SIBUGAY TECHNICAL INSTITUTE INCORPORATED

Lower Taway, Ipil, Zamboanga Sibugay

www.sibugaytech.edu.ph
[email protected]

School President: 0917-127-1826/ 0917-127-1902 Academic Dean: 0906-439-3454

Registrar’s Office: 0935-342-0564 Guidance Coach: 0949-751-0953
DSA: 0935-119-0287 Principal: 0950-801-4326

GEN BIO 2
GENERAL BIOLOGY 2

LEARNER’S MODULE
(UNIT - FINAL)

TEACHER/S CONTACT NO. GRADE AND STRAND

DARYL JAY B. SANCO 09356556630

_________________________________________
Student’s Name

1
 Senior High School

General Biology 2
Quarter 1 - Module 1
GENETICS

GENERAL BIOLOGY 2

2
 Earth Science- Grade 12 Alternative
Delivery Mode Quarter 1 - Module 1:
Genetics
First Edition, 2020

Republic Act 8293, section 176 states that: No copyright shall subsist in any work
of the Government of the Philippines. However, prior approval of the government agency or
office wherein the work is created shall be necessary for exploitation of such work for profit.
Such agency or office may, among other things, impose as a condition the payment of
royalty.

Borrowed materials (i.e., songs, stories, poems, pictures, photos, brand names,
trademarks, etc.) included in this book are owned by their respective copyright holders.
Every effort has been exerted to locate and seek permission to use these materials from
their respective copyright owners. The publisher and authors do not represent nor claim
ownership over them.

Published by the Department of Education – Division of Cagayan de Oro Schools

Division Superintendent: Dr. Cherry Mae L. Limbaco, CESO V

Development Team of the Module

Author:

rley Merida, Duque Caguindangan, Eleanor Rollan, Rosemarie Dullente, Marife Ramos, January Gay Valenzona, Mary Sier
ica Bunani Cuňado, Kyla Mae L. Duliano Management Team
co, Ph.D., CESO V

Co-Chairperson: Alicia E. Anghay, Ph.D., CESE

Assistant Schools Division Superintendent

Members Lorebina C. Carrasco, OIC-CID Chief Jean S. Macasero, EPS- Science Joel D. Pota
Gemma Pajayon, PDO II
Evelyn Q. Sumanda, School Head Cely B. Labadan, School Head

Printed in the Philippines by

Department of Education – Division of Cagayan de Oro City
Office Address: Fr. William F. Masterson Ave Upper Balulang Cagayan de Oro
Telefax: (08822)855-0048
E-mail Address: [email protected]

3
 Senior High School

General Biology
2
Quarter 1 - Module 1:
Genetics

This instructional material was collaboratively developed and reviewed by educators from public an
We value your feedback and recommendations.

4
This page is intentionally blank

5
 Table of Contents

What This Module is About................................................................................................. i

What I Need to Know.......................................................................................................... ii
How to Learn from this Module.......................................................................................... ii
Icons of this Module........................................................................................................... iii

What I Know..................................................................................................................... iii

First Quarter
UNIT TEST –Lesson 1: (Week 1) Genetic Engineering
What I Need to Know.................................................................................. 13
What’s I Know: Definition of Terms............................................................. 13
What New.................................................................................................... 13
What is It: Leaning Concepts................................................................... 14-15

What’s More: Poster Making....................................................................... 16

What’s I’ve learned: Determining Genetic Technology................................ 16
What I Can Do: Pros and Cons................................................................... 16

UNIT TEST –Lesson 2: (Week 2) Applications of Recombinant

DNA
What I Need to Know.................................................................................. 17
What’s I Know: Definition of Terms............................................................. 17

What’s New: Designer Genes..................................................................... 17

What’s Is It: Learning Concepts............................................................... 16-20

What’s More:.............................................................................................. 20
What I’ve Learned......................................................................................21

PRELIM –Lesson 3: (Week 3) History of Life on Earth

What I Need to Know.................................................................................. 22

What I Know: Definition of Terms............................................................... 22

What’s New................................................................................................ 22

What is It: Learning Concepts................................................................. 23-25

What I Have Learned:.............................................................................. 25-26

PRELIM –Lesson 4: (Week 4) Mechanisms that Produce Change

6
in Populations

What I Need to Know.................................................................................. 27

What I know: Definition of Terms................................................................ 27

What’s New: A Picture Paint a Thousand Words........................................ 27

What is It: Learning Concept....................................................................28-30

MIDTERM –Lesson 5: (Week 5) Evolution and Origin of

Biodiversity: Patterns of Descent with Modification

What I Need to Know.................................................................................. 31

What I Know: Definition of Terms............................................................... 31

What’s New................................................................................................ 31

What is It: Learning Concepts.................................................................... 32-33

What’s More............................................................................................... 33
What I’ve Learned:...................................................................................33-34
MIDTERM –Lesson 6: (Week 6) Development of Evolutionary
Thought

What I Need to Know.................................................................................. 35

What’s New................................................................................................ 35

What Is It: Learning Concepts..................................................................... 35

What’s More: Charles Darwin Journey.................................................... 36-37

What I Have Learned:................................................................................. 38

PREFINAL -Lesson 7: (Week 7) Evidences of Evolution

What I Need to Know.................................................................................. 39

What’s New................................................................................................ 39

What Is It: Learning Concepts..................................................................... 40

What’s More: Evolution Evidences.......................................................... 41-42

PREFINAL -Lesson 8: (Week 8) Evolutionary Relationships of
Organisms

What I Need to Know.................................................................................. 43

What I Know: Definition of Terms............................................................... 43

What’s New: Family Features..................................................................... 43

What is It: Learning Concepts................................................................. 44-45

7
 What’s More: Phylogenic Tree.................................................................... 46
What I Can Do............................................................................................46

FINAL –Lesson 9: (Week 9) Systematics Based on

Evolutionary Relationships: Tree of Life and Systematics
What I Need to Know.................................................................................. 47
What I Know: Definition of Terms............................................................... 47

What’s New: Similarities and Uniqueness................................................... 47

What is It: Learning Concept................................................................48-49

What’s More: Essay.................................................................................... 50

FINAL –Lesson 10: (Week 10) Systematics Based on

Evolutionary Relationships: Taxonomy
What I Need to Know.................................................................................. 51
What I Know: Definition of Terms............................................................... 51

What’s New................................................................................................ 51

What is It: Learning Concepts..................................................................... 52

What’s More: Practical Uses of Biological Classification............................. 53

FINAL –Lesson 11: (Week 11) Systematics Based on

Evolutionary Relationships: Cladistics and Phylogeny
What I Need to Know.................................................................................. 54
What I Know: Definition of Terms............................................................... 54

What’s New................................................................................................ 54

What Is It: Learning Concept...................................................................... 55

What’s More: Phylogenic Tree.................................................................... 55

What I Can Do............................................................................................55

References....................................................................................................................... 56

8
This page is intentionally blank

9
 Module 1
Genetics
What This Module is About

This module demonstrates your understanding of the characteristics of Earth

that are necessary to support life, particularly on the essential components of this
planet that drives all living things or biotic factors (plants, animals, microorganisms)
to exist. It also emphasizes on the different subsystems (geosphere, hydrosphere,
atmosphere, and biosphere) that make up the Earth and how these systems interact
to produce the kind of Earth we live in today.

This module will help you explore the key concepts on topics that will help you
answer the questions pertaining to our very own, planet earth.

