Bio (In Focus Year 12)
Uploaded by
isra elBio (In Focus Year 12)
Uploaded by
isra elGlenda Chidrawi Contributing
Margaret Robson author
12 Sarah Bradstock Sarah Jones
YEAR Elizabeth Thrum
2ND EDITION
00_bio_InFocus12_2e_sb_08851_pre.indd 1 08/08/18 5:02 pm
Biology In Focus Year 12 © 2018 Cengage Learning Australia Pty Limited
2nd Edition
Glenda Chidrawi Copyright Notice
Margaret Robson This Work is copyright. No part of this Work may be reproduced, stored in a
Sarah Bradstock retrieval system, or transmitted in any form or by any means without prior
Elizabeth Thrum written permission of the Publisher. Except as permitted under the
Contributing author: Sarah Jones Copyright Act 1968, for example any fair dealing for the purposes of private study,
ISBN 9780170408851 research, criticism or review, subject to certain limitations. These limitations
include: Restricting the copying to a maximum of one chapter or 10% of this
Publisher: Eleanor Gregory book, whichever is greater; providing an appropriate notice and warning with the
Project editor: Felicity Clissold copies of the Work disseminated; taking all reasonable steps to limit access to
Editor: Kay Waters these copies to people authorised to receive these copies; ensuring you hold the
Proofreader: Dr Gillian Dite appropriate Licences issued by the Copyright Agency Limited (“CAL”), supply a
Permissions researcher: Helen Mammides remuneration notice to CAL and pay any required fees. For details of CAL licences
Indexer: Russell Brooks and remuneration notices please contact CAL at Level 11, 66 Goulburn Street,
Text design: Leigh Ashforth (Watershed Design) Sydney NSW 2000, Tel: (02) 9394 7600, Fax: (02) 9394 7601
Cover design: Chris Starr (MakeWork) Email: [email protected]
Cover image: Getty Images/Raycat Website: www.copyright.com.au
Production controller: Karen Young
Typeset by: MPS Limited For product information and technology assistance,
in Australia call 1300 790 853;
Any URLs contained in this publication were checked for currency during the in New Zealand call 0800 449 725
production process. Note, however, that the publisher cannot vouch for the
ongoing currency of URLs. For permission to use material from this text or product, please email
[email protected]
National Library of Australia Cataloguing-in-Publication Data
A catalogue record for this book is available from the National Library of
Australia.
Cengage Learning Australia
Level 7, 80 Dorcas Street
South Melbourne, Victoria Australia 3205
Cengage Learning New Zealand
Unit 4B Rosedale Office Park
331 Rosedale Road, Albany, North Shore 0632, NZ
For learning solutions, visit cengage.com.au
Printed in China by China Translation & Printing Services.
1 2 3 4 5 6 7 22 21 20 19 18
00_bio_InFocus12_2e_sb_08851_pre.indd 2 08/08/18 5:02 pm
CONTENTS
PREFACE . . . . . . . . . . . . . . . . . . . . . . . . viii
AUTHOR AND REVIEWER TEAMS. . . . . . . . . . ix
ACKNOWLEDGEMENTS . . . . . . . . . . . . . . . ix
USING BIOLOGY IN FOCUS . . . . . . . . . . . . . . x
SYLLABUS MAPPING . . . . . . . . . . . . . . . . xiii
1 Working scientifically and depth studies 1
1.1 The nature of biology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2
1.2 Solving scientific problems: depth studies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6
1.3 Planning your depth study . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .12
1.4 Communicating your understanding . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .25
MODULE FIVE » HEREDITY 32
2 Sexual and asexual reproduction 33
2.1 Asexual and sexual reproduction – one parent or two? . . . . . . . . . . . . . . . . . . . . . . . . . . .34
2.2 Asexual reproduction – only one parent . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .48
2.3 Sexual reproduction in mammals . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .60
2.4 Manipulation of reproduction in agriculture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .72
Chapter summary. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .74
Chapter review questions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .76
3 Cell replication 78
3.1 Cell division – mitosis and meiosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .79
3.2 DNA structure – the Watson and Crick model . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .90
3.3 DNA replication – the Watson and Crick model . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .97
3.4 The importance of accuracy during DNA replication . . . . . . . . . . . . . . . . . . . . . . . . . . . . .103
3.5 The continuity of species . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .105
Chapter summary. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .108
Chapter review questions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .110
4 DNA and polypeptide synthesis 112
4.1 DNA in prokaryotes and eukaryotes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .113
4.2 Polypeptide synthesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .119
4.3 How genes and the environment affect phenotypic expression . . . . . . . . . . . . . . . . .128
4.4 The structure and function of proteins in living things . . . . . . . . . . . . . . . . . . . . . . . . . . .137
Chapter summary. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .146
Chapter review questions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .148
9780170408851 iii
00_bio_InFocus12_2e_sb_08851_pre.indd 3 08/08/18 5:02 pm
Genetic variation 150 5
5.1 Genetic variation – meiosis, fertilisation and mutations . . . . . . . . . . . . . . . . . . . . . . . . . .151
5.2 Genotypes and inheritance patterns . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .159
5.3 Deviations from Mendel’s ratios . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .171
5.4 Population genetics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .179
Chapter summary. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .188
Chapter review questions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .190
Inheritance patterns in a population 192 6
6.1 DNA technologies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .193
6.2 Using large-scale data to study population genetics . . . . . . . . . . . . . . . . . . . . . . . . . . . . .201
6.3 Using large-scale data to study population genetics and disease . . . . . . . . . . . . . . . .211
6.4 Using large-scale data to study population genetics and human evolution . . . . . .215
Chapter summary. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .220
Chapter review questions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .222
End-of-module 5 review 223
iv CONTENTS 9780170408851
00_bio_InFocus12_2e_sb_08851_pre.indd 4 08/08/18 5:02 pm
MODULE SIX » GENETIC CHANGE 226
7 Mutation 227
7.1 Mutagens . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .228
7.2 Types of mutations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .236
7.3 Mutations and how they affect organisms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .241
7.4 Population genetics – mutation, gene flow and genetic drift . . . . . . . . . . . . . . . . . . . .248
Chapter summary. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .254
Chapter review questions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .256
8 Biotechnology 258
8.1 Biotechnology – past, present and future . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .259
8.2 Ethics and social implications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .271
8.3 Future directions and benefits of research . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .275
8.4 Changes to Earth’s biodiversity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .276
Chapter summary. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .278
Chapter review questions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .280
9 Genetic technologies 281
9.1 Processes and outcomes of reproductive technologies . . . . . . . . . . . . . . . . . . . . . . . . . .282
9.2 Cloning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .287
9.3 Recombinant DNA technologies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .293
9.4 Current genetic technologies that induce genetic change . . . . . . . . . . . . . . . . . . . . . . .298
9.5 Benefits of using genetic technologies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .299
9.6 The effect of biotechnology in agriculture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .303
9.7 Social, economic and cultural influences on biotechnologies . . . . . . . . . . . . . . . . . . . .305
Chapter summary. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .308
Chapter review questions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .310
End-of-module 6 review 310
9780170408851 CONTENTS v
00_bio_InFocus12_2e_sb_08851_pre.indd 5 08/08/18 5:03 pm
MODULE SEVEN » INFECTIOUS DISEASE 312
Cause and transmission of infectious disease 313 10
10.1 The variety of infectious diseases caused by pathogens. . . . . . . . . . . . . . . . . . . . . . . . . .314
10.2 Robert Koch and Louis Pasteur . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .340
10.3 Causes and effects of disease in agricultural production . . . . . . . . . . . . . . . . . . . . . . . . .344
10.4 Adaptations of pathogens to facilitate their transfer . . . . . . . . . . . . . . . . . . . . . . . . . . . . .355
Chapter summary. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .360
Chapter review questions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .362
Responses to pathogens 363 11
11.1 Investigating plant defences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .364
11.2 Animal responses to pathogens . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .370
Chapter summary. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .392
Chapter review questions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .394
Immunity 395 12
12.1 The human immune system . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .396
12.2 Modelling the innate and adaptive immune systems . . . . . . . . . . . . . . . . . . . . . . . . . . . .425
Chapter summary. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .428
Chapter review questions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .430
Prevention, treatment and control of disease 431 13
13.1 Limiting the spread of infectious disease . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .432
13.2 Preventing the spread of infectious disease . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .436
13.3 Pharmaceuticals for controlling infectious disease . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .447
13.4 Environmental management and quarantine methods . . . . . . . . . . . . . . . . . . . . . . . . .451
13.5 Incidence and prevalence of a disease . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .454
13.6 Predicting and controlling the spread of disease . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .457
13.7 Aboriginal protocols in the development of medicines . . . . . . . . . . . . . . . . . . . . . . . . . .459
Chapter summary. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .462
Chapter review questions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .464
End-of-module 7 review 466
vi CONTENTS 9780170408851
00_bio_InFocus12_2e_sb_08851_pre.indd 6 08/08/18 5:03 pm
MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 468
14 Homeostasis 469
14.1 Homeostasis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .470
14.2 Mechanisms to maintain homeostasis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .478
14.3 Adaptations in endotherms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .493
14.4 Mechanisms to maintain water balance in plants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .497
Chapter summary. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .502
Chapter review questions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .504
15 Non-infectious diseases 505
15.1 Causes and effects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .506
15.2 Incidence, prevalence and mortality rates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .524
Chapter summary. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .538
Chapter review questions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .540
16 Epidemiology 541
16.1 Analysis of patterns of non-infectious disease . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .542
16.2 Treatment, management and future directions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .551
16.3 Methods used in epidemiological studies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .554
16.4 Benefits of epidemiological studies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .562
Chapter summary. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .564
Chapter review questions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .566
17 Prevention 569
17.1 Educational programs and campaigns. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .570
17.2 Genetic engineering . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .580
Chapter summary. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .588
Chapter review questions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .590
18 Technologies and disorders 591
18.1 The ear. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .592
18.2 The eye . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .598
18.3 The kidney . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .614
18.4 Effectiveness of technologies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .622
Chapter summary. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .624
Chapter review questions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .626
End-of-module 8 review 627
ANSWERS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 629
GLOSSARY . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 630
INDEX . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 646
9780170408851 CONTENTS vii
00_bio_InFocus12_2e_sb_08851_pre.indd 7 08/08/18 5:05 pm
PREFACE
Biology in Focus 2nd edition (Year 12) has been written to step is explained and mathematical relationships are shown
the specifications of the NSW Syllabus for the Australian in their biological context. In order to consolidate learning,
Curriculum, Stage 6 Biology. The authors are academic and students are challenged to try similar questions on their own.
classroom teaching experts, chosen for their comprehensive Answers to these questions appear on the student website.
knowledge of the biology discipline and best teaching The broad range of investigations demonstrates the
practice in biology education at secondary and tertiary levels. high level of importance the authors attach to exploring
They have written the text to make it accessible, readable and discovering the living world through practical activities
and appealing to students, covering contexts that ensure and research. Investigations are presented in a manner
students gain a wide perspective on the breadth and depth of that provides opportunities for students to develop skills in
current biology. The rigorous and methodological approach designing experiments as well as in planning and conducting
enables students to reach the highest possible standard. The valid and reliable procedures, taking into account safety
level of depth and interest are aimed at giving students the and conducting risk assessments. The hands-on activities
necessary understanding to pursue tertiary studies in biology, introduce, reinforce and provide opportunities for students
health sciences, medicine, conservation science, genetics, to practise first-hand the Working scientifically investigation
biotechnology, bioinformatics and other STEM-related courses. skills of the NSW syllabus. Opportunities for students include
Each chapter of Biology in Focus follows a consistent experimental design, data collection, analysis and drawing
pattern. Learning outcomes from the syllabus appear on conclusions. There are more than enough investigations to
the opening page. The text is then broken into manageable meet the 35 hour minimum requirement of the syllabus.
sections under headings and sub-headings. All chapters Chapter 1 explores the concepts of reliability, validity and
have been structured around the syllabus-identified inquiry the nature of scientific investigation using the scientific
questions, and focus within the chapter is on students asking method, and provides valuable information for performing
and refining their own questions for investigation. Relevant and analysing investigations and carrying out depth studies.
diagrams that are easy to interpret and illustrate important Detailed information is provided that is designed to enhance
concepts support the text. New terms are bolded and defined students’ experiences and to provide them with information
in a glossary at the end of the book. Important concepts that will maximise their marks in this fundamental area, as is
are summarised to assist students in their note-making. reinforced throughout the course.
Question sets are found at the end of each section within Students are encouraged to evaluate experimental design
the chapter, and a comprehensive set of review questions and consider ideas for improvement, taking into account
at the end of each chapter expands on the questions sets accuracy, precision, uncertainty and error – concepts that
for further revision and practice. Questions have been set to are introduced in Chapter 1. This invaluable tool supports
accommodate the abilities of all students. Complete worked student learning as they work through chapter questions and
answers appear on the teacher website. investigations.
Worked examples, written to connect important ideas and Biology in Focus 2nd edition (Year 12) provides students
solution strategies, are included throughout the text. Solutions with a comprehensive study of modern biology that will fully
are written in full, including step-by-step instructions on how prepare them for exams and any future studies in the area.
to perform mathematical calculations. The logic behind each Glenda Chidrawi (lead author)
viii 9780170408851
00_bio_InFocus12_2e_sb_08851_pre.indd 8 08/08/18 5:05 pm
AUTHOR AND REVIEWER TEAMS
Glenda Chidrawi – lead author because she has a special interest in the use of digital
technology to enhance student engagement and learning in
Glenda Chidrawi (BSc Hons, HDipEd (PG)), with an Honours
the Biology classroom. Sarah’s special biological interest is in
degree in molecular biology, has been involved in biology
animal and human physiology and disease processes.
education for more than 30 years. She has lectured and
taught biology at universities and schools in both South
Africa and Australia (Brigidine College 2000–2014 and Margaret Robson
Knox Grammar School 2015–2016). Glenda is currently an
Margaret Robson has been a Science teacher with the NSW
education consultant with the Association of Independent
Department of Education for the last 37 years, teaching both
Schools of NSW. Glenda has co-authored senior Biology
Biology and Chemistry. She is currently Head Teacher of
textbooks, including Biology Options – Communication, part
Science at Brisbane Water Secondary College. Margaret was
of an award-winning series. Glenda has also co-authored the
one of the co-authors of the very successful Biology in Focus
Biology in Focus Preliminary and Biology in Focus HSC textbooks
HSC textbook. Her work for this textbook included writing
and the Student Resource CDs and Teachers’ Resource CDs
for the Student Resource CD and the Teachers’ Resource CD.
that support these publications. Glenda has had articles
Margaret has been an HSC marker for Biology since 1996,
published in educational journals and has written programs
including nine years as a Senior Marker. She has also served
for the AISNSW and material for the NSW QTP Science
as a member of the committee responsible for preparing the
Program Teaching the Stage 6 Syllabus. More recently, Glenda
Catholic Trial paper in Biology for the last seven years.
co-authored the Nelson iScience 10 textbook for the NSW
Australian syllabus. Glenda is a familiar figure at education
conferences in Australia and currently works in the area of Elizabeth Thrum
teacher accreditation at AISNSW.
Elizabeth has been teaching biology for 27 years in a variety of
contexts and schools. She has developed a reputation among
Sarah Bradstock her peers as an experienced Biology teacher at the HSC level
in both marking and writing of trial papers. She is currently the
Sarah grew up in Sydney and graduated from the University
Head of Science at Knox Grammar School, where she works
of Sydney with a Bachelor of Veterinary Science in 1990. She
with a passionate team of educators. She has a passion for
practised as a small animal veterinarian for eight years. After
teaching Biology and helping students reach their potential.
completing a Graduate Diploma of Education in 1997 she
She also likes to work with Biology teachers to ensure that
worked as a full-time Science teacher in Sydney for 20 years.
they can teach engaging lessons. Above all she would like
She is currently undertaking a Master of Education in Digital
students to see how biology is relevant in their daily lives.
Literacy and Knowledge Networks at Charles Sturt University
ACKNOWLEDGEMENTS
Author acknowledgements Publisher acknowledgements
Lead author Glenda would like to acknowledge Mrs Joyce Eleanor Gregory sincerely thanks Glenda, Marg, Sarah and
Austoker-Smith, who encouraged her to put pen to Liz for their perseverance and dedication in writing this book.
paper and mentored her through the early years of writing She also thanks Colin Harrison, Deborah de Ridder, Evan
textbooks. The authors would like to thank their families Roberts and Anita O’Connell for reviewing the manuscript
and colleagues for their support and encouragement, their to ensure that it was of the highest quality. Also thanks to
publisher Eleanor Gregory for her guidance, and the many Gillian Dewar, Anita O’Connell, Kirsten Prior, Marg Robson
students they have taught over the years whose interest in and Rachel Whan for creating NelsonNet material.
Biology and desire to learn has been their inspiration.
9780170408851 ix
00_bio_InFocus12_2e_sb_08851_pre.indd 9 08/08/18 5:05 pm
USING BIOLOGY IN FOCUS
Biology in Focus Year 12 has been crafted to enable you, the student, to achieve maximum understanding and success in this
subject. The text has been authored and reviewed by experienced Biology educators, academics and researchers to ensure
up-to-date scientific accuracy for users. Each page has been carefully considered to provide you with all the information you
need without appearing cluttered or overwhelming. You will find it easy to navigate through each chapter and see connections
between chapters through the use of margin notes. Practical investigations have been integrated within the text so you can see
the importance of the interconnectedness between the conceptual and practical aspects of Biology.
» MODULE FIVE 2 Sexual and asexual reproduction
HEREDITY
Students:
INQUIRY QUESTION • explain the mechanisms of reproduction that ensure the continuity of a species, by analysing sexual and
asexual methods of reproduction in a variety of organisms, including but not limited to:
How does reproduction
– animals: advantages of external and internal fertilisation
ensure the continuity of – plants: asexual and sexual reproduction
a species? – fungi: budding, spores
2 Sexual and asexual reproduction – bacteria: binary fission (ACSBL075)
– protists: binary fission, budding
• analyse the features of fertilisation, implantation and hormonal control of pregnancy and birth in mammals
3 Cell replication •
(ACSBL075) CCT EU
evaluate the impact of scientific knowledge on the manipulation of plant and animal reproduction in
agriculture (ACSBL074) EU L
Biology Stage 6 Syllabus © NSW Education Standards Authority for and on behalf of the Crown in right of the State of New South Wales, 2017
4 DNA and polypeptide synthesis
5 Genetic variation
6 Inheritance patterns in a population
Science Photo Library/Francis Leroy, BIOCOSMOS
Shutterstock.com/Tatiana Shepeleva
32 9780170408851 9780170408851 33
The content is organised under four modules, as set Each chapter begins with a chapter opening page.
out in the NESA Stage 6 Biology syllabus. Each module This presents the learning outcomes from the NESA
begins with a module opening page. Stage 6 Biology syllabus that will be covered in the
chapter and also gives you the opportunity to monitor
your own progress and learning.
To improve comprehension, literacy and understanding, Learning across the curriculum content has been
a number of strategies have been applied to the preparation identified by NESA as important learning for all students.
of our text. One of these is the use of shorter sentences This content provides you with the opportunity to develop
and paragraphs. This is coupled with clear and concise general capabilities beyond the Biology course, and links into
explanations and real-world examples. New terms are bolded areas that are important to Australia
as they are introduced and are consolidated in an end-of- and beyond. This content has been Literacy
book glossary. identified by a margin icon.
Throughout the text, important ideas, concepts and Step-by-step instructions on how to
theories are summarised in key concept boxes. This provides carry out particular procedures, such as drawing an annotated
repetition and summary for improved assimilation of new ideas. diagram or a Punnet square, and the logic behind each step,
are provided in worked examples. Answers to the problems
KEY CONCEPTS
The genetic consequences of meiosis:
at the end of the worked example are provided in the back of
●
– One cell undergoes two meiotic divisions to generate four haploid cells.
– The genes in each haploid cell are a new combination of the parental genes.
– The new combination results from both crossing over and random segregation, allowing the
individual alleles of maternally and paternally derived chromosomes to assort independently.
the book and on the teacher website.
● The genetic consequences of fertilisation:
x 9780170408851
00_bio_InFocus12_2e_sb_08851_pre.indd 10 08/08/18 5:05 pm
The risk assessment table occurs within the investigation.
WORKED EXAMPLE 2.1
ANNOTATED DIAGRAM AND DESCRIPTION OF AN ORGAN OF PERENNATION
The table highlights the risks of the investigation and provides
Annotate a diagram of a perennating organ and explain the advantage of the organ of perennation to
the survival of the species. suggestions on how to minimise these risks –
!
ANSWER LOGIC
Leaves • Draw or insert a diagram. they are not to be considered
• Label all parts of the organ of perennation.
comprehensive. Teachers are expected to RISK
ASSESSMENT
amend this table in the case of substitutions
Bulb
Scale leaves • Annotate the part that stores food.
Main bud store food
or in the case of any additional risks. This
Basal plate Axillary buds
(stem) give rise to • Annotate the part that contains buds.
Roots new plants
Plant: Allium cepa • Name the plant and the organ of
FIGURE 2.24 Stem bulb: onion (organ of perennation) perennation.
may mean obtaining relevant Safety Data
Sheets (SDS) for certain chemicals. All teachers are required
to follow the safety guidelines of their specific school and
Biology is a science and you need to be given the
associated government legislation when students are in
opportunity to explore and discover the living world through
their care.
practical investigations. Investigations introduce and
Full understanding of a concept is often constructed from
reinforce the Working scientifically skills listed in the NESA
many pieces of information. Due to the sequential nature of a
Stage 6 Biology syllabus. In some cases, the investigations
book, this information cannot always be presented together
are open ended. These provide you the opportunity to
because it is best placed in
design and carry out your own scientific investigation, either
other chapters. Links between You will learn more
individually or in a group. At times you are prompted to
concepts that occur on other about fluid transport
consider ideas for improvement or further investigation to in Chapter 6.
pages or in other chapters are
illustrate that science is an ongoing and improving process. At
indicated using the margin
other times, investigations are secondary sourced, meaning
notes.
that you need to research the subject using data and
Regular opportunities to recall new terms and review
information gained by other people. Further information on
recent concepts are provided as short check your
how to conduct a scientific investigation can be found in the
understanding question sets throughout each chapter.
Working scientifically and depth study chapter on page 1.
