. Woodger. New York: Oxford UnIversity Press, 1956. Sets forth
Tarski's ideas about truth, and the relationship between language and the world it repre-
sents. These ideas are still having repercussions in the problem of knowledge representation
in Artificial Intelligence.
Taube, Mortimer. Computers and Common Sense. New York: McGraw-Hili, 1961.
Paperback. Perhaps the first tirade against the modern concept of Artificial Intelligence.
Annoying.
Tietze, Heinrich. Famous Problems of Mathematics. Baltimore: Graylock Press, 1965. A
book on famous problems, written in a very personal and erudite style. Good illustrations
and historical material.
754 B ibliogra ph y
Trakhtenbrot, V. Algorithms and Computing Machines. Heath. Paperback. A discussion
of theoretical issues involving computers, particularly unsolvable problems such as the
halting problem, and the word-equivalence problem. Short, which is nice.
Turing, Sara. Alan M. Turing. Cambridge, U. K.: W. Heffer & Sons, 1959. A
biography of the great computer pioneer. A mother's work of love.
* Ulam, Stanislaw. Adventures of a Mathematician. New York: Charles Scribner's, 1976.
An autobiography written by a sixty-five-year old man who writes as if he were still twenty
and drunk in love with mathematics. Chock-full of gossip about who thought who was the
best, and who envied whom, etc. Not only fun, but serious.
Watson,j. D. The Molecular Biology of the Gene, 3rd edition. Menlo Park, Calif.: W. A.
Benjamin, 1976. A good book but not nearly as well organized as Lehninger's, in my
opinion. Still almost every page has something interesting on it.
Webb, judson. "Metamathematics and the Philosophy of Mind". Philosophy of Science
35 (1968): 156. A detailed and rigorous argument against Lucas, which contains this
conclusion: "My overall position in the present paper may be stated by saying that the
mind-machine-Godel problem cannot be coherently treated until the constructivity problem
in the foundations of mathematics is clarified."
Weiss, Paul. "One Plus One Does Not Equal Two". In C. C. Quarton, T. MeI-
nechuk, and F. O. Schmitt, eds. The Neurosciences: A Study Program. New York:
Rockefeller University Press, 1967. An article trying to reconcile holism and reduc-
tionism, but a good bit too holism-oriented for my taste.
* Weizenbaum, Joseph. Computer Power and Human Reason. San Francisco: W. H.
Freeman, 1976. Paperback. A provocative book by an early Al wbrker who has come to
the conclusion that much work in computer science, particularly in AI, is dangerous.
Although I can agree with him on some of his criticisms, I think he goes too far. His
sanctimonious reference to AI people as "artificial intelligentsia" is funny the first time, but
becomes tiring after the dozenth time. Anyone interested in computers should read it.
Wheeler, William Morton. "The Ant-Colony as an Organism".Journal of Morphology
22,2 (1911): 307-325. One of the foremost authorities of his time on insects gives a
famous statement about why an ant colony deserves the label "organism" as much as its parts
do.
Whitely, C. H. "Minds, Machines, and Codel: A Reply to Mr Lucas". Philosophy 37
(1962): 61. A simple but potent reply to Lucas' argument.
Wilder, Raymond. An Introduction to the Foundations of Mathematics. New York: john
Wiley, 1952. A good general overview, putting into perspective the important ideas of the
past century.
* Wilson, Edward O. The Insect Societies. Cambridge, Mass.: Harvard University Press,
Belknap Press, 1971. Paperback. The authoritative book on collective behavior of insects.
Although it is detailed, it is still readable, and discusses many fascinating ideas. It has
excellent illustrations, and a giant (although regrettably not annotated) bibliography.
Winograd, Terry. Five Lectures on Artificial Intelligence. AI Memo 246. Stanford,
Calif.: Stanford University Artificial1ntelligence Laboratory, 1974. Paperback. A
description of fundamental problems in AI and new ideas for attacking them, by one of the
important contemporary workers in the field.
* ---. Language as a Cognitive Process. Reading, Mass.: Addison-Wesley (forthcom-
ing). From what I have seen of the manuscript, this will be a most exciting book, dealing
with language in its full complexity as no other book ever has.
* ---. Understanding Natural Language. New York: Academic Press, 1972. A de-
tailed discussion of one particular program which is remarkably "smart", in a limited world.
The book shows how language cannot be separated from a general understanding of the
world, and suggests directions to go in, in writing programs which can use language in the
way that people do. An important contribution; many ideas can be stimulated by a reading
of this book.
- - - . "On some contested suppositions of generative linguistics about the scien-
tific study of language", Cognztion 4:6. A droll rebuttal to a head-on attack on Artificial
Intelligence by some doctrinaire linguists.
* Winston, Patrick. Artificial Intelligence. Reading, Mass. : Addison-Wesley, 1977. A
strong, general presentation of many facets of AI by a dedicated and influential young
proponent. The first half is independent of programs; the second half is LISP-dependent
and includes a good brief exposition of the language LISP. The book contains many
pointers to present-day AI literature.
Bibliography 755
* ---, ed. The Psychology of Computer Vision. New York: McGraw-Hili, 1975. Silly
title, but fine book. It contains articles on how to program computers to do visual recogni-
tion of objects, scenes, and so forth. The arlicles deal with all levels of the problem, from the
detection of line segments to the general organization of knowledge. In particular, there is
an article by Winston himself on a program he wrote which develops abstract concepts from
concrete examples, and an article by Minsky on the nascent notion of "frames".
* Wooldridge, Dean. Mechanical Man-The Physical Basis of Intelligent Life. New York:
McGraw-Hili, 1968. Paperback. A thorough-going discussion of the relationship of men-
tal phenomena to brain phenomena, written in clear language. Explores difficult
philosophical concepts in novel ways, shedding light on them by means of concrete exam-
ples.
756 Bibliography
Credits
Fi~res: Fig. 1, Johann Sebastian Bach by Elias Gottlieb-Haussmann (1748), collection of
WIlliam H. Scheide, Princeton, New Jersey; Fig. 2, Flute Concert in Sanssouci, by Adolf von
Menzel, Nationalgalerie, West Berlin; Figs. 3,4, 152, "The Royal Theme" and the last page
of the "Six-part Ricercar," from the original edition of Musical Offering by Johann Sebastian
Bach, are reproduced courtesy of the Library of Congress; Figures of lithographs and
woodcuts of M. C. Escher are reproduced by permission of the Escher Foundation, Haags
Gemeentemuseum, The Hague, copyright the Escher Foundation, 1979, reproduction
rights arranged courtesy of the Vorpal Galleries, New York, Chicago, San Francisco, and
Laguna Beach; Fig. 9, photograph of Kurt GOdei by Orren J. Turner from Foundations of
Mathematics: Symposium Papers Commemorating the Sixtieth Birthday of Kurt Godel, edited by
Jack J. Bulloff, Thomas C. Holyoke, and S. W. Hahn, New York, Springer-Verlag, 1969;
Figs. 17, 96, "Figure-Figure" and "A section of mRNA passing through a ribosome,"
drawings by Scott E. Kim; Figs. 19, 44, 133, 148, musical selections from the Musical
Offering by J. S. Bach, music printed by Donald Byrd's program "SMUT"; Fig. 25, "Cretan
labyrinth" from W. H. Matthews, Mazes and Labyrinths: Their History and Development, New
York, Dover Publications, Inc., 1970; Fig. 39, photograph of Rosetta Stone, courtesy of the
British Museum; Fig. 40, A collage of scripts. Samples of cuneiform, Easter Island,
Mongolian and Runic scripts from Hans Jensen, Sign, Symbol and Script, East Germany VEB
Deutscher Verlag Der Wissenschaften; samples of Bengali and Buginese script from Ken-
neth Katzner, The Languages of the World, New York, Funk & Wagnalls, 1975; samples of
Tamil and Thai from I. A. Richards and Christine Gibson, English Through Pictures, New
York, Washington Square Press; Fig. 59, "Intelligence built up layer by layer" (Fig. 9.8)
adapted from Patrick Henry Winston, Artificial Intelligence, Reading, Mass., Addison-Wesley
Publishing Company, reprinted by permission; Figs. 63, 69, photographs of an ant bridge
by Carl W. Rettenmeyer and construction of an arch by termite workers by Turid Holl-
dobler, from E. O. Wilson, The Insect Societies, Cambridge, Mass., Harvard University Press,
1979; Fig. 65, schematic drawing of a neuron adapted from The Machinery of the Brain, by
Dean Wooldridge, copyright 1963, McGraw-Hill, Inc. used with permission of McGraw
Hill Book Company, and from Fig. II-6, page 26, Speech and Brain-Mechanisms, by Wilber
Penfield and Lamar Roberts, copyright by Princeton University Press, reprinted by
permission of Princeton University Press; Fig. 66, "the human brain, seen from the left
side," from Steven Rose, The Conscious Brain, copyright 1973 by Steven Rose, reprinted
by permission of Alfred A. Knopf, Inc., New York, and John Wolfers, London; Fig. 68,
"overlapping neural pathways," from John C. Eccles, Facing Reality, New York, Springer-
Verlag, 1970; Figs. 77, 78, 80, 82, 117, 137, 138, 141, The Shadows, State of Grace, The Fair
Captive, The Air and the Sung, Mental Arithmetic, Common Sense, The Two Mysteries, and The
Human Condition I by Rene Magritte, copyright by ADAGP, Paris, 1979; Figs. 79, 95,
"Tobacco Mosaic Virus" and "Secondary and Tertiary Structure of Myoglobin" from
Albert Lehninger, Biochemistry, New York, Worth Publishers, 1975; Figs. 91, 92, "The four
constituent bases of DNA" and "The ladder-like structure of DNA" from Arthur
Kornberg, "The Synthesis of DNA," Scientific American, copyright October 1968, all
rights reserved; Fig. 93, "Molecular model of the DNA double helix," reprinted by
permission, from V. M. Ingram, Biosynthesis of Macromolecules, Menlo Park, California, The
Benjamin/Cummings Publishing Company, 1972; Fig. 97, "Polyribosome" from The Pro-
teins, edited by R. E. Dickerson and H. Neurath, page 64, New York, Academic Press; Fig.
98, "A two-tiered molecular canon" from O. L. Miller, Jr., "Visualization of Genes in
Action," in Scientific American, copyright March 1973, all rights reserved; Figs. 101, 102,
103, "The T4 bacterial virus," "Infection of a Bacterium by a virus," and "The mor-
phogenetic pathway of the T4 virus," from William B. Wood and R. S. Edgar, "Building
a Bacterial Virus" in Scientific American, copyright July 1987, all rights reserved; Fig.
105, photograph of Srinivasa Ramanujan from S. R. Ranganathan, Ramanujan, the Man and
the Mathematician, New York, Asia Publishing House, 1967; Figs. 110, Ill, 112, from Terry
Winograd, Understanding Natural Language,New York, Academic Press, 1972; Fig. 113,
photograph of Alan Turing by Mssrs. C. H. O. Trevelyan from Sara Turing, Alan M.
Turing, Cambridge, England, W. H. Heffer and Sons, Ltd., 1959; Fig. 116, "a meaningful
story in Arabic" from Abdelkebir Khatibi and Mohammed Sijelmassi, The Splendor of Islamic
Calligraphy, New York, London, Thames & Hudson, copyright by Qarawiyne Library in
Fez; Fig. 118, Procedural representation of "red cube which supports a pyramid," adapted
Credits 757
from Computer Models of Thought and Language, edited by Roger C. Schank and Kenneth
Mark Colby. W. H. Freeman and Company, copyright 1973; Figs. 119, 122, 124, 130,
Bongard problems from M. Bongard, Pattern Recognition, Rochelle Park, New Jersey,
Hayden Book Company, Spartan Books, 1970
758
Index
AABB form, 130, 227 amino acids, 518-25, 533-34; in Typogenetics,
Abel, Niels Henrik, 404 508,510-11
ABORT (BlooP), 412 analogical thinking: by computer, 603; underpin-
abortion, 176 ning of, 570-71
abstraction, levels of, 651-53, 656-57, 660, analogies, 668-74
666-72,674 Analytical Engine, 25, 598, 727
Achilles: answer-schemas and, 475; Carroll para- anaphase, 667
dox and, 46, 170, 181, 193; Crab Canon and, anarchy, 693
204,666-67; heel of, 389,484; image of GOD, "and", 177-80, 181, 186, 630
223; inaccessible neurons of, 328, 686; initial Anderson, Alan Ross, 197
letter of, 231, 507, 667; innocence of, 406, 408, Announcer, 633-40
424; mapped onto ant colony, 318, 324; men- anomalies, 44, 96, 208, 435, 723
tioned, 84, 272, 525, 573, 669; mystified by Another World (Escher), 250, 255
Crab, 560; orchard analogy and, 427; origin of, answer-schemas, 462~, 475, 688
28, 29; picture of, 42; problem reduction and, ant bridge, 334
610-11; recursion and, 128-31, 149; as violin, ant colonies: artificial, 359; caste distribution in,
502 318-28; castes in, 317-18; communism in, 318,
Achilles property, 396-98, 415 330-31; compared with brains, 315-16, 318,
acoustico-retrieval, 278-80, 460 324-25, 350, 358-59; contrasted with gases,
acronyms, 31-32, 113, 174, 176, 204, 237, 272, 317; freedom and control in, 315-16, 327; intel-
374,606,684,727,736,738,740 ligent, 310-36; levels in, 319-27; mechanisms of
acrostics, 7, 81 teams and signals, 317-21; order and chaos in,
active site, 528-29, 544 316-17; regrouped, 332-33; signals in, 320-28;
actor formaliim, 662~ symbol level in, 324-28, 330; teams in, 317,
"Actually InteUigent" programs, 676 319-27; thresholds in, 316-17, 319-21; trails of,
addition: AI programs and, 677-78; com- 315-17; see also caste diitribution, Aunt Hillary,
mutativity, associativity of, 55, 225-26; in Fermant, Joh. Seb., Fourmi, Lierre de, teams,
BlooP, 409; noncom mutative, 222-23, 639; pq- signals, symbols
system and, 49-53, 417; representability of, 417; Ant Fugue, 337, 349, 350, 382, 570, 686, 737-39
of supematurals, 455; TNT notation for, "Ant Fugue" (Escher), 322-23
206-7; triple, 101, 206-7 Anteater, 275-84, 311-36, 382, 570, 722
addresses (in memory), 289, 290 anti-AI attitudes, 27, 470-72, 628
adenine, see nucleotides anticodons, 522-24
advertisements, 478 ants: dispensability of, 326; nest of, 359; vs. ant
AI: applied to mathematics, 573, 614-15; argu- colonies, 314, 315, 319, 321, 326, 330
ments against, 597-99; attitudes against, see aperiodic crystals, 167-69, 174-76
anti-AI attitudes; computer languages and, arch of tertnites, 358-59
299-300, 548; converging towards brains, 579; Aria with Diverse Variations (Bach), 392-93, 395
defined, 26; difficulty of, 26-27, 573, 740; evi- Aria with Diverse Varialions (Dialogue), 408
dence and, 695; faith underlying, 572, 578-79; Aristotle, 19
COdel's Theorem and, 388-90, 471-77, 706-7; aridunetization, 262-65, 268-69, 533-34
history of, 19, 24-27, 594-97, 600-9; level- aridunoquining, 445-54, 466-68, 497, 502, 541,
translation and, 285; oudine of, 601-3; relation 580-81
to mathematics, 559-60; stratification of, arms, mutually washing, 691
299-300 art: identity crisis of, 699-700, 703-6; modem,
AI programs: compared with people, 679-80; cu- 699-706; by computer, 603, 619-20
riosity of, 679; Lucas' argument and, 577-78 Art-Language, 622
AI Thesis, 579 Art of the Fugue (Bach), 79-81, 86, 671
Air and the Song, The (Magritte), 494 Art of Zen Strings, 237, 239-42, 244, 626
Air on C's String, 445, 446, 497 Artificial Imagery, 560
airplane-haystack story, 675 Artificial Intuition, 560
aleatoric music, 163, 174, 700 Artificial Ism, 625
Algol, 292, 293, 381, 630 artificial "thinking", 337, 601
algorithms, 292,410,412,413, 414,440,459,567 Ascending and Descending (Escher), 12-13, 15, 21,
"all", 60 716
"a1most"-situations, 634-40, 641-43, 649 Asian Box, Very Gold, see Gold Box, Very Asian
alpha helix, 521, 525 assemblers, 291, 294
Alternative Structures of the Union, see ASU's assembly language, 290-95; compared to DNA,
ambiguity: computer languages and, 297-98; in 290-91
translation into TNT, 209-11 assembly lines, cellular, 528-29, 544-45
Appearances of Achilles and the Tortoise in Dialogues are not indexed, but those of less frequent
characters are. The reader is encouraged to consult the figure on page 370 for possible help in cross-
references.