This module has eleven (11) lessons:

 Lesson 1: Genetic Engineering
 Lesson 2: Applications of Recombinant DNA
 Lesson 3: History of Life on Earth
 Lesson 4: Mechanisms that Produce Change in Populations
 Lesson 5: Evolution and Origin of Biodiversity: Patterns of Descent with
Modification
 Lesson 6: Development of Evolutionary Thought
 Lesson 7: Evidences of Evolution
 Lesson 8: Evolutionary Relationships of OrganismsLesson 9:
Systematics Based on Evolutionary Relationships: Tree of Life and
Systematics
 Lesson 10: Systematics Based on Evolutionary Relationships:
Taxonomy
 Lesson 11: Systematics Based on Evolutionary Relationships:
Cladistics and Phylogeny

What I Need to Know

After going through this module, you are expected to:
1. Outline the processes involved in genetic engineering. (STEM_BIO11/12-IIIa-b-6)
2. Discuss the applications of recombinant DNA. (STEM_BIO11/12-IIIa-b-7)
3. Describe general features of the history of life on Earth, including generally accepted
dates and sequence of the geologic time scale and characteristics of major groups of
organisms present during these time periods. (STEM_BIO11/12-IIIc-g-8)
4. Explain the mechanisms that produce change in populations from generation to
generation (e.g., artificial selection, natural selection, genetic drift, mutation,
recombination) (STEM_BIO11/12-IIIc-g-9)
5. Show patterns of descent with modification from
6. Common ancestors to produce the organismal diversity observed today.
STEM_BIO11/12-IIIc-g-10
7. Trace the development of evolutionary thought (STEM_BIO11/12-IIIc-g-11)

10
8. Explain evidences of evolution (e.g., biogeography, fossil record, DNA/protein
sequences, homology, and embryology) (STEM_BIO11/12-IIIc-g-12)
9. Infer evolutionary relationships among organisms using the evidence of evolution.
(STEM_BIO11/12-IIIc-g-13)
10. Explain how the structural and developmental characteristics and relatedness of DNA
sequences are used in classifying living things. STEM_BIO11/12IIIhj-14
11. Identify the unique/ distinctive characteristics of a specific taxon relative to other taxa
(STEM_BIO11/12IIIhj-15)
12. Describe species diversity and cladistics, including the types of evidence and
procedures that can be used to establish evolutionary relationships.
(STEM_BIO11/12IIIhj-16)

11
How to Learn from this Module
To achieve the learning competencies cited above, you are to do the following:
• Take your time reading the lessons carefully.
• Follow the directions and/or instructions in the activities and exercises diligently.
• Answer all the given tests and exercises.

Icons of this Module

What I Need to This part contains learning objectives that
Know are set for you to learn as you go along the
module.

What I know This is an assessment as to your level of

knowledge to the subject matter at hand,
meant specifically to gauge prior related
knowledge
What’s In This part connects previous lesson with that
of the current one.

What’s New An introduction of the new lesson through

various activities, before it will be presented
to you

What is It These are discussions of the activities as a

way to deepen your discovery and under-
standing of the concept.

What’s More These are follow-up activities that are in-

tended for you to practice further in order to
master the competencies.

What I Have Activities designed to process what you

Learned have learned from the lesson

What I can do These are tasks that are designed to show-

case your skills and knowledge gained, and
applied into real-life concerns and situations.

II

12
This page is intentionally blank

13
 Lesson
Genetic Engineering
1
UNIT TEST (week 1)

What I need to know

Learning Competency
The learners should be able to outline the steps involved in genetic engineering
(STEM_BIO11/12-III a-b-6)

At the end of the lesson, the learners will be able to:

• compare classical breeding with modern genetic engineering techniques;
• enumerate the steps in molecular cloning;
• describe some methods to introduce DNA into cells; and
• explain the selection and screening of transformants / genetically modified
organisms (GMOs)

What I know

Definition of Terms:

1. Genetic Engineering 6. Genome

2. DNA 7. Gene Mapping
3. Recombinant DNA 8. Biotechnology
4. Plasmids 9. Polymerase Chain Reaction
5. Cloning 10. Gene Therapy

What’s new

PRE-ACTIVITY:

1. How organisms may be modified?

2. Enumerate plants and animals that have desirable or enhanced traits and how each of the traits
was introduced or developed. Modifying Technique ex. Classical Breeding, Recombinant DNA
Technology.

ENHANCED TRAIT MODIFYING TECHNIQUE

Example: Flavr-Savr (Delayed Ripening Recombinant DNA Technology
Tomatoes
1. 1.
2. 2.
3. 3.
4. 4.

14
5. 5.

15
 What’s is it

INTRODUCTION:

 Genetic engineering, the artificial manipulation, modification, and recombination of DNA or

other nucleic acid molecules in order to modify an organism or population of organisms.
 The term genetic engineering initially referred to various techniques used for the
modification or manipulation of organisms through the processes of heredity and
reproduction. As such, the term embraced both artificial selection and all the interventions
of biomedical techniques, among them artificial insemination, in vitro fertilization (e.g.,
“test-tube” babies), cloning, and gene manipulation.
https://www.britannica.com/science/genetic-engineering

 Classical plant breeding uses deliberate interbreeding (crossing) of closely or distantly

related individuals to produce new crop varieties or lines with desirable properties. Plants
are crossbred to introduce traits/genes from one variety or line into a new genetic
background.
https://www.sciencedaily.com/terms/plant_breeding.htm#:~:text=Classical%20plant%20breeding%20uses%20deliberate,i
nto%20a%20new%20genetic%20background.

 Genetic engineering is the process of using recombinant DNA (rDNA) technology to alter the
genetic makeup of an organism. Traditionally, humans have manipulated genomes indirectly
by controlling breeding and selecting offspring with desired traits. Genetic engineering
involves the direct manipulation of one or more genes. Most often, a gene from another
species is added to an organism's genome to give it a desired phenotype.
Genetic engineering involves the use of molecular techniques to modify the traits of a target
organism. The modification of traits may involve:
1. introduction of new traits into an organism
2. enhancement of a present trait by increasing the expression of the desired gene
3. enhancement of a present trait by disrupting the inhibition of the desired genes’
expression.
A general outline of recombinant DNA may be given as follows:
1. cutting or cleavage of DNA by restriction enzymes (REs)
2. selection of an appropriate vector or vehicle which would propagate the recombinant DNA
( eg. circular plasmid in bacteria with a foreign gene of interest)
3. ligation (join together) of the gene of interest (eg. from animal) with the vector (cut bacterial
plasmid)
4. transfer of the recombinant plasmid into a host cell (that would carry out replication to
make huge copies of the recombined plasmid)
5. selection process to screen which cells actually contain the gene of interest
6. sequencing of the gene to find out the primary structure of the
protein Ways in which these plasmids may be introduced into host organisms:
 Biolistics. In this technique, a “gene gun” is used to fire DNA-coated pellets on plant
tissues.
Cells that survive the bombardment, and are able to take up the expression plasmid coated
pellets and acquire the ability to express the designed protein.

16
  Plasmid insertion by Heat Shock Treatment. Heat Shock Treatment is a process used to
transfer plasmid DNA into bacteria. The target cells are pre-treated before the procedure to
increase the pore sizes of their plasma membranes. This pretreatment (usually with CaCl2) is
said to make the cells “competent” for accepting the plasmid DNA. After the cells are
made competent, they are incubated with the desired plasmid at about 4°C for about
30min. The plasmids concentrate near the cells during this time. Afterwards, a “Heat
Shock” is done on the plasmid-cell solution by incubating it at 42°C for 1 minute then back
to 4°C for 2 minutes. The rapid rise and drop of temperature is believed to increase and
decrease the pore sizes in the membrane. The plasmid DNA near the membrane surface are
taken into the cells by this process. The cells that took up the plasmids acquire new traits
and are said to be “transformed”.
 Electroporation. This technique follows a similar methodology as Heat Shock Treatment, but,
the expansion of the membrane pores is done through an electric “shock”. This
method is commonly used for insertion of genes into mammalian cells.
Some methods are:
 Selection of plasmid DNA containing cells
 Selection of transformed cells with the desired gene
 PCR detection of plasmid DNA
 Genetically Modified Organisms (GMOs)

What’s more

Poster Making:

Create a poster on the steps and other methods involved in recombinant DNA.

What’s I’ve learned

POST QUIZ:

1. Determine which technologies are most appropriate for which cell types.

TECHNOLOGY CELL TYPE

1 Plants cells
2. Electroporation
3.Biolistics
4. Bacterial cells
5. Mammalian cells

17
 What’s I can do

PERFORMANCE TASK:

1. Research on the pros and cons of genetic engineering.

PROS CONS
1.
2.
3.
4.
5.
2. What is your opinion on Genetic Engineering? Note: Support your opinion with facts and include
the issue of biosafety.

