0% found this document useful (0 votes)
546 views8 pages

Experiment No. 15 Practical: Polymerase Chain Reaction

The document describes using polymerase chain reaction (PCR) to amplify the internal transcribed spacer (ITS) region of plant genomic DNA. PCR was performed using ITS5a and ITS4 primers under specified thermal cycling conditions. Agarose gel electrophoresis showed a clear band, indicating amplification of the target DNA segment. It can be concluded that PCR achieved a high degree of magnification of the DNA segment.

Uploaded by

Anura Bandara
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
546 views8 pages

Experiment No. 15 Practical: Polymerase Chain Reaction

The document describes using polymerase chain reaction (PCR) to amplify the internal transcribed spacer (ITS) region of plant genomic DNA. PCR was performed using ITS5a and ITS4 primers under specified thermal cycling conditions. Agarose gel electrophoresis showed a clear band, indicating amplification of the target DNA segment. It can be concluded that PCR achieved a high degree of magnification of the DNA segment.

Uploaded by

Anura Bandara
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
You are on page 1/ 8

Experiment No.

15

Practical : Polymerase Chain Reaction

Introduction:

Template- Plant genomic DNA isolated in the previous class

Target Gene- Internal Transcribe Spacer (ITS) region

ITS refers to a piece of non-functional RNA situated between stryral ribosomal RNAs (rRNA) on a
common precursor transcript. Sequence comparison of the ITS region is widely used in taxonomy and
molecular phylogeny because it is easy to amplify even from small quantities of DNA, and has a high
degree of variation even between closely related species. In addition to the standard ITS1+ITS4 primers
used by most labs, several taxon- specific primers have been describe that allow selective amplification
of fungal sequences. ITS region is nowadays being used to know the genetic diversity among different
strains of bacteria by sequencing the ITS gene.

Primer sequences:

ITS5a 5’ CCTTATCATTTAGAGGAAGGAG 3’

ITS4 5’ TCCTCCGCTTATTGATATGC 3’

PCR conditions: 94°C 2mins

94°C 30sec

49°C 30sec

72°C 1min

72°C 7min

Material

Template – Plant Genomic DNA isolation in the previous class, Nucleotides

Taq Polymerase, Buffer for pH control & stabilization

Target Gene – Internal Transcribed Spacer (ITS) region

Primers- ITS5a: Forward Primer, ITS4: Reverse Primer, Automated PCR machine
MgCl2 solution

Procedure

The PCR machine was loaded with the mixture of the above mentioned reagents and buffer solution and
the initially run for 2min at 94oC.Then 30 PCR cycles were run in the machine at 94oC for 30sec then at
49oC for 30sec and at 72oC for 1min in the PCR machine. Then the machine was set at 72oC for 7mins.
Finally the DNA fragments were separated and an agarose gel electrophoresis was run to visualize the
DNA bands.

Observations

The gel was visualized under UV light and a clear solid band was observed in the gel as shown in the
below image.

Figure 01: Band pattern for PCR process

Conclusion

With reference to the observations of gel electrophoresis it can be concluded that a high degree of
magnification of the DNA segment was achieved by the PCR.

Discussion

The polymerase chain reaction (PCR; Erlich, 1989) is a powerful technique that has rapidly become one
of the most widely used techniques in molecular biology because it is quick, inexpensive and simple.
The technique amplifies specific DNA fragments from minute quantities of source DNA material, even
when that source DNA is of relatively poor quality.

 It does not necessarily require the use of radioisotopes or toxic chemicals


 It involves preparing the sample DNA and a master mix with primers, followed by detecting
reaction products

Because PCR amplifies the regions of DNA that it targets, PCR can be used to analyze extremely small
amounts of sample. This is often critical for forensic analysis, when only a trace amount of DNA is
available as evidence. PCR may also be used in the analysis of ancient DNA that is tens of thousands of
years old. These PCR-based techniques have been successfully used on animals, such as a forty-
thousand-year-old mammoth, and also on human DNA, in applications ranging from the analysis of
Egyptian mummies to the identification of a Russian tsar and the body of English king Richard III.