Index 759
associativity, 55-56, 207 bees, 360, 641, 720
assumptions, shaky, 420, 422, 429, 580, 581, 644, Beethoven, Ludwig van, 6, 75, 163, 634
672 beliefs, catalogue of, 382, 384
ASU's: defined, 373-74: orientation in, 375; trips Bell, A. G., 296
in, 377-79, 383 Belnap, Nuel, 197
ATN's, see Augmented Transition Networks Berio, Luciano, 704
ATN-colony, 359 bicentuplets, 540
atoms: in physics, 303: in Propositional Calculus, bifurcations, 91-94, 100, 456-59, 467, 579
182, 186: in TNT, 207, 213, 214 biojukeboxes, 160, 175
ATTACCA, 176,284, 311,505 BirthtJay Can/ala (Bach), 461
attachment and nonattachment, 232-33, 244 BirtMo.y Cantatatata (Dialogue), 468, 475, 688
augmentation, 8, 9, 146, 503, 681--83, 738: inter- birthdays, 461-64
vallic, 156-57 bits, 288--89, 290, 291
Augmented Transition Networks, 150, 258-59, BLOCK (BlooP), 410-11
359, 621, 625-27, 630 blocks world, 586-93, 627-32, 674
Augustus II, Elector of Saxony, King of Poland, BlooP, 406, 409-30, 440, 441, 444: alphabet of,
461 419, 425; control structures in, 410; primordial
Aunt Hillary, 314-33, 382, 630 steps of, 409, 412-13: syntax of, 410-15
Author, the, 3, 6, 204, 370, 689, 722, 724-42 BlooP programs, 410-14
authorship triangle, 94-95, 96, 689 Blue Programs, 418-20, 422, 427
autological adjectives, 20-21 Bluediag [N), 42-44, 428
automatic programming, 298-99 board evaluation: static and dynamic, 604-5, 611;
Avery, Oswald, 159, 161 Strange Loops in, 604-5
awareness, deductive vs. analogical, 570-71, 619 Bodhidharma, 232, 238, 245, 252, 625
axiom schemata, 47, 48, 65, 87, 468, 472-73, 543 Bolyai, Farkas, 92
axiomatic systems, see formal systems Bolyai, Janos, 91-92
axioms: defined, 35; lack of in Propositional Cal- Bongard, M., 646
culus, 183; of MIU-system, 33, 35; of P-system, Bongard problems, 646-62, 664, 669, 674; uni-
73-74: of pq-system, 47; of pq-system, modi- versality of, 661-62
fied, 87; of 31O-system, 263: of TNT, 216; of Boole, Geo., 20, 404, 600
TNT, extended, 451-52, 466-68; of tq-system, Boolean Buddhism, 577
65 boomerangs, 75, 84, 267, 472
axons, 339-40 bootstrapping, 24, 293-94, 524, 548
bottom (recursion), 139-40: see also skeletons
Babbage, Charles, 24-26, 598, 601, 726-42 bottom-up vs. top-down, 48-49
Babbage test, 735-73 bottoming out, 133-35, 151, 259, 301, 650
BACH (acronym), 174-75 boustrophedonic writing, 168-69, 176
B-A-C-H (melody), 79--81, 86, 102, 121, 155-57, boxed systems, 469-70, 543
266, 719 Boyle's law, 308; see also gases
Bach, Anna Magdalena, 482 brains: ant colonies and, 315-16, 318, 324-25,
Bach, C. P. E., 3, 4, 80 350, 358-59; as ATN-colonies, 359: as mathe-
Bach, Joh and Seb., 633, 669 matical objects, 559: Epimenides paradox and,
Bach, Joh. Seb.: AI and, 27, 677; as composer, 584--85: formal systems and, 337-38, 559-62,
392, 461, 740-42; as glassblower, 79; as 569-79, 584--85, 676, see also Church-Turing
harpsichordist, 275, 279, 280; as inspiration for Thesis, formal vs. informal systems, brains and
Dialogues, 28, 737; confused with Fermat, rules; frame and outer messages and, 170-71;
331-35: depth of, 7--8, 9-10,27-28, 70-71, 677; mappings between, 341-42, 345-46, 369--82:
dissection vs. appreciation of, 680; Escher and, music and, 163; operating systems and, 296;
199, 666-67: Forkel on, 4, 86; homage to, 81; programmability of, 302; rules and, 26-27, 676,
improvisation by, 3-7, 96, 719; in Leipzig, 383, see also brains and formal systems: suborgans of,
404; indirect self-reference of, 79--81, 86: life 340-41; thoughts and, 337-65; vs. minds, 576:
and death of, 86; modulation and, 122-23, 130: see also minds, intelligence, etc.
recursive qualities of music of, 70-71: Shepard Breton, Andre, 700
tones and, 719: squared, 679: vs. Cage, 157, "British Grenadiers, The", 607
162-64, 174-75; see also Old Bach Brouwer, Luitzen E. J., 404
Bach, Wilhelm Friedemann, 4, 6 Buddha-nature, 233, 234, 238-44
background assumptions, 644 Buttcrjlies (Escher), 147-48
backtr*king, 97, 629, 632 Buxtehude, Dietrich, 335
backwards chaining, 618 Byrd, Donald, see SMUT
bankers, 457 Byron, Lord, 25
base-pairing, complementary, 433, 506-7, 514-16,
517, 523, 534
baseball, 637-38 C-system, 65-67, 71-72
bases (genetics): 514, see also nucleotides: in Ty- CAGE (acronym), 174-75
pogenetics, 505--8, 510 C-A-G-E (melody), 156-57
Baso, 234 Cage, John, 156-57, 163-64, 167, 174-75, 556,
Bassui,255 699-700, 704
beautiful vs. non-beautiful, 552-58, 560, 573-75, calculating prodigies, see idiots savants
581--82 Canon by Intervallic Augmentation, 525
beauty: computers and, 575; elusiveness of, 554, "Canon per augmentationem et contrario motu"
555, 565, 574-75, 581, 583--84 (Bach), see Sloth Canon
760 Index
"Canon per Tonos" (Bach), see Endlessly Rising in, 618; recursive structure of, 150-52;
Canon strengths and weaknesses of, 151-52, 285-87,
canons: copies and, 8-9, 146; Dialogues and, 573, 603-4, 611; Turing and, 595, 596, 736;
665-69, 738; Escher drawings and, 15; in Gold- varieties of, 601; without look-ahead, 604
berg Variations, 392; in Musical Offering 7-10, chests of drawers, nested, 644-45
726-27; poIyribosomes and, 526-28; self-refs children's stories and AI, 675-76
and, 501-3; structure of, 8-10; two-tiered, Chiyono, 256
527 -28; see also individual canons, fugues choice, 711-14
Cantor, Georg, 20, 216, 418, 421, 422-24 Chopin. Frederic, 70, 257, 677
Cantor set, 142 chords and analogies. 673-74
"Cantorcrostipunctus", 424 chromosomes, homologous, 668
Capitalized Essences, 29 chunked versions of this book: jacket, vi-vi~ viii-
car radio, 670-71 xiii. 370, 758-77
cardinality, intuitive sense of, 567 chunking: ant colonies and, 326-27; brains and,
Carroll, John B., 630 381-84,559; computer languages and, 290-92,
Carroll, Lewis, 20, 28, 46, 192, 372, 681; material 381,412-13; defined, 285-88; determinism and.
by, 43-45, 366-68 306-8, 363, 522; of DNA, 531-32; intuitive
Carroll paradox: 28, 43-45, 681; evidence ver- world-view and, 305-6, 362-63; of music, 160,
sion, 693-94; message version, 170; problem 164, 525; of one's own brain, 382; probabilistic,
posed by, 46, 181; proof version, 192-93; Sam- 384; scientific explanation and, 305-6; super-
uel's argument and, 68~5; symbolized, 193; conductivity and, 305; trade-offs in, 326; vision
see also infinite regress and,348
cascades, 224, 529, 626, 664 Church, Alonw, 428, 476, 561
caste distribution: encoding of knowledge in, 319, Church-Turing Thesis, 428-29, 552, 561-79; AI
324-28, 359; meaning of, 321-24; updating of. Version, 578-79, 580, 581; Hardy's Version,
318-19, 324 566; Isomorphism Version, 567-68; Micro-
catalogues of programs (Blue, Green, Red), 419, scopic Version, 572; Public-Processes Version,
427-28 562,568, 574, 580; Reductionist's Version, 572,
catalysts, 528-29 574; Soulist's Version, 574; Standard Version,
cats, 313, 343-46. 532 561-62, 579; Tautological Version, 561; The-
causality, types of, 709-10 odore Roszak Version, 574-75; unprovability
CCrab, see AITACCA of,562
ceilings, see loops, bounded; BlooP Church's Theorem, 560-61,574,579-81,609, 697
celestial mechanics, 353-54 cigars, 199, 201, 383, 481, 651
CElls (BlooP), 410-11 classes vs. instances, 351-55, 360-61; see also pro-
cellular processes. as models for AI, 663-64 totypes, intensionality and extensionality, analo-
Central Crabmap, 667 gies, conceptual skeletons, etc.
Central Dogma: of Mathematical Logic, 271, codes: art and, 703-4; familiar and unfamiliar,
532-34; of the MIU-system, 513; of Molecular 82, 158, 267; see also decoding, GOOel Code,
Biology. 504-5, 514, 532-34, 536, 667; of Ty- Genetic Code, etc.
pogenetics, 513; of Zen strings, 238, 239, 240, "coding" of sentences, 583-84
243 codons, 519-20, 524, 533, 535; see also GOOei
Central Dogmap. 532-34. 545, 547, 672, 709 codons, duplets
Central Pipemap, 701-2 Colby, K., 599
central processing unit, 288, 289 columns in brain. 346
Central Proposition, 264, 269 Comenius, Johann Amos, 625
Central Slothmap, 702 comments in programs, 297
Central Xmaps. 702, 716; see also individual en- Common Sense (Magritte), 700-1
tries common sense and programs, 301
centrality, 374-75 communicability of algorithms, 562
centromere, 668 commutativity, 55-56, 209, 225-27, 453, 639
cerebellum. 341 compelling inner logic, 161-62, 163-64
Chadwick, John. 50 competing theories, and nature of evidence, 695
chain letters, 546 compiler languages, 292-95
Champernowne, David, 595 compilers, 292-95, 297, 503
Champollion, Jean Fran~ois, 165 compiling, reverse of, 381
channeling, 299, 376-77 Complete List of All Great Mathematicians, see
chaos in number theory, 137-38, 152, 557; see also List
order and chaos completeness, 100-2, 417-18, 422, 465; see also
chauvinism, 171-73 incompleteness, consistency
checkers programs, 573. 604-5 complexity of world, 569
Chekhov, Anton, 642 composite numbers, 64, 65~, 73; see also prime
chess: chunking and, 28~7, 604; grand masters numbers
in, 286-87; round-the-house. 595; self-modify- compound sentences, in TNT, 214
ing, 687-88 compound words, 665
chess boards, hierarchy of, 687 computer chess, see chess programs
chess players, cycle of, 94-95 computer languages: analogues in cell, 547; di-
chess programs: Babbage and. 25, 729-31, 736; alects of, 503; flexibility and, 298-99; high-
choice and, 711-12; Crab and, 721, 729-31; dif- level, 292-93, 297-300; message-passing,
ficulty of, 151-52, 605; jumping out of the sys- 662-63; power of, 299, 428-29; presented,
tem and, 37-38, 678; knowledge representation 289-99,406-30,498-99; in SHRDLU, 629-32
Index 761
computer systems, 287-302 200-1, 204, 507; hikes and plays flute, 549-58;
computers: assembled by computers, 504, 684; intelligence of, 549, 558, 733; jukebox of,
crying, 675-76; determinism and, 25-27, 154-57; meets Achilles, 200; musical evening
306-7, 684--86; fallibility of, 575, 578, 678; chez, 720-42; origin of, 666-68; plight of, 281,
learning by, 603-5; origins of, 24-26; in pho- 383--84; questionable behavior of, 560, 562,
nographs, 78, 484, 486--88; see also programs, 573-74, 579--81; receives presents and enter-
AI, AI programs tains guests, 275--84, 311-36; subjunctive after-
concept network. 651-54; see also semantic net- noon chez, 633-40; Theme of, 729, 732, 740,
works 742; vs. Tortoise, 75-78, 406, 483--88, 540, 543
conceptual dimensions, 670-71 Crab Canon (Bach), 202-3, 666
conceptual mapping, 668-72 Crab Canon (Dialogue), 204, 355-56, 665-69, 672,
conceptual nearness, 371-73, 614, 651-56 723-25,738
conceptual revolutions, 660-61, 673 Crab Canon (Escher), 198-99, 667
conceptual skeletons, 381, 514, 666-72, 674 crab canons, 9, 198-203, 204, 355, 501, 665-69;
connotations and culture, 372-73, 379--80 in DNA, 200-1
consciousness: causality and, 709-10; source of, crab programs, 500-1
384--85, 387--88; understanding of, 82, 680, creativity, mechanizability of, 25, 26, 571. 620,
708-10 673; see also originality, paradox of AI, non-
conservation of complexity, 60, 195 programmability, etc.
