Journal of Agricultural Science and Technology B 5 (2015) 691-700
doi: 10.17265/2161-6264/2015.10.006
D DAVID PUBLISHING
Species Identification of a Commonly Believed
Sinarapan Fish Mystichtys luzonensis (Smith, 1902) in
Lakes Buhi and Bato of Bicol Region
Jacob Anderson Cajuigan Sanchez1, 5, Venus Banguilan Buraga1, Carmelita Pingol Mapanao1, 4, Mary Beth
Bacano Maningas1, 2 and Mudjekeewis Dalisay Santos3
1. Graduate School of University of Santo Tomas (UST), España, Manila 1008, Philippines
2. Molecular Biology and Biotechnology Laboratory, Research Center for Natural and Applied Sciences (RCNAS), University of
Santo Tomas, Manila 1008, Philippines
3. Genetic Fingerprinting Laboratory, Bureau of Fisheries and Aquatic Resources-National Fisheries Research and Development
Institute (BFAR-NFRDI), Quezon City 1011, Philippines
4. College of Arts and Sciences, Polytechnic University of the Philippines, Manila 1016, Philippines
5. College of Arts and Sciences, Pampanga State Agricultural University, Pampanga 2011, Philippines
Abstract: The paper aimed to determine the true identity of a presumed or commonly believed Sinarapan fish and compare their
phylogenetic relationships by using DNA barcoding. The fish samples were collected by researchers from a fisheries research and
development institution in April 2015 from four different lakes of Bicol Region, i.e., Lakes Buhi, Danao, Manapao and Bato. DNA
was extracted using cetyl trimethyl ammonium bromide (CTAB) extraction buffer. The polymerase chain reaction (PCR) profile for
the reaction was 94 °C for 10 min, followed by 35 cycles of 1 min at 94 °C, 1 min at 48 °C and 1.5 min at 72 °C, and a final
extension of 10 min at 72 °C. The CO1 region with approximately 650 bp was amplified because of its capability to differentiate taxa.
Sequencing was done by Macrogen while phylogenetic analysis was produced using a Molecular Evolutionary Genetics Analysis
(MEGA) software version 6.0. The findings showed that CO1 can be used as a DNA marker in molecular identification of the fish
samples. Samples from two of the four lakes were successfully sequenced. From basic local alignment search tool (BLAST) results,
the maximum parsimony (MP) and neighbor-joining (NJ) trees revealed that samples from Lakes Buhi and Bato are not species of
Sinarapan but rather species of Leiopotherapon plumbeus and Rhinogobius giurinus, respectively. Furthermore, DNA barcoding is
very useful in proving the true identity of unknown samples.
Key words: Goby fish, Sinarapan, DNA barcoding, CO1 gene, Bicol region.
1. Introduction fish is facing possible extinction. To address this
problem, the House Bill No. 1011 [4] and Senate Bill
Sinarapan, Mystichtys luzonensis (Smith, 1902) is
No. 1046 [5] during the Sixteenth Congress of the
listed in the Guinness book of world records 2001 as
Republic of the Philippines declared the Sinarapan
the world’s smallest commercially-harvested fish [1]
sanctuary to prevent over exploitation. The Sinarapan
in freshwater lakes of Camarines Sur and other parts
sanctuary covers Lake Manapao and Lake Makuao,
of Bicol region, Philippines [2]. The magnitude of this
and both are located in Barangay San Ramon. Lake
recognition has increased following various claims
Katugday is in between Barangay San Ramon and
that the fish is endemic in Bicol region [3].
Barangay De Lafe in municipality of Buhi, Camarines
Known to be very small, fragile and delicious, this
Sur, and Lake Danao is located in the boundary of
Corresponding author: Jacob Anderson Cajuigan Sanchez,
Barangay Danao, municipality of Polangui, Albay and
research field: molecular phylogenetics.