CHECK YOUR
UNDERSTANDING 1 List the male reproductive parts of a flower and describe the function of each part.
2 Draw and label the female reproductive parts of a flower and describe the function of each part.
2.1c 3 Distinguish between pollination and fertilisation in plant reproduction.
4 Describe the pollination mechanism of two named Australian plants.
5 Identify two ways in which the reproductive structures differ between wind-pollinated and insect-
pollinated plants.
6 Name the structure that each of the following develops into after fertilisation: ovum, seed, ovary wall.
INVESTIGATION 5.1 7 Identify two methods of seed dispersal in named Australian plants.
Information and
Secondary-source and practical investigation to model meiosis,
communication
technology
fertilisation and mutations
capability
During meiosis, genetic variation arises as a result of the behaviour of chromosomes during:
Literacy
• synapsis and crossing over The chapter review section, which appears at the end of
• independent assortment and random segregation.
In your investigation, you need to model how variation is introduced in the process of meiosis, fertilisation
and mutation.
each chapter, provides:
Independent
assortment and
gamete diversity
Watch the animation,
AIMS
1 To model meiosis (including crossing over, independent assortment and random segregation) and predict
• a visual chapter summary that shows how the important
listen to the narration
concepts are linked. This will be a valuable tool when you
and then work variations in the gametes produced (Part A)
through the quiz.
2 To model fertilisation in order to predict variations in the genotype of offspring (Part B)
3 To predict variations in the genotype of offspring if a mutation was to arise during meiosis and/or
subsequent fertilisation (Part C)
are revising for tests and exams
RESOURCES
Meiosis with
crossing over To research how meiosis may be modelled and gain ideas for creative approaches, refer to secondary source
material. This may include information in this textbook, as well as online websites, video clips and animations,
such as the weblink resources.
PART A: CHROMOSOME BEHAVIOUR DURING MEIOSIS LEADS TO GENETIC VARIATION
6 CHAPTER SUMMARY Modern genetic tools
Include SNPs GWAS and haplotypes
AIM Inheritance patterns in a population: Can population genetic patterns be predicted with any accuracy?
To model meiosis, including crossing over, segregation, independent assortment of chromosomes and the Inheritance patterns can be studied and predicted using genetic technologies that determine the sequence of SNP Haplotype GWAS
genes along a section of DNA. Single nucleotide A group of genes that are Genome-wide
production of haploid gametes polymorphism inherited together association study
Ethical issues arising from gathering 4 2
of genetic information
MATERIALS
DNA sequencing DNA profiling 8
Pipe cleaners (or playdough/plasticine/strips of paper) in two different colours, to represent chromosomes – Determines the exact order of bases
of a gene, e.g. ACGTACGTACTTGGA
Also known as DNA fingerprint analysis
one colour represents paternal and the other maternal chromosomes. Make each homologous pair of
Mother Child Male 1 Male 2
Several methods can be used, including: Human evolution studies:
Modern humans of
chromosomes a different length – long, medium and short. To keep your model simple, demonstrate meiosis Anthropological genetics
African origin conquered
archaic groups and
in a parent cell with three pairs of chromosomes. Sanger method New-generation technologies
Human migration theories
replaced them by
DNA is isolated and (e.g. Oxford nanopore) DNA is propelled interbreeding.
replicated using with a motor protein through a protein
METHOD PCR. nanopore.
1 In your model of meiosis, use a cell with: Maxim Gilbert Multiregional hypothesis (MRE) Once dispersed, Out of Africa hypothesis
method Relies mostly on fossil evidence. evolved into Replacement hypothesis – relies mostly
– at least three pairs of chromosomes made out of pipe cleaners, strips of paper or strings of beads Chemicals are used to
identify a specific base.
STR’s (short tandem repeats) are sections
of non-coding DNA that are unique
modern humans on mtDNA evidence.
to individuals and can be used for the
– two colours to distinguish between maternal and paternal chromosomes
Ectrophoresis is then used
to compare the patterns of identification of individuals. Suggests gene
bases. flow between
– different-sized chromosomes to distinguish between the three homologous pairs (for example: long, The process:
neighbouring
populations. All human
Archaic Homo
sapiens left Africa.
A second migration
Population genetics populations can happened about
medium and short). Gene pool The study of genetic variation in a
• DNA is isolated. be traced back 100 000 years ago.
• PCR is used to amplify the amount of DNA. to Homo erectus
The alleles found in population and changes to the frequency
2 Move the chromosomes through each stage of meiosis on templates of cells drawn on A3 paper, or use the a population of alleles within a population. Data
analysis from large-scale collaborative
• Sections are separated according to
length using gel electrophoresis.
leaving Africa about
2 million years ago.
Modelling meiosis template worksheet. Select a method of recording your results from ideas suggested in projects is used for:
Human evolution studies
the results section. See next page. Multiregional Years ago Replacement (Out of Africa)
Modern
Conservation management Africans Europeans Asians Australians humans Africans Europeans Asians Australians
Model how variation is introduced by the process of meiosis, showing the processes described below. How to avoid extinction by maintaining Disease and genetics data
genetic biodiversity, e.g. the koala. Enables scientists to study patterns of genetic disease 50 000
Meiosis I inheritance as well as focusing in improved treatment options 100 000
1 Crossing over – linked genes are exchanged between paternal and maternal chromosomes, increasing the Traditionally field observations were used.
Now genetic data is gathered to make
150 000
For example:
possible combinations of genotypes. informed decisions on biodiversity.
BRCA1 and BRCA2 genes code BRCA2
gene
Homo
erectus
for proteins that repair genes. 1 000 000
Mutations of these genes are BRCA1
Spread of Homo erectus Spread of Homo erectus
linked to breast cancer. gene
through the world through the world
Homo
Chromosome 17 Chromosome 13 habilis
2 000 000
African origin for Homo erectus African origin for Homo erectus
Modern genetic tools See next page.
220 MODULE FIVE » HEREDITY 9780170408851 9780170408851 CHAPTER 6 » INHERITANCE PATTERNS IN A POPULATION 221
156 MODULE FIVE » HEREDITY 9780170408851
9780170408851 USING BIOLOGY IN FOCUS xi
00_bio_InFocus12_2e_sb_08851_pre.indd 11 08/08/18 5:05 pm
• end-of-chapter review questions that review
understanding and provide opportunities for application NelsonNet
and analysis of concepts and how they interrelate.
NelsonNet is your protected portal to the premium
4 CHAPTER REVIEW QUESTIONS Qz
30 Explain the importance of twin studies in genetics. 35 Explain what is meant by ‘gene expression’ and its
digital resources for Nelson textbooks, located at
significance in living organisms. What, then, is the purpose
www.nelsonnet.com.au. Once your registration is
31 Describe three ways in which gene expression can
Review quiz
of polypeptide synthesis?
be regulated. You may use diagrams to assist your
explanation. 36 Design an investigation that a scientist could conduct to
1 Draw a diagram and annotate it to explain the structure of 17 Draw a diagram to represent a thymine nucleotide of show that exons are the only coding sequences expressed
a eukaryotic chromosome. DNA, labelling the three distinct chemical components. 32 Explain the importance of literature reviews in research.
in a protein.
Describe any changes you would need to make to your 33 Discuss the importance of bioinformatics in
2 Compare the chromosome of a eukaryote with that of a
diagram if this was a nucleotide of RNA. understanding both DNA and protein functioning. Use the
complete, you will have access to a valuable suite of
prokaryote.
18 Compare the structure of fibrous and globular proteins. information in Figure 4.28 to support your answer.
3 Distinguish between the following structures:
19 Distinguish between a proteome and a genome, using 34 Write an extended response to discuss whether genes or
a nucleoid and plasmid the environment have a greater influence on phenotype.
examples.
b scaffold and histone Support your arguments with current biological
c nuclear DNA and non-nuclear DNA in eukaryotes. 20 Construct a flow chart with words, arrows and diagrams, knowledge.
digital resources for each chapter to further enhance
to represent:
4 Identify one similarity and two differences between a
a the process of transcription of pre-RNA from DNA
plasmid and mtDNA.
b the subsequent editing of RNA to become mature RNA
5 Explain why mtDNA is useful for evolutionary studies.
c the process of translation.
6 List the following in order of genome size, from largest to
21 Create a flow chart with words and arrows to outline
smallest: prokaryote circular DNA, eukaryote nuclear DNA,
and reinforce learning.
the sequence of events that occurs during transcription
yeast DNA, mtDNA.
and translation. Indicate on your flow chart which steps
7 What are histones? Describe their role in the nucleus of occur inside the nucleus and which steps occur in the
eukaryotic cells and in regulating gene expression. cytoplasm.
8 Using diagrams, explain how DNA is packaged in a 22 Compare transcription and translation in the DNA of
prokaryotic cell. prokaryotes and eukaryotes.
9 Define ‘gene’. Explain why the definition has changed over
time.
10 Give three examples of how the environment affects gene
expression and two examples of how the environment
23 Explain the difference between coding and non-coding
DNA.
24 Identify the sequence of amino acids that would
result from an mRNA molecule with the sequence
Each chapter is supplemented with the following
affects phenotype in a way that is not hereditary. AUUCGUGUAGCCGGUCGA.
11 Draw a Venn diagram to compare DNA and RNA.
12 Use words and arrows to represent the central dogma of
molecular biology.
13 Give the full name of each of the following types of
25 Draw the non-coding strand of DNA that would have
given rise to the mRNA molecule in Question 24.
26 Discuss the importance of using models in biology,
referring to the discovery of the structure of DNA by
digital resources.
Watson and Crick as an example.
• Worksheets to review concepts and to
nucleic acids in cells and outline the function of each:
a DNA 27 Construct a simplified diagram of a strand of DNA to show
a sequence of nucleotides 24 bases in length, following
b mRNA
the instructions below.
c rRNA
a Use a single line to represent the sugar-phosphate
d tRNA
WS
backbone and letters to represent the bases.
practise applying understanding to new
e mtDNA b Use the mRNA codon table in Figure 4.15 to make sure
f miRNA that the first triplet of bases on the DNA strand you
construct codes for a start codon in mRNA and that the
14 Do more complex organisms have a larger number of
last triplet of bases codes for a stop codon.
chromosomes? Use data to justify your answer.
28 Draw a diagram to show how the strand of DNA that you
15 List the following in order of size, from smallest to largest:
created in Question 27 would be:
examples
a polypeptide, protein, amino acid, dipeptide
a transcribed into mRNA
b nucleic acid, nucleotide, chromosome, gene.
b translated into a polypeptide chain (use the mRNA
16 Draw a diagram to represent: codon table in Figure 4.15).
a a protein molecule, and label all parts listed in 29 Write two changes in bases that could occur in the DNA
Question 15a strand that you created in Question 27 that would not
b part of a chromosome, and label all parts listed in result in a change in the sequence of amino acids. Explain
• A review quiz containing 20 autocorrecting
Question 15b. why this is so.
148 MODULE FIVE » HEREDITY 9780170408851 9780170408851 CHAPTER 4 » DNA AND POLYPEPTIDE SYNTHESIS 149
Qz
multiple-choice questions to review
Each module concludes with a module review. This understanding Review quiz
contains short-answer questions that provide you with the
• Links to websites that contain extra
opportunity to assimilate content across the chapters that fall
information. These are hotspotted within the
within that module.
NelsonNetBook and can also be accessed at
» END-OF-MODULE REVIEW MODULE 5 : HEREDITY
http://biologyinfocus12.nelsonnet.com.au
9 Use the diagram below to answer the questions that follow. 11 A species of mosquito that causes yellow fever has
three pairs of chromosomes in its cells. Calculate how
C
D many different combinations of maternal and paternal
B chromosomes would be possible in the gametes. Show
Answer the following questions. your working.
Disclaimer
1 Explain why the genetic code needs to be universal in 6 Familial hypercholesterolaemia is a disorder in which 12 An inherited condition known as ichthyosis results in scaly
order for bacteria to produce human growth hormone. receptors on liver cells that normally take up cholesterol skin. The disorder is found in 1 in 6000 males, but the
Use a flow chart to provide an example that illustrates from the bloodstream do not work. This results in very disease is almost unknown in females.
your answer. high levels of cholesterol in the blood. Individuals who E a What type of inheritance may account for the
are heterozygous have half of the receptors functioning; difference in the occurrence of ichthyosis in males
2 The diploid number of chromosomes in humans (Homo homozygous individuals have no receptors functioning. A and females?
sapiens) is 46 and the diploid number of chromosomes F
a Name the type of inheritance pattern shown in b From which parent would an affected male inherit the
Please note that complimentary access to NelsonNet
in rice (Ozyra sativa) is 24. Decide whether each of the hypercholesterolaemia, giving reasons for your answer. defective allele? Explain why.
following statements is true or false, and provide evidence a Give the letter(s) of the label that points to the part(s)
b Describe the expected effect of the gene for c What is the probability that a male could pass the
from your understanding of genetics to support your of the flower where each of the following occurs:
hypercholesterolaemia on cholesterol levels in the defective gene to his sons? Explain your answer.
answer. i meiosis
blood of a person who is: d What may account for the fact that there are no
a Simpler organisms have fewer chromosomes than ii pollen lands during pollination
i homozygous for the normal allele known cases of the disease in females?
complex organisms.
iii fertilisation.
and the NelsonNetBook is only available to teachers
ii heterozygous
b Plant species have fewer chromosomes than animal 13 A dingo is a carnivorous placental mammal with high-
iii homozygous for the hypercholesterolaemia allele. b Explain how artificial pollination is carried out, referring
species. quality parental care. The Tasmanian devil is a carnivorous
to letters of parts of the diagram to help you explain.
c The number of chromosomes in a human gamete is c Draw a Punnett square to determine the genotypes of marsupial mammal. It is not known exactly how many
offspring of two parents who are heterozygous for the c In terms of the diagram, explain the difference between
less than the diploid number of chromosomes in rice. chromosomes a thylacine tiger had, but scientists expect
hypercholesterolaemia gene. Give the phenotypic and an ovary, an ovule and an ovum. You may redraw part
d The number of chromosomes in a rice gamete is the it to be fourteen, like related marsupials.
genotypic ratios of offspring. of the diagram and label it to aid your explanation.
same as the number of chromosomes in a human Scientists believe that by placing synthetic chromosomes
who use the accompanying student textbook as a core
d If a harmful mutation occurred in a cell at position A,
gamete. 7 A male guinea pig that is pure breeding for black fur is created from DNA fragments from a preserved Tasmanian
explain the consequences, if any, for this plant and
crossed with a guinea pig that is pure breeding for white tiger genome into a treated egg cell of a related species,
3 Using a flow chart with words and arrows, or a sequence future generations.
fur. The offspring have parts of their body that are black it may be possible to create a viable egg that can be
of annotated diagrams, outline the reproductive e If a mutation occurred in the cells inside C, explain implanted into a surrogate mother, to recreate the extinct
and parts that are white. the possible consequences for this plant and future
technology used to produce each of the following: Tasmanian tiger.
a What type of inheritance does this suggest for coat generations.
a cloned adult cows
educational resource in their classroom. Contact your
colour in these guinea pigs? Give a reason for your Which host animal, dingo or Tasmanian devil, would be
b cloned embryos f Explain how a flower such as this one could ensure best to use to act as an egg donor? Which would be best
answer. cross pollination rather than self-pollination, and the
c stem cuttings as a surrogate mother? Justify your answer.
b Discuss what the expected offspring would be in resulting advantages to future offspring.
d genetically modified cotton terms of genotypes and phenotypes (and their ratios) g If the inheritance pattern of this flower is incomplete 14 Explain why germline mutations introduce new alleles
e in vitro fertilisation. if, in guinea pigs, dominance, and it reproduces by self-fertilisation, into a population, but somatic mutations do not.
i black was dominant over white
sales representative for information about access codes
predict the genotypic and phenotypic ratios of
4 Compare the physical and chemical structure of DNA and 15 If a single-stranded break occurs in the DNA of a cell, this
ii black and white showed incomplete dominance offspring in the first filial generation.
proteins, including differences in chemical composition, creates a problem for the cell, but if a double-stranded
monomers, bonding, physical shape, primary structure iii black was X-linked and dominant
10 The sequence of diagrams below represents the stages of break occurs in DNA, this is a much greater risk. Explain
and overall structure. iv black was codominant and sex-linked. a cell dividing by mitosis. why.
5 In 1940, a blood cell protein was discovered in humans 8 Discuss four natural mechanisms of reproduction in living A B C D E 16 A double-stranded break that occurs during meiosis can
and conditions.
that had first been discovered in rhesus monkeys. The organisms that ensure the continuity of the species. be repaired using a sister chromatid. Explain how this
allele of the gene that produces the protein is called Include in your discussion examples of mechanisms seen could occur.
Rh positive (Rh+) and is dominant over the allele for the in both asexual and sexual reproduction and unicellular
absence of the protein, termed Rh negative (Rh–). The and multicellular organisms.
allele for Rh+ shows complete dominance. Draw one
Punnett square to show all of the following, and explain a Write out the letters in the order in which these stages
each using examples from the Punnett square. occur.
a An Rh– child is born from parents who have at least b How many chromosomes are there in the cell?
one Rh– allele. c What would the haploid number of chromosomes be
b Two Rh+ parents could have a Rh– child. for these cells?
c Siblings in the same family are a mixture of Rh+ and Rh–. d Draw the cells that would result if the above cell was
to divide by meiosis. You may use colour to help you
illustrate this process.
9780170408851 CHAPTER 6 » INHERITANCE PATTERNS IN A POPULATION 223 224 MODULE FIVE » HEREDITY 9780170408851
The depth study provides you with the opportunity to
pursue a topic of interest from within the course. It enables
you to study a topic in more depth and present your findings
in a format of your choice. Advice and support to assist you
in undertaking your depth study can be found in Chapter 1,
as well as suggestions for topics provided at the end of each
module review. Refer to the NESA Stage 6 Biology syllabus
for the full details on the scope and completion of your
depth study.
▻ Investigate the structure and physiology of a variety of flowering plants, with an emphasis on
reproductive mechanisms that are adaptations that ensure continuity of the species.
▻ Research the claim that sexual reproduction helps speed up evolution and may allow some algae to
adapt quickly enough to tolerate the rise in sea surface temperature. Evaluate the possibility that this
adaptation will allow some corals to survive a bleaching event.
▻ Investigate gametogenesis and compare and model differences in meiosis during the production
of egg cells and sperm cells in mammals.
▻ Look into the Red Queen hypothesis and find out whether it promotes natural selection for or
against sexual reproduction.
xii USING BIOLOGY IN FOCUS 9780170408851
00_bio_InFocus12_2e_sb_08851_pre.indd 12 08/08/18 5:05 pm
SYLLABUS MAPPING
Working scientifically mapping
Content statements from the NESA Stage 6 Biology syllabus are shown in full on the chapter opening pages of the chapters
where they are dealt with. A full mapping of chapters and content statements can be found on the NelsonNet Teacher website.
Below is a mapping of the outcome statements for Working scientifically across all the chapters of Biology in Focus Year 12.
OUTCOME STATEMENTS CHAPTER
A STUDENT: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
BIO11/12-1 develops and
evaluates questions and
✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓
hypotheses for scientific
investigation
BIO11/12-2 designs and
evaluates investigations
in order to obtain primary ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓
and secondary data and
information
BIO11/12-3 conducts
investigations to collect
valid and reliable primary ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓
and secondary data and
information
BIO11/12-4 selects and
processes appropriate
qualitative and quantitative ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓
data and information using a
range of appropriate media
BIO11/12-5 analyses
and evaluates primary
✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓
and secondary data and
information
BIO11/12-6 solves scientific
problems using primary
and secondary data, critical ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓
thinking skills and scientific
processes
BIO11/12-7 communicates
scientific understanding
using suitable language and ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓ ✓
terminology for a specific
audience or purpose
Biology Stage 6 Syllabus © NSW Education Standards Authority for and on behalf of the Crown in right of the State of New South Wales, 2017
9780170408851 xiii
00_bio_InFocus12_2e_sb_08851_pre.indd 13 08/08/18 5:05 pm
SYLLABUS MAPPING
00_bio_InFocus12_2e_sb_08851_pre.indd 14 08/08/18 5:05 pm
Working scientifically
1 and depth studies
A student:
• Questioning and predicting
– BIO11/12-1 develops and evaluates questions and hypotheses for scientific investigation
• Planning investigations
– BIO11/12-2 designs and evaluates investigations in order to obtain primary and secondary data and information
• Conducting investigations
– BIO11/12-3 conducts investigations to collect valid and reliable primary and secondary data and information
• Processing data and information
– BIO11/12-4 selects and processes appropriate qualitative and quantitative data and information using a
range of appropriate media
• Analysing data and information
– BIO11/12-5 analyses and evaluates primary and secondary data and information
• Problem solving
– BIO11/12-6 solves scientific problems using primary and secondary data, critical thinking skills and scientific
processes
• Communicating
– BIO11/12-7 communicates scientific understanding using suitable language and terminology for a specific
audience or purpose
Biology Stage 6 Syllabus © NSW Education Standards Authority for and on behalf of the Crown in right of the State of New South Wales, 2017
Shutterstock.com/Syda Productions
9780170408851 1
01_bio_InFocus12_2e_sb_08851_txt.indd 1 04/08/18 2:01 PM
Science is the systematic study, by observation and experiment, of the natural and physical world (Fig. 1.1).
Science is characterised by a way of thinking and working, and, most fundamentally, by questioning.
The knowledge and understanding that arise from this questioning are not in themselves science. They
are the products of science, as is the technology that arises from this knowledge and understanding.
Science is empirical, which means that when scientists ask questions, they seek to answer them by using
evidence, in particular observational and experimental evidence.
Biology as a field of study was named in the 19th century and arose from
iStock.com/BraunS
the studies of medicine and natural history, both of which date back to ancient
times. The term ‘biology’ comes from the Greek words bios (life) and logos
(word or discourse). Biology asks questions about all living things, including
plants, animals and micro-organisms. It asks questions about their structure
and functioning, how and why they have changed over time and continue to
change, about their interactions with each other and the environment, and
about biodiversity and the continuity of life – looking at heredity and variation.
These fields of interest in biology are grouped into subdivisions such as botany,
zoology, microbiology, evolutionary biology, ecology and genetics. Given that
FIGURE 1.1 Investigating in biology all living things are interdependent, biology is a fascinating science!