PCR procedure steps:

Denaturation: DNA fragments are heated at high temperatures, which reduce the DNA double helix to
single strands. These strands become accessible to primers

Annealing: The reaction mixture is cooled down.Primers anneal to the complementary regions in the
DNA template strands, and double strands are formed again between primers and complementary
sequences

Extension: The DNA polymerase synthesizes a complementary strand. The enzyme reads the opposing
strand sequence and extends the primers by adding nucleotides in the order in which they can pair. The
whole process is repeated over and over.

The DNA polymerase, known as 'Taq polymerase', is named after the hot-spring bacterium Thermus
aquaticus from which it was originally isolated. The enzyme can withstand the high temperatures needed
for DNA-strand separation, and can be left in the reaction tube. The cycle of heating and cooling is
repeated over and over, stimulating the primers to bind to the original sequences and to newly
synthesised sequences. The enzyme will again extend primer sequences. This cycling of temperatures
results in copying and then copying of copies, and so on, leading to an exponential increase in the
number of copies of specific sequences. Because the amount of DNA placed in the tube at the
beginning is very small, almost all the DNA at the end of the reaction cycles is copied sequences.

The reaction products are separated by gel electrophoresis. Depending on the quantity produced and the
size of the amplified fragment, the reaction products can be visualized directly by staining with ethidium
bromide or a silver-staining protocol, or by means of radioisotopes and autoradiography.
Figure 02: PCR procedures: cycle 1

The PCR steps are all carried out, one after the other, in bouts of cycling. Cycle 1 is as follows:

• During denaturation (about 1 min at 95°C), the DNA strands separate to form single strands.

• During annealing (about 1 min at temperatures ranging between 45°C and 60°C), one primer binds to
one DNA strand and another binds to the complementary strand. The annealing sites of the primers are
chosen so that they will prime DNA synthesis in the region of interest during extension.

• During extension (about 1 min at 72°C), the DNA synthesis proceeds through the target region and for
variable distances into the flanking region, giving rise to 'long fragments' of variable lengths.

Figure 03: PCR procedures: cycle 2


When the second cycle starts, there are effectively two types of template: (1) the original DNA strands;
and (2) the newly synthesised DNA strands, consisting of the target region and variable lengths of the
flanking region at the 3' end. When the latter template is used in this cycle, only the target region is
replicated.

Figure 04: PCR procedures: cycle 3

In the third cycle, the newly synthesised target region DNA (i.e. without flanking regions) acts as
template. The original DNA molecule is still present, and will be until the end of the reaction. However,
after a few cycles, the newly synthesised DNA fragment quickly establishes itself as the predominant
template. Cycles are typically repeated 25 to 45 times. Standardisation of the thermocycler's running
conditions is essential for the reproducibility of results.

Template DNA

Nearly any standard method is suitable for template DNA purification. An adequate amount of template
DNA is between 0.1 and 1 µg for genomic DNA for a total reaction mixture of 100 µl. Larger template
DNA amounts usually increase the yield of non-specific PCR products.

Primers

(1) PCR primers should be 10-24 nucleotides in length.

(2) The GC content should be 40%-60%.

(3) The primer should not be self-complementary or complementary to any other primer in the reaction
mixture, to prevent primer-dimer and hairpin formation.
(4) Melting temperatures of primer pairs should not differ by more than 5°C, so that the GC content and
length must be chosen accordingly.

MgCl2 concentration

Because Mg+2 ions form complexes with dNTPs, primers and DNA templates, the optimal
concentration of MgCl2 has to be selected for each experiment. Too few Mg+2 ions result in a low yield
of PCR product, and too many will increase the yield of non-specific products. The recommended range
of MgCl2 concentration is 1 to 3 mM, under the standard reaction conditions specified.