692 Species Identification of a Commonly Believed Sinarapan Fish Mystichtys luzonensis
(Smith, 1902) in Lakes Buhi and Bato of Bicol Region
the municipality of Buhi, near Barangay Makaangay. recovery of its 5’ end from representatives of most, if
Lake Buhi, Buhi, Camarines Sur, Lake Danao, not all, animal phyla [16] and (2) CO1 has a greater
Danao, Masbate, Lake Manapao, Barangay San range of phylogenetic signal than any other
Ramon, Buhi Town, Camarines Sur, and Lake Bato, mitochondrial gene. Similar with other protein coding
Bato, Camarines Sur are said to be the homes of genes, its third-position nucleotides show a high
Sinarapan and thus serve as main sources for fishing. incidence of base substitutions, leading to a rate of
The Sinarapanis is from the genus Mystichtys and molecular evolution that is about three times greater
Gobiidae family. They are morphologically than that of 12S or 16S rDNA [17].
transparent, except for black eyes, with an average Here, this paper aimed to use DNA barcoding using
length of 12.5 mm. Males are smaller than females. CO1 DNA marker on Sinarapan sample collections to
Previous reports showed that the biggest specimen confirm its true identity and determine the
only grew up to 15 mm with an average length of only phylogenetic relationship of the collected samples.
12.5 mm [2]. However, the fish started disappearing in
2. Materials and Methods
the 1980’s with the advent of motorized fishing to
capture them for commercial purposes [6]. 2.1 Samples
A report from the Department of Agriculture [7]
The Sinarapan samples were collected by the of
revealed that Mystichtys luzonensis is threatened with
researchers from the Bureau of Fisheries and Aquatic
extinction due to overfishing and introduction of
Resources-National Fisheries Research and
exotic species, like Nile tilapia (Oreochromis niloticus)
Development Institute (BFAR-NFRDI) from four
[8]. While recent efforts have been conducted for
different lakes in Bicol Region, namely, Lakes Buhi
habitat enhancement [9] and water quality monitoring
(L1), Danao (L2), Manapao (L3) and Bato (L4).
[10] for conservation, there are few studies that took
Muscle tissues of about 100 mg were obtained from
account of the Sinarapan’s true identity.
randomly selected samples, fixed in 95% ethanol and
In developing proper management strategies, the
stored at -20 °C until DNA extraction.
taxonomy will be fundamental since accurate
identification of a species is a basic pre-requisite in 2.2 DNA Extraction
fisheries management [11]. During the past decades,
Three samples were obtained from each lake for
DNA barcoding and marker-assisted selection (MAS)
replication purposes. DNA was extracted using cetyl
have been used to identify fishery species [12]. A
trimethyl ammonium bromide (CTAB) extraction
short fragment, which usually ranges around 648-705
buffer following the method of Doyle [18] with
base pairs [13] of cytochrome c oxidase 1 (CO1)
modifications by Santos et al. [19]. The concentrations
marker—a mitochondrial DNA, can be used to of the DNA extracts were measured using a Nano
identify fishes [14]. Previous researches proved that spectrophotometer with concentrations ranging from
this identification system was able to differentiate the 144 ng/uL to 148 ng/uL.
taxa of different fishes in Pantabangan dam [15] and
has provided a quick solution to the challenges of 2.3 CO1 Amplification
using conventional taxonomy in fisheries based on A 24 uL reaction mixture was prepared containing
morphological characteristics, especially when water, 10× PCR buffer, 2 mM dNTP’s, 10 uM each of
working on immature or damaged samples. The gene forward primer LCO1490:
(CO1) has two important advantages: (1) the universal 5’GGTCACAAATCATAAAGATATTGG3’ and
primers for this gene are very robust, enabling reverse primer HCO2198:
Species Identification of a Commonly Believed Sinarapan Fish Mystichtys luzonensis 693
(Smith, 1902) in Lakes Buhi and Bato of Bicol Region
5’TAAACTTCAGGGTGACCAAAAAATCA3’[16], samples being tested belong to the animal phyla. It
25 mM MgCl2, 5 units/uL Taq polymerase and 2 uL also affirmed the consistency of the optimized
of DNA template. The polymerase chain reaction extraction and amplification protocols done in this
(PCR) profile for the reaction was 94 °C for 10 min, experiment. The usefulness of CO1 gene in barcoding
followed by 35 cycles of 1 min at 94 °C, 1 min at of unknown fish samples was achieved.