RECOMMENDED READINGS:

1. https://www.ck12.org/book/human-biology-genetics/section/10.1/
2.https://www.ck12.org/c/biology/biotechnology/lesson/Biotechnology-
BIO/?referrer=concept_details
3.https://www.khanacademy.org/science/biology/biotech-dna-technology/intro-to-biotech-
tutorial/a/intro-to-biotechnology

18
 Lesson Discuss the Applications of Recombina
2
UNIT TEST (week 2)

What I need to know

Learning Competency:
The learners should be able to discuss the applications of Recombinant DNA
Technology (STEM_BIO11/12-III a-b-7)

Specific Learning Outcomes:

At the end of the lesson, the learners will be able to:
• give examples of products from recombinant DNA technology;
• illustrate the use of databases to search genes for desired traits;
• describe steps in PCR to amplify and detect a gene of interest;
• identify the parts of an expression vector;
• explain how genes may be cloned and expressed

What I know

PRIOR KNOWLEDGE: Definition of Terms

1. Clone 6. Modified Trait

2. Plasmids 7. Human Genome
3. Biotechnology 8. Genetic Modified Organism
4. PCR Amplification
5. Detection

What’s new

PRE-ACTIVITY: Designer Genes Work

1. How does DNA Replicate?
2. What is Genetically Modified Organism (GMO)?
3. Illustrate your own Designer genes based on the following:
1. Identify a special trait.
2. Identify a source organism.
3. Identify a target organism.
4. Identify the modified/ added trait.
Example: Hot Tomato > Chili > Tomato > Spicy Tomato

19
Tomatoes

It was reported this week that Brazilian scientists are hoping to create spicy tomatoes using Crispr
gene-editing techniques. Although tomatoes contain the genes for capsaicinoids (the chemicals that
give chillies their heat) they are dormant – Crispr could be used to make them active. This is
desirable because, compared to tomatoes, chillies are difficult to farm – and capsaicinoids have
other useful applications besides their flavour – in pepper spray for example.
https://www.theguardian.com/science/2019/jan/13/the-five-genetically-modified-fruit-edited-bananas-tomatoes

What’s is it

INTRODUCTION:

PRESENTATION OF RECOMBINANT DNA

There are many different traits that can be introduced to organisms to change their properties. The
following table shows examples of modified traits using cloned genes and their applications:

MODIFIED TRAIT GENE MODIFICATION RECIPIENT ORGANISM APPLICATION (FIELD)

Insulin Production Insertion of Human Bacteria (Medicine)
Insulin Gene Production of Human
Insulin in Bacteria
Pest Resistance Insertion of Bt-toxin Corn / Maize (Agriculture)
gene Production of corn
plants with increased
resistance to corn
boxer
Delayed Ripening Disruption of a gene Tomato plant Agriculture)
for a ripening enzyme Production of plants
(e.g. with fruits that have
polygalacturonase) delayed ripening
fruits. These fruits will
survive longer
transport time,
allowing their delivery
to further locations
(i.e. export deliveries)
Chymosin Production Insertion of a gene for Bacteria (Industry)
chymosin Enhance large scale
production of
chymosin. This
enzyme
serves as a substitute
for rennet in the
coagulation of milk.
Rennet has to be
harvested from calves.
The large scale
production of this
enzyme in bacteria
provides an abundant
supply of this
important component

20
 for the cheese
production industry.
 PCR Amplification
Once a desired trait is chosen, information must be acquired for either its detection or expression in a
given organism.

1. Detection
 Some researchers may be interested in determining if a given gene/trait is available in a
particular organism. If no previous research provides this information, researchers may test
the DNA of different organisms for the presence of these specific genes. A technique that
allows the detection of specific genes in target organisms is called PCR.
 PCR amplification is an in-vitro method that simulates DNA replication in vivo. It utilizes a
thermostable (heat-resistant) DNA polymerase that builds single stranded DNA strands unto
unwound DNA templates.
 PCR uses repeated cycles of incubation at different temperatures to promote the unwinding
of the DNA template (~95°C); the annealing of a primer (a ~20bp oligonucleotide sequence
(recall RNA primers in DNA replication) onto the ssDNA template strand (~54 - 60°C); and the
extension of the generated ssDNA strand through the binding of complementary bases to
the template strand (~72° C). The thermostability of the polymerase allows it to survive the
repeated cycles of denaturation, annealing and extension with little loss of enzyme function.
Each cycle of PCR doubles the amount of the target sequence. A typical PCR experiment
uses about 35 cycles of amplification. This increases the original amount of the target
sequence by 235 (i.e. ~34 billion) times.
 Gene detection by PCR involves the design of primers that would only bind to sequences
that are specific to a target. For example, researchers would want to find out if gene X (e.g.
the gene for insulin) is available in a target organism (e.g. a mouse, Mus musculus). Primers
may be designed by looking at the available sequences for gene X in the databases (e.g. all
the genes for insulin in different organisms; humans, pigs, cows, etc.). The different gene X
sequences must be aligned/ compared to match areas of sequence similarity (conserved
sequences) and areas of sequence dissimilarity (non-conserved sequences). Primers
designed to have the same sequence as the conserved areas will be specific for binding gene
X sequences in all the target organisms. Primers designed to have the same sequence as the
non-conserved areas will only be specific for the organisms which match its sequence.
STEPS in PCR Amplification

 Step 0: Undenatured Template ; Temp ~ 54 °"C;

Template: double stranded (ds) DNA strand. Complementary sequences are held together by H-bonds
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand)
3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand)

 Step 1: Template denaturation ; Temp ~ 95 °"C;

Template: single stranded (ss) DNA strands; DNA strands are separated; H-bonds between
complementary sequences are broken
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand)
3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand)
 Step 2: Primer Annealing ; Temp ~ 54 °"C (dependent on primer melting temperature);
Template: ssDNA strands. H-bonds are formed between complementary sequences on the
primers and the target sequences.
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand)
Direction of elongation  CCATAGATC (Reverse Primer)

21
5’ GCGATGAGG 3’ → Direction of elongation (Forward Primer)

3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand)

 Step 3: New DNA strand elongation ; Temp ~ 72 °"C;
The two new dsDNA strands are formed by the elongation of the generated ssDNA and the H-bonds
between the complementary sequences on these new strands and their templates. Each of the new
dsDNA strands is made up of one old strand from the original template, and one new strand that was
generated as a reverse complement of the template. This is called semiconservative replication of
the sequence.

New Strand 1:
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand) (old)
3’ CGCTACTCCTATACTGGGCTATCTATCTCCATAGATC-5’ (Reverse Primer) (new)

New Strand 2:
5’ GCGATGAGGATATGACCCGATAGATAGAGGTATCTAG-3’ (Forward Primer) (new)
3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand) (old)

 Step 4: Repeat step 1 to 3 for N number of cycles (N is usually 35)

PCR Results
The expected product of PCR amplification will depend on the sequences / position at which the
primer sequences bind. If the forward primer starts binding at nucleotide 3 (coming from the 5’
end)
of
a 43bp long gene, and the reverse primer binds at a position complementary to nucleotide 39 of the
coding strand, then a 37bp product is expected per cycle of PCR.

PCR Applications

 PCR may be used to detect the presence of a desired gene in an organism. Depending on the
primer design, the expected product may represent only a specific region of the gene or the
entire gene itself. The first case is useful for detection of the gene, or the detection of
organisms with that specific gene within a sample. The second case is useful for the
amplification of the entire gene for eventual expression in other organisms. The direct
amplification/copying of a full gene is part of the process for “cloning” that gene.
2. Cloning and Expression
 Some genes provide economically, and industrially important products (e.g. insulin-coding
genes; genes for collagen degradation). In some cases, scientists would want to put these
genes into organisms for the expression of their products. One example would be the
insertion of an insulin- coding gene from the human genome into bacteria. This allows the
“transformed” bacteria to now produce human insulin as a product.
 Certain types of bacteria are capable of this process since they are able to take genes within
their cell membranes for eventual expression. The genes are normally in the form of small,
circular DNA structures called plasmids.

What’s more

ACTIVITY:

1. Illustrate the steps in restriction digestion and PCR.

22
 What’s I’ve learned

POST QUIZ:

1. Discuss how PCR may be used for the detection of disease-causing pathogens in a population
during the COVID Pandemic.
For example: it may be used to check if a patient has a COVID virus infection.
2. Discuss how the cloning and expression of certain genes allows for massive production of the
desired product.
For Example: the cloning and expression of insulin in bacteria allows for the mass
production of this necessary protein for use by diabetic patients.