consistency: defined, 94; of extended TNT, 223, Crick, Francis, 505, 532, 533, 534, 617
459; hypothetical worlds and, 95-100; inter- Crime and Punishment (Dostoevsky), 379--80
pretations and, 88, 94-101; Lucas and, 477; Cristofori, Bartolommeo, 3
oath of, in TNT, 450; proofs of, 23-24, 191-92, critical mass, 228, 317, 389, 417, 470
229-30, 449-50; of Propositional Calculus, crossing-over, 665-68
191-92,229; of TNT, 229-30, 449-50; varieties crystal in magnetic field, 140-43
of, 94-96; see also w-consistency crystallization metaphor, 347
constants, parameters, variables, 643-44, 669 CT-Thesis, see Church-Turing Thesis
context: necessity of, 161-64, 173-76; restoring of, Cube with Magic Ribbons (Escher), 281--82
115-16, 128, 133, 161-64, 173-76 cursively drawable figures, 67-68, 72
context-free sums, 520-22 cytoplasm, 517, 518, 522-24
contexts, nested, 643-46, 672, 674 cytosine, see nucleotides
continued fractions, 140, 277, 563, 565
continuous vs. discrete processes, 598
Contracrostipunctus, discussed, 82--85, 267, 270-71, da Vinci, Leonardo, 641
406-7, 424,i467-70, 483--84, 534-37, 608, 721 Dali, Salvador, 700
contradictions: between levels, see level-conflicts; Dase, Johann Martin Zacharias, 567
caused by impossible cycles, 94-96; coexisting data base, 618
in same brain, 383, 697-98; diagonal argument daughter programs, 503, 546
and, 420-22; in mathematics, 17-24, 196-97, David, Hans Theodore, 3, 28, 719
223, 580--81; w-consistency and, 453; personal Day and Night (Escher), 252, 255, 667
nonexistence and, 698; in pq-system, 87, 88; in Dboups, Hfpsh, 515, 533
Propositional Calculus, 191-92, 196-97; in self- De Chirico, Giorgio, 700
image, 696; Tortoise's shell and, 177--80; two De Morgan, Augustus, 20, 404, 600
levels of, 581, 584; visual, 97-99; Zen and, 99, decidable strings, 417
235, 246-56, 698; see also paradoxes, inconsis- decimal system, 262-64, 269
tency, Epimenides paradox, etc. decipherment of texts, 50, 164-65, 173-74, 583
Contrafactus, 641, 643, 669 decision procedures: for alienness, 487--88,
Convex and Concave (Escher), 105-9, 348 540-41; for axiomhood, 41, 48, 470; for beauty,
Cooper pairs, 304-5 552-58, 560, 579, 581--82, 583--84; as BlooP
copies: canons and, 8-9, 527-28; in code, 517, puzzles, 415-17; for Buddha-nature, 234, 239,
527-28; complementary to originals, 70, 501, 272; defined, 39-41; for Diophantine equations,
506-7, 517, see also inversion; DNA and, 559-60; for dreamable themes, 384; for end of
529-31; inexact, 500-3, 546; nature of, 146-49; Dialogue, 402-3; for genuineness of koans,
self-reps and, 500-4, 512-13; television and, 234,239; for Goldbach property, 400,414; for
489; viruses and, 542-43; visually nested, Granny, 344-45, 347-48; for halting, 425-29;
138-40; see also sameness, isomorphisms for intelligence, see Turing test; for Mozart
copper, 173 pieces, 649; no guarantee of existence of, 72;
Cops Silva and Gould, 405 for number-theoretic truths, 228-29, 426,
Copy mode (Typogenetics), 506--8 551-58, 560, 573-74, 579--81; for primality, 64,
cortex: areas of, 344; cerebral, 340-48; visual, 149, 413; for proof-pair-ness, 416, 439-41; for
343-48 sameness, 146-49, 158-59; for sorting numbers
counterfactual parameters, 639 into two classes, see Church-Turing Thesis; for
counterfactuals, 634-40, 641-44 termination, 425-29; for "the Way" in Zen,
counterpoint, see canons, fugues, Bach, etc. 250-51, 253, 254; for theoremhood, 39-41,
counting, 55-57, 228, 364 47-49, 72-73, 190-91, 408, 416, 560, 579--80,
court system, 692, 693 582; for theorem-numbers, 440-41, 580; top-
covalent bonds. 514 down vs. bottom-up, 48-49; for Tortoise-pair-
cows, 312, 346, 351 ness, 441; for Tortoise property, 396-97, 415,
CPU, see central processing unit 441; for truth, 213, 228-29, 417, 552-58,
Crab: entertains Achilles, 480-94; genes of, 560-61, 579, 581; for validity of derivations,
762 Index
194,416,439-41, 470; for well-formedness, 182, DNA polymerase, 530, 531
269, 416, 582; for wondrousness, 402, 425 DNA Rapid Transit Service, 505, 517
decoding: of DNA, 159-62, 175-76, 201, 231, Doctor program, 599-600, 608
531-32, 538; of formal systems, 50-51, 54; of dog-and-bone problem, 611-13
fortune, 154; via GOOei isomorphism, 267; of .doGma I, .doGma II, 532-33
nature, 409; of records, 154-57, 158-59, dogs, 233, 234, 354, 383, 569, 570, 611-12, 679
161~, 172, 174-75; as revelation, 160-61; of Doko, 250, 698
Russian text, 380; see also isomorphisms, transla- Dostoevsky, Feodor, 379--80
tion, information, chunking double negation, 183, 545, 554
decoding mechanisms: complexity of, 158-62, Double Nodulation, law of, 243
172-76, 582--84; innate, 170-71; nature of, Dragon (Escher), 473-74, 524, 698
158-76; record players as, 83, 154-57; trans- Drawing Hands (Escher), 15, 21, 133, 689-92, 710,
parency of, 267, 501; for Tripitaka, 257; see also 716, 737
isomorphisms, etc. dreams, 378, 379, 384, 725
Deduction Theorem, 186 Dreyfus, Hubert, 574
default options, 352-53, 386, 411, 645, 674 dualism, 251-55, 698-99; see also subject vs. object
defects and expectations, 77, 86, 102, 222, 476 Dumpty, H., 332
demi-doublets, 633-34, 669 duplets (Typogenetics), 510, 512
demons, 663~ Dvorak, Antonin, 163
deoxyribonucleic acid, see DNA
derivations: alleged, 439-40; defined, 35-36; fal- E. coli bacterium, 176, 537-41
lacious, 220, 439; in MIU-system, 35-36, 262, Earrwig, Dr. Tony, 586-93, 627
264, 439; in Propositional Calculus, 184, 185, earth chauvinism, 171-72
188, 189-90, 196; supernatural, 454-55; in Earth-Moon-Sun system, 353-54
TNT, 217, 218, 219,224-27,269; in tq-system, earthworm(s), 341-42
65; in Typogenetics, 507, 509; vs. proofs, Eccles, John, 574
35-36, 193-94, 195 Edifying Tlwughts of a Tobacco Smoker (Bach), 482
Descartes, Rene, 263, 340, 677 Edifying Thoughts of a Tobacco Smoker (Dialogue),
description-schemas, 650; see also templates 543
descriptions: calculus of, 338; restructuring of, eggs, 192, 360, 383
649-53, 659-61, 672; tentative, 646-49 Einstein, Albert, 100
descriptors, 647 electrons, 140-46, 258, 303-5
detachment, rule of, 185--86, 577 ELIZA, see Doctor program
determinism, 54; see also free will embedding of formal systems, 97, 207, 215
Devil,685 emergent phenomena, 708-9, 714
Dewdrop (Escher), 249, 256 emotions: brains and, 83; counterfeit, 599-600;
Di of Antus, 333 dependence of intelligence upon, 573, 597-98;
diagonal method, Cantor's, 418-24, 426, 427-29, as epiphenomena, 677; music and, 83, 160,
438, 446, 469 163~, 174-75,383--84,626-27, 676-77,699;
Diagram G, 135-37 potential, 281, 383--84, 583; programs and, 573,
dialogicians, 81 597-600, 626-27, 675-77; universality of, 163,
dialogues, miniature, 191-92, 193, 408-9, 431, 174-75
560, 565, 595-96, 598, 599 emulation, 295
Dialogues: origin of, 28, 665-69; as self-refs, Endlessly Rising Canon (Bach), 10-11, 15,46, 130,
84--85, 129, 204, 502-3, 667, 738-39 717-19,742
Dickens, Charles, 326, 328, 380 ENIUQ (procedure), 498-99
Difference Engine, 25 enlightenment, 232, 237, 243, 246, 251, 254-55,
differentiation, cellular, 543-46 479, 567
digestion, 306 Enlightenment 'Yond Enlightenment, 237, 239,
digits, shunting of, 264 243,244
Diophantine equations, 279, 459-60 Eno, 232, 252
Diophantus of Alexandria, 275 enzymes: function of, 520-22, 528-30, 543-45; as
directory of real numbers, 421-24 models for AI, 663~; rules of inference and,
disambiguation, 586-93, 603, 629-32 509-10, 513, 531; structure of, 519-21, 525; syn-
distance to goal, 611-13 thesis of, 517-19,522-25,527-29,538-45,547;
divisor-freeness, 74 versatility of, 529; vs. typoenzymes, 529; See also
djinns, 113-15, 216-17, 223, 224; see also Genie proteins, typoenzymes
DNA: as aperiodic crystal, 167; as carrier of ge- epigenesis, 159-60, 161-62, 531-32, 665
netic information, 159; compared to computer Epimenides, picture of, 496
languages, 290-91; composition and structure Epimenides paradox: connection with GOOeI's
of, 514-15; covalent backbone of, 514-15; as Theorem, 17-18; Escher and, 716; expanded
declarative knowledge, 616-17; double strands, version, 21, 22; fear of, 23; French-English ver-
514-15, 530-31; isomorphism with organism, sion, 501; indirect recursion and, 134; molecu-
146-48; mode of self-replication, 529-30; in lar version, 536-37; neural version, 584--85;
outer space, 167, 175-76; as program, language, Quine version, 431-37, 445,446, 449, 497-99,
data, 290-91, 547; quining and, 531; recombi- 531, 537; subtlety of, 495-98; Tarski version,
nant, 665; relation to mRNA, 517; self-destroy- 580--81, 584--85; two levels of, 581, 584--85;
ing, 536; unusual interpretation of, 231 Whitely'S version, 476-77
DNA endonuclease, 530, 531 epiphenpmena, 308-9, 363, 577, 596, 677-79
DNA ligase, 530, 531 errors in programs, 295, 297-98, 596
Index 763
Escher. Maurits Camelis: Bach and. 201. ~7; flags. 29-32. 188
contradictions and. 97-99; copies and. 146-48; flashcards. see tRNA
drawings of. see list of IUustrations (xiv-Viii); flat vs. spatial. see 2-D vs. 3-D
figure and ground in. 67~; flat vs. spatial flattened look-ahead. 604-5
and. 473-74. 689; incompleteness and. 716-17; flattened rules of inference. see theorems vs. rules
Magritte and. 480; as prime mover. 689-92. flexibility and inflexibility. 26-27. 296-302.
710; on subbrains. 387; Strange Loops and. 611-14. 657. 673-75. 686
10-15. 737; Zen and. 255-57 flights of fancy. 378
Escherization. repeatability of. 473-74. 689; see FlooP. 406. 424-30. 567-68; fed into itself.
also 2-D vs. 3-D. GOOelization 425-26; power of. 428-29. 561-62
ESP. 598-99. 693-95 fluency. 376-77
essential incompleteness: of Achilles' birthday. flutes. 3-5. 27. 528. 552 -58. 720. 726
462-64. 475-76. 688; of AI. see Tesler's The- F(n) and M(n). 137. 142. 359
orem; of list of reals. 423-24. 469; of phono- focusing. 657-59
graphs. see TOdelization; of self-engulfing folding-up of enzymes. 511-12. 519. 521. 525
process. 493; of TNT and related systems. football. 44. 303. 353. 634-40. 643. 644. 645. 672
46S-71; see also GOdelization. TOdelization. footraces. 29-32. 43. 594-95. 681-83
Escherization. nonprogrammability. etc. forced matching. 670-72
Eta Oin. 586-93. 674 forgetting. 577. 578. 619
ETAOIN SHRDLU. 628. 630 Forkel. Johann Nikolaus. 4. 86
Euclid. 19. 43. 58-60. 88-89. 216 form. 47. 66-67. 68. 73. 190-91.370-71; syntactic
Euclid's prime numher Theorem. 35. 58-60. 228 vs. semantic. 581-84. 631
Euler. Leonhard. 3. 394 form and content. 84-85. 204. 279. 581-84.
Euwe. Max. 605 667-68. 740
evidence. nature of. 633-36 formal systems. presentations of: C-system.
evolution. 321-22 64-65; MIU-system. 33-41; P-system. 73-74;
existential quantifiers. see quantifiers pq-system. 46-60; Propositional Calculus.
exotic styles of thought. 552. 563-64. 566-67 181-97; TNT. 204-30; tq-system. 64-65; Ty-
expanding nodes. 134-36 pogenetics. 504-13
explanatory power on high level. 321. 326. 707-10 formal systems vs. reality. 53-58
expressibility and expressive power. 101. 417. formal vs. informal reasoning. 193-97. 228-29.
441-43. 444-45. 450. 454. 465-70. 580-81 271-72.449-50. 614-15. 618-19
extrasensory perception. see ESP formal vs. informal systems. 26-27. 559-85. 598.
extraterrestrial intelligence. 162-64. 167. 172-76. 684-86; see also brains. minds. etc.
341. 646. 661-62 formalist philosophy of mathematics. 458
eyes. 237. 248. 260. 308. 311. 313. 477. 633. 715 formula: closed. see sentence; open. 207-8
formulas of TNT. 206. 207-15
Fair Captive. The (Magritte). 489 Four-color Theorem. parodied. 550
FANCY NOUN. 132-34 4-D space. 638-39
Fantasia and Fugue in G minor (Bach). 719 four-postulate geometry. see geometry. absolute
fantasy rule. 183-85. 187 4'))" (Cage). 156
faucet. mental. 364-65 Fourmi. Lierre de. 333-34
faultlessly functioning machines. 575-78 frame effect, 704
Faure. Gabriel. 163 frame messages. 162. 166-67. 176
feedback and feedforward. 544-45 frames. 373. 644-46. 662-63. 672
Fermant. Johant Sebastiant. 332-35 framing devices. 478
Fermant's Last Fugue. 335 Frank. Philipp. 642
Fermat. Pierre de. 275-77. 278; confused with Frederick the Great. King of Prussia. 3-8. 27.
Bach. 331-35 394. 729
fermatas. 275. 329. 332. 333 free will. 388. 680. 708. 710-14. 720-16. 734-35.