1.1 The nature of biology
Questions lead to investigations and these in turn lead to scientific theories that are testable and
falsifiable. This applies to all sciences, including biology. For a theory to be considered scientific, it must
be possible to test it and, most importantly, to test whether it is not true. This is what falsifiable means:
‘able to be disproved’. This sets science apart from many other disciplines in which there are theories that
cannot be tested or disproved. Such theories are not scientific.
This is why scientists never talk about proving a theory, but rather about providing evidence to
WS support a theory. When a large enough amount of evidence has been gathered that supports a theory,
Laboratory
then that theory is accepted by the scientific community. Examples of theories in biology that have so
rules much evidence supporting them that they are generally accepted are the Cell Theory and the Theory of
Evolution by Natural Selection.
However, no matter how much evidence you gather supporting a theory, it takes only one experiment
that disagrees to disprove a theory. As Einstein said: ‘No amount of experimentation can ever prove me
right; a single experiment can prove me wrong’.
There are many examples of theories and hypotheses in biology that were proposed and later
rejected or changed when new evidence came to light. For example, the theory of spontaneous
generation is now obsolete, and a theory proposed as the one-gene-one-enzyme theory was later
changed when it was realised that a single gene may code for a number of different polypeptides.
There are also examples of theories that were based on hoaxes, such as that of Piltdown man. Some
hypotheses have been rejected because the scientific method used could not be repeated and was
later shown to be invalid (for example, the hypothesis that proposed that autism could be caused by
a certain vaccination).
KEY CONCEPTS
● Scientific theories are falsifiable; they can be disproved, but they cannot be proved. For a theory
to be accepted it must be supported by a great deal of evidence.
● A good hypothesis is falsifiable and it takes only one instance of results that disagree with the
hypothesis to disprove it.
● No amount of success in testing a hypothesis can prove it is right. Each confirming instance
only increases one’s confidence in one’s idea.
2 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 9780170408851
01_bio_InFocus12_2e_sb_08851_txt.indd 2 04/08/18 2:01 PM
The scientific method – an overview
The scientific method is the process of systematically gathering information and data by observation Critical and
and measurement, and using the information and data to formulate and test hypotheses. It is creative thinking
from such investigations that the body of scientific knowledge that we accept today has been
accumulated.
The scientific method is summarised in Figure 1.2.
FIGURE 1.2 The
scientific method
Scientific method
Think of a question
Formulate a hypothesis
informed by existing literature
Develop predictions
Peer Design an experiment
review to test predictions
Change
hypothesis
Perform experiment
numerous times
Communicate
results
Analyse data
Results support Results do not
hypothesis support hypothesis
Hypotheses
The scientific method begins with asking questions (sometimes called research questions). Based on
How to formulate
these questions, you formulate a hypothesis, which is a tentative answer to your question. This usually a hypothesis is
involves reading the literature to see if anyone has already answered your question or investigated a discussed in more
detail on pages
similar question. For example, we might hypothesise that if we use a particular fertiliser on a certain 11–12.
species of seedling, then the seedlings will grow taller. We could test this hypothesis by performing
experiments where we measure the height of a particular species of seedling subjected to different
fertilisers.
In scientific investigations, progress is often not a straight line, from one point to the next, but a series
of progressions that sometimes veer off the original path. Often, the result of your initial experiments
will make you reassess the direction you intend taking, and may lead you to change your hypothesis and
refine your experimental design (Fig. 1.2).
9780170408851 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 3
01_bio_InFocus12_2e_sb_08851_txt.indd 3 04/08/18 2:01 PM
Experiment design and validity of results
An experiment is designed and performed to test a prediction, and the results are then analysed. If the
results of the experiment agree with the prediction, then the hypothesis is supported. Note that it is not
proved, only supported. There may be other explanations that would also be supported by the results. If
the results do not agree with the prediction, then the hypothesis is not supported and the scientist needs
to come up with another explanation.
Experiments are considered valid when scientists test the hypothesis that they intended to test and
Validity, reliability
and accuracy are get consistent and accurate results when repeated. A valid experiment involves setting up controls and
discussed in more making sure that the only thing that changes in the experiment is the variable being tested. All other
detail on page 16.
conditions must be controlled to remain the same. Experiments are considered reliable when they can
be repeated to give the same results and random error is eliminated or minimised. An experiment is
considered accurate when its measurements are close to the true value – for this to be achieved, the
risk of error in measurement must be kept to a minimum. For an experiment to be valid, it must be both
reliable and accurate. This will be dealt with in more detail in a later section (page 16).
Communication and peer review
Reproducibility and peer review are important aspects of science. If an experiment cannot be repeated
to give the same results, then there is a good chance that a mistake was made and the experiment is not
valid. For example, if experiments cannot be repeated to give the same results because of uncertainties
in the original measurements, the result is that the hypothesis is clearly disproved.
Scientists communicate their work to each other to share new ideas and information and as a way
of contributing to the ongoing development of science. They usually communicate new findings to each
other in seminars and conferences, as well as writing articles for scientific journals. When you conduct
an experiment and write a report on it, the report is very much like a scientific paper.
Before a scientific paper is published, it is reviewed by other scientists – experts in the particular
area – who evaluate it. They try to determine whether:
◗ the experiments conducted were appropriate
◗ the conclusions drawn were valid
◗ the hypothesis is clearly supported or not.
If the paper is considered to make a useful contribution to science, and the experiments and analysis
are valid, then it will be published. Other scientists can then read the paper and use it to inform their own
work. Scientists also communicate their work in other ways to the public and to students.
Descriptions of the scientific method are somewhat idealised. In practice, the scientific method may be
a bit messy and not follow the steps in order. Sometimes scientists have only questions but no hypothesis
Science and to answer them. In these cases, experiments are done or observations are made to try to form a hypothesis
pseudoscience
Read this article about
that can then be tested. Sometimes, in trying to answer one question, a new and more interesting question
the scientific method arises, so a scientist will change the experiments to work on the new question instead. However, once a
and come up with
your own explanation scientific discovery is made, and even when a new and exciting discovery is made by accident, the scientific
of the difference method will be used to formulate and test hypotheses that arise to explain it.
between science and
pseudoscience.
KEY CONCEPTS
● A hypothesis is a predictive statement about the relationship between the variables in an
investigation and is an ‘expected’ answer to a question.
● The scientific method consists of questioning and formulating hypotheses, making
measurements to test the hypotheses, analysing the results, and communicating them for peer
review. It is the process by which science proceeds.
4 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 9780170408851
01_bio_InFocus12_2e_sb_08851_txt.indd 4 04/08/18 2:01 PM
Biology as a scientific discipline
Disciplines within science can be characterised by the sorts of questions that they ask. Biology asks
questions about the organisation and grouping of living organisms, how living things change over time,
why some species survive and others do not, and how living things interact with their environments and
with each other.
Biologists find that these questions may be answered by looking at the morphology and functioning
of living organisms, how they reproduce and are adapted for survival, their origin, distribution and
interactions, as well as inheritance patterns and increases in diversity. Biological studies ask questions at
various levels – macroscopic, microscopic and molecular. Developments in technology and advances in
knowledge and understanding in biology progress hand in hand, with each one assisting the other.
The more we find out in biology, the more questions are generated. There are many questions we
have not answered yet. As current and future biologists investigate and answer these questions, yet more
questions will arise that no one has thought of yet. Will all the possible questions about living organisms
ever be answered?
Models in science
Over the years, scientists have asked questions and sought and, at times, found answers to those
questions. From their answers we have constructed models of how living things may be related and
how and why they change over time. These models are always changing, as we get more evidence
and better answers to existing questions, or as we seek answers to new questions. Models are
representations of biological reality – they are not the reality itself any more than a model aeroplane
is a real aeroplane. Models can be physical models, some are mathematical models made up of
equations and data, and yet others are conceptual models consisting of principles, laws and theories.
Biologists use all sorts of models as they ask and seek to answer questions. At times they combine
models and switch between models.
Models in biology have two important purposes – to explain how things work, and to predict what
will happen. A model that does not accurately predict the results of an experiment will generally be
revised or replaced. Two models may give similar results in some situations but different results
in others. Model selection is important to get valid and reliable results. For example, the model of
Mendelian (autosomal recessive) inheritance and the model of non-Mendelian inheritance can both
be used to describe and analyse the pattern of inheritance of genetic traits. Overall, the two models
give similar results, with exceptional circumstances taken into account in non-Mendelian genetics. See Chapter 5 for
more details on
For example, in the Mendelian genetics model, all genes are assumed to be inherited independently these models of
of each other and are either dominant or recessive. However, it has been found that some genes occur inheritance.
on the same chromosome or are located on sex chromosomes, and breeding experiments that involve
these genes do not give the expected ratios typical of the Mendelian model. In studies of other genes, no
clear dominance is seen – both genes are expressed if present, or a blend of genes is expressed. In these
cases, non-Mendelian models such as sex-linkage, co-dominance or incomplete dominance are used to
analyse patterns of inheritance, taking the additional complexities into account. This doesn’t mean that
either model is always ‘right’ or ‘true’, just that Mendelian inheritance is the basic model, but the other
inheritance models may need to be applied to take into account further complexities in inheritance
patterns. Choosing the right model for a situation is an important skill in solving problems in biology.
KEY
CONCEPTS
● Biology uses models such as physical, mathematical and conceptual models to describe
biological systems and to make and test predictions. Models are constantly being refined
as we learn more.
9780170408851 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 5
01_bio_InFocus12_2e_sb_08851_txt.indd 5 04/08/18 2:01 PM
Biology – knowledge and understanding
As you progress through your Biology course, you will learn a lot of useful skills, and practise working
scientifically by performing investigations and depth studies. You will also gain some knowledge and
develop a deeper understanding of biology.
The knowledge that has arisen from answering questions asked by biologists can be broadly
categorised into five major concepts: form and function; similarity and diversity; stability and change;
systems and interactions; and patterns, order and organisation. Figure 1.3 shows how the five concepts
in the Year 12 Biology course fit into unifying themes.
As you learn more of the content knowledge of biology, you need to create your own mental models
to help you understand it. Concept maps are a useful way of representing your mental models. They help
to remind you that biology is not simply a collection of facts. Every idea in biology is connected to other
ideas. For each module in biology, you should create a concept map both to record the content that you
learn and to make connections between different content areas and modules.
FIGURE 1.3 Unifying
concepts in biology
Form and function
Simi
Heredity and
reproduction
ion
nisat r
larity
e
and erns, ord
and
Genetic
orga
dive
Patt
Biology change and
biodiversity
rsity
Non unifying
-in concepts
dise fectiou
a s
diso se and
rder
s
Disease and
Sy disorders
ste
ms ge
an han
di dc
nte an
rac ility
tio
ns S tab
Solving scientific problems:
1.2
depth studies
Depth studies are your opportunity to work scientifically and solve scientific problems. When performing
a depth study, you will pose questions, develop hypotheses to answer your questions, and then seek
evidence to support or disprove your hypotheses. The evidence may come from the existing scientific
literature or from your own experiments. You will need to analyse data to determine whether your
hypotheses are supported. Analysing data usually requires you to represent it in some way, often
mathematically or graphically. Finally, as scientists do, you need to communicate your findings to others.
There are many ways that you can do this, and you need to choose the method most appropriate to the
audience you wish to communicate with.
6 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 9780170408851
01_bio_InFocus12_2e_sb_08851_txt.indd 6 04/08/18 2:01 PM
Types of depth studies
There are two broad types of depth study:
1 first-hand or practical investigations, where you design and perform experiments to gather primary
data, or to test a claim or device
2 investigations based on secondary sources, where you research and review information and data
collected by other people.
First-hand investigations to gather primary data may be:
◗ work undertaken in a laboratory
◗ field work, where observations are undertaken at home, school or elsewhere (for example, on
excursions or by engaging with community experts)
◗ the creation and testing of a model or device.
Secondary-source depth studies may include: How to write a
literature review
◗ undertaking a literature review is discussed in
more detail on
◗ investigating emerging technologies and their applications in biology pages 9–10.
◗ analysing a science fiction movie or novel
◗ developing an evidence-based argument or a historical or theoretical account.
Depth studies may be presented in different forms, some of which include:
◗ written texts (experiment reports, field work reports, media reports, journal articles, essays and
management plans)
◗ visual presentations (diagrams, flow charts, keys, posters and portfolios)
◗ multimedia presentations
◗ physical models
◗ a combination of the above.
All depth studies will involve the analysis of data, either from primary data that you collect yourself
or secondary data that you collect from analysing other people’s research such as longitudinal data
or resource management data. Looking for patterns and trends in data will involve analysing and
constructing graphs, tables, flow charts, diagrams, keys, spreadsheets and/or databases. This will be
dealt with in more detail in the section Designing your investigation (see page 15). You may also wish to
refer to the NSW Stage 6 Biology syllabus document for more information.
Why undertake a depth study?
Depth studies encourage us to identify areas of interest and enable us to deepen our understanding in
a chosen area, taking responsibility for our own learning. Although a field of study may be identified by
the teacher, students may pursue their own area of interest within this field, be it technology, current
research, biologists working in the field, or other areas.
Depth studies provide students with time and an opportunity to: How to plan a
depth study is
◗ use the research methods that scientists use discussed in
detail on
◗ analyse works for scientific relevance and validity pages 12–15.
◗ broaden their range of reading in a field of interest
◗ extend their depth of thinking and understanding
◗ ask questions and investigate areas that do not have definite answers
◗ investigate contentious issues and use critical thinking skills to consider the validity of views
expressed in a variety of sources
9780170408851 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 7
01_bio_InFocus12_2e_sb_08851_txt.indd 7 04/08/18 2:01 PM
◗ use inquiry-based learning and develop their creative thinking in an area of their own choosing, at
their own level.
Stages in a depth study
The summary below outlines the four main stages of conducting a depth study, and the Working
scientifically skills (see the NESA Stage 6 Biology syllabus) that you will need to develop and apply at
each stage.
1 Initiating and planning involves:
Questioning and predicting
(BIO-1): develops and evaluates questions and hypotheses for scientific investigation
Planning investigations
(BIO-2): designs and evaluates investigations in order to obtain primary and secondary data and
information
2 Implementation and recording involves:
Conducting investigations
(BIO-3): conducts investigations to collect valid and reliable primary and secondary data and
information
Processing data and information
(BIO-4): selects and processes appropriate qualitative and quantitative data and information using a
range of appropriate media
3 Analysing and interpreting involves:
Analysing data and information
(BIO-5): analyses and evaluates primary and secondary data and information
Problem solving
(BIO-6): solves scientific problems using primary and secondary data, critical thinking skills and
scientific processes
4 Communicating involves:
(BIO-7): communicates scientific understanding using suitable language and terminology for a
specific audience or purpose
Biology Stage 6 Syllabus © NSW Education Standards Authority for and on behalf of the Crown in right of the State of New South Wales, 2017
Working Scientifically
Skills Outcome:
BIO11/12-1 Posing questions and formulating hypotheses
The first step to beginning any investigation or depth study is deciding on a
Alamy Stock Photo/Jim West
question. A good research question is one that can be answered by conducting
an experiment, making observations or conducting a secondary-source
investigation.
Obviously, it is a good idea to investigate something that you find interesting.
If you are working in a group, try to find something that is interesting to everyone
in the group.
A good way to start is by ‘brainstorming’ for ideas (Fig. 1.4). This applies
whether you are working on your own or in a group. Write down as many ideas
FIGURE 1.4 Brainstorm as many ideas as you can as you can think of. Avoid being critical at this stage. Get everyone in the group
in your group.
to contribute, and accept all contributions uncritically. Write every idea down.
8 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 9780170408851
01_bio_InFocus12_2e_sb_08851_txt.indd 8 04/08/18 2:01 PM
After you have run out of ideas, it is time to start being critical. Decide which questions or ideas are Personal and
the most interesting. Think about which of these it is actually possible to investigate given the time and social capability
resources available. Remember that the most important resources you have are the skills of the people in
Critical and
the group. Make a shortlist of questions, but keep the long list too, for the moment. Once you have your creative thinking
shortlist, it is time to start refining your ideas.
A good research question should define the investigation, set boundaries and provide some direction
to the investigation. The difference between developing a research question and formulating a hypothesis
can be summed up as ‘known versus unknown’. You need to do some research of known results in
Six methods of
your area of interest (research questions) before deciding what you think the expected outcome of an data collection
experiment may be (hypothesis). and analysis
Writing a literature review – refining your question
Your depth study will be from one of the areas described in Figure 1.3, which is based on the NSW Stage
Literacy
6 Biology syllabus document. These areas are described in the remaining chapters. However, you will
need to go beyond the basic syllabus content because the purpose of a depth study is to extend your Information and
communication
knowledge while building your skills at working scientifically. technology
The next step is therefore to find out what is already known about the ideas on your list. You need to capability
do a literature review. If your depth study is a secondary-source investigation, then the literature review
may be the investigation itself. A formal written literature review includes the information you have Critical and
found and complete references to the sources of information. It also includes interpretation and critique creative thinking
of what you have read. This is particularly important for a secondary investigation.
Why are literature reviews important?
Literature reviews are important because they help you to:
◗ increase your breadth of knowledge and identify what is and is not known about an area of research
◗ learn from others and think of new ideas that may be relevant to a research project
◗ identify gaps in current knowledge that you may wish to research or recommend be researched by
scientists in the future
◗ identify methods that could be relevant to your project (avoid reinventing the wheel and/or making
the same mistakes as others)
◗ identify the variety of views (sometimes opposing views) in an area of research and consider how
these fit in with your own views.
Your literature review
A literature review is a search and evaluation of available literature in a particular subject area. It has a
particular focus and is always defined by your research question or hypothesis.
The process of conducting a literature review involves researching, analysing and evaluating the
literature. It is not merely a descriptive list of the information gathered on a topic, or a summary of one
piece of literature after another. It outlines any opposing points of view in the research and also expresses
the writer’s perspective of the strengths and weaknesses of the research being reviewed. A literature
review brings together results of different studies, pointing out areas where researchers or studies agree,
where they disagree, and where significant questions remain. By identifying gaps in research, literature
reviews often indicate the direction for future research.
When planning an investigation, you will find that using a literature review will give you an idea of
past findings, procedures, techniques and research designs that have already been used. This will help
you to decide which methods are worth copying, which need modifying and which to avoid (those that
have been inconclusive or invalid). You may plan your investigation to target a gap in research or try to
replicate an investigation to test and validate claims and ideas.
9780170408851 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 9
01_bio_InFocus12_2e_sb_08851_txt.indd 9 04/08/18 2:01 PM
The length of your literature review will depend on its purpose. If it is a depth study in itself, it will
need to be more detailed and draw conclusions about the research. If it is used as an introduction to
inform your research, it will be shorter and more focused. Discuss this with your teacher.
Reasons to write a literature review
◗ To extract information from sources
◗ To consider the validity of views expressed in each source
◗ To consider how existing views fit in with a research project, to place it in context and demonstrate
how the research is linked to a body of scientific knowledge
◗ As an end in itself (for example, as a secondary-source research assignment to use the findings to
support a concluding judgement)
◗ As a starting point to begin planning a primary investigation, identifying both what is known and
where there are current gaps in research
Characteristics of a good literature review
◗ Helps the reader know what knowledge and ideas have been established on a topic and the areas of
strength and weakness in the research
◗ Organises the information gathered into sections that present themes
◗ Does not attempt to list all published material, but rather brings together and evaluates the literature
according to a question, hypothesis or guiding concept
How to write a literature review
1 Getting started: define the topic or research questions (key concepts) and formulate a literature
WS review question (you may have to do some wide reading before finalising this step). Write a list of key
words.
How to successfully
evaluate and use 2 Find articles: use library catalogues, databases and the Internet. Refine your search technique, using
websites
specific words that narrow your search to the focus question. Interpret and evaluate your search
results. Record search words that are successful and, if necessary, modify your search strategy.
3 Structure and write your literature review:
i Introduction: define the topic, establish your reasons for reviewing the literature, state the specific
Literature reviews
More detail on how to
focus of the review and explain the organisation or sequence of your review.
write a good literature ii Body: group the literature according to common themes, provide an explanation of the
review
relationship between the research question and the literature reviewed, and proceed from the
general, wider view of the research to the specific area you are targeting.
Include information about the usefulness, recency and major authors or sources of the
literature.
iii Conclusion: summarise important contributions of the literature, point out important flaws
The CRAAP test
Apply the CRAAP test
or gaps in research if appropriate, and explain the link between your focus question and the
to any websites that literature reviewed (if the literature review is your depth study) or why you have chosen your area
you find.
of investigation (if the literature review was conducted to refine your investigation).
Evaluating sources
Critical and Always be critical of what you read. Be wary of pseudoscience, and any material that has not been peer
creative thinking
reviewed. Apply the CRAAP (currency, relevance, authority, accuracy, purpose) test to websites that you
find. The most reliable sites are from educational institutions, particularly universities, and government
10 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 9780170408851
01_bio_InFocus12_2e_sb_08851_txt.indd 10 04/08/18 2:02 PM
and scientific organisations such as the CSIRO and WHO, and professional
Shutterstock.com/Ermolaev Alexander
journals such as the Medical Journal of Australia and international equivalents.
You can narrow your search to particular types of sites by including in your
search terms ‘site:edu’ or ‘site:gov’ so that you find sites only from educational or
government sources.
Make sure you keep a record of the information that you find as well as the
sources, so that you can correctly reference them later (Fig. 1.5). It is a good
idea to start a logbook (page 18) at this stage. You can write in references or
attach printouts to your logbook. This can save you a lot of time later on. Your
logbook may be hard copy or electronic but, either way, begin keeping it now.
Finally, talk to your teacher about your ideas. They will be able to tell you FIGURE 1.5 Start researching your topic
whether your ideas are likely to be possible for investigation given the equipment and make sure you keep a record of all your
references. Good record keeping is important in
available. They may have had students with similar ideas in the past and can scientific research, and it begins at this stage of
make suggestions about what worked well and what did not. the investigation.
After you have researched your questions and ideas, you will ideally be able
to narrow the shortlist down to the one question that you want to tackle. If none
Science Photo Library/MARTYN F. CHILLMAID
of the questions or ideas looks possible (or interesting), then you need to go
back to the long list.
Proposing a research question or hypothesis
If you are doing a primary-source investigation (of, for example, the effect of
the environment on phenotype), then you need to define a research question
and/or hypothesis.