48 °C, 1.5 min at 72 °C, and a final extension of 10 In addition, the CO1 gene can resolve potential
min at 72 °C. CO1 amplicons were electrophoresed mislabeling due to incorrect morphological
through a 1% agarose gel stained with GelRed and identification, since Sinarapan shares similar
submerged in 1× TAE buffer. An approximately 650 phenotypic characteristics with a variety of juvenile
bp fragment of the CO1 was amplified. fishes. It also was affirmed in the previous report that
CO1 gene can be used to identify the incidence of
2.4 Purification and Sequencing
mislabeling. The said study found that frozen “Tawilis”
The PCR amplicons were purified in the Molecular which is a Sardinella species, and “bluefin” tuna fillets
Biology and Biotechnology Laboratory of University are sold at a high price, yet consumers will later on
of Santo Tomas (UST) and were sent to Macrogen realize that they bought a different kind of fish.
Korea for sequencing. The resequencing was done as Hence, molecular identification using CO1 gene
needed. can be used to address the complexity and limitations
2.5 Phylogenetic Analysis of morphological characters in fishes to effectively
discriminate different species. Furthermore, CO1 gene
The maximum parsimony (MP) and has been proved to be an effective tool for a reliable
neighbor-joining (NJ) cladograms were created with and fast identification of commercially-important
fish species that were obtained from available online
fishes [15].
data. There is no reference sequence for Mystichtys
luzonensis found in the NCBI reference sequence 3.2 Purification of PCR Products
(http://www.ncbi.nlm.nih.gov/refseq). The sequences
Two PCR products from each lake were chosen for
were aligned using Clustal X software and were
DNA purification based on the intensity of bands.
determined to be suitable for the said phylogenetic
These are L1S1, L1S3, L2S1, L2S3, L3S1, L3S3,
trees [20]. All genetic distance analyses were
L4S1 and L4S3 (Fig. 2). However, results showed that
established using Molecular Evolutionary Genetics
L2S3, L3S1 and L3S3 have degraded DNA samples.
Analysis (MEGA) software version 6.0 [21]. Data for
Hence, only one sample from lake 2 can be used,
guanine and cytosine (GC) percentage were collected
while lake 3 is no longer represented.
using the sequence analysis provided by Macrogen.
The primer dimers found in each well called for
3. Results and Discussion another round of purification. Re-purification of the
good samples in Fig. 2 resulted to a very low intensity
3.1 CO1 Gene Amplified in All Samples
of primer dimmers, indicating that the gene of interest,
A total of 12 samples (Fig. 1), composed of the four CO1, was already purified (Fig. 3). These samples
different lakes with three replicates each, were used in were sent to Macrogen for sequencing.
this test. Except for the negative control containing no The degradation of the DNA in samples of L2S3,
template, all samples from the four different lakes L3S1 and L3S3 may be attributed to different factors,
showed positive amplification of the CO1 gene with such as abrupt change in temperature, storage,
approximately 650 bp. This confirmed that the frequent thawing, low DNA concentration and chemical
694 Species Identification of a Commonly Believed Sinarapan Fish Mystichtys luzonensis
(Smith, 1902) in Lakes Buhi and Bato of Bicol Region
2,072 bp
1,500 bp
600 bp
Fig. 1 Amplification of CO1 gene from all samples.
PCR products showing positive amplification at ~650 bp across all lanes except for negative control.
10,000 bp
1,000 bp
750 bp
500 bp
Fig. 2 Five samples showing positive amplification.
Purified PCR products in all lanes except L2S3, L3S1, L3S3 and negative control.
10,000 bp
4,000 bp
1,000 bp
750 bp
500 bp
Fig. 3 Purified PCR products showed positive amplification at 650 base pairs in all lanes except negative control.
Species Identification of a Commonly Believed Sinarapan Fish Mystichtys luzonensis 695
(Smith, 1902) in Lakes Buhi and Bato of Bicol Region
intervention. On the other hand, the purification of final dataset. Evolutionary analysis was conducted in
DNA resulted to the removal of possible contaminants, MEGA version 6 [21].
such as protein including other exogenous sources. The nucleotide composition of L1S1 is 2,777 (A),
3,811 (T), 1,559 (G) and 4,269 (C) with an average
3.3 L1S1 (Sample from Lake Buhi) and L4S1 (Sample
GC content of 47%. BLAST results revealed that
from Lake Bato)
L1S1 is 100% (five BLAST accessions) and 99%
From the five samples sent to Macrogen, there were (five BLAST accessions) homologous to L. plumbeus
three sets of re-sequencing and only two samples were (Table 1).