Fermat's Last Theorem: 275-79. 332.416; coun- 739; see also jumping out of the system
terexample to. 277. 279. 460; inverted. 333-34; Frege. Gottlob. 20
parodied. 335. 551; proof of. 277. 279.460 French fries. 636-38. 683
Feynman diagrams. 144-46 French Suite no. 5. Gigue (Bach). 130
Fibonacci (Leonardo of Pisa). 136. 246 frequencies. of words and letters. 377. 630
Fibonacci sequence. 136. 138. 139. 152. 173-74. friend. mental model of. 386-87
265.416 fringe science. 693-94
fiddles. see violins fugues. 335. 634. 730. 736; in the An of the Fugue.
fifth postulate (Euclid). 90-93. 222. 451-52 79-81. 86; devices in. 314. 322-23. 329-30.
50 (fifty). 338. 557. 564 737-40; Dialogues and. 28; in the Musical Offer-
figure and ground: 61-63. 64-74. 731; in music. ing. 4-9; nature of. 9. 281-84. 737
70-71 Fundamental Facts 1 and 2. 440-42
FIGURE.-FIGURE figure (Kim). 68-70. 73 fundamental jukebox-axiom. 155
filters: for abstraction. 286. 407-9. 648. 657-60. funneling. 346-48
663. 673; for Pools. 418. 427
finitistic methods of reasoning. 24. 230 G (GOOeI's string). 18. 271-72. 285. 447-55.
Fishes and Scales (Escher). 146-47 459-60. 502. 580. 608. 667. 707-8
fission and fusion (of concepts). 338. 352-56. 438. G', G", G'" J Gcu, 466-68
764 Index
games played by AI programs, 601 Goldbach. Christian. 394. 395
Ganoo, 189-90, 256, 407 Goldbach Conjecture. 394-96. 400. 404, 557-58.
gases and molecules, 307--8, 317, 693 615; parodied. 551
Gatele5s Gat., see MumonJran Goldbach property. 395-97. 400. 414. 418
Gauss, Karl Friedrich, 92, 100 Goldbach Variation. 395-98. 400. 426, 441
Gebstadter. Egbert B., 94-95. 402-3. 484 Goldberg. Johann Theophilus. 391-92
Gelemter. E.. 606-7 Goldberg Variations (Bach). 392-93. 395
general recursivity. 406. 430. 470 Goodfortune. Hexachlorophene J.. 103-4. 115.
genes. 200-1. 507. 512. 524-25. 531. 544-45.668 128-29. 130
Genetic Code. 160.519-20. 522-24, 533-34. 536. Goso,248
538; origins of. 231. 548 Gplot. 138. 140-43. 146-47. 159. 503, 661
genetics. 504-48 grammar: for computer languages. 297. 408-15;
Genie. Meta-Genie. etc . 109-16.216-17.223.224. for Feynman diagrams. 142. 145; high-level.
610; see also djinns 625-27; for koans. 625--26; for music. 626-27;
genie. symbol-manipulating. 39-40. 48 for natural languages. 130-34, 150. 363.
genotype and phenotype, 159~2. 167. 173-74. 588-93. 619--21. 630-32; for thought. 627
175-76.295. 531-32. 667~ Grand Tortue. 237. 243-44
Gentzen. Gerhard. 195 grandmother cell. 344. 345
Geometric Code. 235-37. 241. 626 grandmothers. perception of. 344. 345. 347-48.
geometry: absolute. 91. 93. 97. 222. 407. 451-52; 349
eUiptical. 93; Euclidean. 19-20. 88-92. 100.222. graphics. 728
451.456. 606-7; non-Euclidean. 19-20. 91-93. grass roolS. 693
98-99. 100. 222-23. 451. 455-56; "true" version Great Tutor. 237. 239. 244
of. 88-94. 99-100. 456-57 Green Programs. 427
German professor. proverbial. 130-31 Gremdiag [Nl. 427
Giant Electronic Brains, 25. 601 Grelling's paradox. 20--21. 22
glia. 339 Groot. Adriaan de. 286
GlooP. 406. 428-29 grounds. excellent. 731
G(n).137 guanine. see nucleotides
goals and subgoals. 227. 589. 590-91. 609--14. guaranteed termination. 41. 396--98. 399. 403
618-19. 629. 632 guitars. 62. 200
Goblet G. 79. 81. 83--85. 267 gullibility. 75-76. 106. 309. 461. 600. 701
God. 216. 400. 478. 482. 533. 567. 597. 711; pic- Gutei. 237
ture of. 142-43 GOO25. white stony. 626
GOD (acronym). 110-15. 133. 134. 216. 223. 224.
722; see also djinns. Genie HACKER. 664
GOOel. Kurt. 15-19. 24. 28. 738. 740. 742 haiku. 153-54. 525. 619-20
GOOei Code. 18. 268. 533-35 halting problem. 74. 425-29. 594. 697
GOOei codons. 268. 425. 533-35 hamburger-confusion. 577
GOOei isomorphism. 261-71. 439. 442-46. Hammurabi. 169
738-39; likened to reflection of world in brain. Hardy. Godfrey Harold. 562~
502.570 hannonic tension. 122-23; see also tension and res-
GOOel-numbering. 18. 438. 738-39; of FlooP pro- olution
grams. 425-26. 502; of MIU-system. 261~; of harpsichords. 3. 391. 502
TNT. 268-70. 579 Harrison. Lawrence. 657
GOOei questions. Lucas on. 389. 390 Haussmann. Elias Gottlieb. 2
GOOelization. 270; programmabilitv. of. 471-73; HE-HE puzzle. 62~3. 669
repeatability of. 424. 465--76. 688; see also headache. 62~3
Escherization. TOdelization. jumping out 'ot hearing by computer. 602
the system "heart". in an AI program. 679
GOOelizing operator. 472-73. 475-76. 543 Heisenberg uncertainty principle. 455. 698
GOOeI's argument. summarized. 18. 272. 448 Helen of Troy. 110
GOOeI's article. 17. 24. 438 hemiolia. 257. 519
GOOeI's construction. illustrated. 84 hemispheres. 257. 340-41
GOOel's method. underlying causes of. 204. 407. Henkin. Leon. 541
465.468-71 Henkin sentences. 541-53. 709; explicit and im-
GOOeI's Second Theorem. 230. 449-50. 696 plicit versions. 542-43
GOOeI's Theorem: AI and. 388-90. 471-77. Henkin's Theorem. 488
706-7. 714; analogue of in molecular biology. hereditary arguments. 36. 47-48. 217. 261
534. 536-37; brief mentions. 72. 74. 78. 100. heterarchies. 134. 359. 534. 651-54. 662. 691
486; consequences of. 450~0. 469-76; Con- heterological adjectives.20-21. 22
tracrostipunctus and. see Contracrostipunctus; Di- heuristics. 587. 588. 590. 603. 629
ophantine equations and. 45~0; LISP and. Hewitt, Carl. 662
738-39; proof of. 18. 265-72. 438-49; stated. hiccups. 116. 254. 255. 673. 725-26. 736
17. 101, 272 hierarchy of variability. 643-45. 669
GOOeI's Theorems and human introspection. 450. high-fidelity vs. low-fidelity. 77. 85. 101, 406-7.
696-98 470.697-98
Goffman. Erving. 478 high-level explanatory power. 707-9
gold. 173 Hilbert. David. 20. 23-24. 230. 459--60
Gold Box. Very Asian. 404-5 Hilbert's program. 23-24. 229--30
Index 765
Hilbert's tenth problem. 459-00 infinite regress. 111-13. 142. 146. 152. 231.
H(n).137 388-89. 426. 497. 738; in CarroU paradox.
Hofstadter. D. R.. 75. 310. 724. 728. 742 43-45. 170. 192-93. 684-86. 693-94; halted.
Hofstadter's Law. 152 127. 133-35. 170. 605. 684-86; of objectivity.
Hogen. 248 479; leno and. 31-32. 610; see also CarroU para-
holes in formalized systems. 24. 26.449. 451. 465, dox. bottoming out. recursive acronyms. re-
468.470-71 peatability. etc.
holism: defined. 254. 312; vs. reductionism. 284, infinite sentence. 497
311-36. 389-90. 708-9; Zen and. 254 infinite sky. 401
Hubel. David. 341. 343 infinitesimals and nonstandard analysis. 455
Human Condition I. The (Magritte). 705-6 infinity: Bach and. 10. 719; Escher and. 15; han-
Hyakujo. 254 dled finitely. 59-60. 221-25. 461-64. 468; iUus-
hydrogen bonds. 516. 522. 525 trated. 135-36. 138-43; names of. 475--76;
hyphen-strings. 47. 64-65. 66 supernaturais and. 454; types of. 421; see also
hypothetical worlds. 95-100. 338. 360-62. non termination. infinite regress. recursion. etc.
634-40. 641-44; grounded ness in reality. 362, informal systems. see formal vs. informal systems
378-79 information: accessibility of. see inaccessibility; cre-
hypothetica1s. 44-45. 634-40 ation of. 513; depth from surface. 234-35.409.
427. 549--58. 606-7. 612-13. 628. 673. see also
i.454 decoding; discardable. 649. 653. 657-59.
I. 454 669--72; flow of. 513. 533. 545. 547; irrelevant.
"I". referent of. 608 560
"I Can Be Played (Proven. etc.) ...... 488. 541 information-bearers. 158. 166. 167
"I Cannot Be Played (Proven. etc.)...... 76--77. 85. information-revealers. 158. 267
406-7. 448. 465-67. 536. 541. 608 inhibition. ceUular. 544
l-counts. 260-61 inner messages. 166--71. 174-76. 501. 524
I-level. see inviolate level input-output devices. 288
I-mode. see InteUigent mode input parameters (BlooP). 411
iceberg. 495-96. 497 insight. 613. 660-61. 665-76
ideal numbers. 56--58 instant replays. straight and subjunctive. 634-40.
identification with artifacts. 609. 713-14 641.672
idiots savants. 566-67 instructions: in machine language. 289--95; vs.
IF-statements (BlooP). 411-12 templates. 497-99. 531. see also programs vs.
images: blurry. 686--87; of thought. 623 data
"Imaginary Landscape no. 4" (Cage). 163-64. 699 INT(x). 138-41. 146. 661
imitation game. see Turing test inteUigence: accidental inexplicability of. 707; es-
Immunity Theorem. 536 sential abilities for. 26; extraterrestrial. see ex-
implicit characterization. 41. 67. 72-73. 93 traterrestrial intelligence; liftability of. see
improvisation vs. introspection. 739 skimming off; limits of. 475-76. 679-80; neces-
inaccessibility of lower levels to hight"r levels. sary underpinning of. 324; simplicity of.
686-92. 706--10; in Aunt Hillary. 330-31. 630; 172-73; subtle features of. 566; tangled recur-
in brains/minds. 302.328-29. 362-65. 619. 677. sion and. 152; typical abilities of. 559; univer-
686-92. 697. 706-10. 739; in programs. 296. sality of. and intrinsic meaning. 158. 162-64.
300-1. 588. 630. 679; see also software and 170-76. 501. 661-62; see also brains. minds. AI.
hardware. introspection. level-confticts etc.
incompleteness: Bach and. 86; of brains. 585; de- InteUigent mode. 38-39. 65. 193-94. 613-14
fined. 86; Escher and. 716-17; of extensions of intensionality and extensionality. 337-39. 350.
TNT. 465--71; of formal arithmetics. 18. 86. 361-62
101-2. 407. 618-19; of list of mathematicians. intentions of machines. 684-85
422; of list of reals. 421-24; of Lucas. 477; of interestingness. programmed. 615
phonographs. see record players. intrinsic vul- interpretation-conventions. 687-88
nerability of; of Principia Mathematica. 18. 24. interpretations: adjusted to avoid inconsistency.
61S-19; of self-knowledge. 696-98; of TNT. 87-88. 453. 456. see also undefined tenns; mul-
271-72. 430. 450-51; see also essential in- tiple. 94-102. 153-57. 266-67. 271. 447-48; of
completeness. w-incompleteness. etc. pq-system. 49--53. 87-88. 101-2. 158; of Propo-
inconsistency: defined. 94; with external world. sitional Cakulus. 186-87. 189. 191-92; of
87-88. 95; internal. 87. 88. 94-96; of people. strands. 509-10; of TNT. 205-9. 266-67. 453.
197.697-98; of Tortoise. 177-80; see also consis- 533; of tq-system. C-system. P-system. 64-65.
tency. contradictions. w-inconsistency. Zen 73-74
increasing and decreasing rules. 73. 74. 260-61. interpreters: mechanisms in brain. 582-84; peo-
264. 269. 401-2. 407-8.441; see also lengthen- ple. 293. 297. 524. 671; programs. 293. 504.
ing and shortening rules. chaos in number the- 547. 616. 632. 662. 692
ory intrinsicaUy high-level properties. 707-9
index numbers for programs. 418-20. 427-28 introspection. see self-monitoring. self-awareness.
index triplets for supernaturals. 455 self-knowledge. inaccessibility. TNT. introspec-
India. 549. 551. 557. 562-66 tion of
Indra's Net. 258. 359 intuition. 560. 564. 613. 680. 713; programming
inducers. 545 of. 605. 609
infinite bundle of facts. 397-98 inversion. 8--9. 81. 146. 681-83. 737-38; see also
infinite coincidence. 398. 421 copies. complementary t(' original
766 Index
inviolate level. 686-92 616.619; encoded in ant colonies. 319-28.359;
inationality vs. rationality in brain/mind. 575-78 explicit vs. implicit. 617-18; modularity of.
irregularities. meta-irregularities. etc. 475-76 615-18. 628; procedural vs. declarative. 363-65.
1san.254 615-17. 630. 654;
~. 254-55. 625. 704-6 knowledge transplantation. surgical. 618
isomorphisms: between Bongard problems. 660. koans, 30. 189-91. 233-45. 246-59. 625-26; gen-
669; between brain-struaures and reality. 82. erated by computer. 625-26; genuine vs.
337-39. 350. 502. 569-71; between brains. phony. 234-35. 239. 242. 244. 427. 625-26
369-82; coarse-grained. 147-48. 503; in Cun- Kronecker. Leopold. 216
tracrostipunctu.s. 83-85; between Crab's DNA Kuhn. Thomas. 660
and Crab Canon. 203. 667-68; defined. 9. KupfergOdel. Roman. 394
49-50; between earthworms. 342-43. 345; of Kyogen. 244-45
emotions. 163; exotic. prosaic. 159-60; fluid.
338. 350. 362; between form and content in La Mettrie. Julien Offroy de. 3. 27. 729
Dialogues. 84-85. 128-30. 204. 667-68; be- labeling technique. 487-88. 540-41
tween formal systems and number theory. 408. Lambert. J. H . 91. 92. 99
625; GOdel-numbering and. see GOdel isomor- lamp. meta-lamp. etc . 108-13. 216
phism; between mathematicians. 566; between language(s): acquisition of. 170. 294. 302; aaive
mathematics and reality, 53-60; between mental meanings in. 51-52; Arabic. 623-24; of bees.
processes and programs. 568-73; between 360; of the brain. 570; Chinese. 164. 665. 676;
MIU-system and 310-system. 261-65; between collage of. see scripts; computers and. 130-34.
models of natural numbers. 217; partial. 300-1. 363. 586-93. 599-600. 601-3. 619-32.