RECOMMENDED READINGS:

1. https://flexbooks.ck12.org/cbook/ck-12-middle-school-life-science
2.0/section/3.18/primary/lesson/recombinant-dna-ms-ls
2. https://www.ck12.org/book/cbse_biology_book_class_xii/section/14.1/
3. https://www.ck12.org/section/dna-technology/

23
 Lesson History of Life on Earth
3
PRELIM (week 3)

What I need to know

Learning Competency
The learners describe general features of the history of life on Earth, including generally accepted
dates and sequence of the geologic time scale and characteristics (STEM_BIO11/12-IIIc-g-8)

Specific Learning Outcomes

At the end of the lesson, the learners will be able to:
• identify the dates and sequence of the periods in the geologic time scale;
• identify the major events in each major period;
• describe the characteristics of the major groups of organisms’ presents during a time period;
• identify types of fossils; and
• describe causes of mass extinctions.

What I know

PRIOR KNOWLEDGE: Definition of Terms

1. Precambrian 6. Cambrian 11. Permian

2. Paleozoic 7. Ordovician 12. Triassic
3. Mesozoic 8. Silurian 13. Jurassic
4. Cenozoic 9. Devonian 14. Cretaceous
5. Epoch 10. Carboniferous

What’s new

PRE-ACTIVITY:

1. What is the age of the Earth?

2. What was the Earth like million years ago? Describe.
3. Watch a video clip on YouTube. Geological Time Scale and Fossils
(https://www.youtube.com/watch?v=3EfewdEC8bk)

24
 What’s is it

INTRODUCTION:

https://clarkscience8.weebly.com/geologic-time-scale.html

The Geological Time Scale (GTS)

A. Four eras - Precambrian; Paleozoic; Mesozoic; Cenozoic

25
B. Periods under the Paleozoic era - Cambrian, Ordovician, Silurian, Devonian, Carboniferous,
Permian
C. Periods under the Mesozoic era - Triassic, Jurassic, Cretaceous
D. Periods under the Cenozoic era - Tertiary and Quaternary

CAMBRIAN EXPLOSION is the belief that there was a sudden, apparent explosion of diversity in life
forms about 545 million years ago. The explosion created the complexity of multi-celled organisms in
a relatively short time frame of 5 to 10 million years. This explosion also created most of the major
extant animal groups today.
TYPES OF FOSSILS DESCRIPTION EXAMPLES
Molds Impression made in a Shells
substrate = negative image of
an organism
Casts When a mold is filled in Bones and teeth
Petrified Organic material is converted Petrified trees;
into stone Coal balls (fossilized plants and
their tissues, in round
ball shape)
Original Remains Preserved wholly (frozen in Woolly mammoth;
ice, trapped in tar pits, dried/ Amber from the Baltic Sea
dessicated inside caves in arid region
regions or encased in amber/
fossilized resin)
Carbon Film Carbon impression in Leaf impression on the rock
sedimentary rocks
Trace/ Ichnofossils Record the movements and Trackways, toothmarks,
behaviors of the organism gizzard rocks, coprolites
(fossilized dungs), burrows
and
nests
THE SIX WAYS OF FOSSILIZATION
1. Unaltered preservation - Small organism or part trapped in amber, hardened plant sap
2. Permineralization/ Petrification - The organic contents of bone and wood are replaced
with silica, calcite or pyrite, forming a rock-like fossil
3. Replacement - hard parts are dissolved and replaced by other minerals, like calcite,
silica, pyrite, or iron
4. Carbonization or Coalification - The other elements are removed and only the
carbon remained
5. Recrystalization - Hard parts are converted to more stable minerals or small crystals turn
into larger crystals
6. Authigenic preservation - Molds and casts are formed after most of the organism have been
7. destroyed or dissolved
DATING FOSSILS
Knowing the age of a fossil can help a scientist establish its position in the geologic time scale and
find its relationship with the other fossils. There are two ways to measure the age of a fossil: relative
dating and absolute dating.

1. RELATIVE DATING
 Based upon the study of layer of rocks
 Does not tell the exact age: only compare fossils as older or younger, depends on their
position in rock layer

26
  Fossils in the uppermost rock layer/ strata are younger while those in the lowermost
deposition are oldest

How Relative Age is Determined

 Law of Superposition: if a layer of rock is undisturbed, the fossils found on upper layers are
younger than those found in lower layers of rocks
 However, because the Earth is active, rocks move and may disturb the layer making this
process not highly accurate
Rules of Relative Dating
(From: http://staff.harrisonburg.k12.va.us/~esutliff/forms/Relative_Dating_1334236393.ppt)

A. LAW OF SUPERPOSITION: Sedimentary layers are deposited in a specific time- youngest rocks on
top, oldest rocks at the bottom
B. LAW OF ORIGINAL HORIZONTALITY: Deposition of rocks happen horizontally- tilting, folding or
breaking happened recently

C. LAW OF CROSS-CUTTING RELATIONSHIPS: If an igneous intrusion or a fault cuts through existing

rocks, the intrusion/fault is YOUNGER than the rock it cuts through
INDEX FOSSILS (guide fossils/ indicator fossils/ zone fossils): fossils from short-lived organisms that
lived in many places; used to define and identify geologic periods

2. ABSOLUTE DATING
• Determines the actual age of the fossil
• Through radiometric dating, using radioactive isotopes carbon-14 and potassium-40
• Considers the half-life or the time it takes for half of the atoms of the radioactive element to
decay
• The decay products of radioactive isotopes is stable atoms.

What’s I’ve learned

MULTIPLE CHOICE. Choose the letter of the correct answer.

1. The largest division of the geologic time scale is the

A. Eon
B. Era
C. Period
D. Epoch

2. The Mesozoic Era was the Age of Reptiles while the current
Cenozoic Era is the Age of
A. Mammals
B. Birds
C. Humans
D. Technology

3. The layers in sedimentary rocks are also called

A. eras
B. epochs
C. strata
D. gaps
27
4. The movie “Jurassic Park” got its title from which era?
A. Paleozoic
B. Mesozoic
C. Cenozoic
D. Holozoic

5. During which era were the first land plants formed?

A. Cambrian
B. Pre-Cambrian
C. Paleozoic
D. Mesozoic

6. The era of middle life, a time of many changes on Earth

A. Paleozoic
B. Mesozoic
C. Cenozoic
D. Holozoic

7. What is the longest part of Earth’s history where trace fossils

appeared.
A. Pre-Cambrian
B. Paloezoic
C. Mesozoic
D. Cenozoic

8. The geologic time scale is subdivided into 4 groups. List them

from the largest to the smallest.
A. Eons, periods, epochs, eras
B. Eras, eons, periods, epochs
C. Epochs, periods, eras, eons
D. Eons, eras, periods, epochs

9. The end of this era was believed to be caused by a comet

or asteroid colliding with Earth, causing a huge cloud of dust
and smoke to rise into the atmosphere, blocking out the sun.
A. Paleozoic
B. Holozoic
C. Mesozoic
D. Cenozoic

10. Which geologic event occurred during the Mesozoic era?

A. Pangaea formed
B. Asteroids killed the dinosaurs
C. The Rocky Mountains formed
D. The Pleistocene Ice Age

28
 Lesson Mechanisms that Produce Change in P
4
PRELIM (week 4)

What I need to know

Learning Competency
The learners shall be able to explain the mechanisms that produce change in populations from
generation to generation (STEM_BIO11/12-IIIc-g-9)

Specific Learning Outcomes

At the end of the lesson, the learners will be able to:

• explain that genetic variation is the prerequisite and should therefore be present for any
genetic process to cause change in populations from generation to generation;
• state the Hardy-Weinberg Principle;
• enumerate the conditions that should be present for a gene or in a larger scale, a population,
to
attain Hardy-Weinberg equilibrium; and
• calculate gene and genotype frequencies and derive the Hardy-Weinbergequation

What I know

PRIOR KNOWLEDGE:

1. Natural Selection 6. Genetic Variation

2. Mitigation 7. DNA Sequence
3. Mutation 8. Genetic Drift
4. Genotype
5. Genetic Equilibrium

29
 What’s new

PRE ACTIVITY: A Picture Paint a Thousand Words

1. Observe the two pictures and Recognize the

similarities and the differences between individuals
or animals belonging to the same species.

https://www.dogalize.com/2016/12/dog-breeds/
https://blogs.scientificamerican.com/observations/the-concept-of-race-is-a-lie/

What’s is it

INTRODUCTION:

 Hardy–Weinberg law The law that states that in an infinitely large, interbreeding population
in which mating is random and in which there is no selection, migration, or mutation, gene
and genotype frequencies will remain constant from generation to generation. In practice
these conditions are rarely strictly present, but unless any departure is a marked one, there
is no statistically significant movement away from equilibrium. Consider a single pair of
alleles, A and a, present in a diploid population with frequencies of p and q respectively.
Three genotypes are possible, AA, Aa, and aa, and these will be present with frequencies of
p2, 2pq, and q2 respectively.
https://www.encyclopedia.com/science-and-technology/biology-and-genetics/genetics-and-genetic-
engineering/hardy-weinberg- law#:~:text=Hardy%E2%80%93Weinberg%20law%20The%20law,generation%2C
%20with%20no%20overlap%20b etween
 The five conditions that must be met for genetic equilibrium to occur include:

1. No mutation (change) in the DNA sequence.

2. No migration (moving into or out of a population).
3. A very large population size.
4. Random mating.
5. No natural selection.
https://www.ck12.org/book/ck-12-life-science-concepts-for-middle-school/section/4.9/

30
  The Hardy-Weinberg equation is a mathematical equation that can be used to calculate the
genetic variation of a population at equilibrium. he equation is an expression of the principle
known as Hardy-Weinberg equilibrium, which states that the amount of genetic variation in
a population will remain constant from one generation to the next in the absence of
disturbing factors.
p2 + 2pq + q2 = 1

where p is the frequency of the "A" allele and q is the frequency of the "a" allele in the population. In
the equation, p2 represents the frequency of the homozygous genotype AA, q2 represents the
frequency of the homozygous genotype aa, and 2pq represents the frequency of the heterozygous
genotype Aa. In addition, the sum of the allele frequencies for all the alleles at the locus must be 1,
so p + q = 1. If the p and q allele frequencies are known, then the frequencies of the three genotypes
may be calculated using the Hardy-Weinberg equation.
https://www.nature.com/scitable/definition/hardy-weinberg-equation-299/#:~:text=Science%20at%20Scitable-
,Hardy%2DWeinberg%20equation,In%201908%2C%20G.%20H.&text=If%20the%20p%20and%20q,using%20the%20Hardy%
2DWeinberg%20equation.

 Natural selection, genetic drift, and gene flow are the mechanisms that cause changes in
allele frequencies over time. When one or more of these forces are acting in a population,
the population violates the Hardy-Weinberg assumptions, and evolution occurs.
 Natural selection occurs when individuals with certain genotypes are more likely than
individuals with other genotypes to survive and reproduce, and thus to pass on their alleles
to the next generation. As Charles Darwin (1859) argued in On the Origin of Species, if the
following conditions are met, natural selection must occur:

1. There is variation among individuals within a population in some trait.

2. This variation is heritable (i.e., there is a genetic basis to the variation, such that
offspring tend to resemble their parents in this trait).
3. Variation in this trait is associated with variation in fitness (the average net reproduction
of individuals with a given genotype relative to that of individuals with other genotypes).

 Mutation. Although mutation is the original source of all genetic variation, mutation rate for
most organisms is pretty low. So, the impact of brand-new mutations on allele frequencies
from one generation to the next is usually not large. (However, natural selection acting on
the results of a mutation can be a powerful of evolutionpmechanism

evolution!)

 Natural selection. Finally, the most famous mechanism of evolution! Natural selection occurs
when one allele (or combination of alleles of different genes) makes an organism more or
less fit, that is, able to survive and reproduce in a given environment. If an allele reduces
fitness, its frequency will tend to drop from one generation to the next. We will look in detail
at different forms of natural selection that occur in populations.

31
  Gene flow. Gene flow involves the movement of genes into or out of a population, due to
either the movement of individual organisms or their gametes (eggs and sperm, e.g.,
through pollen dispersal by a plant). Organisms and gametes that enter a population may
have new alleles, or may bring in existing alleles but in different proportions than those
already in the population. Gene flow can be a strong agent of evolution.

 Non-infinite population size (genetic drift). Genetic drift involves changes in allele frequency
due to chance events – literally, "sampling error" in selecting alleles for the next generation.
Drift can occur in any population of non-infinite size, but it has a stronger effect on small
populations. We will look in detail at genetic drift and the effects of population size.

What I’ve learned

Analyze the sample problem on Hardy –Weinberg population

1. The frequency of two alleles in a gene pool is 0.19 (A) and 0.81 (a). Assume that the population is in
Hardy –Weinberg equilibrium
a. Calculate the percentage of heterozygous individuals in the population.
b. Calculate the percentage of homozygous recessives in the population.

2. An allele W for white wool, is dominant over allele w, for black wool. In a sample of 900 sheep, 891 are white
and 9 are black. Calculate the allelic frequencies within this population, assuming that the population is in
Hardy –Weinberg equilibrium.

32
 Lesson Evolution and Origin of
Biodiversity: Patterns of Descent with Modification
5
MIDTERM (week 5)

What I need to know

Learning Competency
The learners shall be able to show patterns of descent with modification from common ancestors to
produce the organismal diversity observed today.
STEM_BIO11/12-IIIc-g-10

Specific Learning Outcomes

At the end of the lesson, the learners will be able to:
• define species according to the biological species concept;
• distinguish the various types of reproductive isolating mechanisms that can lead to speciation;
• discuss the different modes of speciation; and
• explain how evolution produce the tremendous amount of diversity among organisms.

What I know

PRIOR KNOWLEDGE: Definition of Terms

1. Species 6. Allopatric
2. Classification 7. Sympatric
3. Interbreeding 8. Parapatric
4. Isolating mechanism
5. Zygote

What’s new

PRE ACTIVITY: Answer the following questions briefly.

1. Identify or give an organism which can be an animal or a plant species.

2. Identify the different kind or variants of the species.
Example:
Specie: Cat
Kinds or Variants: Lion, Tiger, Cheetah

33
 What’s is it

INTRODUCTION:

 Species, in biology, classification comprising related organisms that share common

characteristics and are capable of interbreeding.
 Ernst Mayer’s definition: “Species are groups of interbreeding natural populations
that are reproductively isolated from other such groups.”

The reproductive isolating mechanisms

A. Pre-zygotic isolation mechanisms prevent fertilization and zygote formation.

I. geographic or ecological or habitat isolation – potential mates occupy different areas or
habitats thus, they never come in contact
II. temporal or seasonal isolation – different groups may not be reproductively mature at
the same season, or month or year
III. behavioral isolation – patterns of courtship are different
IV. mechanical isolation – differences in reproductive organs prevent successful
interbreeding
V. gametic isolation – incompatibilities between egg and sperm prevent fertilization
B. Post-zygotic isolation mechanisms allow fertilization but nonviable or weak or sterile hybrids are
formed.
I. hybrid inviability – fertilized egg fails to develop past the early embryonic stages
II. hybrid sterility – hybrids are sterile because gonads develop abnormally or there is
abnormal segregation of chromosomes during meiosis
III. hybrid breakdown - F1 hybrids are normal, vigorous and viable, but F2 contains many
weak or sterile individuals
The modes of speciation:
A. Allopatric speciation or geographic speciation (allo – other, patric – place; ‘other place’) -
occurs when some members of a population become geographically separated from the
other members thereby preventing gene flow. Examples of geographic barriers are bodies of
water and mountain ranges.
B. Sympatric speciation (sym – same, patric – place; ‘same place’) - occurs when members of
a population that initially occupy the same habitat within the same range diverge into two or
more different species. It involves abrupt genetic changes that quickly lead to the
reproductive isolation of a group of individuals. Example is change in chromosome number
(polyploidization).
C. Parapatric speciation (para – beside, patric – place; ‘beside each other’) – occurs when
the groups that evolved to be separate species are geographic neighbors. Gene flow occurs
but with great distances is reduced. There is also abrupt change in the environment over a
geographic border and strong disruptive selection must also happen.

34
 What’s more

ACTIVITY:

1. Research 5 similar species with different characteristics.

Example: Gartner snakes live in the same region One lives in water
One lives in land

What’s I’ve learned

POST QUIZ:

1. Give examples on the reproductive isolating mechanisms.

MECHANISMS EXAMPLES
1. Geographic Isolation 1.
2.
3.
2. Temporal or Seasonal Isolation 1.
2.