successfully sequenced. These are L1S1 and L4S1. The nucleotide composition of L4S1 is 2,207 (A),
Sequence read lengths ranged from 542 to 693 base 3,125 (T), 1,136 (G) and 3,107 (C) with an average
pair with an average length of 618 base pair long. No GC content of 46%. BLAST results revealed that
insertions, deletions or stop codons were observed, L4S1 is 98% (five BLAST accessions) and 99% (three
indicating the absence of nuclear mitochondrial BLAST accessions) homologous to R. giurinus (Table
pseudogenes (NUMTs) among sequences [15]. A 2).
simple evolutionary tree, representing the history of On the other hand, the NJ method for L1S1 and
collected species, was inferred using MP and NJ L4S1 (Fig. 5) produced an optimal tree with the sum
methods (Figs. 4 and 5). After the MP and NJ trees of branch length = 1.71780854 is shown. The
generation, DNA barcoding reliably grouped the percentage of replicate trees, in which the associated
species according to their families. Bootstrap analysis taxa clustered together in the bootstrap test, is shown
was accomplished using 1,000 pseudo replications to next to the branches. The evolutionary distances were
increase the validity of the results. computed using the maximum composite likelihood
The L1S1 formed a monophyletic group with method and are in the units of the number of base
Leiopotherapon plumbeus (bootstrap value of 99%) substitutions per site. The analysis involved 43
and L. unicolor (bootstrap value of 94%). Meanwhile, nucleotide sequences. All positions containing gaps
L4S1 formed a monophyletic group with R. giurinus and missing data were eliminated. There were a total
(bootstrap value of 99%). A separate monophyletic of 452 positions in the final dataset. Evolutionary
group of Rhinogoboius sp., and R. brunneus is analyses were conducted in Molecular Evolutionary
indicative that the aforementioned species can be Genetics Analysis (MEGA 6).
grouped with L4S1 vis-à-vis optimization in the Both cladograms (MP and NJ) showed that L1S1
parameters set in the MP tree. and L4S1 belong to another type of species, revealing
The MP cladogram of L1S1 and L4S1 (Fig. 4) had that the previous on-site collections are probably
a consistency index of 0.273543, the retention index is composed of a variety of fishes other than Sinarapan.
0.608696, and the composite index is 0.168478 for all Meanwhile, MP and NJ cladograms of L1S1 and
sites and parsimony-informative sites. The percentage L4S1 tell us that they are closely related to L.
of replicate trees, in which the associated taxa plumbeus and R. giurinus, respectively, and not
clustered together in the bootstrap test, is shown next directly associated with the other species.
to the branches. The MP tree was obtained using the It can be deduced that the reasons for obtaining
subtree-pruning-regrafting (SPR) algorithm. The different kinds of fish instead of Sinarapan are the
analysis involved 43 nucleotide sequences. All following: (1) government initiative to restock
positions containing gaps and missing data were different kinds of fish, (2) the introduction of invasive
eliminated. There were a total of 515 positions in the species, i.e., fish cages of tilapia, (3) the site of collection
696 Species Identification of a Commonly Believed Sinarapan Fish Mystichtys luzonensis
(Smith, 1902) in Lakes Buhi and Bato of Bicol Region
[22]
[23]
Fig. 4 The MP tree of L1S1 and L1S4.
Species Identification of a Commonly Believed Sinarapan Fish Mystichtys luzonensis 697
(Smith, 1902) in Lakes Buhi and Bato of Bicol Region
[22]
[23]
Fig. 5 The NJ tree of L1S1 and L1S4.
698 Species Identification of a Commonly Believed Sinarapan Fish Mystichtys luzonensis
(Smith, 1902) in Lakes Buhi and Bato of Bicol Region
Table 1 BLAST Result of L1S1 (Lake Buhi).