146-47. 371-82; as revelations. 159-61. 263; as 674-75. 721; effea on thought. 376-77; Eng-
roots of meaning. 49-53. 87-8. 94. 267. 337. lish. 169.372-73. 377. 379-80. 619-32. 674-75;
350; self-reps and. 501-3; between something flexibility of. 649.674-75; French. 297. 366-68.
and part of itself. 138-43. 146-47; between spi- 372-73. 377. 501. 618; German. 366-68.
derwebs. 371-72; transparent. 82. 158. 267; on 372-73.380. 665; Hebrew. xviii. 377; hierarchy
various levels between same objeas. 369; be- of. 22; imprecise. 674-5; invisible isomorphisms
tween visual apparatuses. 345-46; in visual and. 82; Japanese. 169; as medium for proofs.
processing. 344; see also meaning. translation. 88-90. 195; necessary underpinning of. 324;
copies. decoding. etc. partitions between. 671; procedural grammars
for. 131-34.619-32; reading meaning into com-
':Jabberwocky" (Carroll). 366-68. 372-73 puter-produced. 599-600. 625; on Rosetta
Jacquard loom. 25 stone. 165; Russian. 297. 379-80. 642; self-refs
Jaki. Stanley. 574 in. 431-37. 495-98. 501; see also meaning. trans-
':Jammerwoch. Der". (Carroll-Scott). 366-68 lation. etc.
':Jaseroque. Le" (Carroll-Warrin). 366-68 Lashley. Karl. 342. 343. 348
Jauch. J. M. 408. 409. 478-79 "last step". 462-63. 468
Jefferson. G . 598 lateral geniculate. 343-44
Joan of Arc. 20 layers: of deception. 478; of messages. 166-71.
Johns. Jasper. 703 524. 703-4; of stability. 643-45
Joshu. 233. 237. 238. 240, 253. 259. 272 leakage. between levels of science. 305-6
JOSHU (TNT-string). 443 Legendre. Adrien-Marie. 92
jukeboxes. 154-57. 160-61. 164. 170-71. 174-76. Lehninger. Albert. 504
500 Leibniz. Wilhelm Gottfried. 24-25. 600
jumping out of a subsystem, 477 lemmas. 227
jumping out of the system: in advertisement. 478; Lenat. Douglas. 615
by answer-schemas. 462-64; GOdel's Theorem lengthening and shortening rules: decision proce-
and. see GOdelization. essential incompleteness; dures and. 48-49. 182.407-8; MIU-system and.
illusion of. 478-79. 698; as method to resolve 39-40. 260-61. 264. 613; TNT and. 213. 266.
contradiaions. 196-97; in political systems. 692; 269; see also increasing and decreasing rules.
by programs. 36-38.476-78. 678; from 2-D to problem reduaion
3-D. see 2-D vs. 3-D; Zen and. 255. 479; see also Leonardo of Pisa. see Fibonacci
GOdelization. TOdelization. Escherization. TC- Lennontov. Mikhail. 642
battles. repeatability. nonprogrammability. etc. level-conflicts: in Aunt Hillary. 330. 630; in mind!
brain. 575-78; in messages. 164. 170. 699-704;
Kaiserling. Count. 391-92 between objea language and metalanguage.
Kay. Alan. 662 194. 449-50; in SHRDLU. 630
Kennedy. John F. 641 level-confusion: ants and. see ants vs. ant colonies;
keys. musical. 10. 299. 466. 501; see also modula- in art. see 2-D vs. 3-D; authorship and. 3. 608.
tion 720-26; in computer systems. 287. 291. 295.
Kim. Scott. 68-69. 503. 523. 719 300-2. 308; of Kimian self-rep. 503; minds!
Kirnberger. Johann Philipp. 9. 726 brains and. 287. 575-77; in Propositional Cal-
kitchen sink. the. 315 culus. 185. 194; subjunc-TV and. 608; self and.
Kleene. Stephen C. 476 709
Klein bottle. 691 level-crossing, in thought. 666. 668
Klugel. G. S. 91 level-mixing in genetics. 509-10. 513-14. 546-48
knitting. 149-50 level-shifting. conceptual. see abstraaion. levels of
knots. 341-44. 272. 628 levels: of computer languages. 290-99; distina vs.
knowledge: accessible vs. inaccessible. 362. 365. similar. 285. 287; in Escher. 11-15. 689-91.
Index 767
levels (ctmtinmd) MacLaine. Shirley. 285
715-16; haziness of. 13-15. 546-48. 715-16; in- macroscopic effeas from microscopic causes.
tennediate. 302-3. 317. 324. 532. 632; of irre- 307-8
ality. 243.641; of MU-piaure. 311-13. 328-29. MACSYMA. 615
525-26; of particles. 305; in radio news. 128; of Madstop. 727
reality. 15. 103-25. 128-29. 184-85. 481. 493. magnetic field and crystal. 140-43
640. 725-26. 737. 739; in recursive processes. Magnificat in D (Bach). 549. 552. 558
128-29; of rules in thought. 26-27 Magnificrah. Indeed. 560. 574. 581
levels of description: of ant colonies. 315-33; of Magritte. Rene. 480-81. 489. 493-94. 627. 700-2.
brain. 349-50. 382. 559. 570-77. 584-85; of 705~; paintings by. see List of IUustrations (xiv-
caste distribution. 319-29; of chess boards. xviii)
285~; of errors. 294-95; of gases. 308; of Mahaianobis. P. C. 565
human body. 285; of human psyche. 287; of main theses of book. 26. 46. 559. 714
mental processes. 568-73. 575-78. 584-85; of Majotaur. 119-21. 123-25
programs. 294-95. 380-81; of television screen. malaphors. 657
285; see also holism vs. reduaionism Mandelbrot. Benoit. 71
levels of meaning: in ant colonies. 319-27; in Cun- manifestations of symbols. 351
lTacrostipunctw. 82-85; of DNA. 160. 531-32. Mao Tse-tung. 433
665; in Epimenides paradox. 496. 581. 584-85; mappings: charted. 85. 449. 533. 536; induced.
of groove-patterns. 83-84; of Mumon. 248; of 668~. 671-72
MUMON. 21XH>7; of music. 162~3; of neural mamles. roUing. 711-12
aaivity. 575-77; of TNT-strings. 266. 270-71 Margie-balloon story. 675
levels of struaure: of enzymes. 51O-11. 519. 521. Materialism. champions of. 27. 729
525-27. 532; of music. 525 mathematical logic. history of. 19-24
liar paradox. see Epimenides paradox mathematical view of brains. 559
Liberation (Escher). 57-58. 65 mathematicians. 458-59. 559. 566. 614
lightning calculators. see idiots savants mathematics: done by computers. 573. 602.
limericks. 483. 736 614-15; foundations of. 19-24; reality and.
limitative results. in general. 19. 74. 609.697.699 54-58. 456-59
Lincoln. Abraham. 454 Mathews. Max. 607-8
lines. geometrical. 19-20. 90-93. 100. 222. 452. McCarthy. John. 293
456 McCulloch. Warren. 134
LISP. 293. 381. 626. 652. 692. 738-39 meaning: built on triggering-patterns of symbols.
List of All Great Mathematicians. 404. 422 325. 327. 350; carried only on symbol level.
Little Harmonic Labyrinth (Bach). 121-23. 129. 130 324-27. 330. 350. 709-10. codes and. 82.
Little Harmonic Labyrinlh (Dialogue). 127. 128-30. 158~2. 164~7. 267; of Contracrostipunctus.
149. 216. 610-11 82-85; of DNA. 160. 531-32. 665; explicit vs.
Little Hannonic Labyrinth (of Majotaur). 119-25 implicit. 82-85. 158-76. 495-500. 583; in for-
Littlewood. J. E . 564 mal systems. see interpretations; inteUigence
lizards. 108-9. 1l0. 115-17. 125 and. 158. 162-64. 170-76. 501. 661~2; intrin-
Lobachevskiy. Nikolay. 91 sic. see meaning. explicit vs. implicit; location of.
local vs. global properties. 21. 160. 359. 363. 153-57. 158-76. 408-9. 582-84; as multidimen-
371-75. 543. 582-84. 678 sional cognitive struaure. 582-84; multiple. 8.
localization of knowledge. in brains and pro- 10. 52-53. 82-85. 94-102. 153-57. 158. 172.
grams. 342. 348. 365. 617-18 266~7. 271. 409. 447-48. 524. 532. 666. see
Lockwood. Anna. 700 also disambiguation; in music. 83. 160. 161.
logic. 19-24. 43-45. 99-100. 177-80. 181-97. 162-64.167.172.174-75.227.582-84.626-27.
461-64. 618-19 676-77. 699-700. 704; objeaive. see meaning.
Loocus the Thinker. 477 explicit vs. implicit; as optional high-level fea-
look-ahead trees. 151. 604-5. 611. 712 ture. 571; passive vs. aaive. 51-52. 94. 97. 100.
loops: bounded. 149. 410-14. 418. 440-41. 444; 102. 191-92. 266. 267. 271. 456; purpose and.
free. 149. 424-25; in music. 150; in program- 321-32; rooted in isomorphisms. 49-53.87-88.
ming. 149-50. 410-14. 424-25. 503. 632 94. 267. 337. 350; unnecessary on evolutionary
lottery. 639-40 time scale. 321-22
Lovelace. Lady Ada Augusta. 25. 307. 598 meaningless vs. meaningful interpretations. 51. 88
lower levels. see substrate. mental meaninglessness. in art and music. 699-700.
lowest-level rules embodied in hardware. 685-86 704-5
Lucas. J. R. 388-90. 471-73. 475. 476. 477. 574. meat grinders. 414
577-78. 597 Mechanical mode. 38-39. 65. 194. 221. 613-14
Lucas' argument: counterarguments to. 475-77. mechanization of thought processes. See AI. for-
577-78; merits of. 472; summarized. 471-73 mal systems. etc.
Lucas sequence. 139. 152. 174 meiosis. 665. 672
melodies: recall of. 363-64; time-shared. 385
M-mode. see Mechanical mode memory. in computers. 288-89. 546. 616
MacGillavry. Caroline. 667 memory dump. 381
machine dependence and independence. 294 men vs. women. 477. 595-96
machine language. 289-300. 306. 381. 547 Mendel. Arthur. 3. 28
machines: not the sum of their parts. 389-90; MentLJl Arithmetic (Magritte). 627
reHeaing on themselves. 288-89; self-assem- mention, see use vs. mention
bling. 160. 486. 504. 543. 545 Menzel. Adolph von. 4-5
768 Index
Meredith. Marsha. 625 monkeys. vision of. 345-46
Mergenthaler. Otto. 630 Monod. Jacques. 161
message-passing languages. 662~3 morphogenesis. 539. 543-44
messages. 154. 158-76; in ant colonies. 350; in Mosaic II (Escher). 61~3
bottles. 167~9. 524; layers of. 166-71. 524. mountain-car wreck story. 338-39. 361. 365
703-4; from nature. 408-9; see also frame mes- Mozart. W. A.. 649. 702
sage. inner message. outer message mRNA. 517-20. 522-25. 527-28. 530-33. 536.
messenger. for wans. 235-36. 238 545. 547. 662. 663
messenger RNA. see mRNA MU. as possible theorem of MIU-system. 33-41.
meta. 216-17. 224 229. 25~1. 265~7. 271. 708
meta-agnosticism. 114 MU. Zen word. 233. 241. 246. 254. 259. 272. 311.
meta-analogy. 673-74 312-313. 328
meta-answer-schema. 463 MU-LOOP (FiooP). 424-25. 441
meta-author. 607-9. 726 Mu Offering. A. 272. 628
metabook. 22 mu-operator.424
meta-descriptions. 656-57. 674 MU-piaure. 283-84. 310-13. 327. 328-29.
meta-evidence. etc.. 693-94 525-26
Meta-Genie. see Genie MU-puzzle. 33-41. 259~1. 509-10. 613-14
meta-hiccups. 726 multifurcation of TNT. 467
meta-intuition. 605 multiple representations. 616-18. 670-71. 674
META-JOSHO. etc . 443 multiplication. 54-56. 64~5. 206. 409. 455. 566.
metaknowledge. 364 567
metalanguage. 22. 184. 194. 248. 270. 514 Mumon. 242. 246. 248-49. 253. 259. 260. 272;
metalogic. 23. 676 commentaries by. 246-49. 252; poems by.
metamathematics. 23. 579; reflected inside TNT. 246-49. 252. 272
449--50 MUMON. string of TNT. 265~7. 271. 441-42
Metamorphosis (Escher). 14-15 MumonItan. 246
metaphase.~7 music: composed by computer. 25. 595. 597. 603.
metaphor. 672 607-9. 626-27. 676-77; dimensions of. 175;
meta-proteins. 533-34 mathematics and. 227. 555. 560; modern.
metarules. etc.: in chess. 687-88; in inteUigence. 156-57. 163~. 174-75. 699-700. 704; notation
26-27. 559. 684-85 of. 552-59. see also SMUT; semantics of. 83.
meta-search. 397 162~. 167. 174-75. 582-84. 626-27. 676-77;
meta-symbols. 560 superhuman comprehension of. 172. 679; syn-
metatheorems. 193-94 tax of. 121-23. 129-30. 227. 626-27. 737; to
metatheory. fonnalized. 194 break phonographs by. 75-78; to infiltrate pho-
meta-TNT. etc . 442-43. 533-34 nographs by. 487-88; see also fugues. canons.
meta-wishes. see wishes pianos. flutes. etc.
meteorites. 167. 172 music box. preprogrammed. 677
methylation. 540-41 Musical Offering. Tlui (Bach). 4-10. 86. 665. 666.
metric. mental. 613. 614; see also conceptual near- 719. 720. 724. 727. 739-42
ness mutations. 295
Meyer. Leonard B . 167. 704
Michelangelo. 642
microprogramming. 295 N. see number theory
minds: overlap of. 376; programmability of. 302. Najunamar. Z. 549-52
679. see also AI. paradox of AI. Tesler's The- Nansen. 248-49. 253. 255
orem. non programmability; thoughts and. natural language utterances as programs. 629
369--90; two ways of creating. 390; vs. brains. natural numbers: defined. 54. 204; generalized;
309. 575-77; see also brains. inteUigence. etc. 453-56; postulates for. 216-17; see also number
mini-vocabulary. 647 theory. numerals. TNT. prime numbers. etc.
Minsky. MalVin. 373. 388. 644. 679. 722 near misses, see "ahnost"-situations
mirroring. see isomorphisms. representation nearly decomposable systems. 303~
misspelling and computers. 297-98 negation. 70. 71. 183. 191-92. 21O-11. 214. 545
MIU-numbers. 264~7: See also theorem-numbers negative space. 62~. 66~. 72; see also figure
MIU-system. 33-41. 46. 47. 48. 52. 191. 260~7; and ground
as model for TNT. 439-42. 466; table of rules nested movies. 184-85
of. 260 nested works of art. 15. 106. 700-1. 705~
MIU+MU-system.466 nesting. 127. 138-41. 184-85. 660; see also recur-
Mobius Strip I (Escher). 29-30 sion
Mobius Strip II (Escher). 276 neural networks. see symbols
modes of fugue-listening. 282-84 Neuroneater. 382
modularity. 149-50. 615-18. 628. 677-78; see also neurons: compared with ants. 315. 325. 339-40;
localization. local vs. global properties described. 339-40; Euclids. 60; faultless func-
modulation. 10. 121-23. 129--30. 466. 501. 717. tioning of. 575-77; firing of. 83. 340. 316.