35
 3
3. Behavioral Isolation 1.
2.
3
4. Mechanical Isolation 1.
2.
3
5. Gametic Isolation 1.
2.
3

Recommended Readings:
1. https://www.khanacademy.org/science/biology/her/tree-of-life/a/species-speciation

36
 Lesson Development of Evolutionary Thought
6
MIDTERM (week 6)

What I need to know

Learning Competency
The learners shall be able to trace the development of evolutionary thought. STEM_BIO11/12-IIIc-g-
11

Specific Learning Outcomes

At the end of the lesson, the learners will be able to:
• enumerate the scientists and cite their respective contributions in the development of
evolutionary thought;
• describe Jean Baptiste Lamarck’s hypothesis on evolutionary change;
• discuss Charles Darwin’s theory of evolution by natural selection; and
• explain the Modern Synthesis as the unified theory of evolution

What I know
PRIOR KNOWLEDGE: Definition of Terms

1. Taxonomy 6. Family
2. Kingdom 7. Genus
3. Phylum 8. Species
4. Class 9.Natural Selection
5. Order 10. Artificial Selection

What’s new
PRE-ACTIVITY: Research

1. Create a “Photo Collage” about Evolution.

2. Enumerate the scientist and cite their respective contributions in the development of evolutionary
thought.

SCIENTIST CONTRIBUTIONS
1.
2.
3.

37
 4.
5.

What’s is it

INTRODUCTION:

 Scientific classification is a method by which biologists organize living things into groups. It is
also called taxonomy. Groups of organisms in taxonomy are called taxa (singular, taxon). You
may already be familiar with commonly used taxa, such as the kingdom and species.
 Why do biologists classify organisms? The major reason is to make sense of the incredible
diversity of life on Earth. Scientists have identified millions of different species of organisms.
Among animals, the most diverse group of organisms is the insects.
Linnaean System of Classification

 The most influential early classification system was developed by Carolus Linnaeus. In fact,
all modern classification systems have their roots in Linnaeus’ system. Linnaeus was a
Swedish botanist who lived during the 1700s. He is known as the “father of taxonomy.”
Linnaeus tried to describe and classify the entire known natural world. In 1735, he
published his classification system in a work called Systema Naturae (“System of
Nature”).
 The taxa are below:
o Kingdom - This is the highest taxon in Linnaean taxonomy, representing major
divisions of organisms. Kingdoms of organisms include the plant and animal
kingdoms.
o Phylum (plural, phyla) - This taxon is a division of a kingdom. Phyla in the animal
kingdom include chordates (animals with an internal skeleton) and arthropods
(animals with an external skeleton).
o Class - This taxon is a division of a phylum. Classes in the chordate phylum include
mammals and birds.
o Order - This taxon is a division of a class. Orders in the mammal class include rodents
and primates.
o Family - This taxon is a division of an order. Families in the primate order include
hominids (apes and humans) and hylobatids (gibbons).
o Genus - This taxon is a division of a family. Genera in the hominid family include
Homo (humans) and Pan (chimpanzees).
o Species - This taxon is below the genus and the lowest taxon in Linnaeus’
system. Species in the Pan genus include Pan troglodytes(common chimpanzees)
and Pan paniscus (pygmy chimpanzees).
https://www.ck12.org/book/cbse_biology_book_class_xi/section/1.3/

38
  Thomas Malthus was an English economist. He wrote a popular essay called “On
Population.” He argued that human populations have the potential to grow faster than the
resources they need. When populations get too big, disease and famine occur. These
calamities control population size by killing off the weakest people.
 Catastrophism was a theory developed by Georges Cuvier based on paleontological evidence
in the Paris Basin. Cuvier was there when he observed something peculiar about the fossil
record. Instead of finding a continuous succession of fossils, Cuvier noticed several gaps
where all evidence of life would disappear and then abruptly reappear again after a notable
amount of time. Cuvier recognized these gaps in the fossil succession as mass extinction
events.
 This led Cuvier to develop a theory called catastrophism. Catastrophism states that natural
history has been punctuated by catastrophic events that altered that way life developed and
rocks were deposited.
 In geology, gradualism is a theory developed by James Hutton according to which profound
changes to the Earth
 This theory inspired an evolution theory in paleontology, also called gradualism, according to
which the species appeared by the gradual transformation of ancestral species.
 According to this theory, the population of a species is transformed slowly and progressively
into a new species by the accumulation of micro-evolutionary changes in the genetic
heritage.
 The law of use and disuse, which states that when certain organs become specially
developed as a result of some environmental need, then that state of development is
hereditary and can be passed on to progeny.
Evolution of Darwin’s Theory

 It took Darwin years to form his theory of evolution by natural selection. His reasoning went
like this:
1. Like Lamarck, Darwin assumed that species can change over time. The fossils he
found helped convince him of that.
2. From Lyell, Darwin saw that Earth and its life were very old. Thus, there had been
enough time for evolution to produce the great diversity of life Darwin had observed.
3. From Malthus, Darwin knew that populations could grow faster than their
resources. This “overproduction of offspring” led to a “struggle for existence,” in
Darwin’s words.
4. From artificial selection, Darwin knew that some offspring have variations that
occur by chance, and that can be inherited. In nature, offspring with certain variations might
be more likely to survive the “struggle for existence” and reproduce. If so, they would
pass their favorable variations to their offspring.
5. Darwin coined the term fitness to refer to an organism’s relative ability to
survive and produce fertile offspring. Nature selects the variations that are most useful.
Therefore, he called this type of selection natural selection.
6. Darwin knew artificial selection could change domestic species over time. He
inferred that natural selection could also change species over time. In fact, he thought that if
a species changed enough, it might evolve into a new species.

39
 What’s more

ACTIVITY:

Answer the following questions on a separate sheet of paper:

a. What did Darwin’s travels reveal to him about the number and variety of living species?
b. How did tortoises and birds differ among the islands of the Galapagos?
c. What is evolution? Why is referred to as a theory?
d. Darwin found fossils of many organisms that were different from any living species. How
would this finding has affecting his understanding of lifes diversity?

What’s I’ve learned

POST QUIZ:

Write true if the statement is true or false if the statement is false.

1. As recently as 200 years ago, many people believed that Earth was only 6,000 years old.
2. Artificial selection occurs when nature selects for beneficial traits.
3. The individual Galápagos Islands are all similar to each other.
4. Malthus argued that human populations grow faster than their resources.
5. Lamarck was one of the first scientists to propose that species evolve by natural selection.
6. Lyell was one of the first to say that Earth must be far older than most people believed.
7. Lamarck’s inheritance of acquired characteristics is has become a widely accepted scientific
theory.
8. Fossils proved to Darwin that species can evolve.
9. The term fitness to refer to an organism’s ability to outrun its hunters.
10. Darwin published his findings soon after returning to England from the voyage of the Beagle.
11. According to Darwin, natural selection is what occurs, and evolution is how it happens.
12. During his journey aboard the Beagle, Darwin found fossils from the seas in the mountains.
13. Galápagos tortoises have differently shaped shells depending on where they live.
14. Darwin’s book changed science forever.
15. Alfred Russel Wallace developed a theory of evolution at the same time as Darwin.

40
 Lesson Evidences of Evolution
7
PREFINAL (week 7)

What I need to know

Learning Competency
The learners explain evidences of evolution (e.g. fossil record, biogeography, DNA/ protein sequences,
homology and embryology (STEM_BIO11/12-IIIc-
g-12)

Specific Learning Outcomes

At the end of the lesson, the learners will be able to:
• describe the evidences to support evolution and
• explain some modern evidences of evolution

What I know

PRIOR KNOWLEDGE: Definition of Terms

1. Homologous 6. Genetic code

2. Analogous 7. Biogeography
3. Molecular Biology 8. Fossils
4. Transcription 9. Evolution
5. Translation 10. Modification

What’s new

PRE-ACTIVITY: Video

1. List down 5 evidences of evolution.

2. Fossils & Evidence for Evolution: https://www.youtube.com/watch?v=iYr3sYS9e0w

41
 What’s is it

INTRODUCTION:

 The Evidence for Evolution Anatomy and embryology Darwin thought of evolution as
"descent with modification," a process in which species change and give rise to new species
over many generations. He proposed that the evolutionary history of life forms a branching
tree with many levels, in which all species can be traced back to an ancient common
ancestor.
 Homologous features If two or more species share a unique physical feature, such as a
complex bone structure or a body plan, they may all have inherited this feature from a
common ancestor. Physical features shared due to evolutionary history (a common
ancestor) are said to be homologous.
 Analogous features To make things a little more interesting and complicated, not all physical
features that look alike are marks of common ancestry. Instead, some physical similarities
are analogous: they evolved independently in different organisms because the organisms
lived in similar environments or experienced similar selective pressures. This process is
called convergent evolution. (To converge means to come together, like two lines meeting at
a point.)
 Determining relationships from similar features In general, biologists don't draw
conclusions about how species are related on the basis of any single feature they think is
homologous. Instead, they study a large collection of features (often, both physical features
and DNA sequences) and draw conclusions about relatedness based on these features as a
group. We will explore this idea further when we examine phylogenetic trees.
 Molecular biology Like structural homologies, similarities between biological molecules can
reflect shared evolutionary ancestry. At the most basic level, all living organisms share:
 The same genetic material (DNA)
 The same, or highly similar, genetic codes
 The same basic process of gene expression (transcription and translation)
 The same molecular building blocks, such as amino acids
 Biogeography The geographic distribution of organisms on Earth follows patterns that are
best explained by evolution, in combination with the movement of tectonic plates over
geological time.
 Fossil record Fossils are the preserved remains of previously living organisms or their traces,
dating from the distant past. The fossil record is not, alas, complete or unbroken: most
organisms never fossilize, and even the organisms that do fossilize are rarely found by
humans.