For example, you may begin by thinking: ‘I wonder if a new fertiliser will
affect plant growth’. This idea is too general, so you need to turn it into a
more specific research question. The research question may be: ‘What effect
does a new fertiliser have on root and stem growth in a plant?’ The question
needs to be specific enough to guide the design of your experiment. It needs
to include what you will be varying (for example, type of fertiliser) and what
result you will expect (root and/or stem growth). Once you have decided on
your research question, further reading will guide you to design a suitable
experiment (Fig. 1.6). You would read up about the chemical components of
different fertilisers, ways of measuring root and stem growth, and what types
of plants have and have not had growth benefits from fertilisers in the past.
You need to decide on what specifically you will be changing (for example,
you may decide to select a new fertiliser with twice as much nitrogen as the
FIGURE 1.6 You need to frame your research
old fertiliser) and exactly what you will measure (shoot height, root length question carefully. This student is investigating
and root mass in a seedling). The research question can then be turned into plant growth with different fertilisers.
a hypothesis: If a fertiliser that contains more nitrogen is introduced, then a
particular seedling’s shoot height, root length and root mass will increase.
KEY CONCEPTS
● Frame your research question carefully by making it specific enough to guide the design of the
investigation.
● Poor research question: ‘How can we make a seedling grow the best?’ ‘Best’ is a vague term.
What you mean by ‘best’ may not be what someone else means.
● Good research question: ‘Which one of two fertilisers gives the maximum growth of roots and
stem in a seedling?’ This question is not vague. It tells you what you will be varying and what you
will be measuring. It also gives a criterion for judging whether you have answered the question.
9780170408851 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 11
01_bio_InFocus12_2e_sb_08851_txt.indd 11 04/08/18 2:02 PM
Formulating a hypothesis
A hypothesis is a predictive statement about the relationship between the variables and is an ‘expected’
answer to your question. It is often written as an ‘If … then …’ statement, to explain an expected relationship,
such as: ‘If x is introduced/increased/decreased, then y will increase/decrease/stay the same.’
An example of a hypothesis is:
If the amount of nitrogen in the fertiliser provided to a seedling in the soil is increased, then the height
of the stem and/or length of the roots of the seedling will increase.
Your hypothesis should give a prediction that you can test, ideally quantitatively (that is, by taking
measurements).
A hypothesis is usually based on an existing model or theory. It is a prediction of what will happen in
a specific situation based on that model. For example, investigators may use a model that describes how,
in the nitrogen cycle, nitrates from the soil are assimilated into proteins for plant growth. A hypothesis
based on an increased nitrate model may predict that, with plants that normally grow in nitrogen-poor
soils, introducing additional nitrogen in a fertiliser may increase growth.
A good research question or hypothesis identifies the variables that will be investigated. Usually you
will have one dependent variable and one independent variable. For a depth study you may have two or
more independent variables that you control (for example, you may test two different fertilisers if time
and resources allow). You should only change one variable at a time in any investigation.
If your experiments agree with predictions based on your hypothesis, then you can claim that they
support your hypothesis. This increases your confidence in your model, but it does not prove that it
is true. Hence, an aim for an experiment should never start ‘To prove . . .’, because it is not possible to
actually prove a hypothesis, only to disprove it.
If your experimental results disagree with your hypothesis, then you may have disproved it. This is
not a bad thing! Often the most interesting discoveries in science start when a hypothesis based on an
existing model is disproved, because this raises more questions.
Even if your question or hypothesis meets these criteria, do not be surprised if you change or modify
it during the course of your investigation or depth study. In scientific research, the question you set out
to answer is often only a starting point for more questions.
KEY CONCEPTS
● Investigations begin with a question, which is used to formulate a hypothesis.
● A literature review helps you refine your question or hypothesis. It helps you know what knowledge
and ideas have been established on a topic and the areas of strength and weakness in the research.
● A good hypothesis is a statement that predicts the results of an experiment, states the expected
relationship between the variables and can be tested using quantitative measurements.
1.3 Planning your depth study
Critical and
There are many things to consider when planning and designing an investigation. You need to think about
creative thinking how much time you will have, what space and equipment you will need, and where you will go if you
want to make measurements or observations outside. If you are doing a secondary-source investigation
or some other type of depth study, such as a creative work (e.g. building a physical model), you still need
to plan ahead to make sure you have the resources you need.
You may be working in a group or on your own. Most scientists work in groups. If you can choose who
you work with, think about it carefully. It is not always best to work with friends. Think about working
with people who have skills that are different from your own.
Work and Having a plan allows you to ensure that you collect the data, whether from a primary or secondary
enterprise
source, that is needed to test your hypothesis. The longer the investigation, the more important it is that
you have a clear plan. Table 1.1 lists several things to consider.
12 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 9780170408851
01_bio_InFocus12_2e_sb_08851_txt.indd 12 04/08/18 2:02 PM
TABLE 1.1 Planning your depth study
PRIMARY-SOURCE INVESTIGATION SECONDARY-SOURCE INVESTIGATION
What data will you need to collect? What information will you need to gather?
What materials and equipment will you need? What sources will you use?
When and where will you collect the data? When and where will you gather the information?
If you are working in a group, what tasks are assigned If you are working in a group, what tasks are assigned
to which people? to which people?
Who will collect the data? Who will collect what information?
Who will be responsible for record keeping? How will record keeping be done to avoid plagiarism?
How will the data be analysed? How will the information be analysed?
How will sources be referenced? How will sources be referenced?
Devising a plan for your investigation Working
Scientifically
The most common problem that students have is time management. It is important to plan to have Skills Outcome:
BIO11/12-2
enough time to perform the experiments, including repeat measurements, and to analyse them and
report on them.
A good plan will help you keep on track. Your teacher may ask you to hand in a plan of your depth Personal and
social capability
study before you begin the implementation stage. Table 1.2 gives an idea of the types of things you should
think about.
TABLE 1.2 Depth study plan
INTRODUCTION TO DEPTH STUDY PLAN
Title Choose a title for your depth study.
What?
Rationale Explain why you have chosen this area of research.
Why? Describe what you are hoping to achieve through this investigation. Include any ways you think
your investigation may benefit yourself, your class and possibly your family, friends and the school/
wider community (if applicable).
Type of depth study and State the type of depth study you intend conducting (e.g. literature review, practical investigation).
research model (if applicable) Where applicable, describe any theoretical models that you will use for your depth study. Include
Which? references to your reading and explain why you chose this model.
Timeline
Action and time frame Working scientifically skills
When? How?
1 Initiating and planning Questioning and predicting: formulate questions and/or a hypothesis; make predictions about ideas,
When? (For example, issues or problems.
weeks 1–2) Planning: wide reading – research background information; assess risks and ethical issues; plan
valid, reliable and accurate methods; select appropriate materials and technologies; identify
variables; plan experimental controls and how to measure them.
2 Implementation and Conducting investigations: safely carry out valid investigations; make observations and/or accurate
recording measurements; use appropriate technology and measuring instruments.
When? (For example, Processing and recording data and information: collect, organise, record and process information
weeks 2–4) and/or data as you go.
3 Analysing and interpreting Analysing data and information: reduce large amounts of data by summarising or coding it; begin
When? (For example, week looking for trends, patterns or mathematical relationships.
4–mid week 5) Problem-solving: evaluate the adequacy of data (relevance, accuracy, validity and reliability) from
primary and/or secondary sources.
9780170408851 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 13
01_bio_InFocus12_2e_sb_08851_txt.indd 13 04/08/18 2:02 PM
INTRODUCTION TO DEPTH STUDY PLAN
4 Communicating Presenting your depth study: use appropriate language, scientific terminology, calculations,
When? (For example, weeks diagrams, graphing and other models of representation; acknowledge your sources.
5–mid week 6).
Final presentation Due date: end of week 6
Data collection
Note that what you submit in your final depth study may be different from your initial planning list.
a Action: independent b Outcome: dependent variable c Validity: controlled variables
variable What will you measure and how What will you need to keep constant to make this a
Describe what you will will you measure it? (Quantitative/ fair test? What control(s) will you use (if applicable)?
change in your investigation. qualitative data?)
Data analysis and problem solving
d Data analysis e Conclusion
What method(s) will you use How will you judge whether the experiment was valid?
to analyse the data, and how How will your data allow you to test your hypothesis or answer your question?
will you represent the trends
and patterns?
Working Scientifically Selecting equipment
Skills Outcome:
BIO11/12-3
A well-framed question or hypothesis will help you choose the equipment that you need. For example,
if your hypothesis predicts a temperature change of 0.5°C, then you will need a thermometer that can
measure to at least this precision (precision and accuracy are discussed on page 19). You also need to
know how to use the equipment correctly. Always ask if you are unsure. The user manual will usually
specify the precision of the device and let you know of any potential safety risks, so read it.
Work and
enterprise You need to think about how you can minimise uncertainties and errors. Minimising uncertainty
Personal and is not just about using the most precise equipment you can find; it is also about clever experimental
social capability technique.
Working safely: risk assessment
You may be required to complete a risk assessment before you begin your investigation. You need to
think about three things.
1 What are the possible risks to you, to other people, and to the environment or property?
2 How likely is it that there will be an injury or damage?
3 If there is an injury or damage to property or environment, how serious are the consequences
likely to be?
A ‘risk matrix’ can be used to assess the severity of a risk associated with an investigation. ‘Negligible’
may be getting clothes dirty. ‘Marginal’ might be a bruise from falling off a bike, or from a broken branch
in a tree. ‘Severe’ could be a more substantial injury or a broken window. ‘Catastrophic’ would be a death
or the release of a toxin into the environment. You need to ensure that your investigation is low risk.
Once you have considered what the possible risks are, you need to think about what you will do
about them. What will you do to minimise them, and what will you do to deal with the consequences if
something does happen? You can use a risk assessment table like the one shown in Table 1.3.
Consider where you will perform your experiments or observations. Will you need to consider the
convenience or safety of others? Talk to your teacher about what space is available.
14 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 9780170408851
01_bio_InFocus12_2e_sb_08851_txt.indd 14 04/08/18 2:02 PM
TABLE 1.3 Example risk assessment table for managing risks
!
WHAT ARE THE WHAT RISK DOES THIS HAZARD RISK
HAZARDS? POSE? HOW CAN YOU SAFELY MANAGE THE RISK? ASSESSMENT
Potassium Eye irritant Wear safety glasses. If the solution comes in contact with
permanganate the eyes, use an eyewash.
Glassware Broken glass may cut the skin Handle all glassware with care. If glass breaks, sweep it
up with a brush and dustpan.
Ethical considerations
There are ethical frameworks for biological investigations, protecting the lives of animals and humans. Ethical
understanding
You need to take into consideration ethical principles before you begin your research. Think about basic
human values, animal rights, the rights of children, and whether the use of some technologies has ethical
repercussions. Ethical principles in biology could be a whole depth study of its own.
In your research for your literature review, include information about ethical codes of conduct related
Use of live
to your investigation. organisms in
In a secondary-source investigation, take precautions with cyber safety and remember to keep your schools
personal information private.
KEY CONCEPTS
● In primary-source investigations, you collect and analyse your own data. In secondary-source
investigations, you analyse someone else’s data.
● Investigations need to be planned carefully so that they answer your research question. You
also need to consider safety, ethical issues and the possible environmental impacts of your
investigation.
Designing your investigation Working
Scientifically
Skills Outcome:
Data: reliability, accuracy, validity and relevance BIO11/12-3
When designing your investigation, think about how you can minimise uncertainties and overcome
failure. For example, root growth will be affected if plant roots are attacked by fungus (mould). Try to
think of all the things that could go wrong in your experiment and put preventative measures in place.
You may also need to come up with a backup plan, so start early in case things go wrong and you need
to re-do your experiment. Information and
communication
If you are conducting a secondary-source investigation, then your literature review will be the basis technology
of your investigation. Remember that a literature review is not simply a summary of what you have capability
read – you need to add meaning. This may come from comparing and contrasting competing models
and constructing an argument, or by analysing and presenting secondary-source data. When using Critical and
secondary sources, remember to make comparisons between data and claims in a number of reputable creative thinking
sources, including science texts, scientific journals and reputable Internet sites, and to reference these
appropriately.
If you are doing a primary-source investigation, a brief literature review will form the background
Literacy
information and you will then make measurements to gather data yourself. You can collect data
by performing experiments or making observations in the field. You will gain practice at making
measurements if you do some of the investigations in the following chapters. These investigations can
form the basis of your depth study.
9780170408851 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 15
01_bio_InFocus12_2e_sb_08851_txt.indd 15 04/08/18 2:02 PM
Variables
When doing experiments, you need to decide which variable you will change, what you will measure
and which variables you will control. Consider which variables you can control, and which you cannot.
Typically, an experiment will have three types of variable:
1 an independent variable, which we are testing and we therefore purposefully change
2 a dependent variable, which is the result that we measure – this changes as a result of changing the
independent variable. We assume that the dependent variable is in some way dependent on the
independent variable
3 controlled variables, which are kept constant so that they do not interfere with our results.
Reliability
Whenever possible you should make repeat measurements. This allows you to check that your
measurements are reliable. Your results are reliable if repeat observations and/or measurements taken
under exactly the same circumstances give the same results within experimental uncertainty. If a result
is not reproducible, it is not a reliable result. The cause may be that a variable other than the one you
are controlling is affecting the value of the dependent variable. If this is the case, you need to determine
what this other variable is, and control it if possible. Results may also be unreliable if random errors
occur in the method. A reliable experiment is one which, if repeated multiple times, gives the same
result (within an acceptable margin of error). Reliable sources, such as scientific journals and texts, are
Numeracy
sources whose information is trustworthy because they are is written by qualified professionals and
are consistent across multiple sources.
Accuracy
Accuracy may refer to a result or to an experimental procedure. Accuracy of a result (data) is a measure
of how close it is to an expected value given in scientific literature (for example, scientific journals).
Secondary-source information is accurate when it is found to be similar to information presented in
peer-reviewed scientific journals.
To improve accuracy in experiments, we use the most precise measuring instruments available, avoid
Numeracy
human error (for example, measuring errors), carry out repeat trials, and find an average to smooth out
random errors so that the value we obtain approaches the expected value more closely.
Accuracy is also linked to any uncertainty in measurement. For example, we can determine the size of
red blood cells by estimating their number in a field of view and dividing by the size of that field of view.
Alternatively, we can measure their size with less uncertainty using a mini grid slide or a calibrated digital
microscope.
Plausible accuracy is accuracy that is estimated, taking into consideration the evident sources of
error and the limitations of the instruments used in making the measurements.
Validity
To ensure that results are valid, in a primary investigation you must carry out a fair test.
◗ Identify variables that need to be kept constant.
◗ Develop and use strategies to ensure these variables are kept constant.
◗ Demonstrate the use of a control.
◗ Use appropriate data collection techniques.
◗ Trial procedures and repeat them, checking that the results are the same each time.
In a control, you remove the factor being tested in the experiment to see whether, without that factor,
a different result is obtained.
These steps ensure that the process used and the resultant data measure what was intended. Results
need to be valid if you are going to be able to draw a conclusion from them.
16 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 9780170408851
01_bio_InFocus12_2e_sb_08851_txt.indd 16 04/08/18 2:02 PM
An investigation is valid if factors that may vary within an experiment are deliberately held constant
to ensure a fair test. These ‘controlled variables’ are kept the same so that the only factor that is allowed
to change in the experiment is the independent variable. The result is that the investigation measures
what was intended and the data obtained is accurate and reliable.
Evaluating your investigation
Some good questions to ask to assess reliability, validity and accuracy are shown in Table 1.4.
TABLE 1.4 Assessing reliability, accuracy and validity in investigations
PRIMARY INFORMATION AND DATA SECONDARY INFORMATION AND DATA
Reliability Have I tested with repetition and obtained How consistent is the information with
consistent results? information from other reputable sources?
Have I done multiple trials and found an Are the data presented based on repeatable
average to eliminate random errors? processes?
Accuracy Do the results of the investigation agree with Is this information similar to information
the scientifically accepted value? presented in peer-reviewed scientific journals?
Have I used the best measuring equipment
available?
Validity Does my experiment measure the variable of Do the findings relate to the hypothesis or
interest? Does it actually test the hypothesis problem?
that I want it to? Have all variables apart from Are the findings accurate and the sources
those being tested been kept constant? Have reliable?
errors been kept to a minimum? Are my results
accurate and reliable?
KEY CONCEPTS
● An experiment will have three types of variables: dependent, independent and controlled.
● Reliability of first-hand data is the degree to which repeated observation and/or measurements
taken under identical circumstances yield the same results.
— To assess reliability, compare results from repeat experiments to see if they are the same.
— To improve reliability, control all variables other than those being tested, repeat and average
results to reduce random errors, and use precise measuring equipment so that the same
result can be obtained each time the experiment is repeated.
● To assess accuracy, examine how close a measurement is to its true value or how similar the
information is to that in peer-reviewed scientific literature.
— To improve accuracy, minimise uncertainty, reduce systematic errors and use the most
precise measuring equipment available. Use peer-reviewed secondary sources.
● To assess validity in a primary investigation, evaluate how closely the processes and resultant
data measure what was intended.
— In a secondary investigation, assess whether the information is relevant to the topic and if it
is from reliable sources.
— To improve validity, refine the experiment design to reduce complex variables that cannot be
kept constant, as well as reducing random and systematic errors.
Gathering data
You also need to consider how many data points to collect. In general, it is better to have more data than
Numeracy
less. However, you will have limited time to collect your data, and you need to allow time for analysis
and communicating your results. A minimum of 6–10 data points is usually required to establish a
relationship between variables, if the relationship is linear. A linear relationship is one where if you plot
one variable against the other you get a straight line. If you think the relationship might not be linear, then
take more data points and think carefully about how they will be spaced. You should try to collect more
data in the range where you expect the dependent variable to be changing more quickly. For example, if
you are measuring temperature of a hot object as it cools as a function of time, then you should collect
more data early, when cooling is more rapid.
9780170408851 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 17
01_bio_InFocus12_2e_sb_08851_txt.indd 17 04/08/18 2:02 PM
You will need to keep a record of what you do during your investigation. Do this in a hard copy or
electronic logbook.
Keeping a logbook
Scientists keep a logbook for each project that they work on. A logbook is a legal document for a working
Literacy
scientist. If the work is called into question, then the logbook acts as important evidence. Logbooks are
sometimes even provided as evidence in court cases (for example, in patent disputes). Every entry in a
scientist’s logbook is dated, records are kept in indelible form (pen, not pencil), and entries may even be
signed. Never record data on bits of scrap paper instead of your logbook!
Your logbook will include:
Personal ◗ notes taken during the planning of your investigation
and social
capability ◗ a record of when, where and how you carried out each experiment
◗ diagrams showing the experimental set-ups, biological drawings, and other relevant information
◗ all your raw results
◗ all your derived results, analysis and graphs
◗ all the ideas you had while planning and carrying out experiments, and analysing data
◗ printouts, file names and locations of any data not recorded directly in the logbook.
It is not a neat record, but it is a complete record (Fig. 1.7). Your teacher may check your logbook at
various intervals to assess your progress.
Your logbook
Shutterstock.com/ESB Professional
Always write down what you do as you do it. It is easy to forget what you did
if you do not write it down immediately. Your logbook may be hard copy or
electronic. Either way, your logbook is a detailed record of what you did and
what you found out during your investigation. Make an entry in the logbook
every time you work on your depth study.
Logbooks are important working documents for scientists. All your data
should be recorded in a logbook, along with all records of your investigations.
FIGURE 1.7 Make sure you keep an accurate Recording data and creating scientific tables
record of what you do as you do it.
If you are going to be collecting multiple data points, then it is a good idea to
draw a table to record them in. Scientific tables are always drawn with a ruler,
Literacy
and they are fully enclosed tables with appropriate headings. Label the columns in the table with the name
and units of the variables. If you know that the uncertainty in all your measurements is the same, then you
can record this at the top of the column as well. Otherwise, each data entry should have its uncertainty
recorded in the cell with it. When constructing a results table, put units in the headings and not in the
Working body of the table. It is best practice to put the independent variable in the first column and the dependent
Scientifically Skills variable in the second, if you are drawing a vertical table. For a horizontal table, the independent variable
Outcome: BIO11/12-4
is placed in the top horizontal row and the dependent variable in the first vertical column.
It is a good idea to start your analysis while you are collecting your data. If you spot an outlier and you
are still making measurements, then you have the opportunity to repeat that measurement. If you made
a mistake, then put a line through the mistake and write in the new data.
Plotting and analysing data as you go is sometimes beneficial because it allows you to spot something
that may be of interest early on in your investigation. You then have a choice between revising your
hypothesis or question to follow this new discovery, or continuing with your plan. Many investigations
start with one question and end up answering a completely different one. These are often the most
fun, because they involve something new and exciting. Some of the most significant finds (for example,
penicillin) have come from unexpected results of experiments or serendipity.
18 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 9780170408851
01_bio_InFocus12_2e_sb_08851_txt.indd 18 04/08/18 2:02 PM
Accuracy, precision and errors in measurement Working
When making measurements, your aim is to be as precise and accurate as possible. Scientifically
Skills Outcome:
An accurately measured result is one that represents the ‘true value’ of the measured quantity as BIO11/12-5
closely as possible. When we take repeated measurements, we assume that the mean (average) of the
measurements will be close to the ‘true value’ of the variable. However, this may not always be the case.
For example, if you have ever been a passenger in a car with an analogue speedometer and tried to read
it, your reading will be consistently different from what the driver reads. This is because of parallax error.
The needle sits above the scale, and when viewed from the side does not line up correctly with the true
speed. Beware of parallax error with any equipment using a needle. This is an example of a systematic
error, in which measurements differ from the true value by a consistent amount. Note that often we do
not know what the ‘true value’ is.
Scientists should be aware of the possibility of error in all stages of an investigation. Notes on possible
sources of error should be kept in the logbook.
◗ Planning stage: errors may arise as a result of limitations of time and/or materials. Assess the Critical and
creative thinking
possibility and adjust the method so that errors are minimised.