739 343-45. 347. 350. 357; as an inviolate level.
modules in brain. see symbols 302. 677. 686. 691-92. see also inaccessibility;
Modus Ponens. see detachment not controllable consciously. 302. see also inac-
molecular biology. 504. 514-48 cessibility; on-center and off-center. 343-44; in
Mondrian. Piet. 700 retina. 343-44; simple. complex. hypercomplex.
Index 769
neurons (clmlinued) orchard analogy. see information. depth from sur-
344-45.346. 347; as summing inputs. 316. 340. face
575-77. 677 order and chaos: in ant colonies. 316-17; in num-
neurosurgery. 309. 313-14. 618. 678 ber theory. 393. 395.398-402.406. 408-9. 418;
NI!UJ Yorker. Tlui. 641-42 self-awareness and. 406
nickelodeon. 500; see also jukeboxes 0Tder and Chaos (Escher). 399
nodes and links. 370-71. 652-54 ordinals. 462~. 475-76
noise in vacuum. 82 o~ point. 329-30
nondivisibility. 73-74 ongin of life. 548
nonequilibrium thermodynamics. 693 original (as opposed to copies). 504
Noneuclid. 91-92 originality and machines. 25-26. 606-9
nonexistence. 254-55. 698. 725; see also Tumbolia ORNATE NOUN. 131-33
non producible numbers. 265 outcome. 184
non programmability: of creativity. 570-71. 620, outer messages. 166-71. 174-76. 501. 524. 704
673; of emotions and wiD. 677. 684-86; of OUTPUT (BlooP). 410. 41I
GOdelization. 472-76; of inteUigence. 26-27, overlapping genes. 524-25
471-73. 597-99. 601; of irrationality. 575-77; overview capacity. 613-14. 678; see also jumping
of jumping out of the system. 37-38. 477-78. out of the system
674-75; of ordinal names. 476; of soul. 574-75;
of world chess champion. 151-52. 674; see also
people vs. machines. essential incompleteness. P-system. 64. 73-74
Tooelization. paradox of AI. TC-battles. 2-D vs. padding. 402-3
3-0. etc. ~es. in computers. 289
non-self-assembling viruses. 542-43 palindromes. m molecular biology. 201. 667
non-self-descriptive adjectives. see heterological Palindromi. 353-54. 634-37. 643. 644
adjectives Pappus. 606-7
nonsense: based on sense. 378-79; computer-gen- paradigm shifts. 660~1
erated. 620. 621-22. 625-26; human-generated. paradox: of AI. 19. 26-27. 620. 673. see also
621-22 Tesler's Theorem; in art. see Escher. Magritte.
nontermination. 408. 425-30; see also potentially Cage; of credibility through faUibility. 564; of
endless searches. FlooP God and the stone. 478; in mathematics. 17-24.
nontheorems. see theorems vs. nontheorems 580-81; of motion. see Zeno's paradoxes; near
normal science. 66O~1 misses. 612. 691; resolutions of. 1I6. 196-97.
nouns. most common in English. 630 245. see also MU. Tumbolia. jumping out of the
novelty. and jumping out of tbe system. 475 system; of self-consciousness. 389; of the Type-
nuclei: atomic. 303-4; ceDular. 514. 517. 518 less Wish. 115-16; in Zen. 249-55; see also con-
nucleotides. 514-17. 519. 522-24. 530. 540-41; tradictions, inconsistency
first letters of. 231. 517. 666 parallel postulate. see fifth postulate
number theory: applications of. 278-29; core of. PARRY. 300-301. 5~00. 677
100. 407; Crab and. 551-58. 560. 562. 573-74. parsing of natural languages, 588-93. 630-32; see
579-81; demise of. 228-29. 426; formalized. see also grammar. language
TNT; informal (N). 54~0. 204. 228; nonstan- partial recursivity. 430
dard. 100. 452-59; primitive notions of. 204-9; particles. elementary. 54. 140-46. 258. 303-5.
as sealed-off mini-world. 569; soothing powers 309.522
of. 391-404; "true" version of. 458-59; typical partitions. mental. 671
sentences of. 204-5; typographical. see TNT; as parts. 303-5; see also reduaionism
universal mirror of formal systems. 260~5. Pascal. Blaise. 24. 25. 600
270; used and mentioned. 458 pathways: in ATN's and RTNs. 131-34. 150;
numbers. nature of. 54-58.452.458 cbemical. 528-29. 544-45. 663~; conditional
numerals. 205~. 213; vs. numbers. 264 on circumstances. 383-84; goal-oriented choice
of. 227. 609-15; as incorporating knowledge.
objea language. 22. 184. 248 beliefs. 378-79; morphogenetic of T4. 539;
objectivity. quest after. 479. 693-96 plausible vs. implausible. 383; potential. in
Oborin. Lev. 162 brain. 281
oaopus cell. 345 pattern recognition. see Bongard problems. con-
Oin. Eta. see Eta ain ceptual skeletons. vision by computers
Oistrakh. David. 162 patterns on all levels. 674
Okan~. 232. 234. 237. 238. 239. 241. 242 Peano. Giuseppe. 20. 216-17
Old Ba. Ch . 726 Peano arithmetic. 100
Old Bach. 4. 28. 460. 481-83. 738. 739 Peano postulates. 216-17. 224
"'-consistency. 459; see also ",-inconsistency pearl and oyster. 17. 438
",-incompleteness. 221-22. 421. 450-51 Penfield. Wilder. 342-43
",-inconsistency. 17. 223. 453-55. 458-59 Penrose. Roger. 15
1-0 vs. 3-D. 519-21. 616-17 people vs. machines. 25-27. 36-38. 151-52.
open-ended searches. see potentially endless 388-90. 471-73. 475-77. 559~2. 567-75.
searches. nontermination. unprediaable but 577-79. 595-99. 606-9. 621-23. 680. 684-86
guaranteed termination. loops. free. FlooP. etc. peptide bonds. 523
operating systems. 295-96. 300-31, 308 perception: visual. 97-98; and Zen. 251
operators and operons. 544-45 Perfea items. 3. 75-79. 85. 406. 424. 486. 536
oracles. 567 perfea numbers. 416. 418
770 Index
phages. see viruses 211-12. 413. 551-58. 615; differences of. 393.
phenotype. see genotype and phenotype 395-98. 400. 416; sums of. 393-96. 400. 414
</>XI74. 176. 524-25 primitive recursive truths, 407
phonographs. see record players primitive recursivity. 406, 407, 414-20, 422, 424,
phonons. 304 429-30, 440, 441, 444, 451. 466, 472
phorocopy machines. 499 Principia Malhematica, 18-19. 21. 23-24, 228.
photons. 142-46. 258 618-19
physics. laws of: as basis for choosing between Print GaUery (Escher). 15, 714-17
rival mathematical theories. 100. 456-57; as printer of computer. 301. 307
blocking infinite regress. 170. 685; as formal problem reduction, 609-13; self-applied, 613
system. 53-54; inconsistency and. 95-96. 99. problem spaces, representation of. 611-13
584-85; intuitive. 362-63. 711; levels and. procedures, 132-34, 150;-51, 292, 410-15, 418-20,
303-5. 307-8. 693; no escape from. 477. 575; 424-28; chains of, 413-14, 415, 418
Reductionist's Dilemma and. 522. 709; underly- processors (computers). 504, 513. 547; _also cen-
ing consciousness. 575. 685, 710 tral processing unit
1T, 277. 306, 408, 415. 421, 546, 568. 605, 673, producible numbers, 264~5. 269-70
728 program space, 299
Piano postulates. 552-53 programs: in Analytical Engine. 25; in BlooP and
pianos, 3-4, 302. 305, 633-34, 700, 726; inverted, FIooP, 410-15. 424-26; Blue. Green. Red. see
681-83 Blue, Green, Red programs; chess-playing, see
Picltwick Papers, Tlui (Dickens), 24, 326, 595, 598 cbess programs; constructed by programs. 589,
pinball machine, 307 629-32, 664; as data, 293, 692; for determining
PitH Dream, 703 enzyme function, 521-22; for determining phe-
pipes. 480-82, 486, 488, 493-94, 521. 638, 701-3 notype, 532; for determining tertiary structure,
planets and satellites, 353-54 521-22; families of, 503, 546; for generating
PLANNER, 629-32 theorems, 471-73, 578, 615, 617-18; high-level
plurals. 354 comparison of. 380-81; for naming ordinals.
pocket calculators. 568-70. 616. 678. 710 476; recursive structure of. 149-50; second-
pointers in computers. 289-90. 619 order. third-<>rder. etc.. 476; self-modifying.
points (geometrical), 19-20, 90, 92-93. 100, 207, 152, 692; self-reproducing, 498-504, 547; for
222.452.456 translating programs. 291-94; vs. data. 499.
Polanyi. Michael, 574 513, 531. 546-48. 616-17. 630. see also use vs.
polarons. 304-5 mention; vs. programmers. 306.734-37; see also
polypeptides, 523, 525, 528 computers, computer languages. AI programs,
polyribosomes. 526-28 etc.
Pons Asinorum proof. 606-7. 669 Prokofiev. Sergei. 150
Pool B. 418 pronoun reference. 587. 591. 592
Pool F, 427 proof-pairs. 416. 438-43. 446-47. 450-51.
popcorn. 104. 124-25 452-54. 466. 468. 469
popping. 127-35. 184-85 proofs: nature of. 18-24. 58-60, 88-93. 192-97.
popping-tonic. 105-6. 1I6-17 , 125 227-28. 458-59. 578. 707-8; as never absolute.
porridge, 431 191-94; of proofs, 192-93; vs. derivations, 35,
ports of access, 670-71 193,194-95
Post, Emil, 33 prophase, 665-66
post-ending endings, 392, 403 Propositional CalcuIus, 181-97; embedded in
postal system metaphor, 663 TNT, 195, 197, 207, 215-17; as an epi-
postulates of geometry, 90-91, 92-93, 407 phenomenon, 578; interpretations of symbols
potentially endless searches, 396, 400-402, 425, of, 186, 189, 191-92; rules of inference, justi-
400-401. 444. 582-83 fied. 188-89; rules of inference, presented,
pq-system: completeness and consistency of. 101; 181-87; rules of inference. table of. 187;
decision procedure for. 47-49; expressive weak- streamlined. 193-94; variants of, 195; ways to
ness of, 101. 221-22. 407. 417; horse-apple- improve. 193-94; 196-97; weaknesses of.
happy interpretation of. 51. 88. 215; isomor- 195-97. 578; well-formedness in, 181-83
phisms and, 49-53, 158, 625; modified. 87-88, proteins, 517-18. 544-45; as procedural knowl-
92-93, 102; surprise interpretation of, 52-53, edge, 616-17; as programs, data, interpreters,
94 processors, 547; see also enzymes
predicate calculus, 609 prototype principle, 352
predicates, number-theoretical, 208-9 provability, 18, 101
predictable termination, 400, 407, 409-18, 420, Prudence and Imprudence, 191-92, 229
441, 582; see also unpredictable but guaranteed pruning, explicit vs. implicit, 286
termination, terminators pseudo-epigenesis, 531-32
Pu~. 337, 383. 460. 686, 737, 739 psychic powers, 693; see also ESP
preludes and fugues. 280-84. 335; see also Ptolemy V Epiphanes. 165
fugues. WeU-Tempered Clavier Puddle (Escher). 256
premise, 184 puIling-<>ut (mechanisms), see decoding (mech-
preprocessing. 647. 650. 659 anisms)
President v. Supreme Court. 692 punctuation. 33, 268. 440, 510, 512. 520. 524-25
primary structure: of proteins, 519-22; of ty- purines, 506-7, 514, 516. 534; see also nucleotides,
poenzymes. 511. 512 bases. base-pairing
prime numbers. 58-59, ~7. 72-74, 149. purposeful vs. purposeless behavior. 320-22
Index 771
pushcorn, 124-25 recursion: avoidance of infinite regress in, 127,
pushing, 127-34, 184--85 134-35; avoidance of paradox in, 127; defined,
pushing-potion, 105~ 127-29, 131-35; elemen~ry particles and,
Pushkin, Alexander, 124 142-46; fanwy rule and, 184--85; in game-play-
puzzles, 8, 33-35, 62~3, 67, 73, 137, 182, 212, ing programs, 150-51,604-5; indirect, 134, 137;
215, 220, 401, 415-17, 425, 442-43, 444, in language, 130-34, 588, 591, 592; in music,
512-13, 564-565, 609, 621-23, 646~, 689 121-23, 129-30; and unpredi=bility, 152; see
pyramidal family of theorems, 221-25, 450-53 also nesting, levels, distinct vs. similar, level-
pyrimidines, 506-7, 514, 516, 534; see also nu- confusion, etc.