42
 What’s more

ACTIVITY:

Identify the evidence shown by the picture and explain how it supports evolution.

43
44
 Lesson Evolutionary Relationships of Organis
8
PREFINAL (week 8)

What I need to know

Learning Competency
The learners should be able to infer evolutionary relationships among organisms using the evidences
of evolution (STEM_BIO11/12-IIIc-g-13)

Specific Learning Outcomes

At the end of the lesson, the learners will be able to:
• recognize how comparisons of similarities and differences can suggest evolutionary relationships;
• explain the significance of using multiple lines of evidence to identify evolutionary
relationships;
• infer the degree of relationships among organisms based on the amino acid sequence in the
cytochrome c molecule;
• compare four species of horses by measuring structures in their hind legs; and
• differentiate various hominids by describing their physical features.

What I know

PRIOR KNOWLEDGE: Definition of Terms

1. Phylogeny 6. Polytomy
2. Phylogenetic Tree 7. Taxonomy
3. Branch Point 8. Binomial Nomenclature
4. Basal Taxon
5. Sister Taxa

What’s new

PRE-ACTIVITY:

1. Recall and Write the evidences of Evolution.

45
 What’s is it

INTRODUCTION:
INFERRING RELATIONSHIPS FROM EVIDENCES OF EVOLUTION
Living things share some biomolecules which may be used to prove relationships. These chemicals
include DNA and proteins. The building blocks of these chemicals may be analyzed to show
similarities and differences among organisms. The more similarities, the closer the relationships.

One of these is the protein cytochrome-c, an important enzyme found in virtually all organisms. It is
a highly conserved protein which functions in the electron transport chain system of the
mitochondria which is needed for the release of energy from food. It also performs a role in
apoptosis (programmed cell death) by being released into the cytosol activating the events of cell
death.

There are 104 amino acids in the human cytochrome c, 37 of which have been found at the same
position in every cytochrome c that has been sequenced. The molecules are assumed to have
descended from a primitive microbial cytochrome that existed over two billion years ago.

A cladogram is a diagram used to represent a hypothetical relationship between groups of animals,

called a phylogeny. A cladogram is used by a scientist studying phylogenetic systematics to visualize
the groups of organisms being compared, how they are related, and their most common ancestors.

A phylogeny is a hypothetical relationship between groups of organisms being compared. A

phylogeny is often depicted using a phylogenetic tree.

A phylogenetic tree is a diagram used to reflect evolutionary relationships among organisms or

groups of organisms. Scientists consider phylogenetic trees to be a hypothesis of the evolutionary
past since one cannot go back to confirm the proposed relationships. In other words, a “tree
of life” can be constructed to illustrate when different organisms evolved and to show the
relationships among different organisms

a phylogenetic tree can be read like a map of evolutionary history. Many phylogenetic trees have a
single lineage at the base representing a common ancestor.

Scientists call such trees rooted, which means there is a single ancestral lineage (typically drawn
from the bottom or left) to which all organisms represented in the diagram relate. Notice in the
rooted phylogenetic tree that the three domains— Bacteria, Archaea, and Eukarya—diverge from a
single point and branch off. The small branch that plants and animals (including humans) occupy
in this

46
diagram shows how recent and miniscule these groups are compared with other organisms. Unrooted
trees don’t show a common ancestor but do show relationships among species.

In a rooted tree, the branching indicates evolutionary relationships (Figure 3). The point where a
split occurs, called a branch point, represents where a single lineage evolved into a distinct new one.
A lineage that evolved early from the root and remains unbranched is called basal taxon. When two
lineages stem from the same branch point, they are called sister taxa. A branch with more than two
lineages is called a polytomy and serves to illustrate where scientists have not definitively
determined all of the relationships. It is important to note that although sister taxa and polytomy do
share an ancestor, it does not mean that the groups of organisms split or evolved from each other.
Organisms in two taxa may have split apart at a specific branch point, but neither taxa gave rise to
the other.

https://courses.lumenlearning.com/suny-wmopen-biology2/chapter/phylogenies-and-the-history-
of- life/#:~:text=In%20scientific%20terms%2C%20the%20evolutionary,closely%20related%2C
%20and% 20so%20forth.

47
 What’s more

ACTIVITY: Phylogenetic Tree

1. Illustrate the Phylogenic Tree of Human Ancestors.

What’s I’ve learned

POST QUIZ: Amino Acid Sequences of in Cytochrome-c

Animals Amino acid Sequence

Horse

Chicken

Frog

Human

Shark

48
 Lesson Systematics Based on
Evolutionary Relationships: Tree of Life and
9
FINAL (week 9)

What I need to know

Learning Competency
The learners should be able to Explain how the structural and developmental characteristics and
relatedness in DNA sequences are used to classify living things (STEM_BIO11/12IIIh-j-14)

Specific Learning Outcomes

At the end of the lesson, the learners will be able to:
• describe the multiple lines of evidence used to infer evolutionary
relatedness;
• discuss how anatomical, developmental and relatedness in DNA
sequences are used as evidence to infer the relatedness of taxa; and
• explain that classification is based on evolutionary relatedness

What I know

PRIOR KNOWLEDGE: Define the following terms:

1. Homology 6. Archaea
2. Molecular clock
3. Phylogeny
4. Systematics
5. Tetrapods

What’s new

PRE-ACTIVITY: Answer the following questions.

1. What makes you unique and what makes you similar? To your siblings, mother or father.

Similarities Unique
1.
2.
3.
4.

49
 5.

What’s is it

INTRODUCTION:

Lines of evidence to infer evolutionary relationships:

1. Fossil evidence
2. Homologies - Similar characters due to relatedness are known as homologies. Homologies can be
revealed by comparing the anatomies of different living things, looking at cellular similarities and
differences, studying embryological development, and studying vestigial structures within individual
organisms.
Each leaf has a very different shape and function, yet all are homologous structures, derived
from a common ancestral form. The pitcher plant and Venus' flytrap use leaves to trap and digest
insects. The bright red leaves of the poinsettia look like flower petals. The cactus leaves are modified
into small spines which reduce water loss and can protect the cactus from herbivory.

Another example of homology is the forelimb of tetrapods (vertebrates with legs). - Frogs,
birds, rabbits and lizards all have different forelimbs, reflecting their different lifestyles. But those
different forelimbs all share the same set of bones - the humerus, the radius, and the ulna. These are
the same bones seen in fossils of the extinct transitional animal, Eusthenopteron, which
demonstrates their common ancestry.

Organisms that are closely related to one another share many anatomical similarities.
Sometimes the similarities are conspicuous, as between crocodiles and alligators, but in other cases
considerable study is needed for a full appreciation of relationships.

Developmental biology- Studying the embryological development of living things provides clues to
the evolution of present-day organisms. During some stages of development, organisms exhibit
ancestral features in whole or incomplete form.

3. Biogeography- the geographic distribution of species in time and space as influenced by many
factors, including Continental Drift and log distance dispersal.

4. Molecular clocks help track evolutionary time- The base sequences of some regions of DNA
change at a rate consistent enough to allow dating of episodes in past evolution. Other genes change
in a less predictable way.