◗ Data collection and processing stages: remember to assess the degree of uncertainty and to keep note
of the accuracy of measuring devices. WS
◗ Concluding stage: evaluate the validity of the investigation and discuss any sources of error, as well as
Validity, reliability,
possible ways of reducing error in future investigations. accuracy and
precision
Sometimes it is difficult to remember the difference between accuracy and precision. For example,
on a dart board, think of accuracy as how close to the centre your dart hits, and your measurement of
precision as how closely you can group your shots (Fig. 1.8).
FIGURE 1.8 On a
a b c d dart board, accuracy
is determined by how
close to the centre
(bullseye) your dart
lands. Precision is how
closely you can group
your darts.
Low accuracy Low accuracy High accuracy High accuracy
Low precision High precision Low precision High precision
When looking at precision and accuracy FIGURE 1.9 Graph
Actual, target or
in scientific measurements, measurements reference value distinguishing
between accuracy
that are close to the known value are said to and precision
be accurate, whereas measurements that Accuracy
Probability density
are close to each other are said to be precise.
Therefore, for measurements to be accurate
and precise, they must be close to the mean
value and the measurements need to be close
to each other.
A graph may also be used to show the
relationship between accuracy and precision
Value
(Fig. 1.9). Precision
9780170408851 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 19
01_bio_InFocus12_2e_sb_08851_txt.indd 19 04/08/18 2:02 PM
In the scientific definition, precision is described as a measure of the variability of the measurements,
Numeracy
so it affects the spread of the repeated measurements about the mean value. The smaller the spread,
the greater the precision. This is shown in Figure 1.10. Figure 1.10a shows precise measurements, and
Figure 1.10b shows less precise measurements. Note that both data sets are centred about the same
mean, so they have the same accuracy.
FIGURE 1.10 In a
a b
plot of number of
Number of measured
Number of measured
measured values
versus reading, the
results in a have a
values
values
small spread about
the mean (true value)
and are therefore
more precise. The
results in b have a
larger spread about
the mean and are less ‘True value’
‘True value’
precise.
Reading Reading
There is always the risk that errors in measurement may arise when actually doing the measuring,
but some errors also arise when we are calculating derived data. We need to keep both types of error to
a minimum if our results are to be reliable, accurate and valid.
Accuracy and
precision Visit the weblink Accuracy and precision to increase your understanding of minimising error and to
clarify some concepts about processing of raw data that may seem complex at first. This weblink deals
with precision and accuracy, and gives an easy but realistic example of how and why it is necessary to
process raw data and to calculate percentage, mean and standard deviation.
Critical and Estimating uncertainties
creative thinking
When you perform experiments, there are typically several sources of uncertainty in your data. Sources
of uncertainty that you need to consider are the:
◗ limit of reading of measuring devices
◗ precision of measuring devices
◗ variation of the measurand (the variable being measured).
For all devices there is an uncertainty due to the limit of reading of the device. The limit of reading is
different for analogue and digital devices.
People often confuse precision with the resolution of a measuring device. The resolution tells us
about the ‘degree to which an instrument can be read’. Precision is the ‘degree to which an instrument
can be read repeatably and reliably’.
Analogue devices have continuous scales and include swinging needle multimeters and liquid-in-
glass thermometers. For an analogue device, the limit of reading, sometimes called the resolution, is half
the smallest division on the scale. We take it as half the smallest division because you will generally be
able to see which division mark the indicator (needle, fluid level, etc.) is closest to. So, for a liquid-in-glass
thermometer with a scale marked in degrees Celsius (Fig. 1.11a), the limit of reading is 0.5°C.
Digital devices such as digital multimeters and digital thermometers have a scale that gives you a
number. A digital device has a limit of reading uncertainty of a whole division. So a digital thermometer
that reads to whole degrees (Fig. 1.11b) has an uncertainty of 1°C. For a digital device the limit of reading
is always a whole division, not a half, because you do not know whether it rounds up or down, or at what
Resolution and point it rounds. The digital device (Fig. 1.11c) has a greater resolution than (a) or (b) because it measures
precision
to one decimal place. The limit of reading is 0.1°C.
20 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 9780170408851
01_bio_InFocus12_2e_sb_08851_txt.indd 20 04/08/18 2:02 PM
a b c
Shutterstock.com/
Shutterstock.com/
iStock.com/belterz
By Africa Studio
FabrikaSimf
FIGURE 1.11 a Analogue and b and c digital thermometers with different resolutions (reading limits)
The resolution, or limit of reading, is the minimum uncertainty in any measurement. Usually the
uncertainty is greater than this minimum.
Measuring devices such as data loggers usually have their precision given in the user manual.
Many students think that digital devices are more precise than analogue devices. This is often not
the case. A digital device may be easier for you to read, but this does not mean it is more precise. The
uncertainty due to the limited precision of the device is generally greater than the limit of reading (see
Figs 1.11a, 1.11b).
KEY CONCEPTS
● Systematic error is due to the measuring device (for example, if it is not calibrated correctly) or
technique (for example, parallax error or through incorrect positioning of the instrument).
● Random error is due to unavoidable variations in reading a measurement.
● Accuracy refers to the closeness of a measured value to a standard or known value.
● Precision refers to the closeness of two or more measurements to each other.
● The uncertainty in any measurement depends upon the limit of reading of the measuring
device, and the precision of the device.
Analysing data Working
Scientifically
When you have collected all your data, you will need to analyse it. Record all your analyses in your Skills Outcome:
BIO11/12-5
logbook. If you have more than a few data points, it is a good idea to display them in a table. Tables of
data need to have headings with units for each column, and a caption stating what the data means or
how it was collected (see how to construct a table on page 18). Tables are used for recording raw data and Critical and
also for organising derived data. creative thinking
Calculating derived data from raw data
Raw data is what you actually measured (with units and uncertainties). Derived data is data that you have
Numeracy
calculated using raw data. For example, your raw data may be the length of roots and height of shoots in
each plant. From this data you may choose to derive the average length and height of roots and shoots
and/or you may wish to calculate the overall percentage growth.
Drawing and using graphs
If you look at any science journal, you will see that almost every article contains graphs. Graphs are not
only a useful way of representing data, but they are also commonly used to analyse relationships between
variables. You should have lots of graphs in your logbook as part of your exploration of the data. It is often
useful to plot your data in different ways, especially if you are unsure what relationship to expect between
your dependent and independent variables.
Graphs should be large and clear. The axes should be labelled with the names of the variables and
their units. The independent variable is placed on the x-axis and the dependent variable on the y-axis.
Choose a scale so that your data takes up most of the plot area. This will often mean that the origin is not
shown in your graph. Usually there is no reason why it should be. The scale is plotted in equal increments.
9780170408851 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 21
01_bio_InFocus12_2e_sb_08851_txt.indd 21 04/08/18 2:02 PM
To determine a relationship you need to have enough data points and the range of your data points
should be as large as possible. A minimum of six data points is generally considered adequate if the
relationship is expected to be linear (give a straight line), but always collect as many as you reasonably
Data points
Some helpful can, given the available time.
advice on deciding For non-linear relationships, you need more data points.
the number of data
points
Types of graphs
There are different types of graphs so you need to know which type to use. Your choice will depend on
what you have measured.
Scatter plots are used when you are looking for a relationship between variables. A scatter plot is a
graph showing your data as points (Fig. 1.12a). Do not join them up as in a dot-to-dot picture. Use a line
of best fit if they appear to fall in a straight line.
Line graphs are also used to find a relationship between variables. When both the independent and
dependent variables are continuous, a line graph is drawn to show how one variable will affect the other.
For example, the independent variable may be the number of hours seedlings were exposed to light and
the dependent variable may be the average height of the shoots (see Table 1.5).
TABLE 1.5 Height of shoots in seedlings exposed to variable periods of light
TIME EXPOSED TO LIGHT PER DAY FOR
2 WEEKS (hours) HEIGHT OF SHOOTS (mm)
0 24
2 18
4 17
6 15
8 13
10 11
12 9
14 7
a b
Frequency distribution graph for wetland birds
Effect of fertiliser on root growth
10
8
Standard fertiliser
8
Change in root length (cm)
New fertiliser
Number of birds
6
6
4 4
2
2
0
n
an
p- le
n
0
d
n d
ro
he
am rp
is ke
ro ce
w
he
sw Pu
0 5 10
ks
ib ec
he e-fa
ific
-n
ac
Amount of fertiliser (mg/cm3 soil)
w
hi
Bl
c
Pa
ra
W
St
FIGURE 1.12 a A scatter plot demonstrating a mathematical relationship; b a column graph displaying results from counting categories
22 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 9780170408851
01_bio_InFocus12_2e_sb_08851_txt.indd 22 04/08/18 2:02 PM
Column or bar graphs are used if groups of things have been counted or measured. An example is the
heart rates of different types of animals. A bar graph has categories on the y-axis and numbers on the
x-axis. A column graph has numbers on the y-axis and categories on the x-axis (Fig. 1.12b). The columns
or bars have a gap between them and do not touch.
A histogram is similar to a column graph, but the columns touch each other. These are used for data
where a continuous variable has been divided into consecutive categories. An example is the average
monthly rainfall in Sydney during autumn and winter in 2016 (Table 1.6).
TABLE 1.6 Average rainfall in Sydney during autumn and winter, 2016
MONTH AVERAGE RAINFALL (mm)
March 130
April 129
May 120
June 133
July 97
August 81
A sector or pie graph is used to compare parts of a whole. An example is the composition of a predator’s
diet (Table 1.7 and Fig. 1.13). A protractor must be used when drawing a pie chart.
TABLE 1.7 Components of diet of red fox (Vulpes vulpes) FIGURE 1.13 Data in
Dietary contribution (%) Table 1.7 shown as a
FOOD DIETARY CONTRIBUTION (%) pie graph
Fruit Other
Rabbits 30 Rabbits
Carrion
Lambs 20
Small marsupials 10 Birds
Frogs 10
Lizards 10 Lizards
Birds 5
Carrion 5
Frogs
Fruit 5
Lambs
Other 5 Small marsupials
Linear lines of best fit
A good graph to start with is simply a scatter plot of the raw data. You will usually be able to tell by
looking whether the graph is linear. If it is, then fit a straight line (line of best fit).
Removing outliers
Numeracy
When you plot your raw data, you may find that one or two points are outliers. These are points that do
not fit the pattern of the rest of the data. These points may be mistakes. For example, they may have been
incorrectly recorded or a mistake may have been made during measurement. They may also be telling
you something important. For example, if they occur at extreme values of the independent variable, then
it might be that the behaviour of the system is linear in a certain range only. You may choose to remove or
ignore outliers when fitting a line to your data, but you should be able to justify doing so.
9780170408851 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 23
01_bio_InFocus12_2e_sb_08851_txt.indd 23 04/08/18 2:02 PM
Non-linear lines of best fit
Relationships between variables are often not linear. If you plot your raw data and it is a curve, then do
not draw a straight line through it. In this case you need to think a little harder. If your hypothesis predicts
the shape of the curve, then try fitting a theoretical curve to your data. If it fits well, then your hypothesis
is supported.
Note that a line of best fit is not the same as joining the dots. It is rarely useful or appropriate to join
the dots, even though this is often the default setting in spreadsheet software.
KEY
CONCEPTS
● Data is usually recorded in tables.
● Graphs are used to represent and analyse data.
● Linear graphs are useful for analysing data.
Working Scientifically
Interpreting your results
Skills Outcome:
BIO11/12-6 Once you have analysed your results, you need to interpret them. This means being able to either answer
your research question or state whether your results support your hypothesis.
You need to take into account the uncertainties in your results when you decide whether they support
Numeracy
your hypothesis. For example, suppose you have hypothesised that the maximum range in which the
enzyme pepsin will function is between 35°C and 40°C, yet your results show that the maximum activity
occurs at 42°C. You may think that this result does not support your hypothesis. To say whether the result
agrees with the prediction, you need to consider the uncertainty. If the uncertainty is 1°, then the results
disagree with the hypothesis. If the uncertainty is 2° or more, then the results do agree and the hypothesis
is supported.
If your hypothesis is not supported, it is not enough to simply say ‘our hypothesis is wrong’. If the
hypothesis is wrong, what is wrong with it?
It may be that you have used a model that is too simple. For example, when designing an experiment
using catalase, you may base your hypothesis on the model that enzymes in the human body work best
Enzyme model
at around human body temperature (37°C), like many digestive enzymes. In your experiment, you then
Effect of find that the optimum temperature for catalase is 10°C. This may be because you were not aware of the
temperature on
catalase activity
model that proposes that, in order to function in cells lining the digestive tract, catalase needs to avoid
being digested. To do this, it changes shape to its functional form and works best at a low optimum
temperature between 0°C and 10°C. At body temperature catalase is indigestible but not the optimum
shape for peak performance. Therefore, your hypothesis may be better described by a model that takes
into account the idea that catalase must avoid being digested and achieves this by functioning best at
temperatures lower than body temperature. Before you decide that the model is at fault, however, it is a
good idea to check carefully that you have not made any mistakes.
It is never good enough to conclude that ‘the experiment didn’t work’. Either a mistake was made or
the model used was not appropriate for the situation. It is your job to work out which. In doing so, you
will come up with more questions.
Experiments that do not support predictions based on existing models are crucial in the progress
of science. It is these experiments that tell us there is more to find out, and inspire our curiosity as
scientists.
KEY
CONCEPTS
● You must know the uncertainty in your results to be able to test your hypothesis.
● If your hypothesis is disproved, you need to be able to explain why.
24 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 9780170408851
01_bio_InFocus12_2e_sb_08851_txt.indd 24 04/08/18 2:02 PM
1.4 Communicating your understanding Working
Scientifically
Skills Outcome:
BIO11/12-7
If research is not reported on, then no one can learn from it. An investigation is not complete until the
results have been communicated. Most commonly, a report is written. Scientists also use other means to
communicate their research to each other, such as posters and talks. To communicate their work to the
public, scientists may use science shows and demonstrations, public lectures, websites, videos and blogs. Literacy
All of these are useful ways of communicating your understanding, and you need to select the mode that
best suits the content you wish to communicate and the audience to whom you wish to communicate.
Writing reports
A report is a formal and carefully structured account of your investigation or depth study. It is based on
the data and analysis in your logbook. However, the report is a summary. It contains only a small fraction
of the information that you collected.
A report consists of several distinct sections, each with a particular purpose. When writing a report
for a science journal, you will need to provide an abstract and an introduction, but for secondary school
purposes the following headings are suggested:
◗ Background information
◗ Aim
◗ Hypothesis
◗ Risk assessment
◗ Materials
◗ Method
◗ Results and analysis
◗ Discussion of results
◗ Conclusion
◗ Acknowledgements
◗ References
◗ Appendix.
Reports in scientific journals are always written in the past tense, because they describe what you
have done. They start with an abstract – a very short summary of the entire report, typically between 50
and 200 words. The abstract appears at the start of the report but is always the last thing that you write.
Try writing just one sentence to summarise each part of your report.
At school level, your report may be written in the present or past tense. Start with a clearly stated aim,
making sure it includes variables and the change you will be measuring.
Background information
The background information tells the reader why you did this investigation or depth study and how
you developed your research question or hypothesis. This is the place to explain why this research is
interesting. The introduction also includes the literature review, which gives the background information
needed to be able to understand the rest of the report. The introduction for a secondary-source report
is similar to that for a primary-source investigation. In both cases, it is important to reference all your
sources correctly.
9780170408851 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 25
01_bio_InFocus12_2e_sb_08851_txt.indd 25 04/08/18 2:02 PM
Aim
In any experiment, the aim describes what you intend to do. For example, you may aim to investigate, to
measure, to model, to compare, to verify or to calculate. The aim should be brief and it should link with
the hypothesis that predicts what you expect to find.
Hypothesis
The hypothesis is written as a predictive ‘If … then …’ statement of your expected result, and it must be
falsifiable (that is, it must be able to be disproved). It does not give a reason why you expect that result.
Risk assessment
Risk assessment is discussed on pages 14–15.
Materials
A list of all the materials and equipment (including quantities and concentrations, if applicable) that you
used during the experiment is provided.
Method
The method summarises what you did. It says what you measured and how you measured it. It also
explains, briefly, why you chose a particular method or technique. The method is written in point form.
If in the present tense, each sentence usually starts with a verb. The method also describes how you
measured your results and recorded your information.
For a primary-source investigation, the method describes how you carried out your experiments or
observations in enough detail that someone with a similar knowledge level could repeat your experiments.
It should include large, clear diagrams of equipment set-up, such as water baths in enzyme experiments.
You should have diagrams in your logbook, but these are generally rough sketches. Diagrams should be
redrawn neatly for a report, as in Figure 1.14.
The method section for a secondary-source investigation is generally shorter. If you are doing a review
of the current literature on a topic, then your method will say what literature searches you carried out
and how you decided which sources to use.
FIGURE 1.14 A
potometer is used to Leafy twig transpiring
measure the rate of
absorption in relation
to transpiration.
Reservoir
Rubber stopper Tap to re-set
with hole for air bubble Hole for uptake
plant of water
Capillary tube
with scale Air bubble
Water
Direction of flow
of water Water
26 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 9780170408851
01_bio_InFocus12_2e_sb_08851_txt.indd 26 04/08/18 2:02 PM
Results
The results section is a summary of your results. It is usually combined with the analysis section, although
they may be kept separate.
Tables comparing the results of different experiments or secondary sources are useful. Avoid including
long tables of raw data in your report. Wherever possible, use a graph instead of a table. If you need to
include a lot of raw data, then put it in an appendix attached to the end of the report.
Think about what sort of graph is appropriate. If you want to show a relationship between two
variables, then use a scatter plot. Display your data as points with uncertainty bars and clearly label any
lines you have fitted to the data. Column and bar graphs are used for comparing different data sets. Do
not use a column or bar graph to try to show a mathematical relationship between variables.
Any data and derived results should be given in correct SI units with their uncertainties. If you
performed calculations, then show the equations you used. You might want to show one example
calculation, but do not show more than one if the procedure used is repeated.
Discussion
The discussion should summarise what your results mean. If you began with a research question, give the
answer to the question here. If you began with a hypothesis, state whether or not your results supported
your hypothesis. If not, explain why. If your investigation led you to more questions, as is often the case,
say what further work could be done to answer those questions.
Working
Conclusion Scientifically
Skills Outcome:
The conclusion is a very brief summary of the results and their implications. Say what you found. A BIO11/12-3
conclusion should be only a few sentences long and should not contain any inferences. Make sure
your conclusion relates back to your aim and hypothesis. This is where you state whether or not your
hypothesis is supported.
Acknowledgements and references Referencing
guide
Scientific reports often include acknowledgements thanking people and organisations that helped with This guide is
designed to
the investigation. This includes people who supplied equipment or funding, as well as people who gave help you with
you good ideas or helped with the analysis. In science, as in other aspects of your life, it is always polite referencing your
sources.
to say ‘thank you’.
The final section of a report is the reference list. It details the sources of all information that was
actually used to write the report. This list will generally be longer for a secondary-source investigation.
Wherever a piece of information or quotation is used in your report it must be referenced at that point.
Referencing
This is typically done either by placing a number in brackets at the point (for example, [2]), or the author i-tutorial
and year of publication (for example, (Smith, 2016)). The reference list is then provided in either a footnote This tutorial
will help you
at the end of each page or a single complete list at the end of the report. There are different formats for understand
referencing and
referencing, so check with your teacher about what format they prefer. There are several good online show you how to
guides to referencing. avoid plagiarism.
References versus bibliographies Information and
communication
A reference list is not the same as a bibliography. A bibliography is a list of sources that are useful to technology
understanding the research. The sources may or may not have been used in the report. You should have capability
a bibliography in your logbook from the planning stage of your investigation. The references will be a
subset of these sources. A primary-source investigation does not include a bibliography. A secondary-
source investigation may include a bibliography as well as references, to demonstrate the scope of your WS
literature search. For some secondary-source investigations, such as an annotated bibliography, the Writing a
bibliography itself may be a major section of the report. bibliography
9780170408851 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 27
01_bio_InFocus12_2e_sb_08851_txt.indd 27 04/08/18 2:02 PM
Appendix
WS
Appendices often contain information that is not essential in explaining the findings of an investigation.
A good practical For example, any lengthy and repetitive information that supports your finding, such as relevant raw
report
data, is presented in an appendix.
KEY CONCEPTS
● A formal report has the same form as an article written by a scientist. It begins with an abstract
(in a scientific journal) or an aim and, at school level, background information. It includes
information from a literature review on both the scientific principles behind the research and
the research method selected. It includes a risk assessment, materials, method, results and
analysis, discussion and conclusion. All sources need to be referenced correctly.
Other ways of communicating your work
You may want to present the results of your investigation in some other way. Scientists communicate
their work in many ways. Sometimes a poster is presented or a seminar is given. An article or blog may
be written or a web page created. Scientists usually use more than one means, and sometimes several
means, to communicate a really interesting investigation.
Look at examples of science investigations reported on websites, in the newspaper, on the TV and so
on. This will give you an idea of the different styles used in the different modes. Think about the purpose.
Is it to inform, to persuade, or both? What sort of language is used?
Think about your audience and purpose, and use appropriate language and style. A poster is not
usually as formal as a report. A video or web page may be more or less formal, depending on your audience.
Posters and websites use a lot of images. Images are usually more appealing than words and numbers,
but they need to be relevant. Make sure they communicate the information you want them to. An
example of a poster is provided on pages 30–31.
If you are creating a website, consider accessibility. On websites, fonts need to be large enough
and clear, and digital images should have tags. You can follow the weblink for more information on
Website
accessibility accessibility and web-page design.
The Royal Society If you make a video, then consider who your audience is and what will appeal to them. Think about
for the Blind has
information on how you will balance content with entertainment.
making websites
accessible. A formal report uses referencing to show where you found information. Other means of
communicating about your depth study or investigation also need to acknowledge the sources of
information you used. You also need to be very careful about using copyright content – for example,
you cannot copy images from other people’s websites unless the site’s owner gives permission. Talk to
your teacher about how they would like you to acknowledge your sources.
However you communicate your work, make sure you know what the message is and who the
audience is. Once you have established that, you will be able to let other people know about the interesting
things you have discovered in your investigation.
Ideas for depth studies
As you progress through this book, you will see investigations in each chapter. Some of these investigations
are described in detail. They are designed to be useful as training exercises in how to perform primary
investigations – how to set up equipment, make measurements and analyse data. Even if your depth
study is from secondary sources, it is important to gain experience in doing experiments because biology
is based on experiments.