cleotides, bases, base-pairing recursive acronyms, 113, 133, 134-35, 738, 742
Pythagoras, 418, 556-57 recursive diagrams, 135-37
recursive figures, 67-70, 72, 73
Q(n), 137-38, 152, 265,409 recursive formula, of thinking, 560
quantifiers, 207-9, 210, 211-12, 214, 217-19 recursive functions, 136-40, 152, 430, 455; see also
quantum mechanics, 19, 54, 140-46, 350, 455, general recursivity, primitive recursivity, BlooP,
457, 699; see also particles HooP
Quantz, Joachim, 4 recursive graphs, 138-43
quarks, 304, 305, 350 recursive sequences, 135-38, 139
quasi-isomorphisms, see isomorphisms, fluid recursive sets, 72-74, 152, 191
quaternary structure, 525 recursive structure of ideas, 386--87, 560, 621,
Questions and Speculations, 676--80 644-45, 650, 656-57, 669, 671-72
Quine, Willard Van Orman, 435, 446, 449, 699 Recursive Transition Networks, 131-34, 136, 145,
quining, 431-37, 445, 446, 449, 497-99, 531 150,620-21
QUIT (BlooP), 412 recursively enumerable sets, 72-74, 152, 191, 265,
quo~tion,426,431,433-37,496-97, 702, 738 269
quo~tion marks, 33, 434, 498, 499, 702 recursively related notation-systems, 475
Red Programs, 427-28
Rachmaninoff, Sergei, 150 Redding [N], 428, 429
RACRECIR, 738 redness, subjective and objective, 710
radio broadcasts, 128, 163, 169, 353,478, 545, 720 reductionism: defined, 312; proteins and, 520-22;
Ramanujan, Srinivasa, 562~, 614 see also holism vs. reductionism, sealing-off
randomness, 408-9, 620, 673, 712 Reductionist's Dilemma, 522, 709
rational and irrational numbers, 140-42, 418,452, reentrant code, 387
556-57 refrigerators, see record players, low fidelity
rational vs. irrational, in human head, 575-77 registers, in computers, 289
rats in mazes, 342 relativity, 19, 96, 100, 680
Rauschenberg, Robert, 703 Relativity (Escher), 97-98
r.e. sets, see recursively enumerable sets relevant implication, 197
reading frame shift, 154, 525 renormalization, 142-46, 258, 304-5, 309
reality, nature of, 409 repea~bility, see GOdelization, TOdelization, diag-
rearrangement of parts, 78, 333-35, 484; see also onal method, Escherization, TC-batteries, an-
self-assembly swer-schemas
reasoning about formal systems, 38-39, 66, represen~bility, 407, 417-18, 430, 441, 443, 444,
260-72,438-52,465-71, 579--81 451, 466, 468, 579--80
reasoning by programs, 569-70, 577-78, 586-93, represen~tion of knowledge: in AI, 569, 615-21,
606-7, 609-11, 614-15, 618-19, 628-32 626-32, 641-59, 664~5, 668-72; in brains, see
recognition: molecular, 540-41; visual, 346-48, symbols, localization
646~2; vs. production, 648-49 repressors, 544-45
recognizable forms, 68 Reptiks (Escher), 116-17
recombination, 657, 665~9 Requirement of Formality, 33, 52, 65
record players: alien-rejecting, 487--88; Epsi1on- retrogression, 8-9, 81, 146, 200, 208, 500-501,
Zero, 486; family of, in Crab's jukebox, 154-57; 549, 666-68, 723-25, 737-38
Grand Self-assembling, see record player Ep- return addresses, 128, 133
silon-Zero; as information-revealers, 15~1, revelation, 160~1, 175
164; intrinsic vulnerability of, 75-78, 102, 424, ribo, some, 236
470, 483--86, 536, 543, 584, 721, see also ribonucleic acid, see mRNA, rRNA, tRNA
TOdelization, TC-battles, etc.; likened to formal ribosomal RNA, see rRNA
systems, 84, 85; low-fidelity, 77, 85, 101,406-7, ribosomes: as models for AI, 662, 663; molecular
470; Omega, 78, 468, 483--84; Numbers 1, 2 ... canons and, 527-28; need for in DNA's self-
etc., 76-77; Tortoise-chomping, 483, 487--88; rep, 530; origin of, 528, 548; as self-assembling
two-channel monaural, 634, 669; see also objects, 485--86, 542; structure of, 528; as trans-
jukeboxes lators of Genetic Code, 485, 518-19, 522-25,
records: defective, 102, as information-bearers, 547; in Typogenetics, 512
158, 160~1, 164; as labyrinths, 120-24; with ricercar, defined, 7
multiple melodies, 154-57; as phonograph- RICERCAR (E), 7, 727-42
breakers, 75-78, 83--85, 271, 406-7, 424, 469, Rippled Suiface (Escher), 256-57
484, 486, 536, 543, 584; smashed, information RNA, see mRNA, rRNA, tRNA
in, 161; in space, 162~, 172, 174-75; of Well- RNA polymerase, 527, 530, 544
Tempered Clavier given to Crab, 275, 278--80 robot in T-maze, 711-13
records and record players, likened to cellular Rogers, Hartley
constituents and cells, 83, 158~, 167, 175, 536 ropes, thin and thick, 229-30
772 Index
Rose, Steven, 342 self-awareness, 406, 479, 573
Rosetta stone, 165, 166 self-descriptive adjectives, see autological adjectives
Roszak, Theodore, 574 self-enguIfing, 489-94; failed, 490, 492; total, 493
Rousseau, Henri, 680 self-knowledge, possibility of, 696-98, 706
Royal Theme, 4-10, 96, 719, 739-40 self-modifying games, 687~
rRNA,528 self-monitoring, 328, 385, 387~, 697, 713
RTN's, see Recursive Transition Networks self-perception, 695-98; vs. self-transcendence,
rule-less systems, 598, 685; see also fonna! vs. in- 478
fonna! systems self-progranuned objects, 685~, 691-92
rules: arithmetical vs. typographical, 262-64, 269; self-proving sentences, 542-43
flattened into strings, see theorems vs. rules; in- self-quoting sentence, 426, 400-97
telligence and, 26-27, 559, see also brains and self-reference: Bach and, 86; banning, 21-23; as
fonna! systems cause of essential incompleteness, 465, 470-71;
rules of inference: of C-system, 65; compared focusing of, 438, 443, 445-48; G&lelian, 17-18,
with enzymes, 509-10, 513, 531; defined, 34--35; 271, 447-49, 497, 502, 533, 667, 738; indirect,
derived, 193-94; of MIU-system, 34, 260; of P- 21, 85, 204, 436-37, 502, 667, 738-39; many-
system, 74; ofpq-system, 47; proposed, 66, 221; leveled, 742; near miss, 437; Quine method,
of Propositional Calculus, 187; recursive enu- 431-37, 445-46, 449, 497-99, 531; by transla-
merability and, 152; run backwards, 48-49, 182; tion, 502
of 310-system, 263; of TNT, 215, 217-20, self-reference and self-replication, compared, 530,
223-25; of tq-system, 65; of Typogenetics, 533-34, 541-43
509-10 self-referential sentences, 435-37, 477, 495-99,
rules of production, see rules of inference 501
run-<>f-the-mill sets, 20-21 self-rep: by augmentation, 503; canons and, 501,
Russell, Bertrand, 18-24 503; differentiating, 546; epigenesis and, 160;
Russell's paradox, 20-21, 685 by error message, 503; inexact, 500-503, 546;
by retrograde motion, 500-501; by translation,
501; trivial, 499; typogenetical, 512-13
Saccheri, Girolamo, 91-93, 99, 452, 456 self-snuffing, 701-2
Sagredo, see Salviati, et al self-swallowing sets, 20
Salviati, Simplicio, Sagredo, 408-9, 478-79, 673, self-symbol, 385, 387~, 709; free will and,
694 710-14; inevitability of, 388
sameness: of ASU's, 375; of BACH and CAGE, self-transcendence, 477-78, 479
153-57; in Bongard world, 650-53, 657, 660, self-unawareness, irony of, 328, 330, 331, 630
664; of butterllies, 147, 369; of demi-doublets, semantic classes, 621, 630
669; elusiveness of, 146-49; of Escher drawings, semantic networks, 370-72; see also concept net-
147; of human and machine intelligence, 337, work
379, 679-80; of human minds, 341-42, 369-72, semi-interpretations, 189, 196
375-77, 382; intensionality and, 338; mech- semifonna! systems, 216; see also geometry,
anisms underlying perception of abstract, Euclidean
646-62, 665-69, 671-72; overlooked, 614, 674; senseless loops, 679
of programs, 380-82; in self-refs and self-reps, sentences in TNT, 208-9
500-4; of semantic networks, 371; of transla- Sentences P and Q, 436-37
tions between languages, 372, 379-80; univer- sequences of integers, 73, 135-39, 173-74,408
sality of intelligence and, 158, 501; vs. set theory, 20-23
differentness, 153-57; visual, 344--48, 662; see sets F and G, 73
also copies, isomorphillms, conceptual mapping 1729, 204-5, 210-11, 345, 393, 551, 564--65
sameness-detectors, see Sams Shadows, The (Magritte), 480
Sams, 650-53, 657, 664 Shakespeare, Wm., 96, 595, 598, 608, 736
Samuel, Arthur, 604-5, 684-86 Shandy Double-Dandy, 611
Samuel's argument, pro and con, 684--86 shared code, 387
San Francisco ChTOTlicle example, 351 Shepard, Roger, 717-19
sand casdes, 725-26 Shepard tones, 717-19
sanity vs. insanity, 192, 696 shielding of lower levels, see inaccessibility
satellite-symbols, see splitting-off SHRDLU, 586-93, 599, 627-32, 674
satori, see enlightenment Shuzan, 251
scale, cyclic, see Shepard tones Sierpmski, W., 404
Schmidt, Johann Michael, 27 signals, crisscrossing, 322-23
Schnirelmann, Lev G., 394 signature, visual, 347-48
SchOnberg, Arnold, 125 Silberescher, LOwen, 394
Schriidinger, Erwin, 167 Silbermann, Gottfried, 3, 4
Schweikart, F. K., 92 silver, 173
science: and Bongard problems, 65~1; self-ap- Simon, Herbert A., 303, 305
plied, 699 simple, complex, hypercomplex cells, see neurons
Scon, Robert, 366 Simplicio, see Salviati
scripts, collage of, 168~9 simplicity, 172, 560, 615
seaIing-<>ff, 305, 309, 350, 534 simulation: of entire brain, 572-73; of neural net-
secondary structure, 521, 525 works, 571-72
self, nature of, 316-17, 327-28, 384~5, 387~8, Six-Pan Ricercar (Bach), 4-7, 719, 739-42
695-96, 709-14 skater metaphor, 412-13
self-assembly, spontaneous, 485~, 542-43 skeletons (recursion), 140-41; see also bottom
Index 773
skimming off top levels, 309, 325, 326, 358-59, subframes, etc., 644-45; see also recursive struc-
568-79 ture of ideas
slinky, 337 subject vs. object, 698-99; see also dualism, use
slippage, conceptual, 633-40, 641-44, 654-56, vs. mention, symbol vs. object
672; see also conceptual mapping subjune-TV, 635-40
Sloth, 633-40, 643, 681--83, 722 subjunctive instant replays, see instant replays
Sloth Canon (Bach), 9, 666, 683 subjunctives, see counterfactuals
Sloth Canon (Dialogue), 738 suborganisms, see subsystems
SWTHs, 684-719 subroutines, 150, 292, 471, 677
slots, 645, 650-53, 656-57, 668 substitution notation in TNT, defined, 224
Smalltalk, 662 substitution relationship (ingredient in G&lel's
smart-stupids, 721-42 proof). 443-45, 497
Smoke Signal, 67, 702 substrate: of Epimenides sentence, 581, 584--85;
SMUT, 6, 80, 155-57, 202, 682, 718, 740 mental, necessity of. for analogical thought,
soap cake, 497 569--71; mental, non interpretability of, 570-71;
soft-Iouds, see pianos mental, simulation of, 571-72; of proteins, 529
software and hardware: in brain, 346, 356--57, subsystems of brain, 385--88, 725
686, 709; defined, 301 subtraction, 52-53, 411-12
soldier ants, 318 sufficiendy powerful systems, 86, 101, 406--7, 430,
Sonato. for Unaccompanied Achilles, 502-3 460,530
Sonata for violin and clavier in F minor (Bach), Suites for unaccompanied cello (Bach), 70-71
162 summarizing string, 221-22,450-51
Sonatas and partitas for unaccompanied violin superconductivity, 304-5
(Bach), 62, 63, 70-71, 257,502 superintelligence, 679
song, self-reproducing, 500 supernatural nwnbers, 223, 453-56, 458-59, 467
"Song Without Time or Season, A", 483 supernatural proofs, 454-55
songs, recombinant, 607--8 supertangling, 688
sonnets, 596, 608, 736 surrealism, 700
soulism, 385,472, 574, 597, 686, 708 Sussman, Gerald, 664
spaces: abstract, 457; of behavior, 306, 307, 363, Swieten, Baron Gottfried van, 6-7
621; of integers, 502 Switcheroo, Q. q., 187
spare tire, 670 symbol-level description of brain, 349-51
Sperry, Roger, 710 symbol vs. object, 699-706; see also subject vs. ob-
Sphex wasp, 360-61, 613--14 ject, use vs. mention, etc.
spidetWebs, 371-72, 617 symbols: active vs. passive, 324-25, 327-28,
splitting-<>ff, 353-54, 664; see also classes vs. in- 337-38; Al realizations of, 662~3, 665; in ant
stances colonies, 324-28, 330; borderlines between,
stacks, pushdown, 127-35, 136, 610-11 354-57, 359--60; as brush strokes, 351; com-
starting positions in Art of Zen strings, 239-40, pared with neurons, 350, 371; compared with
241 ripples, 356-57; conceptual scope of, 350-51;
State of Grace (Magritte), 481 dormant, 327, 349, 355-56,384; form of, 348,
statistical mechanics, see gases 356-57, 361; free will and, 712-14; funneling
Steiner, Geo., 166--67, 642-43, 670 and, 347; of insects, 360-61; invariant core of,
Stent, Gunther, 514 349; joint activation of, 351, 354-56, 359, 361,
stomach processes, 572 365, 584--85, 664~5, 675; message-exchange
strands: of DNA and RNA, 514-18; in and, 350, 371, 662~3; modes of activation of,
Typogenetics, 508-13, 514 349-57, 361; need of, for originality, 609; neu-
Strange Loops' abolishment of, 21-23; with Bab- ral substrate of, 356-57, 570; no access to sub-
bage and Turing, 737; in Bach, 10, 719; in strate by, see inaccessibility; ov"rcrowding of,
Central Dogmap, 534; consciousness and, 358; overlap of, 348-49, 356-57; potential,
709-10; contrasted with feedback, 545, 691; de- 355-56, 382--84; universal, 375-76; vs. neu-
fined, 10; in Escher, 10-15, 714-17; in G&lel, rons, 348, 356--57, 361; vs. signals, 325-27,
15-17,24; in government, 692-93; in language, 349-50
22,691; in the mind, 27, 691-92; in molecular synapses, 339
biology, 231, 532-34, 545, 546-48; in Principia syntax vs. semantics, 626--27, 630-32, 676; see also
Mathematica, 24; surprise element necessary in, form, syntactic vs. semantic
691; in TNT, see TNT, introspection of; see also system, boundaries of, 37-38; see also jwnping out
Tangled Hierarchies, level-mixing, level- of the system
conRicts, level- confusion, etc. System crash, ll6
street nuisances, 25, 726--27, 729 systems, reliable vs. unreliable, 307
stretto, 314, 738
String Manipulation Rules, 240-42 T (Tarski's formula), 580--81
strings: defined, 33-34; folded, 234-44, 427 't' -concept, 'h' -concept, 'e' -concept, 326
structure vs. function, 522, 670-71; see also use vs. T -even phages, 540, 542
mention, syntax vs. semantics T -level, see tangled level
style, 148, 371 table of non theorems, 66
SUB (TNT-formula), 444-45 Tagore, Rabindranath, 169
subbrains, see subsystems Tangled Hierarchies: in art, 704; defined, 10; of
subdescriptions, etc. 650-51; see also recursive genetics, 532-34, 546--48, 688; of meta-
structure of ideas mathematics, 458, 532-34; of mind, 691-92,
774 Index
709-10. 719; near miss. 691; in Propositional FIGURE-FIGURE figure and. 70; as general
Calculus. 194; of self-modifying chess. 688; of metalanguage. 265~7; goals of. 60; in-
Tortoise's reasoning, 177~0; of Typogenetics. completeness of, see incompleteness; introspec-
513.688 tion of. 17. 194.267-72,406.438.443. 449-50.
tangled levd, 688 698. 707~; as its own metalanguage. 267-72.