Classification is linked to Phylogeny

5. Biologists use phylogenetic trees for many purposes, including:

I. Testing hypotheses about evolution
II. Learning about the characteristics of extinct species and ancestral lineages
III. Classifying organisms
The connection between classification and phylogeny is that hierarchical classification is reflected in
the progressively finer branching of phylogenetic trees. The branching patterns in some cases match
the hierarchical classification of groups nested within more inclusive groups. In other situations,

50
however, certain similarities among organisms may lead taxonomists to place a species within a
group of organisms (for example genus or family) other than the group to which it is closely related.
If systematists conclude that such mistake has occurred, the organism may be reclassified (that is
placed in a different genus or family) to accurately reflect its evolutionary history.

51
 What’s more

ACTIVITY: Essay

Why do biologists care about phylogenies?

52
 Lesson Systematics Based on Evolutionary Relationships:

10
FINAL (week 10)

What I need to know

Learning Competency
The learners should be able to identify the unique/distinctive characteristics of a specific taxon
relative to other taxa STEM_BIO11/12IIIh-j-15

Specific Learning Outcomes

At the end of the lesson, the learners will be able to:
• describe the Linnaean system of classification;
• classify organisms into a hierarchy; and
• construct and use dichotomous keys for identification.

What I know

PRIOR KNOWLEDGE: Definition of Terms

1. Classification 6. Taxonomy 11. Dichotomous key

2. Hierarchy 7. Domain
3. Nomenclature 8. Eukarya
4. Identification 9. Species
5. Description 10. Linnaean Taxonomy

What’s new

PRE-ACTIVITY:

1. Find 10 possible types of writing materials found in your house.

2. Write down the key features to be used in groupings. Place the features in a table
SAMPLE TABLE
Features Ballpen Highlighter Notebook Pencil

Less than 6 inches - - + -

53
 More than 6 + + - +
inches

With Ink + + - -

What’s is it

INTRODUCTION:

The taxonomic system was devised by Carolus Linnaeus (1707-1778). It is a hierarchical system
since organisms are grouped into ever more inclusive categories from species up to kingdom. In
1981, a category higher than a kingdom, called domain, was proposed by Carl Woese. The table
below illustrates how four species are classified using the present classification system. (Note that
it is standard practice to italicize the genus and species names).
DOMAIN EUKARYA FEATURES
KINGDOM Animalia Organisms that are able to move on their own
PHYLUM Chordata Animals with a backbone
CLASS Mammalia Chordates with fur or hair and milk glands
ORDER Primates Mammals with grasping fingers
FAMILY Hominidae Primates with relatively flat faces and three-dimensional
vision
GENUS Homo Hominids with upright position and large brain
specific epithet sapiens Members if the genus Homo with a high forehead
and notably thin skull bones
SPECIES Homo sapiens
COMMON NAME human

DOMAIN EUKARYA
KINGDOM ANIMALIA PLANTAE
PHYLUM CHORDATA ARTHROPODA MAGNOLIOPHYTA
CLASS MAMMALIA INSECTA LILOPSIDA
ORDER PRIMATES CANIVORA DIPTERA LILIALES
FAMILY HOMINIDAE CANIDAE DROSOPHILIDAE LILIACEAE
GENUS HOMO CANIS DROSOPHILIA ALLIUM
Specific Epithet SAPIENS FAMILIARIS MELANOGASTER CEPA
SPECIES HOMO SAPIENS CANIS DROSOPHILIA ALLIUM CAPA
FAMILIARIS MELANOGASTER
COMMON NAME HUMA DOG FRUIT FLY ONION

54
 What’s more

ACTIVITY:

1. List down the practical uses of biological classification.

55
 Lesson Systematics Based on
Evolutionary Relationships: Cladistics and Phylogeny
11
FINAL (week 11)

What I need to know

Learning Competency
The learners should be able to describe species diversity and cladistics, including types of evidence
and procedures that can be used to establish evolutionary relationships STEM_BIO11/12IIIh-j-16

Specific Learning Outcomes

At the end of the lesson, the learners will be able to:
• demonstrate how shared derived characters can be used to reveal
degrees of relationship; and
• build cladograms to infer evolutionary relatedness

What I know

PRIOR KNOWLEDGE: Definition of Terms

1. Cladistics 6. Homologous Characters 11. Asteroid

2. Phylogeny 7. Analogous Characters 12. Crinoid
3. Cladograms 8. Clade 13. Holothuroid
4. Character 9. Phylogenic Trees 14. Ophiuroid
5. Character State 10. Echinoid

What’s new

PRE-ACTIVITY:

1. Do you remember the last time you had a family reunion? A summer vacation or a family
barbecue and the latest family picture taken together? Can you describe your family members?
What makes you similar to them and what makes you unique?”
2. list characters or features that served as evidences (e.g. morphological, genetic, etc.) that indeed
they belong to the same family. Note as many as they can think of.
Example:
Family Color of Hair Blood Height Shape of Shape of Skin
Members the Eyes texture/Color Type the Nose the face Color

56
 Father Brown Black Straight B+ 5’7 flat Round Brown

What’s is it

INTRODUCTION:

Basically, a family picture represents a family tree. Family trees show how people are related
to each other. Similarly, scientists use phylogenetic trees like cladograms to study the relationships
among organisms. Sometimes, family trees are used to show relationships between individuals.
Those who are closely related are located closer together than those who are only distantly related.
For instance, in a family tree, we can see that the siblings are close together, indicating a close
genetic relationship. But the siblings are far from their great aunt, indicating a more distant genetic
relationship. Family trees can also be used to see ancestral connections. That is, we can see that all
the people in the last generation have the same great-great-grandparents in common.

What’s more

ACTIVITY: Phylogenic Tree

1. Choose any vertebrates and Create phylogenetic tree showing their evolutionary relationships.
This tree should be primarily based on physical characteristics, such as:
I. Presence or absence of a backbone
II. Ability to breathe in air or water
III. Cold or warm blooded
IV. Carnivore, herbivore, or omnivore
V. Presence or absence of hair/fur
VI. Any other external structures such as horns
2. Research on the internet on the sample of Phylogenic Tree.

What’s I can do

PERFORMANCE TASK:

1. Go online. Choose a group of organisms you are interested to work with (e.g. invertebrates);
2. Download pictures of different species.
3. Print the pictures. In tabular form, list all the characters. Evaluate the characters (whether
primitive or derived).
4. Remember that in building your cladogram, use only shared derived characters.
5. Construct your own cladogram.

57
 References

Manuals/Modules/Lesson Exemplar

The Commission on Higher Education. Teaching Guide for Senior High School
General Biology 2

Department of Education Central Office. Most Essential Learning Competencies

( MELCs). 2020.

Websites

1.https://www.britannica.com/science/genetic-engineering
2.https://www.sciencedaily.com/terms/plant_breeding.htm#:~:text=Classical%20plant%20breeding%
20uses%20deliberate,into%20a%20new%20genetic%20background.
3.https://www.genome.gov/genetics-glossary/Genetic Engineering#:~:text=Genetic%20engineering
%20is%20the%20process,selecting%20offspring%20wit h%20desired%20traits4.
https://www.theguardian.com/science/2019/jan/13/the-five-genetically-
modified-fruit-edited-bananas-tomatoes
5.https://clarkscience8.weebly.com/geologic-time-scale.html
6.https://www.dogalize.com/2016/12/dog-breeds/
7.https://blogs.scientificamerican.com/observations/the-concept-of-race-is-a-lie/
https://www.encyclopedia.com/science-and-technology/biology-and-genetics/genetics-and-
genetic-engineering/hardy-weinberg- law#:~:text=Hardy%E2%80%93Weinberg%20law
%20The%20law,generation%2C%20with
%20no%20overlap%20between

8.https://www.ck12.org/book/ck-12-life-science-concepts-for-middle-school/section/4.9/
9.https://www.nature.com/scitable/definition/hardy-weinberg-equation-
299/#:~:text=Science%20at%20Scitable-
,Hardy%2DWeinberg%20equation,In%201908%2C%20G.%20H.&text=If%20the%20p%20and%20
q,using%20the%20Hardy%2DWeinberg%20equation.
10. https://www.khanacademy.org/science/biology/her/heredity-and-genetics/a/hardy-weinberg-
mechanisms-of-evolution
11. https://www.britannica.com/science/species-taxon

12.https://www.ck12.org/book/cbse_biology_book_class_xi/section/1.3/

Prepared by: Checked and Reviewed by:

DARYL JAY B. SANCO, LPT

Instructor ROMEO C CATALUÑA, ED.D
School Principal

Attested by: Noted by:

NANCY CHIONG-MAGBANUA, MSIT Dr. EUFEMIO D. JAVIER, JR

Academic Dean CEO & School President

58
59