Description Max score Total score Query cover E value Ident Accession
L. plumbeus Voucher DB17.2 cytochrome oxidase
1,068 1,068 77% 0.0 99% KJ013049.1
subunit 1 (CO1) gene, partial cds: mitochondrial
L. plumbeus Voucher DB17.3 cytochrome oxidase
1,068 1,068 77% 0.0 99% KJ013048.1
subunit 1 (CO1) gene, partial cds: mitochondrial
L. plumbeus Voucher DB17.1 cytochrome oxidase
1,064 1,064 76% 0.0 100% KJ013047.1
subunit 1 (CO1) gene, partial cds: mitochondrial
L. plumbeus Voucher PNT-08 cytochrome oxidase
1,064 1,064 77% 0.0 99% KC789541.1
subunit 1 (CO1) gene, partial cds: mitochondrial
L. plumbeus Voucher Lplu1 cytochrome oxidase
1,064 1,064 77% 0.0 99% HQ654716.1
subunit 1 (CO1) gene, partial cds: mitochondrial
L. plumbeus Voucher Lplu1-LdB cytochrome
oxidase subunit 1 (CO1) gene, partial cds: 1,055 1,055 75% 0.0 100% HQ682700.1
mitochondrial
L. plumbeus Voucher Lplu2 cytochrome oxidase
1,055 1,055 75% 0.0 100% HQ654715.1
subunit 1 (CO1) gene, partial cds: mitochondrial
L. plumbeus Voucher Lplu3 cytochrome oxidase
1,055 1,055 75% 0.0 100% HQ654714.1
subunit 1 (CO1) gene, partial cds: mitochondrial
L. plumbeus Voucher Lplu4 cytochrome oxidase
1,055 1,055 75% 0.0 100% HQ654713.1
subunit 1 (CO1) gene, partial cds: mitochondrial
L. plumbeus Voucher Lplu5 cytochrome oxidase
1,044 1,044 75% 0.0 99% HQ654712.1
subunit 1 (CO1) gene, partial cds: mitochondrial
L. plumbeus Voucher Lu2 cytochrome oxidase
863 863 76% 0.0 94% KF227959.1
subunit 1 (CO1) gene, partial cds: mitochondrial
Table 2 BLAST result of L4S1 (Lake Bato).
Description Max score Total score Query cover E value Ident Accession
R. giurinus Voucher 1F75 cytochrome oxidase
968 968 75% 0.0 99% HQ536473.1
subunit 1 (CO1) gene, partial cds: mitochondrial
R. giurinus mitochondrion, complete genome 966 966 77% 0.0 98% KP892753.1
R. giurinus mitochondrion, complete genome 966 966 77% 0.0 98% KF371534.1
R. giurinus Voucher 1F74 cytochrome oxidase
963 963 75% 0.0 98% HQ536472.1
subunit 1 (CO1) gene, partial cds: mitochondrial
R. giurinus Voucher 2F13 cytochrome oxidase
957 957 75% 0.0 98% HQ536471.1
subunit 1 (CO1) gene, partial cds: mitochondrial
R. giurinus Voucher 2F12 cytochrome oxidase
957 957 75% 0.0 98% HQ536470.1
subunit 1 (CO1) gene, partial cds: mitochondrial
R. giurinus Voucher GB11159 cytochrome oxidase
841 841 64% 0.0 99% JX679057.1
subunit 1 (CO1) gene, partial cds: mitochondrial
R. giurinus Voucher GB11160 cytochrome oxidase
830 830 64% 0.0 99% JX679058.1
subunit 1 (CO1) gene, partial cds: mitochondrial
R. giurinus Voucher 1F88 cytochrome oxidase
586 586 75% 2e-163 86% HQ536462.1
subunit 1 (CO1) gene, partial cds: mitochondrial
R. giurinus Voucher 1F84 cytochrome oxidase
586 586 75% 2e-163 86% HQ536458.1
subunit 1 (CO1) gene, partial cds: mitochondrial
R. giurinus Voucher 1F79 cytochrome oxidase
580 580 75% 8e-162 86% HQ536463.1
subunit 1 (CO1) gene, partial cds: mitochondrial
has few population of Sinarapan due to overfishing, (4) Sinarapan. This is indicative of diminishing
Sinarapan can be confused with juvenile fishes population of Sinarapan which is associated to
because of similar morphological traits and (5) the overfishing as it commands a very high market price.