Taq DNA polymerase

Higher Taq DNA polymerase concentrations than needed may cause synthesis of non-specific products.
dNTPs. The concentration of each dNTP (dATP, dCTP, dGTP, dTTP) in the reaction mixture is usually
200 µM. These concentrations must be checked as being equal, because inaccuracies will increase the
degree of misincorporation.

Applications of PCR

Diagnosis of genetic diseases

The use of PCR in diagnosing genetic disease, whether inherited genetic changes or as a result of a
spontaneous genetic mutations, is becoming more common. Diseases can be diagnosed even before
birth. Examples include:

Genetic counselling – screening the parents for genetic disease before deciding on having children

Preimplantation diagnosis – screening for genetic disease before implantation of an embryo in IVF (in
vitro fertilization) Screening for genetic disease before birth using tissue samples from the chorionic
villus (the membranes found between the mother and unborn baby); foetal tissue from the amniotic fluid
(the fluid around the unborn baby); or the small quantities of foetal DNA (DNA from the unborn baby)
found in the mother’s bloodstream

Diagnosing inherited or spontaneous diseases, either as a result of symptoms, or because of family


history (e.g. Duchenne muscular dystrophy)

Genetic fingerprints

One of the most famous uses for PCR is in the creation of a genetic fingerprint (also known as DNA
profiling) from a sample of blood or semen, or from a hair root. Much beloved by writers of detective
fiction, genetic fingerprints are profiles of specific stretches of DNA (loci – commonly, 13 loci are
compared) that vary from person to person. PCR also plays a role in mitochondrial DNA analysis, used
for samples from hair shafts and bones when other samples are not available. The UK police has a
National DNA Database. Genetic analysis based on PCR is also used in paternity testing, and in tissue
typing for organ transplantation.

Figure 05: PCR method used to identify crime scene as fingerprinting technique

Detection and diagnosis of infectious diseases

PCR can detect infectious disease before standard serological laboratory tests (tests to detect the
presence of antibodies), so allowing treatment to start much earlier. Because of this, PCR is also useful
for screening donated blood for infections, and is especially useful for infections that are difficult to
culture in the laboratory, such as tuberculosis.

Detection of infection in the environment

PCR is used to monitor and track the spread of infectious disease within an animal or human population.
PCR can also be used to detect bacterial and viral DNA in the environment, for example looking at
pathogens in water supplies.

Personalized medicine
PCR is used in personalized medicine to select patients for certain treatments, for example in cancer
when patients have a genetic change that makes a patient more or less likely to respond to a certain
treatment.

PCR in research

PCR can be used to create copies of DNA for introduction into host organisms such as Escherichia coli
in genetic engineering, and to amplify stretches of genetic material for Sanger sequencing – the Human
Genome Project used PCR.

PCR can be used in analysis of gene expression, for example looking at levels of expression and when
genes are switched on and off in physiological processes, including in health and disease.

References

1. Erlich, H.A. 1989. PCR technology: principles and applications for DNA amplifications.
Stockton Press, NY.
2. Erlich, H.A. and N. Arnheim. 1992. Genetic analysis using the polymerase chain reaction. Ann.
Rev. Genet. 26:479-506.
3. Griffiths, A.J.F., J.H. Miller, D.T. Suzuki, R.C. Lewontin and W.M. Gelbart. 1996. An
introduction to genetic analysis (6th edn.). W.H. Freeman and Co., NY.
4. Newton, C.R. and A. Graham. 1994. PCR, part 1: Basic principles and methods. EngBios
Scientific Publishers, Oxford.
5. Saiki, R.K., D.H. Gelfand, S. Stoffel, S.J. Scharf, R. Higuchi, G.T. Horn, K.B. Mullis and H.A.
Erlich. 1988. Primer-directed enzymatic amplification of DNA with a thermostable DNA
polymerase. Science 239:487-491.

You might also like