At the end of each module, there is a short section called ‘Depth study suggestions’. Here you will find
ideas for primary- and secondary-source investigations, which build on the content of the preceding
28 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 9780170408851
01_bio_InFocus12_2e_sb_08851_txt.indd 28 04/08/18 2:02 PM
chapters. These suggestions are sourced from experienced teachers and university academics, and from
biology education literature. Your teacher will also have ideas and suggestions. You can also generate
your own ideas by reading about topics you are interested in. Consider what skills from other areas
you might bring to a depth study, particularly if you are artistically creative or musical. Many biologists
combine their love of science with creative pursuits.
By carrying out depth studies, you will extend your knowledge and understanding in biology and,
more importantly, you will learn how to work scientifically – you will learn how to do biology.
KEY
CONCEPTS
● There are many ways of communicating your findings. Choose a method that is appropriate to
your investigation and your intended audience.
9780170408851 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 29
01_bio_InFocus12_2e_sb_08851_txt.indd 29 04/08/18 2:02 PM
Poster: A new fertiliser stimulates seedling
growth of the newly discovered and rare
Eucalyptus pyrenea
Arthur B. Ruse, Jacqueline Hammond, Rufus C. Smith, Karen Trace and Leigh B. Waters, Pyrenees State High
School, Warrenmang, Victoria, Australia
Introduction
Getty Images/Walter Bibikow
The recent identification of a new rare Eucalyptus
species in the Pyrenees region of north-west Victoria,
Eucalyptus pyrenea (Figure 1), has prompted efforts
to try to cultivate the species (1). This would allow
for regeneration of local areas with the native tree,
promoting conservation of this species and enriching
the natural biodiversity of the area.
Growing E. pyrenea seedlings has proven difficult
without the addition of a fertiliser, although the
standard low-phosphorus fertiliser used for Eucalyptus
species, Super Ready, has not stimulated the same
enhanced growth that is usual in other species (2).
A new fertiliser, ExtraGro, has recently become
available for native Australian plants. It contains
identical levels of phosphorus, potassium and trace
elements to those in Super Ready but has double the
amount of nitrogen, which promotes foliage growth
(3). The aim of this study was to determine whether
ExtraGro, containing greater nitrogen, enhanced FIGURE 1
Eucalyptus
E. pyrenea growth above that stimulated by Super pyrenea
Ready.
Method
Genetically identical seedlings were obtained from a
nursery at a length of 10 cm±2 cm and grown in 300 g
of standard Australian native plant potting mixture
(Figure 2). Plants were exposed to full sunlight and
were watered every second day with 25 mL tap water.
Fertiliser (2 mg per seedling) was applied to the
soil immediately prior to each watering.
After two weeks, seedlings were analysed for total
length, shoot length, root length, total dry weight,
shoot dry weight and root dry weight.
Six replicate seedlings were tested per condition.
FIGURE 2 Seedlings in their growing containers. Left pot, seedling
treated with standard fertiliser (Super Ready) and right pot, ExtraGro
Tng DYP, Janos DP, Jordan GJ, Weber E and Bowman DMJS (2014) Phosphorus limits Eucalyptus
grandis seedling growth in an unburnt rain forest soil. Front. Plant Sci. 5:527. doi:0.3389/
fpls.2014.00527 Licenced under CC BY 4.0 http://creativecommons.org/licenses/by/4.0/
30 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 9780170408851
01_bio_InFocus12_2e_sb_08851_txt.indd 30 04/08/18 2:02 PM
Results: ExtraGro stimulates enhanced root growth
n.s.
Effects of fertiliser on root growth 10
15
8
Change in root length (cm)
Root dry weight (g)
10 6
4
5
0 0
Super Ready ExtraGro No fertiliser Super Ready ExtraGro
FIGURE 3 Change in root length of seedlings after two weeks of FIGURE 4 Root dry weight after two weeks of treatment. *P<0.05,
treatment, normalised to untreated seedlings (difference in treated n.s. = not significant. Bars show mean ± standard deviation, n = 6.
seedling length divided by difference in untreated seedling length).
In addition to stimulating shoot elongation and
biomass accumulation, we found ExtraGro to have
Results: ExtraGro promotes greater shoot growth superior root-enhancing properties over Super
Ready. Root length increased significantly more over
FIGURE 5 Representative seedlings two weeks following treatment with ExtraGro than
after two weeks of treatment. Left, with Super Ready (Figure 3). However, root biomass
untreated seedlings. Centre, seedlings was not increased by ExtraGro (Figure 4), suggesting
treated with Super Ready and right, that the increased nitrogen in this fertiliser stimulated
seedlings treated with ExtraGro.
the growth of longer but thinner roots.
Sarah A. Jones, Mullan, G. D. and White, P. J.
2001. Seedling Quality: Making informed choices.
Bushcare and the Department of Conservation
and Land Management. Photo by G. Mullan.
Conclusions
20 We tested whether the ExtraGro fertiliser, containing
P < 0.0001
twice as much nitrogen, stimulated enhanced E.
P = 0.03 P = 0.01 pyrenea seedling growth over that stimulated by
the standard Australian native plant fertiliser Super
Seedling height (cm)
15
Ready.
ExtraGro promoted greater shoot elongation and
10 biomass accumulation. In addition, it stimulated
increased root elongation, although it did not alter
root biomass gain over a two-week period.
5 Therefore, we have found that E. pyrenea
seedlings respond better to a high-nitrogen fertiliser
than standard fertiliser. This significant finding may
0 inform future efforts to cultivate this species.
No fertiliser Super Ready ExtraGro
(2%) (2%)
Treatment
References
1–3. Perugia E., et al. ‘A new Eucalypt native to the
FIGURE 6 Effects of fertilisers on seedling height after two weeks of
treatment Victorian Pyrenees State Park’. Australian Journal of
Native Flora, Vol 3, pp.206–8, 2011.
Treatment of E. pyrenea seedlings with the standard
Australia native plant fertiliser, Super Ready, increased Acknowledgements
seedling height over a growing period of two weeks We thank the Pyrenees Nursery for kind provision of
above the height reached by treatment with water the E. pyrenea seedlings. We also thank P. Whitely for
alone. However, ExtraGro caused superior seedling contributions to plant maintenance, and we thank
shoot growth in terms of biomass (e.g. Figure 5) and our teacher Ms M Marshall for valuable contributions
height (Figure 6). to our study design and poster preparation.
9780170408851 CHAPTER 1 » WORKING SCIENTIFICALLY AND DEPTH STUDIES 31
01_bio_InFocus12_2e_sb_08851_txt.indd 31 04/08/18 2:02 PM
» MODULE FIVE
HEREDITY
2 Sexual and asexual reproduction
3 Cell replication
4 DNA and polypeptide synthesis
5 Genetic variation
6 Inheritance patterns in a population
Shutterstock.com/Tatiana Shepeleva
32 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 32 08/08/18 6:28 pm
2 Sexual and asexual reproduction
Students:
INQUIRY QUESTION • explain the mechanisms of reproduction that ensure the continuity of a species, by analysing sexual and
asexual methods of reproduction in a variety of organisms, including but not limited to:
How does reproduction
– animals: advantages of external and internal fertilisation
ensure the continuity of – plants: asexual and sexual reproduction
a species? – fungi: budding, spores
– bacteria: binary fission (ACSBL075)
– protists: binary fission, budding
• analyse the features of fertilisation, implantation and hormonal control of pregnancy and birth in mammals
(ACSBL075) CCT EU
• evaluate the impact of scientific knowledge on the manipulation of plant and animal reproduction in
agriculture (ACSBL074) EU L
Biology Stage 6 Syllabus © NSW Education Standards Authority for and on behalf of the Crown in right of the State of New South Wales, 2017
Science Photo Library/Francis Leroy, BIOCOSMOS
9780170408851 33
02_bio_InFocus12_2e_sb_08851_txt.indd 33 08/08/18 6:28 pm
Living organisms grow, develop, respire, feed, reproduce, excrete and eventually age and die. For
continuity of life, the most critical characteristic of living organisms is reproduction. Organisms must be
able to reproduce to pass on their genes, whether by replicating themselves or by mating with another
individual to produce fertile offspring.
Offspring carry the same genetic traits or a mix of traits from their parents into the next generation
(Fig. 2.1), ensuring that, even though individuals die, the gene pool and the species continue.
Shutterstock.com/LightField Studios
Shutterstock.com/Claudia Paulussen
FIGURE 2.1 Offspring resemble their parents, physical evidence of genetic material being passed on from one generation
to the next to ensure the continuation of the species.
Asexual and sexual reproduction –
2.1 one parent or two?
Reproduction is a fundamental evolutionary process ensuring the continuity of life. Considering the origin
of life and the evolution of living organisms, reproduction must have been one of the first characteristics
of life to arise. The ability of a chemical system to make copies of itself and, later, the ability of an organism
to make copies of itself, are of primary importance in ensuring the continuity of species.
The reproductive success of an organism is determined by its ability to produce fertile offspring that
survive to reproductive maturity and produce offspring of their own, in this way replacing the parent.
Biological fitness is a measure of an individual’s reproductive success. Biological fitness is calculated
as the average contribution to the gene pool made by a certain genotype within a population and the
relative likelihood that those alleles (variants of a gene) will be represented in future generations. An
allele with higher fitness is more likely to be represented in future generations than an allele of the same
gene with lower fitness. Reproductive success is a feature of an individual, while biological fitness is a
feature of an allele in a population.
There are two main methods of reproduction. Asexual reproduction involves only one parent and
gives rise to offspring that are genetically identical to each other and to the original parent.
Sexual reproduction usually involves two parents who produce offspring that have a mix of the parents’
genes and therefore differ from each other and from the parents. (Occasionally, organisms are bisexual
and if self-fertilisation occurs, the offspring would arise by sexual reproduction from one parent.)
KEY CONCEPTS
● Reproduction means making a copy or a likeness. For living organisms, this means producing
offspring that are identical to the parent or resemble the two parents that gave rise to them.
● Individuals have a finite lifespan, so in order for a population or a species to survive, genetic
material must be passed from one generation to the next. This ability to reproduce is known as
the reproductive success of an individual.
● The genetic material of all organisms in a population makes up the gene pool. The likelihood of
genes appearing in the next generation and being passed on is known as biological fitness.
● In evolutionary terms, reproduction is less significant for individual success and more
important for the continuation of the species.
34 MODULE FIVE » HEREDITY 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 34 08/08/18 6:28 pm
Advantages of sexual reproduction
Sexual reproduction involves the meeting of special sex cells called gametes, which carry genetic
information from both parents to the offspring. As a result, the offspring contain a mix of parental genes
and are not genetically identical to the parents or to other offspring, and this introduces genetic variation
into the population. The greatest advantage that sexual reproduction is thought to provide, in terms of
continuity of life at the species level, is genetic diversity.
Some offspring may possess random variations that make them better suited to new and changing
environmental conditions. They may out-compete their parents and/or other individuals in the
population, thereby gaining a selective advantage. In the face of environmental change, the survival of
some individuals gives the overall population or species a better chance of survival.
The disadvantage of sexual reproduction is that this process demands a greater expenditure of time
and energy, involving processes such as finding a mate, courtship behaviour, gamete production and
mating, before the production of young. These processes may also make organisms more vulnerable
to predators. Because sexual reproduction requires far more investment by an individual than asexual
reproduction, it tends to be the first functional process that is sacrificed in times of hardship.
Sexual reproduction – the meeting of two gametes
During sexual reproduction, a combination of genetic material from two parents is passed on to
offspring. Every species has a characteristic number of chromosomes per cell. For example, humans have
46 chromosomes, camels have 70, tomatoes have 24 and chickens have 78. Each species usually has two
sets of chromosomes, arranged in homologous pairs. The number of chromosomes does not necessarily
reflect the complexity of the organism and even varies among closely related species. For example, the
housefly has 12 chromosomes, whereas the fruit fly has only 8. The important thing to remember for
studies of genetics is that the chromosome number is constant for each species and does not change
from one generation to the next.
In sexual reproduction, to prevent the chromosome number from doubling in each successive
generation, a mechanism to ensure that each parent contributes only half of his or her chromosomes
to their offspring is necessary. Meiosis, a type of cell division that takes place in the reproductive organs
of plants and animals, is important to maintain the characteristic chromosome number during sexual
reproduction. When a cell involved in sexual reproduction divides by meiosis to produce gametes
(sex cells), the chromosome number halves – that is, each resulting gamete contains only one set of
chromosomes.
The terms diploid and haploid refer to the number of sets of chromosomes within any cell. In most
organisms, the somatic cells (body or non-reproductive cells) contain two sets of chromosomes – that is,
the diploid number of chromosomes (in humans this number is 46 or 23 pairs).
Offspring inherit one set of chromosomes from the mother (maternal
chromosomes) and one set from the father (paternal chromosomes)
(Fig. 2.2). A fertilised egg or zygote arises as a result of the fusion of haploid
gametes, when the chromosome number changes from haploid to diploid. 1
The diploid zygote divides by mitosis to become an embryo with identical
Sperm (n) Egg (n) Offspring (2n)
body cells that all have the diploid number of chromosomes.
If n = 1 set of chromosomes, then in humans, n = 23. Human somatic cells
are diploid (2n) and have 46 chromosomes, whereas human gametes are FIGURE 2.2 The sperm and the egg are haploid
haploid (n) and have 23 chromosomes (as a result of meiosis). Fertilisation gametes that give rise to diploid offspring in sexual
reproduction.
of an egg by a sperm restores the diploid number (Fig. 2.3).
9780170408851 CHAPTER 2 » SEXUAL AND ASEXUAL REPRODUCTION 35
02_bio_InFocus12_2e_sb_08851_txt.indd 35 08/08/18 6:28 pm
Mother’s Father’s
chromosomes chromosomes
2n 5 46 2n 5 46
Meiosis
Specialised cells in the ovaries Specialised cells in the testes
Egg cells n 5 23 Sperm cells n 5 23
Fertilisation
Zygote (2n) 5 46
(fertilised egg cell) or
Mitosis
Embryo Each cell
is 2n 5 46
chromosomes
Female child Male child
FIGURE 2.3 Maintenance of the diploid number during sexual reproduction in humans
KEY CONCEPTS
● Sexual reproduction requires the production of male and female gametes (sperm and ova) by
the process of meiosis (reduction division).
● Each gamete is haploid (n) – that is, it has half the normal number of chromosomes.
● The gametes fuse during the process of fertilisation to create a zygote (fertilised egg) with the
full diploid (2n) complement of chromosomes.
● In offspring, 50% of the chromosomes come from the mother and 50% from the father.
● The cells of the zygote divide by mitosis, keeping the chromosome number constant, and the
resulting embryo continues to grow and mature into a new individual.
● Fertilisation and meiosis are reciprocal processes – that is, one is a fusion from haploid to
diploid, and the other is a reduction from diploid to haploid.
36 MODULE FIVE » HEREDITY 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 36 08/08/18 6:28 pm
CHECK YOUR
1 Explain what is meant by each of the following terms: diploid, haploid, gamete, somatic cell, paternal, UNDERSTANDING
maternal.
2 Distinguish between asexual and sexual reproduction. 2.1a
3 Define ‘reproductive success’ and ‘biological fitness’. What is the difference between these two terms?
4 Give one advantage and one disadvantage of sexual reproduction.
5 What is meiosis? Why is this process important to a species?
6 What is the importance of variation in a population?
Sexual reproduction in animals
Sexual reproduction is a mechanism that has evolved to ensure continuity of species. In animals, a
number of sexual reproductive strategies ensure that reproduction occurs effectively in the environment
in which an organism lives.
Most animals are unisexual – there are separate male and female individuals. However, a small range
of animals are bisexual or hermaphrodites, where each individual has both male and female reproductive
organs. Hermaphroditism can be advantageous to species with low population densities, or in animals that
are non-motile (such as coral), where finding a mate is difficult. The disadvantages of hermaphroditism
are that individuals must expend larger amounts of energy to grow and maintain two sets of reproductive
organs. Then if self-fertilisation occurs, the gametes carry fewer possible combinations of genes and
therefore the offspring will have less variation.
Other reproductive strategies include the type of fertilisation (internal or external), the number of
gametes produced, the timing of gamete release, where the young develop (outside or inside the body)
and the nature of parental care. If these strategies are advantageous within the particular environment in
which an organism lives, they can increase its reproductive success.
Fertilisation – external or internal?
In animals, the union of male and female gametes (sperm and ova) can occur outside the body (external
Invertebrates are
fertilisation) or inside the body (internal fertilisation). The key to successful fertilisation of ova by sperm animals without
is that the gametes, each of which is a single haploid cell surrounded by a cell membrane, must meet a backbone, such
as coral polyps,
and not dehydrate in the process. Therefore, external fertilisation is better suited to organisms that insects and snails.
reproduce in an aquatic environment (such as marine creatures) or a very moist environment (such
as earthworms), whereas internal fertilisation is typical of many terrestrial organisms (such as insects,
Vertebrates are
lizards and kangaroos). Vertebrate sexual reproduction is thought to have started in the ocean (fish) animals with a
and freshwater environments (amphibians) and then evolved once vertebrates such as reptiles, birds backbone, such as
fish, amphibians,
and mammals colonised the land and the air. The change in type of fertilisation (external or internal) is reptiles, birds and
consistent with the accepted sequence of species’ evolution. mammals.
The chances of successful external fertilisation are increased by synchronisation of reproductive
cycles, mating behaviours and the release of gametes. When fertilisation and development of the young
take place externally, there is little or no parental care. This means that less time and energy are required
of the parents, but a larger number of gametes must be produced to ensure that some young survive.
The advantage of external fertilisation is the wide dispersal of young. Some marine animals release their
gametes into the sea, and fertilised eggs are carried away to settle in an area far from their parents. This
reduces competition for food and living space, and also allows rapid recovery of populations away from
damaged areas.
9780170408851 CHAPTER 2 » SEXUAL AND ASEXUAL REPRODUCTION 37
02_bio_InFocus12_2e_sb_08851_txt.indd 37 08/08/18 6:28 pm
Pheromones are
Staghorn coral
chemical substances Staghorn coral is an example of a colony of invertebrate marine animals (polyps) that achieve fertilisation
released by one
organism that have by simply shedding millions of gametes into the sea (Fig. 2.4). Environmental cues, such as water
an effect on another temperature, tides and day length, help synchronise the reproductive cycle. When polyps in one coral
organism.
colony start to spawn, pheromones released along with gametes stimulate nearby individuals to spawn,
resulting in coordinated spawning over a wide area.
AUSCAPE All rights reserved/© Nature Production
FIGURE 2.4 Staghorn coral (Acropora yongei sp.) releases bundles containing sperm and eggs.
During the mass spawnings of coral on Australia’s Great Barrier Reef, the number of gametes shed is
so great that, for a time, the sea turns milky. Within one day, fertilised eggs develop into swimming larvae.
After a few days at the surface, the larvae descend to find a suitable site to form a new colony. Although
millions of staghorn coral larvae are produced, almost all are eaten by predators. Of the few remaining,
only a tiny proportion reach adulthood.
Bony fish
The females of most species of marine bony fish produce eggs (ova) in large batches and release them
into the water, where they fuse with sperm outside the body of the female. Because the gametes disperse
quickly, the release of large numbers of eggs and sperm from the females and males must occur almost
simultaneously. In most marine fish, the release of gametes
is restricted to a few brief and clearly determined periods.
Getty Images/Derek Middleton/FLPA/Minden Pictures
Although thousands of eggs are fertilised in a single mating of
bony fish, many of the resulting offspring succumb to microbial
infections or predation, and few survive to maturity.
Amphibians
Amphibians invaded the land without fully adapting to the
terrestrial environment, and so their life cycles still involve
stages in water. Gametes from both males and females are
released in fresh water, such as ponds or streams. In frog and
toad copulation, the male grasps the female and straddles
her back, discharging fluid containing sperm onto the eggs
FIGURE 2.5 Copulation in frogs, where eggs are fertilised externally
as they are released by the female into the water (Fig. 2.5).
38 MODULE FIVE » HEREDITY 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 38 08/08/18 6:28 pm
An enormous number of gametes are
Science Source/Michael J. Tyler
produced by amphibians, first to ensure
that many undergo fertilisation, and
second to ensure the production of a
large number of offspring. Because most
amphibians provide no parental care,
the young tadpoles are easy prey and not
many survive to reproductive age.
Some frogs, such as the Southern
gastric brooding frog (discovered in forests
north of Brisbane in 1974 and recently
registered as extinct), evolved special FIGURE 2.6 A young froglet emerging from the mouth of a
adaptations to ensure survival of the female Southern gastric brooding frog (Rheobatrachus silus) after
developing in its mother’s stomach
young. The eggs of the terrestrial frog were
fertilised by sperm externally in a watery
environment, after which the female would swallow the eggs, and the young developed internally in
the female’s stomach. In the stomach, digestive secretions ceased and the eggs settled into the stomach
wall, where they were protected and absorbed nutrients from the mother for about 6–7 weeks (during
which time the female did not eat). Young frogs were then regurgitated through the mouth (Fig. 2.6).
This mechanism provided some protection for the underdeveloped young from predation, infection and
dispersal, significantly increasing the chance of successful survival of the offspring. These animals were
unusual in having external fertilisation but internal development, and provide an extreme example of
parental care.
Internal fertilisation and parental care in animals
Organisms that undergo internal fertilisation tend to be adapted to terrestrial environments and
reproduce successfully on land. The internal environment for fertilisation not only protects gametes
from dehydration and loss to external elements, but also protects the fertilised eggs and developing
young from immediate predation. Therefore, with internal fertilisation, fewer eggs are required for the
survival of a sufficient number of offspring. The internally fertilised egg may develop a shell and be laid in
the external environment (oviparous) to complete its development (in reptiles and birds, for example), or
it may continue to develop inside the female’s body.
In most mammals, the fertilised egg becomes an embryo that is nurtured inside the female parent’s
body, obtaining nutrients through a placenta, and is born alive (viviparous development). In rare
instances, a combination of the above
Shutterstock.com/Webitect
occurs and eggs with yolk for nourishment
are retained inside the mother’s body until
they are ready to hatch. Newly hatched
young are born alive (ovo-viviparous, for
example in some snakes and sharks).