collection was heterogenous, therefore, it is possible Likewise, previous literatures mentioned that
that the extracted DNA may have come from a initiatives to restock Sinarapan was through the
different kind of fish. The approximately 100% dispersal of “goby fishes” but did not cite if they are
homology of LISI and L4S1 with L. plumbeus and R. indeed Sinarapan or may be other members of the
giurinus confirmed that the collections are not Goby family. In coming up with the relationships of
Species Identification of a Commonly Believed Sinarapan Fish Mystichtys luzonensis 699
(Smith, 1902) in Lakes Buhi and Bato of Bicol Region
the different fish species, the MP and NJ cladograms Camarines Sur and Albay as Protected Area under the
Category of Wildlife Sanctuary, Providing for its
using ClustalX and MEGA softwares are reported to
Management and for Other Purposes.” House Bill 1011,
be effective tools in species identification. Lastly, the the Sixteenth Congress of the Philippines. Accessed April
need to study the genome of Sinarapan (M. luzonensis) 26, 2015. http://www.congress.gov.ph/legisdocs/
is recommended, because there is no reference basic_16/HB01011.pdf.
[5] House of Representatives of the Philippines. 2013.
sequence in the online database for this kind of fish.
“Establishing Lake Manapao, Katugday, Danao and
Makuao Located within the Municipality of Buhi,
4. Conclusions
Camarines Sur and the Municipalities of Polangui and
This study concluded that the samples collected Malinao, Albay as a Protected Area to Be Known as the
Sinarapan Sanctuary, Providing for Its Management and
from the different lakes are not species of Sinarapan,
for Other Purposes.” Senate Bill No. 1046, the Sixteenth
but rather species of L. plumbeus (L1S1) and R. Congress of the Philippines. Accessed April 26, 2015.
giurinus (L4S1). Since these samples are members of http://www.senate.gov.ph/lisdata/1708514300!.pdf.
different species, they did not form a single [6] Escandor, J. 2012. “Senate Bill to Protect Sinarapan.”
Philippine Daily Inquiry. Accessed September 21, 2012.
evolutionary group. Furthermore, DNA barcoding is http://newsinfo.inquirer.net/274630/senate-bill-to-protect-
very useful in proving the true identity of unknown sinarapan.
samples. [7] Baroña, M. L. 2003. “Sinarapan Swims Home.”
Department of Agriculture, Bureau of Agricultural
Acknowledgments Research, April-June 2003, Vol. 5, No. 2. Accessed April
2, 2015. http://www.bar.gov.ph/.
The authors would like to express their gratitude to [8] Soliman, V. S. 1991. “Exploitation Rate, Yield per
Dr. Drusila Esther Estenor Bayate of BFAR-NFRDI, Recruit and Virtual Population of Sinarapan (Mistichthys
Dr. Mudjekeewis Dalisay Santos and staff of Genetic luzonensis) in Lake Manapao, Buhi, Camarines Sur.”
Transactions of the National Academy of Science and
Fingerprinting Laboratory of BFAR-NFRDI for their Technology Republic of the Philippines. Accessed April
kindness, technical assistance, and for allowing the 23, 2015. http://scinet.dost.gov.ph/union/UploadFiles/
researchers to conduct this research in their laboratory. download.php?b=STII-B-00942_A3053_113-122_31913
They are also very thankful to Dr. Mary Beth Bacano 2.pdf&f=../Downloads/STII-B-00942_A3053_113-122_3
19132.pdf&t=application/pdf.
Maningas and staff of the Molecular Biology and [9] Soliman, V. S., and Sergio, M. F. H. A. 2001. “Managing
Biotechnology Laboratory of the University of Santo ‘Sinarapan’ Mistichthys luzonensis Smith in Lake Buhi,
Tomas—Research Center for Natural and Applied Camarines Sur: Insights from Its Biology and Population
Sciences for their generosity and expertise. To God be Dynamics.” In Conservation and Ecological
Management of Philippine Lakes in Relation to Fisheries
the glory.
and Aquaculture, edited by Santiago, C. B., Cuvin-Aralar,
M. L., and Basiao, Z. U. Iloilo, Philippines: Southeast
References
Asian Fisheries Development Center, 113-22.