Tanguy, Yves, 700 441-46, 514; plight of, pictorial version. 71; re-
tape remrders. 485. 519. 523. 525-28 laxed. 228; rules of formation. table of. 213-14;
Tarski. Alfred. 57~1 rules of inference. 215.217-15; sixth axiom of.
Tarski-Church-Turing Theorem, 561, 581 222-23. 451-55. 459. 465~; well-formed ness
Tarski's Theorem. 579. 580~1. 584~5. 697 in. 205-15
Taube. Mortimer. 574 TNT -derivations compared with machine lan-
Taurinus, F. A.. 92 guage.291
TC-battles. 75-78. 406-7. 424. 467-70. 478. TNT-level. explanations on. 708
483-88. 536-41. 721 TNT-numbers. 269-70; See aJ..o theorem-numbers
tea. 153-54.231. 275. 322-23. 333. 549. 557.558. TNT + G. 465~7. 471
561 TNT + G + G'. etc . 467-71
teleological vs. evolutionary viewpoint. 320-22 TNT + -G. 467
telephone calls. 61~3. 127-28. 161; obscene. 431. tobaa:o mosaic virus. 484~5. 542. 543
437 TOdelization. repeatability of. 76-78. 424. 467-70.
telephone systems. 296. 663 483-86; see also GOdelization. essential in-
telephones. 302 completeness. answer schemas. etc.
television. 285. 348. 478. 484. 487-93. 634-40 TOdel's Theorem. 486. 536
telophase. 667 ~ Tokusan. 189-90
templates: for Bongard problems. 650-53. tonic. musical. 121-23. 129-30
656-57; vs. instructions. see instructions vs. tem- Tortoise: answer-schemas and. 475; Carroll para-
plates. programs vs. data dox and. 46. 193. 684~5. 693; Crab Canon and.
tension and resolution. 121-23. 129-30. 227 204. 666-67; degenerate solution by. 669;
tentativity. 646. 651. 654-56. 672 Diophantine equations and. 459-60; as
termination tester. 425-29 harpsichord. 502; initial letter of. 231.507.667;
terminators (F1ooP). 425-29 tnentioned. 102. 170. 267; origin of. 28-29; pic-
terms (TNT). 206-7. 213. 214 ture of. 42; recursion and. 128-30; 149; use of
teniary structure: of proteins. 519-22. 525-27; of words by. 181; vs. Crab. 84~6. 271.406. 424.
tRNA. 524; of typoenzymes. 510-11. 512. 519 467~9. 540. 543; Zen string made by. 272; in
Tesler. Lawrence G. 601 ZET cycle. 94-95
Tesler's Theorem. 601. 623; see also paradox of Tortoise-pairs. 416. 441. 448; compared with
AI. jwnping out of the system. essential in- proof-pairs. 441. 448
completeness Tortoise property. 395-97. 415-18. 425. 426. 441.
tesselations. 68. 69, 198. 667 448
tests vs. functions in BlooP and FlooP. 413; 418 Tortoise's love song. 435-36
text-handling by computers. 301 Tortoise's method. see Todelization
T4 phage. 537-41 Tozan. 190. 255. 257. 479
"the". 586. 629-30 tq-system. 64~7
theorem-nwnbers. 264~7. 269-70. 440-43. 451 transcendentalism. 704
theorem-proving. mechanical. 602. 609. 617-19 transcription: DNA to mRNA. 517. 524. 527-28.
theorems: defined. 35; systematic enwneration of. 530. 533. 536. 538. 540-41. 544-45; DNA to
39-40. 48. 471-73. 578. 615. 617-18; vs. non- tRNA. 425; koans to messengers. 235-36. 288.
theorems. 39-41. ~7. 70. 71-73. 190-91. 239. 242; letters to notes. 83; prevention of.
416-17. 560. 57~0; vs. rules. 43-45, 193-94. 544-45
509-10; vs. Theorems. 35. 193; vs. truths. transfer RNA. see tRNA
49-54. 70-71. 86-102. 190-97. 213. 221-23. translation: between com puter languages. 192-95.
228-30. see also consistency. completeness. 297-98. 306. 380-81. 547. 632; between levels
GOOel's Theorem. consequences of of a brain . 349. 381-84. 709; between natural
TIteseus and Ariadne. 130 languages;.difficulties of. 372-73. 379~; be-
thinking. speed of. 679 tween TNT and meta-TNT. 267-72. 441-46.
SO. as possible MIU-nwnber. 265~7 709; of Crime and Punishment. 379~; English
"this sentence". 436. 495-98. 499 to TNT. 209-13, 215. 417; of "Jabberwocky".
thought. substrate of. 559 372-73. 379; levels of fidelity in. 379~; me-
3n + I problem. 400- 2; see also wondrous and un- chanical. 380. 601. 603; of messengers in to
wondrous nwnbers strings. 234-36; mRNA to proteins. 485.
Three Spheres 1/ (Escher). 258 518-19. 522-25. 527-28. 531-36. 538. 545.
310-system. 261~ 546-48; from N to Meta-TNT. 533; from score
Three Worlds (Escher). 247. 256 to sounds. 83; in Typogenetics. 509-10. 512-13
thymine. see nucleotides transparency to user. 629. 632
tilde. 183. 191-92. 554 trees: look-ahead. see look-ahead trees; recursive
~rinR. 296. 354-55. 387. 730 diagrams, 40. 71, 135-37; of theorems. 40. 71
TNf. 204-30; absolute geometry and. 451-52; triggering patterns of symbols: dependence on
austere. 211. 214. 216. 268. 442. 534; axioms of. tneaningless lower levels. 569; isomorphism be-
215-17. 222-23; as code. 265~7; consistency tween minds and. 369. 376; isomorphism be-
of. 229-30. 449-50; extended. axioms of. tween physical law and, 362; as key to meaning.
451-52.466-68; extensions of. 451-59. 46!Hi8; 325.327.350.360, 385.609; mediated by mes-
Index 775
triggering patterns of symbols (c<mlinued) unicycle, tandem, 633, 669
sages, 350, 371; for melodies, 364; nouns vs. units in Typogenetics, 505, 509
verbs, 361; randomness in, 673 universal quantifiers, see quantifiers
triggers: DNA as, 160-61; dormant symbols and, universal triggering power, 171, 175
281, 383, 384; frame messages and, 162; Vnmon, 254
jukeboxes and, 160-61, 170-71, 174, 500; kOans unobservant machines, 36-37, 674
as, 246; music and, 162-63, 281, 383, 583; unpredictable but guaranteed termination, 400,
outer messages and, 166, 169, 170-71, 174, 501 425
Trio Sonata from the Musical Offering (Bach), 7-8, upper bounds, see loops, bounded, BlooP
720, 724, 726 uracil, see nucleotides
Tripitaka, 257 use vs. mention, 434-37, 458, 531, 545,699-700;
trip-lets, cover, xiv, I, 28, 273 see also form, syntactic vs. semantic, programs
tRNA, 522-24, 547, 548 vs. data, syntax vs. semantics, structure vs. func-
Trojan Horse, 538 tion
truth: capturability by symbol manipulation,
53-60; elusiveness of, 694-95; inexpressible in variables in TNT, 206, 213-14; free, 207-9, 214;
TNT, 580-81; not fully mirrorable in brain, quantified, 208, 214, see also quantifiers
584-85; vs. beauty, 554-58, 584; vs. commer- verb-at-the-end phenomenon, 130-31
cials, 478; vs. falsity, 70, 71, 213, 228-29, 417, V.,.bum (Escher), 257, 731-32
561, 579-81 versus, see accessible vs. inaccessible knowledge,
TTortoise, see ATTACCA active vs. passive symbols, ants vs. ant colonies,
tuba, flaming, 488-89, 492, 735 arithmetical vs. typographical rules, Bach vs.
Tumbolia, 116, 243, 255, 725; layers of, 243 Cage, beautiful vs. non-beautiful, bottom-up vs.
tuning an AI program, 678-79 top-down, classes vs. instances, continuous vs.
Turing, Alan M., 26, 389, 425-26, 428-29, discrete processes, deductive vs. analogical
594-99, 734-42; objections to AI, 597-99 awareness, derivations vs. proofs, dissection vs.
Turing, Sara, 595 appreciation of Bach, distinct vs. similar levels,
Turing machines, 390, 594, 735 enzymes vs. typoenzymes, explicit vs. implicit
Turing test, 595-99, 600, 677-78, 735-37; knowledge, explicit vs. implicit meaning, ex-
arithmetic error in, 596; miniature, 621-23; plicit vs. implicit pruning, formal vs. informal
proposed revisions in, 600 reasoning, formal vs. informal systems, formal
Turtle's Theorem, see Todel's Theorem systems vs. reality, genuine vs. phony k6ans,
2, as concept, 678 high-fidelity vs. low-fidelity, holism vs. reduc-
2-D vs. 3-D: in Escher, 57-58, 105-6, 125, tionism, improvisation vs. introspection, instruc-
473-74, 524, 689-90, 698, 714-16; in Magritte, tions vs. templates, local vs. global propenies,
480-81, 493-94, 700-1, 705-6; television meaningless vs. meaningful interpretations,
screens and, 488-93, 737; trip-lets and, see trip- men vs. women, minds vs. brains, nouns vs.
lets verbs in triggering patterns, 1-0 vs. 3-D, passive
Two Mysteris, The (Magritte), 701-2 vs. active meaning, people vs. machines, plausi-
Two-Part Invention, 28, 43-45, 684-86; see also ble vs. implausible pathways, President v. Su-
Carroll paradox, Lewis Carroll preme Coun, procedural vs. declarative
2 + 2 ~ 5,576 knowledge, programs vs. data, programs vs.
typeface metaphor, 541 programmers, purposeful vs. purposeless be-
Typeless Wishes, 111-15, 610-11 havior, rational vs. irrational, sanity vs. insanity,
types, theory of, 21-23 self-perception vs. self-transcendence, structure
typesetting machine, 608 vs. function, subject vs. object, symbol vs. object,
typoenzymes, 505-13; binding-preferences of, symbols vs. neurons, symbols vs. signals, syntac-
505-6, 511-12 tic vs. semantic form, syntax vs. semantics, tele-
Typogenetic Code, 510, 512, 513, 519 ological vs. evolutionary viewpoint, theorems vs.
Typogenetics, 504-13, 514, 519, 520, 529; con- nontheorems, theorems vs. rules, theorems vs.
trasted with MIV-system, 509-10, 514 Theorems, theorems vs. truth, Tonoise vs.
Typographical Number Theory, see TNT Crab, truth vs. beauty, truth vs. commercials,
typographical operations, defined, 64 truth vs. falsity, 2-D vs. 3-D, use vs. mention,
typos, 404 weight vs. mass, womanseeing vs. seeing, words
vs. letters, Zen vs. logic, Zen vs. words
V, as nontheorem of MIV-system, 36, 39 vibrations, 76-78, 82-85, 102, 270, 271, 469
V-mode, see Vn-mode Vice President, 670
Vlam, Stanislaw, 560, 621, 676 ViUon, Fran~ois, 369
Vn-mode, 39, 98, 254 Vinogradov, Ivan M., 394-95
Vnamuno, Miguel de, 698 Vinogradov propeny, 394-95
uncertainty principle, see Heisenberg uncertainty violins, 62, 63, 70,81,84, 162,200,257, 434, 502,
principle 595, 681, 720, 724
uncles, 446-48, 464, 466, 468, 541, 580 viruses, 536-43; likened to Henkin sentences.
undecidability, 17, 222, 449, 451-55, 468; causes 542-43
of,707-8 vision by computer, 602, 627
undefined terms, 92-102, 216, 456; defined, 93, visual imagery: Bongard problems and, 661;
97 faucets and, 364-65; inaccessible knowledge
understanding, nature of, 569, 675-76, 680 and, 365; lack of in programs, 623; mathemat-
understanding minds/brains: meaning of, 697; ics and, 569, 678; necessitating layers of sub-
possibility of, 697-98, 706-7 strate, 570-71; power of, 338-39; role in
776 Index
conceptual mapping, 668, 672; rubbing-off and, Wolff, Christoph, 392
361--62 womanseeing vs. seeing. womaruee men vs. women
voices in fugues and canons, 28, 282-83, 314, wondrous and unwondrous numbers, 400-2, 408,
322-23, 335, 665-67, 669, 683, 737, 740 415, 418, 425
Voltaire, Fran~ois Marie Arouet de, 3 Wooldridge, Dean, 360
vonices, 713-19 words: in computers, 288-90, 295, 411; as pro-
Vuillard, Edouard, 347 grams, 629-30; spelled backwards, 81, 418, 427,
498, 505, 533, 549, 727, 738, 740; thoughts,
Wachter, F. L., 92 formal rules, and, see main theses; vs. letters,
Warnn, Frank L., 366 325-27, 570, 571; Zen attitude towards, 246,
"WASH ME", 608 249,251-54
WaterfaU (Escher), 11-15, 99, 716 worker ants, 318
Watergate, 692 working inside the system, see Mechanical mode
Watson, j. D., 667
Weasel, 106
weather, 302-3 yes-answers, 461--64
Weaver, Warren, 380 Yngve, Victor, 620
Weierstrass, Karl W. T., 404 Young, LaMonte, 700
weight vs. mass, 171-72
Weizenbaum, joseph, 5994i00, 675 Zen Algebra, 577
well-formed strings: in An of Zen Strings, 239, Zen Buddhism: Achilles teaches the Tonoise
242, 244; BlooP puzzle on, 416; defined, 53; in about, 231-45; computers and, 625-26; Crab's
pq-system, 47; in Propositional Calculus, refrigerator and, 406-7; Escher and, 255-58;
181-83; in TNT, 213-15 holism vs. reductionism and, 312-13; inconsis-
WeU-Tem/Mrm Clavier (Bach), 7, 280-84, 327, 329, tencies and, see Zen vs. logic; introd uction to,
335 246-59; jumping out of the system and, 233,
Well-Tested Conjecture (Fourmi), 333-35 255, 479; music, an, and, 699, 704-6; Mystery
"When johnny Comes Marching Home", 607 of the Undecidable and, 272; nonexistence and,
Whitehead, Alfred Nonh, 18, 21, 23-24 254-55, 698; patriarchs of, 30, 232, 252, 259;
Whitely, C. H., 477 quasi-, 625-26; U-mode and, 39, 98, 254; vs.
wholes, see holism logic, 99, 233-34, 249-51, 254; vs. words, 246,
Wiener, Norben, 684 248-49, 251-54; Zeno and, 30
Wiesel, Torslen, 343 Zen Strings, An of, see An of Zen Strings
will: free, see free will; mechanical, 684-86; roots Zenfunny, Beethoven's Ninth, 634
of,684-86 Zeno of Elea, 28, 29-32, 94-95, 144, 146, 232,
Wilson, E. 0., 350 610, 681, 704, 722
Winograd, Terry, 627-32 Zeno's paradoxes, 29-32, 35, 43, 146, 610
Winston, Patrick Henry, 299 Zentences, 186-90
wishes, meta-wishes, etc., 109-16 ZET -cycles, 94-96, 689
Wittgenstein, Ludwig, 680, 699 zooming in, 645, 671
Index 777