Reptiles
Most reptile eggs are fertilised internally
and then deposited outside the mother’s
body for development. During copulation
(Fig. 2.7), male reptiles use a tubular penis
FIGURE 2.7 Reptiles such as tortoises copulate, so the eggs are
to introduce sperm into the female. fertilised internally.
9780170408851 CHAPTER 2 » SEXUAL AND ASEXUAL REPRODUCTION 39
02_bio_InFocus12_2e_sb_08851_txt.indd 39 08/08/18 6:29 pm
In crocodiles, fertilisation occurs
Getty Images/hphimagelibrary
internally. The female crocodile
(Crocodylus porosus) lays small numbers
of large yolky eggs in clutches along
the sandbanks beside the sea or a river
(Fig. 2.8). The eggs of most reptiles are
covered in a soft but tough leathery shell.
Exceptions are tortoises, geckos and
crocodiles, which lay hard-shelled eggs.
The eggs contain sufficient food reserves
to last until the eggs hatch. The offspring
FIGURE 2.8 After developing in a yolky egg, tiny crocodiles
(Crocodylus porosus) hatch. resemble miniature adults and are able to
crawl from the buried nest to the surface
and make their way to water, a journey that makes them vulnerable to predation. There is no parental
care of these young.
It interesting to note that the temperature at which reptile eggs are incubated often determines
whether the resulting individuals are male or female. At high temperatures, females hatch, even from eggs
in which the individual has male chromosomes. These females are able to lay eggs and reproduce like
normal females, despite being genetically male.
Birds
Courtship behaviour by birds may take place in flight or on the ground, but copulation takes place on
the ground, making the birds vulnerable to predators. Fertilisation is internal. Most male birds do not
have a penis, so during copulation, male and female birds rub the openings of their cloacas together and
sperm are transferred to the female’s body. In some larger birds (such as swans) the male cloaca extends
to form a ‘false’ penis. Once fertilised, the ovum passes along the oviduct and successive glands secrete
yolk, followed by protein (albumen, commonly called egg white) around it. A calcium carbonate shell is
then secreted and this hardens when the egg comes into contact with the air, directly after it is laid. The
hard shell distinguishes bird eggs from soft-shelled reptilian eggs and gives more protection. Most birds
incubate their eggs after laying them, to keep them warm, and exhibit parental care once the young
have hatched.
Mammals
Imagefolk/D.Parer & E.Parer-Cook/ardea.com
Monotremes are
mammals, such as The gametes of all mammals undergo
the platypus and
the echidna, that lay fertilisation internally. Mammals are divided
eggs but still suckle into three subclasses – monotremes,
their young.
marsupials and eutherians – based on the
subsequent development of their embryos.
Monotremes, such as the platypus and
the echidna, are oviparous. After internal
fertilisation, they lay eggs that develop
outside the mother’s body. Platypus parents
incubate their eggs in a nest, whereas
echidnas place their eggs into an abdominal
FIGURE 2.9 A young echidna with its mother
pouch where they stay for about seven
weeks. The young hatchlings (puggles) obtain milk from their mother’s mammary glands by licking
her abdominal skin (Fig. 2.9).
40 MODULE FIVE » HEREDITY 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 40 08/08/18 6:29 pm
Young marsupials develop internally
Alamy Stock Photo/Auscape International Pty Ltd
for a short time after fertilisation and then
continue their embryonic development
in a pouch. Offspring are born at a very
young age and crawl up the mother’s
abdomen to the pouch (Fig. 2.10). In
favourable environmental conditions,
marsupials such as the kangaroo can
have three offspring at different stages
of development at any one time – one
out of the pouch but still drinking milk,
one in the pouch attached to a nipple,
and a fertilised ovum at the blastocyst FIGURE 2.10 Kangaroos give birth to small foetuses, which complete
(ball of cells) stage in the uterus. The their development in a pouch.
development of the youngest is triggered
when the second-youngest detaches from the nipple and leaves the pouch. Because milk production in
kangaroos lasts much longer than a pregnancy, it is necessary to delay development of the new embryo
until the older one is no longer suckling. This delay in development, termed embryonic diapause, is
another strategy to increase chances of survival.
The red kangaroo has a special reproductive adaptation to ensure survival of the young in times of
drought. If the mother is unable to produce sufficient milk to sustain a joey attached to a nipple in the
pouch, this joey dies and a newborn individual will enter the pouch a month later. The tiny newborn
requires far less milk for the first few weeks in the pouch. This strategy ensures the continuity of young
who are ready for development when the drought ends and allows very rapid population growth when
conditions are good. However, in prolonged drought conditions, kangaroos stop breeding and only begin
again when rain triggers a hormonal response in the female. This very effective mechanism restricts
reproduction to times when conditions favour survival of the young.
Eutherians, otherwise known as placental mammals, include dingoes, rodents (such as rabbits,
rats and mice), domesticated animals (such as dogs, sheep and cattle) and humans. Following internal
fertilisation, the young completes its embryonic development inside the body of the mother in a
special organ, the uterus, which nurtures and protects the embryo. Once one or more fertilised eggs
implant into the uterine wall, a placenta develops, connecting the young to a supply of nutrients and
oxygen that passes from the bloodstream of the mother to the developing young (Fig. 2.11). Excretory
wastes such as nitrogenous wastes and
carbon dioxide from the embryo diffuse
Getty Images/Joe Lee
Brain
across the placenta to the mother’s Amniotic
sac
body, where they are excreted along with
Placenta
the mother’s own wastes. The mother
gives birth to live young that are mature
and therefore have a greater chance Eye
of survival. This type of development,
where live young are born, is described
as viviparous. Placental mammals Umbilical
produce one to a few young at a given cord
time and they invest a large amount of
Liver
energy in parental care, increasing the
chance of survival of the young. FIGURE 2.11 Human embryo developing in a uterus attached to a
placenta
9780170408851 CHAPTER 2 » SEXUAL AND ASEXUAL REPRODUCTION 41
02_bio_InFocus12_2e_sb_08851_txt.indd 41 08/08/18 6:29 pm
Internal and external fertilisation in animals are compared in Table 2.1.
TABLE 2.1 Comparison of internal and external fertilisation in animals
DIFFERENCES
CHARACTERISTICS EXTERNAL FERTILISATION INTERNAL FERTILISATION SIMILARITIES
Gametes Large numbers of male and female Large number of male gametes and Male and female gametes
gametes produced fewer female gametes produced required – sperm and eggs (ova)
Union Occurs in open water Occurs inside the reproductive tract Sperm fertilise the eggs when they
environments of the female in organisms that live unite
mostly or completely on land
Conception Simultaneous release of gametes Copulation: the male inserts sperm Sperm will fertilise eggs when
mechanism into the female’s reproductive tract in very close proximity to each
via penis or cloaca other; gametes require a watery
environment for this to occur
Chance of Low, because male gametes are High, because male gametes are If male and female gametes are
fertilisation released into a large open area released into a confined space in close proximity to each other,
where there is less chance of where there is more chance of fertilisation will usually occur
successfully uniting with female successfully uniting with female
gametes gametes
Environment for Usually external, in a watery Usually internal, in a very protected Zygote requires a watery
zygote environment that is vulnerable to environment inside the female’s environment for development
environmental elements such as body. Temperature is controlled and
temperature, predation, infection there is less chance of predation,
and rapid dispersal from the area infection and loss of zygote from
the area
Number of Usually a larger number than in A smaller number of offspring than Zygote number is determined by
offspring/zygotes internal fertilisation, but many in external fertilisation, because the number of sperm and ova that
zygotes perish and so a smaller very few perish (higher success rate) successfully fuse
number of offspring survive
Breeding More frequent than in internal Seasonal and less frequent than in Breeding frequency depends
frequency fertilisation due to the lower external fertilisation due to higher on the requirements of the
fertilisation success rate fertilisation success rate and greater species and the favourability of
energy costs environmental conditions
Parental Usually no parental care Parental care of eggs and/or Parental investment is indirectly
investment developing young is more common proportional to the number of
gametes produced
KEY CONCEPTS
● Fertilisation is the union of male and female gametes and may take place externally or
internally.
● External fertilisation occurs in aquatic or moist terrestrial environments, to prevent
dehydration of gametes. Gametes must be produced in large numbers to ensure success.
● Internal fertilisation takes place inside the body of the female and involves mate attraction and
copulation, which require energy investment and put the organisms at risk of predation, but
fewer eggs need to be produced.
● External fertilisation occurs in most invertebrates and some vertebrates (fish and amphibians).
● Internal fertilisation occurs in some invertebrates (insects and snails) and most vertebrates
(reptiles, mammals and birds).
● Other mechanisms that increase the chances of survival and continuity of species include
nourishment for the developing young and parental care.
42 MODULE FIVE » HEREDITY 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 42 08/08/18 6:29 pm
CHECK YOUR
1 Describe the conditions under which asexual reproduction is advantageous, using a named example. UNDERSTANDING
2 What are the advantages and disadvantages of sexual reproduction?
3 Give examples of one vertebrate and one invertebrate that have external fertilisation. Explain how they 2.1b
ensure the gametes meet.
4 Give examples of one vertebrate and one invertebrate that have internal fertilisation. Describe the habitat
in which they live.
5 Describe the features of internal and external fertilisation that are similar and those that are different.
6 Give two advantages and two disadvantages of internal and external fertilisation.
Sexual reproduction in plants
Sexual reproduction in plants also relies on the successful fusion of male and female gametes. However,
in plants, this fusion is more difficult because plants grow in the ground and cannot move. The broad
range of plants on Earth, from less advanced plants such as mosses and ferns to cone-bearing plants
(gymnosperms) and flowering plants (angiosperms), have developed a range of reproductive strategies to
ensure the continuity of species. These strategies include relying on external agents to carry the gametes
from one parent to another, commonly called pollinating agents. Plants also rely on external agents to
disperse their seeds (wind, water and animals, for example) and, because they do not have the ability to
move away from extreme heat or cold, they have other survival strategies for seeds once they land.
As early angiosperms evolved, advantageous features in flowers that resulted in more successful
pollination would have been selected by natural means, and these features would have been retained
within populations, leading to the great diversity of flowering plants today.
To understand the process of sexual reproduction in plants, it is necessary to examine the structure of
flowers, which are the reproductive organs of plants. A flower contains either female reproductive parts
(carpel or gynoecium), male reproductive parts (stamens) or both, in addition to their non-sexual parts
(petals and sepals) (Fig. 2.12).
Anther – where pollen
grains are formed Stigma – sticky top surface
of the flower, to which
Filament – stalk that carries pollen adheres. May be
Stamen the anther. The length relatively small and smooth
(male parts determines whether the (in insect-pollinated plants)
of the flower) anthers are contained inside or large and feathered
the petals for insect (wind-pollinated plants) Carpel
pollination or hang outside (female parts
for wind pollination of the flower)
Style – joins the stigma
to the ovary
Petals – a whorl of leaves
modified to increase the Ovary–where ovules
likelihood of pollination. They are are formed
often brightly coloured and
scented to attract pollinators,
and may have complex shapes to
facilitate entry of particular Sepals – a whorl of modified
pollinators to the flower leaves, often green. Main
function is to protect the
Receptacle – reinforced base of unopened bud
the flower, which supports the
weight of the reproductive
structures
FIGURE 2.12 Top view and longitudinal section through a flower (male parts labelled in blue and female parts in red)
9780170408851 CHAPTER 2 » SEXUAL AND ASEXUAL REPRODUCTION 43
02_bio_InFocus12_2e_sb_08851_txt.indd 43 08/08/18 6:29 pm
Stigma In order for fertilisation to occur, the male gametes inside pollen
Pollen tube
must be carried from the anthers to the female part of a flower, called the
stigma. This process of gamete transfer is called pollination. Once pollen
has been deposited on the stigma, a pollen tube germinates and grows
Style down the style, carrying inside it the male gamete (sperm cell) to an
ovule contained in the ovary (Fig. 2.13). In flowering plants, fertilisation
occurs internally inside the ovary.
Pollination, fertilisation and seed production
Ovary
Plants are dependent on agents such as wind, water and animals to
carry their pollen, from the anthers of one flower to the stigma of a
flower either on another plant (cross-pollination), or on the same
plant (self-pollination). Cross-pollination ensures greater variation in
the offspring. A strategy that is seen in some plants to favour cross-
Ovule
Placenta pollination rather than self-pollination is for the plant’s pollen to mature
at a different time than its stigma.
FIGURE 2.13 The pathway During fertilisation, the sperm cell that was transferred by the pollen
taken by a pollen tube as it
grows from the stigma to the tube fuses with the egg cell (ovum) inside the ovule in the female part of
ovary the flower. The fertilised ovule develops, protected within the ovary. The
ovule containing an embryo is now termed a seed and the surrounding
ovary grows to become a fruit (Fig 2.14).
FIGURE 2.14
Meiosis
Sexual reproduction
life cycle in flowering
plants Anther
of Pollen
stamen grain
Egg cell
(haploid)
Male gametes Ovule
Stigma (haploid)
of Petal
gynoecium Sepal Fertilisation
Flower
stalk
Embryo (diploid)
Leaf
Seed
Seed is dispersed
Mitosis
Stem
Germination
of diploid
embryo
44 MODULE FIVE » HEREDITY 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 44 08/08/18 6:29 pm
Self-pollination versus cross-pollination
In plants, self-pollination requires less energy as there is no requirement for the plant to produce
structures to attract pollinators, such as brightly coloured petals or nectar. These plants can grow in
areas where insects or other animals that visit plants are absent or very few in number.
Plants that undergo cross-pollination rely on outside agents to transfer pollen from anthers to
stigmas. These may be abiotic agents such as wind or water, or biotic agents such as insects, birds and
mammals. As flowers become increasingly specialised, so do their relationships with pollinating agents.
Pollination by wind
Getty Images/Nnehring
Many angiosperms are wind pollinated and their flowers are small, greenish
and odourless, with reduced or absent petals. The flowers are grouped together
in fairly large numbers and may hang down in tassels that blow around in
the wind and shed pollen freely (Fig. 2.15). Many Australian grasses are wind
pollinated. In these species the anthers are very long and produce large amounts
of light pollen, which is easily picked up by the wind passing over the flowers.
Usually the stigmas are also very large and spread out in a feathery manner to
trap pollen carried by wind.
Wind pollination is very inefficient, so large quantities of pollen are produced. FIGURE 2.15 Small, wind-pollinated grass
flowers (Lolium perenne)
Different pollen grain structures between species ensure compatibility within the
same species.
Pollination by animals
Flowers that attract animals are more effective in ensuring the transfer of pollen and, therefore, the
reproductive success of that species. Special adaptations in the flower are of considerable advantage,
because a one-to-one relationship between a plant and an animal species reduces wastage of pollen
by ensuring that it is deposited on the correct flower. Animals such as insects, birds and mammals
that act as pollinators search in flowers for a reward, such as a meal of nectar (a sugary liquid secreted
by nectaries in the flower) or pollen. During this search, pollen rubs onto their bodies and is then
transferred to the next flower they visit. Flower scent, colour, markings, shape and nectar are important
in attracting animals, all differing between each flower species and adapted to the type of animal they
attract (Table 2.2, Fig. 2.16).
TABLE 2.2 Comparison of wind-, bird- and insect-pollinated flowers
FEATURE
OF FLOWER WIND-POLLINATED FLOWERS BIRD-POLLINATED FLOWERS INSECT-POLLINATED FLOWERS
Petals Small and inconspicuous, usually Usually large and colourful, red Usually large and colourful (yellow or
green or dull in colour or orange, often a tubular shape, blue); may be shaped to encourage
sometimes no petals at all specific pollinators
Scent Usually absent Rarely fragrant because birds have Often present because insects are
little sense of smell highly attracted to scents
Nectar None Large amounts of nectar produced in Sometimes produced at base of petals,
nectary at base of flower so insect must enter the flower to reach
the nectar
Anthers Anthers protrude outside the flower, Anthers are commonly lower than Enclosed within flower, commonly
so pollen is easily blown off by the stigma, colourful, and may not be lower than stigma
wind; abundant pollen is produced enclosed by petals
Stigma Stigma protrudes from the flower, Higher than anthers, sometimes Enclosed within flower, sticky, and
is often long, feathery and sticky, to not enclosed by petals and often commonly higher than the anthers
increase surface area for trapping colourful
wind-borne pollen
Pollen Very small grains, light and powdery; Sticky or powdery pollen; small Relatively large grains and often sticky;
large amounts produced amount produced small amount produced
9780170408851 CHAPTER 2 » SEXUAL AND ASEXUAL REPRODUCTION 45
02_bio_InFocus12_2e_sb_08851_txt.indd 45 08/08/18 6:29 pm
Some Australian flowers (Callistemon – bottlebrush, Banksia and Grevillea species) are pollinated by
small mammals such as bats, possums, pygmy possums and small rodents (Fig. 2.16).
Getty Images/Photograph by David Messent
Getty Images/AUSCAPE
FIGURE 2.16 a b
Examples of native
animals and insects
pollinating flowers;
a the red colour of
the New South Wales
waratah (Telopea
speciosissima) attracts
birds as pollinators;
b a blue-banded
bee pollinating a
purple flower (bees
cannot see red; they
are attracted to
flowers in the blue
and yellow range);
Getty Images/Oxford Scientific
Getty Images/Oxford Scientific
c a hammer orchid c d
(Drakaea glyptodon)
mimics a female wasp;
male wasps act out
mating behaviour
with the orchid flower,
effecting pollination;
d the Australian
honey possum
(Tarsipes rostratus)
pollinates flowers
while feeding on
nectar.
Seed dispersal
After pollination and fertilisation of the flowers of a plant, seeds (fertilised ovules) from inside the ovary
are dispersed (Fig. 2.17). It is an advantage for seeds to be dispersed over a wide distance, as this helps
prevent overcrowding and competition for light, water and soil nutrients. Widespread distribution also
increases the chances of continuity of the species in other locations, in case there is a sudden change
in the local environment, such as fire or disease. Australian native plants have evolved a variety of
adaptations to increase the chance of successful dispersal of their seeds.
Dispersed by animals Dispersed by wind Self-dispersed
Adherent fruits Fleshy fruits
Medicago Solanum Asclepias
polycarpa dulcamara syriaca Papaver
(poppies)
Acer
Bidens Juniperus saccharum
frondosa chinensis
Impatiens
(balsam)
Ranunculus Terminalia
Rubus sp.
muricatus calamansanai
FIGURE 2.17 Adaptations of different types of seeds to facilitate their dispersal
46 MODULE FIVE » HEREDITY 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 46 08/08/18 6:29 pm
The success of seed dispersal depends on the type of agent that the plant relies on. Fruits may be dry
(such as banksia pods, gum nuts) or fleshy (such as apples, dragon fruit) (Fig. 2.18). Dry fruits often have
inbuilt ‘explosive’ mechanisms for dispersal by air, wind or water (abiotic agents). They are usually light
so that they can float on air or water. Fleshy fruits often rely on insects, birds or mammals for dispersal
(biotic agents) – the animals eat the fruit, move along and then egest the seeds, usually some distance
away from the parent plant.
a b c d
Pod Capsule Follicle Follicle
(legume) Separator
Seed
Winged seed
Shutterstock.com/Africa Studio
FIGURE 2.18 Examples of dry and fleshy fruits: a pods or legumes of Acacia; b capsules of Eucalyptus; c follicles of Banksia;
d follicle separator (Banksia) – when wet it pulls the two seeds out of the fruit; e the seeds of fleshy fruits such as
strawberries, blueberries, kiwifruit and dragonfruit are contained within a fleshy ovary (fruit).
Germination
The plant embryo inside a seed is in a dehydrated form and is dormant, to allow the seed to survive
adverse conditions. If the seed lands in suitable soil that provides sufficient water, oxygen and warmth, it
germinates – that is, the embryo begins to grow, producing a radicle or young root to absorb water and
soil nutrients, as well as a plumule or young stem, which develops green leaves for food production by
photosynthesis. Once the seedling becomes established, it grows and develops into an adult plant that
can begin the reproductive cycle once again.
KEY CONCEPTS
● Sexual reproduction in plants involves external agents of pollination and seed dispersal, such
as wind, water, fire (abiotic) and animals (biotic).
● Pollination mechanisms in plants include self-pollination (to ensure survival if reproductive
partners are scarce) and cross-pollination (to increase genetic variation and ensure survival if a
sudden environmental change such as disease or drought occurs).
● The life cycle of a plant involves pollination, fertilisation, seed dispersal and germination.
● Seed dispersal relies on the type of fruit in which the seeds occur matching the type of
dispersal agent available in that environment.
9780170408851 CHAPTER 2 » SEXUAL AND ASEXUAL REPRODUCTION 47
02_bio_InFocus12_2e_sb_08851_txt.indd 47 08/08/18 6:29 pm
● Advantages of sexual reproduction:
– New gene combinations are created and so, by selection, some individuals may survive in the
face of sudden environmental change.
– Harmful mutations may be removed from the population.
– Offspring may differ in their requirements due to the variation in the population and so
there may be less competition for the same resources among offspring.
● Disadvantages of sexual reproduction:
– It is costly in terms of time, energy and bodily resources.
– Two organisms are required.
CHECK YOUR
UNDERSTANDING 1 List the male reproductive parts of a flower and describe the function of each part.
2 Draw and label the female reproductive parts of a flower and describe the function of each part.
2.1c 3 Distinguish between pollination and fertilisation in plant reproduction.
4 Describe the pollination mechanism of two named Australian plants.
5 Identify two ways in which the reproductive structures differ between wind-pollinated and insect-
pollinated plants.
6 Name the structure that each of the following develops into after fertilisation: ovum, seed, ovary wall.
7 Identify two methods of seed dispersal in named Australian plants.
Asexual reproduction –
2.2 only one parent
Asexual reproduction means not sexual reproduction. The name tells us that it does not involve gametes
(sex cells). Only one parent is required and all the genetic material in the offspring is passed down from
this single parent. The result is that offspring are genetically identical to the parent and to each other.
There is no production or fusion of gametes, and no mixing of genetic information to introduce variation.
This has advantages and disadvantages. In unicellular organisms, asexual reproduction is the main form
of reproduction. In multicellular organisms, sexual reproduction is more common.
The advantage of asexual reproduction is that it enables organisms to reproduce quickly without having
to find a mating partner. For plants, which are immobile, finding a mate is complicated. Being genetically
identical may give organisms a competitive advantage if they live in an environment to which they are
particularly well adapted. Asexual reproduction among plants is more common in harsh environments
where organisms are so specific that there is little benefit in having variation within the population. In these
habitats, when favourable conditions arise suddenly, organisms can reproduce quickly and effectively.