[1] Foot, T. 2001. Guinness Book of World Records. New [10] Plopenio, J. C., and Bimedia, S. B. 2011. Water Quality
York: Guinness World Records Ltd.. Monitoring in Lake Buhi, Camarines Sur. Report Paper
[2] Froese, R., and Pauly, D. 2015. “FishBase.” Species 2000 No. 1, Institute for Environmental Conservation and
& ITIS Catalogue of Life, Naturalis, Leiden, the Research Ateneo De Naga University (IECR-ADNU),
Netherlands. Accessed August 26, 2015. Naga City.
http://www.catalogueoflife.org/col/. [11] Mace, G. M. 2004. “The Role of Taxonomy in Species
[3] Soliman, V. S. 1989. “Population Dynamics of Sinarapan Conservation.” Philios. Trans. Roy. Soc. B: Biol. Sci. 359
(Mystichthys luzonensis Smith) in Lake Manapao, Buhi, (1444): 711-9.
Camarines Sur, Philipines.” M.Sc. thesis, Central Luzon [12] Ordoñez, J. F., Ventolero, M. F., and Santos, M. D. 2016.
State University, Munoz, Nueva Ecija, Philippines. “Maternal Mismatches in Farmed Tilapia Strains
[4] House of Representatives of the Philippines. 2013. (Oreochromis spp.) in the Philippines as Revealed by
“Establishing Sinarapan Santuary in the Provinces Mitochondrial CO1 Gene.” Mitochondrial DNA A: DNA
700 Species Identification of a Commonly Believed Sinarapan Fish Mystichtys luzonensis
(Smith, 1902) in Lakes Buhi and Bato of Bicol Region
Map. Seq. Anal. 12: 1-10. [19] Maralit, B. A., Aguila, R. D., Ventolero, M. F., Perez, S.
[13] Frezal, L., and Leblois, R. 2008. “Four Years of DNA K., Willette, D. A., and Santos, M. D. 2013. “Detection
Barcoding: Current Advances and Prospects.” Infect. of Mislabeled Commercial Fishery By-products in the
Genet. Evol. 8 (5): 727-36. Philippines Using DNA Barcodes and Its Implications to
[14] Hebert, P. D., Cywinska, A., Ball, S. L., and De Waard, J. Food Traceability and Safety.” Journal of Food Control
R. 2003. “Biological Identifications through DNA 33 (1): 119-25.
Barcodes.” Proc. Biol. Soc. 270 (1512): 313-21. [20] Santos, M., Lopez, G., and Barut, N. A. 2010. “A Pilot
[15] Yambot, A. V., and Alcantara, S. G. 2014. “DNA Study on the Genetic Variation of Eastern Little Tuna
Barcoding of Commercially Important Grouper Species (Euthynnus affinis) in Southeast Asia.” Phil. J. of Science
(Perciformes, Serranidae) in the Philippines.” 139 (1): 43-50.
Mitochondrial DNA 19: 1-9. [21] Tamura, K., Stecher, G., Peterson, D., Flipski, A., and
[16] Folmer, O., Black, M., Hoeh, W., Lutz, R., and Kumar, S. 2013. “MEGA 6: Molecular Evolutionary
Vrijenhoek, R. 1994. “DNA Primers for Application of Genetics Analysis (MEGA) Software Version 6.0.”
Mitochondrial Cytochrome c Oxidase Subunit from Molecular Biology and Evolution 30 (12): 2725–2729
Diverse Metazoan Invertebrates.” Mol. Mar. Biol. [22] Froese, R., and Pauly, D. 2011. “Mistichthys luzonensis
Biotechnol 3 (5): 294-9. (Smith, 1902).” FishBase. Accessed April 13, 2015.
[17] Knowlton, N., and Weight, L. A. 1998. “New Dates and http://fishbase.org/summary/Mistichthys-luzonensis.html.
New Rates for Divergence across the Isthmus of Panama.” [23] World Conservation Monitoring Centre. 1996.
Proc. R. Soc. B: Biol. Sci. 265 (1412): 2257-63. “Mistichthys luzonensis.” The IUCN Red List of
[18] Doyle, J. 1987. “DNA Protocols for Plants.” Mol. Tech. Threatened Species. Accessed April 13, 2015.
in Taxonomy 57: 283-93. http://www.iucnredlist.org/details/13586/0.