Selective pressures that make asexual reproduction more effective than sexual reproduction include:
◗ a shortage of food and/or other resources – asexual reproduction uses less energy to produce offspring
◗ a small mating population and/or time and other constraints on finding a mate – only one parent is
required for asexual reproduction.
The main disadvantage of asexual reproduction is that, with little or no variation in the population,
the whole group (or species) is particularly vulnerable to sudden changes in the environment, such as
drought, disease, or a new parasite or predator. Changes such as these may result in the survival of few,
if any, individuals.
Many organisms, including protists, fungi and plants, alternate between sexual and asexual
reproduction as a normal part of their life cycle. This mechanism, known as an alternation of generations,
Alternation of
generations in involves a sexually reproducing, gamete-bearing generation alternating with an asexually reproducing,
plants
spore-bearing generation.
48 MODULE FIVE » HEREDITY 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 48 08/08/18 6:29 pm
Asexual reproduction in plants
Have you ever planted the cut-off tops of carrots, beetroot or strawberries and discovered that they
produce roots and grow into new plants? Or perhaps you have seen the runners that grow out of the
ground in strawberry patches or around raspberry bushes. These are examples of asexual reproduction.
New individuals arise from portions of the roots, stems, leaves or buds of adult individuals and are
genetically identical to their parent. This type of asexual reproductive process is referred to as vegetative
propagation.
Vegetative propagation
Some adult plants produce vegetative organs, such as
Getty Images/Studeo-Chase
bulbs, tubers, rhizomes and suckers, from which new
plants can arise. This is equivalent to cloning an adult
plant, as the offspring are genetically identical to the
parent. Perennating organs (from the word perennial,
meaning returning year after year) are underground
organs such as roots or stems that contain enough
stored food to sustain the plant in a dormant state,
from one season to the next. These organs allow plants
to survive adverse conditions such as extreme cold in
winter or drought in summer. Even though the parts
of the plant above the ground may die, the remaining
underground organs develop buds that begin to grow
once favourable conditions return. Buds on deciduous
trees are also considered to be organs of perennation.
In addition to being a way of surviving from one
FIGURE 2.19 Potatoes develop tubers from swollen
year to the next, perennating organs, when separated, regions of the stem. New plants may also grow from
give rise to new plants and so they are a form of asexual the buds (‘eyes’) of a potato.
reproduction. Gardeners often exploit this by splitting
bulbs, cutting up rhizomes or runners, and taking
cuttings of shoots from stems to grow new plants.
Vegetative propagation techniques are often used in agriculture – in growing perennial crops
such as seedless grapes, watermelons and mangoes. This increases the production of crops when
seeds are unavailable and/or difficult to germinate. Asexual reproduction is also used if plants have
specific desirable traits that farmers want to perpetuate in future generations. Some common naturally
occurring examples of vegetative propagation are described below.
Runners – modified stems
Runners are long, thin, modified stems that grow along
Dreamstime.com/Anne Bradley
the surface of the soil. In the cultivated strawberry, for
It is important
example, leaves, flowers and roots are produced at every to identify the
alternate node on the stem runner. Just beyond each organ that has
the modification.
second node, the tip of the node turns up and thickens, For example,
producing new roots and a new shoot that continues the runner is a
modified stem,
the runner. Another example is spinifex (Fig. 2.20), a and the sucker,
grass that has long stems that grow horizontally along on page 50, is a
modified root.
the surface of the soil. At each node, leaves and roots
are produced and so the runner can be subdivided into FIGURE 2.20 Spinifex is a type of grass (Spinifex
new plants. Spinifex ensures its survival by sending out hirsutus) with surface stems (runners) producing new
leaves and roots (plantlets) at each node.
runners in harsh dune conditions such as high wind
erosion, high salinity and high temperatures.
9780170408851 CHAPTER 2 » SEXUAL AND ASEXUAL REPRODUCTION 49
02_bio_InFocus12_2e_sb_08851_txt.indd 49 08/08/18 6:29 pm
Rhizomes – modified stems
Shutterstock.com/postolit
Underground horizontal modified stems, or rhizomes, are characteristic of ginger, ferns such as bracken
fern, and many grasses. They can give rise to a new shoot at each node. Gardeners often propagate ferns
by splitting the rhizomes (Fig. 2.21).
Suckers – modified roots
The roots of some plants produce modified roots called suckers or sprouts, which give rise to new plants.
Trees and shrubs that sucker, such as reeds, wattles and blackberries, can spread quickly into a vacant
patch of habitat after disturbance. The colony wattle (Acacia murrayana) (Fig. 2.22) sends up shoots
from the outer roots and these grow into separate plants if the parent shrub dies. This allows for rapid
regrowth after a decline in numbers (after a bushfire or a drought, for example).
Apomixis
Some plants are able to produce offspring from special generative tissues, without involving fertilisation
FIGURE 2.21 or the production of seeds, a form of reproduction known as apomixis. This ‘generative tissue’ may be
New fern plants
can grow when in the form of gametes, such as in unfertilised ovules, or non-reproductive tissue such as leaf tissue
the rhizome (stem) (Fig. 2.23). It is termed generative tissue because it gives rise to plantlets that can produce asexual seeds.
is fragmented at
the nodes. Apomixis is seen in plants such as kangaroo grass (Themeda triandra), lemon and orange trees (Citrus)
and dandelions. Plantlets such as those that arise on leaves (Fig. 2.23) and their seeds grow into individuals
that are genetically identical to their parent. The advantages of apomixis are that multiplication is rapid
and the plantlets are able to produce seeds, increasing seed dispersal, an adaptation usually associated
only with sexual reproduction. The disadvantage is the lack of variation that is typical of reproduction
that involves two parents.
Apomixis also includes parthenogenesis in animals, a type of reproduction in which the new individual
develops from an unfertilised egg produced by a female. You will have the opportunity to research this
further in Investigation 2.2.
Shutterstock.com/TIPAKORN MAKORNSEN
Alamy Stock Photo/Infinity
FIGURE 2.22 The colony wattle
(Acacia murrayana) regenerates after FIGURE 2.23 Asexual reproduction by apomixis: Kalanchoe plantlets
drought or bushfire. budding along the leaf margins
TABLE 2.3 Examples of the advantages of asexual reproduction
EXAMPLE ASEXUAL REPRODUCTION MECHANISM WHY IT IS AN ADVANTAGE
Spinifex grass Stem runners put out leaves and Enables reproduction in harsh conditions, requires
roots at nodes along the ground less energy to reproduce by runner, and is very rapid
Colony wattle Shoots grow from outer roots Rapid, and large numbers can be reproduced
(suckers) and develop into quickly, an advantage when rapid recovery is needed
separate plants after a decline in numbers (e.g. fire or drought)
50 MODULE FIVE » HEREDITY 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 50 08/08/18 6:30 pm
INVESTIGATION 2.1
A practical and secondary-source investigation to examine organs
of perennation in plants
You are required to:
• examine organs of perennation in plants growing in your local area and/or in your garden at home Literacy
• conduct secondary-source research using a variety of sources to identify different types of perennating
organs and how the modifications are adaptations to promote the continuity of the species
• present your findings in the form of a poster.
The poster you create will detail two examples of perennating organs that allow asexual reproduction in
plants. The examples you select must include no more than one of each organ – root, stem or leaf. You may not
use the organ outlined in the worked example below.
In the description on your poster, include:
• type of organ
• a scientifically named plant in which the organ occurs
• a labelled diagram of the organ, identifying plant tissues that:
– store food
– contain buds or other structures that give rise to new plants.
• a table in which you:
– explain how the organ of perennation gives rise to new plants
– discuss the advantages and disadvantages of the organ of perennation in terms of the survival of
the species.
Some organs of perennation that you may wish to consider are:
• bulbs, corms and tubers • epicormic buds • organs of apomixis.
• rhizomes • runners and suckers
WORKED EXAMPLE 2.1
ANNOTATED DIAGRAM AND DESCRIPTION OF AN ORGAN OF PERENNATION
Annotate a diagram of a perennating organ and explain the advantage of the organ of perennation to
the survival of the species.
ANSWER LOGIC
Leaves • Draw or insert a diagram.
• Label all parts of the organ of perennation.
Bulb
Scale leaves • Annotate the part that stores food.
Main bud store food
Basal plate Axillary buds
(stem) give rise to • Annotate the part that contains buds.
Roots new plants
Plant: Allium cepa • Name the plant and the organ of
FIGURE 2.24 Stem bulb: onion (organ of perennation) perennation.
9780170408851 CHAPTER 2 » SEXUAL AND ASEXUAL REPRODUCTION 51
02_bio_InFocus12_2e_sb_08851_txt.indd 51 08/08/18 6:30 pm
ANSWER LOGIC
An onion is a stem bulb with fleshy leaves. The stem is reduced to a • Describe the organ of perennation
short disc, the basal plate. Roots grow on the lower surface of the
disc and leaf bases on the upper surface.
Axillary buds occur at nodes where the leaves attach, and these • Describe where the buds are.
buds can develop into new bulbs.
If an onion bulb is planted, within a year or two there will be several • Explain the advantage of the organ of
bulbs in that place. These can be separated and re-planted to perennation to the survival of the species.
produce new plants.
Scientists often use
Asexual reproduction in other organisms
yeast for genome
studies, because It is not only members of the plant kingdom that undergo asexual reproduction. This type of reproduction
yeast is a simple
eukaryote with
is common in other organisms where it is advantageous for the parent and young to be genetically
similar cellular identical. Mechanisms of asexual reproduction in animals include budding, binary fission, sporogenesis,
organisation and
processes to
fragmentation and parthenogenesis.
those of complex
multicellular Budding
organisms such as
humans. The yeast In reproductive budding, an adult organism gives rise to a small bud, which separates from the parent and
genome was the
first to be sequenced grows into a new individual.
(in 1996). Yeast are microscopic unicellular organisms that are
a
classified as fungi, along with macroscopic moulds and
Science Photo Library/Eye
of Science
mushrooms. There are hundreds of species of yeast; those
with which you may be familiar are baker’s and brewer’s
yeast (different strains of the same species, Saccharomyces
cerevisiae) and the less useful Candida albicans, which causes
digestive disorders and thrush in humans.
The cells of baker’s yeast are oval-shaped and, when
Science Photo Library/Science Pictures Limited
b environmental conditions are favourable, a small outgrowth
or bud develops on the parent cell. As this outgrowth
enlarges, the parent cell replicates its DNA, the nucleus then
divides and one copy moves into the bud or daughter cell.
When the daughter cell reaches a certain size, it detaches
from the parent cell and continues to grow, until it buds in
turn. This continues as long as there are sufficient nutrients
in the environment. Sometimes the buds do not break away
from the parent cell and a chain of cells forms (Fig. 2.25a). The
cell cycle of division in yeast is similar to that of human cells
(Chapter 3). Yeast cells can replicate every 90 minutes and
their numbers increase exponentially.
Yeast cells are also capable of sexual reproduction, but this
is only triggered if there is a lack of nutrients. Yeast cells are
FIGURE 2.25 a Budding in yeast, where unusual because they can exist in the haploid or diploid form,
daughter cells remain attached to the
parent cell; b hydra budding by producing a and both types of cells can reproduce asexually by budding.
multicellular outgrowth from the side of the This makes them extremely useful in genetic studies. The
parent’s body
diploid form is more resistant to harsh environmental
52 MODULE FIVE » HEREDITY 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 52 08/08/18 6:30 pm
conditions and can form spores that germinate when favourable conditions return, creating haploid
yeast cells once again.
Budding also occurs in some multicellular organisms, including jellyfish, hydra (Fig. 2.25b) and Yeast: an
grooved brain coral (Fig. 2.26). When conditions are favourable, the cells of the parent divide by mitosis experimental
organism for
and grow into a multicellular outgrowth, which develops into a smaller but identical individual or bud. 21st century
biology
This bud detaches from the parent and grows into a reproductive adult. One advantage of budding
is that, if there is no variation in the environment, the identical offspring will always be adapted
to their surroundings and survive to reproduce successfully. However, if the environment changes
(for example, if a new disease or pest enters), the entire species may rapidly decline and die out.
Getty Images/Konrad Wothe
FIGURE 2.26 Grooved brain coral
Binary fission
The term binary fission means splitting (fission) into two (binary). This is the main method of asexual
reproduction in unicellular organisms such as bacteria (prokaryotes) and protists (unicellular eukaryotes).
A newly divided cell grows to twice its size, replicates its genetic material (DNA) and then splits into two
cells with identical genetic material (Fig. 2.27). This may seem simple, but for successful reproduction
and survival, the timing of division is crucial and each individual must retain a complete and exact copy
of the genetic material.
Science Photo Library/CNRI
FIGURE 2.27 Transmission electron micrograph of the
bacterium Listeria dividing into two by binary fission (×9800)
9780170408851 CHAPTER 2 » SEXUAL AND ASEXUAL REPRODUCTION 53
02_bio_InFocus12_2e_sb_08851_txt.indd 53 08/08/18 6:30 pm
Binary fission in bacteria
When reproducing asexually, a bacterial cell can double in number every twenty minutes in favourable
environmental conditions, thereby ensuring a rapid increase in numbers.
The prokaryotic cell grows to full adult size, then replicates its single DNA molecule and each copy of
the DNA attaches to opposite ends of the cell membrane. A range of proteins accumulate at the centre of
the cell and play a role in pinching off the cytoplasm and in ensuring that the DNA is not damaged in the
process. A new cell wall is then synthesised in the area of cell cleavage. The new cells grow to full adult
size before they divide again. The timing and sequence of the steps are closely controlled in the cell cycle.
Researchers are interested in finding out more about the regulation of binary fission in bacteria, as it
may help them develop synthetic chemicals or find new antibiotics that interfere with the process of binary
fission in pathogenic (disease-producing) bacteria, leading to new ways to combat bacterial infections.
A few bacterial species use other patterns of cell division to reproduce. Some bacteria grow much
Reproduction in larger than the adult size and undergo multiple divisions, producing many offspring from one original
bacteria
cell, while others reproduce by budding.
Binary fission in protists
Mitosis and spindle Protists are unicellular eukaryotes that reproduce asexually by a type of binary fission (Table 2.5). This
formation are dealt
with in more detail involves mitosis and the formation of a spindle within the cytoplasm of the cell to distribute chromosomes
in Chapter 3. equally.
Amoeba is a single-celled organism that moves through water or damp soil by cytoplasm flowing
out into long extensions of the cell called pseudopodia. It reproduces asexually by binary fission but,
in adverse environmental conditions, it may form a cyst and then divide by multiple fissions inside
the cyst, forming many identical cells that will be released when favourable conditions return. Binary
fission in amoeba is termed ‘irregular’, as the cell is asymmetrical and division can occur along any
plane (Fig. 2.28a).
TABLE 2.5 Types of binary fission in protists (Fig. 2.28 a–d)
TYPE OF BINARY FISSION CLEAVAGE PLANE EXAMPLE OF PROTIST
Longitudinal Lengthwise Flagellate forms, e.g. Euglena
Transverse Crosswise Ciliate forms, e.g. Paramecium
Oblique At an oblique angle Ceratium
Binary fission Irregular Along any plane Amoeba
FIGURE 2.28 Binary
fission in protists:
a irregular cleavage in a b c d
Amoeba;
b longitudinal
cleavage in Euglena;
c transverse cleavage
in Paramecium;
d oblique cleavage in
Ceratium
Fission
Amoeba
Paramecium
Euglena
Ceratium
54 MODULE FIVE » HEREDITY 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 54 08/08/18 6:30 pm
Binary fission has the advantage of enabling rapid population growth over a short period of time
in adverse conditions, as it requires only one parent. However, the main limitation is that no genetic
diversity is generated. Pathogenic
Some protists are pathogenic and have a life cycle in two stages, one in an insect vector and one in a protists that
belong to the
mammalian host. For example, in Plasmodium species that cause malaria, there are stages in both the group (phylum)
vector and the host that are able to reproduce asexually by fission. The parasite reproduces sexually in protozoa and
their life cycles
the mosquito, and both sexual and asexual reproduction occur in a human host. are dealt with in
more detail
in Chapter 12,
Spores pages 419–20.
Some organisms rely on spore production
Science Photo Library/Dr Keith Wheeler
to reproduce. Spores are tiny, unicellular
reproductive cells that are produced in The Kingdom
great numbers by organisms such as fungi Protista is divided
into phyla that
(moulds and mushrooms, for example) and include protozoa,
some plants (mosses and ferns). Structures slime moulds and
algae.
called sporangia (Fig. 2.29) produce very
large numbers of spores, which are light and
easily dispersed, travelling long distances
by wind. Spores effectively expand the
distribution of the species and are able
to colonise new environments. Unlike a
gamete, a spore does not need to fuse with
FIGURE 2.29 Bread mould, showing hyphae (white) and
another cell to produce a new individual. sporangia (black)
Spores also differ from seeds, as each spore
is a single cell and therefore does not contain an embryo or a food supply. In terms of evolution, evidence
shows that seed-bearing plants arose later than spore-bearing fungi and plants.
Multicellular fungi such as mould and mushrooms are made up of threads or filaments called hyphae
(Fig. 2.29) that are branched and interconnected, forming the main fungal body, called the mycelium
(plural mycelia). These threads may grow underground, or in dead and decaying matter. Unlike plants,
fungi lack chlorophyll and do not photosynthesise, so they can grow in the dark. Their type of nutrition –
either saprophytic (obtaining organic nutrients from dead and decaying matter) or parasitic (obtaining
organic nutrients from living hosts) – allows fungi to colonise aerobic damp, dark environments where
there is less competition for nutrients and water.
An example of spore formation in a fungus occurs in the black mould Rhizopus nigricans, which is
similar to the pin-head mould Mucor and the antibiotic-producing mould Penicillium. These fungi are
multinucleate, because there are many nuclei in the hyphae, with no cross walls to separate them into
individual cells.
When environmental conditions are favourable, fungi reproduce asexually (Fig. 2.30). They develop
large numbers of spore-producing units or sporangia, which grow upwards and are visible as the grey-
green part of mould seen on bread, fruit and sometimes even leather. Sporangia develop as specialised
tips of hyphal threads. They have numerous haploid nuclei, which develop into microscopic spores that
are white at first and then turn black as they ripen. Each spore has several nuclei and some cytoplasm,
surrounded by a wall. Spores are produced in enormous numbers and are extremely light, enabling
widespread air dispersal. They carry genetic material identical to that of the parent. Under favourable
environmental conditions, fungal spores germinate, absorbing water through the wall, which activates
the cytoplasm to grow. Nuclear divisions occur, more cytoplasm is produced and the spore grows into
a new mycelium. This process enables fungi to reproduce rapidly, colonise a wide area and ensure the
continuity of the species.
9780170408851 CHAPTER 2 » SEXUAL AND ASEXUAL REPRODUCTION 55
02_bio_InFocus12_2e_sb_08851_txt.indd 55 08/08/18 6:30 pm
FIGURE 2.30
Asexual reproduction Sporangia (n)
in a fungus such
as Rhizopus (bread
mould)
Sporangium
ruptures,
Spores
releasing
(n)
spores
Stolon
Spore
germinates
Hyphae Hyphae
(rhizoids)
Hyphae (n)
Spores
Watch how sporangia
release spores.
If a fungus is well adapted to a particular habitat, it is advantageous for it to conserve its genome and
not introduce changes, such as those that would arise through sexual reproduction. Other advantages
of asexual reproduction are that the fungus requires fewer nutrients and expends less energy. Retaining
its adaptive advantage through asexual reproduction ensures the continuity of the species in its habitat.
Advantages
of asexual However, changes in the environment will induce a sexual reproductive phase in fungi. During
reproduction in sexual reproduction, the hyphae of two different mating types fuse, before forming a sexual reproductive
fungi
fruiting body that will have spores with different combinations of genetic material.
INVESTIGATION 2.2
Practical investigation of
Alamy Stock Photo/imageBROKER
asexual reproduction (budding,
binary fission, spore formation,
Revise skills, risk propagation) in living organisms
assessment and
safety for using a INTRODUCTION
microscope from
your Year 11 work. Most of the living organisms you will study in this
practical undergo asexual reproduction under Hyphae
favourable environmental conditions. Simulating
these conditions will make your investigation more
successful. To expand your investigation skills, you
may wish to design an experiment with conditions Sporangia
that you think will stimulate sexual reproduction
in these organisms, and then test your hypothesis. FIGURE 2.31 Sporangia at the end of hyphal threads
in a Mucor species of fungus, as seen under the light
You will need a microscope to examine asexual
microscope
reproductive structures.
56 MODULE FIVE » HEREDITY 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 56 08/08/18 6:30 pm
PART A
AIM
To investigate spore production in bread mould
MATERIALS
• 1 slice of moist bread (with no preservatives)
• 1 zip lock plastic bag or Petri dish
• dark environment such as a cupboard
• dissecting needle and forceps (1 per student group)
• glycerine in a dropper bottle (1 per student group)
• glass microscope slides and coverslips (1 per student group)
RISK ASSESSMENT
Copy and complete the risk assessment table below using your knowledge of microscope safety from your
Year 11 practical work.
WHAT ARE THE HAZARDS? WHAT RISK DOES THIS HAZARD POSE? HOW CAN YOU SAFELY MANAGE THIS RISK? !
RISK
Mould Inhalation of spores may lead to allergic Wear a face mask when putting a fungal sample ASSESSMENT
reaction onto glass microscope slides.
Use forceps and a probe; do not handle the mould.
Wash hands at the end of the experiment.
Glass microscope slides May break and cut you
Microscope Can drop on toes
Electrical plug Electrocution
METHOD
1 Place a piece of damp bread (without preservatives) in a zip lock plastic bag or a Petri dish and keep in a
warm, dark place for a few days. Damp oranges or cheese may also be used to grow mould.
2 Examine for mould growth with a hand lens daily. At first you may see hyphal threads (colourless at first).
Once the mould has begun to darken, this signifies the production of spore bodies.
3 To prepare slides of bread mould (wear a face mask if you are allergic to spores):
a Place a drop of glycerine on a slide.
b Using forceps and a dissecting needle, place a few strands of hyphal threads from a pigmented area of
the mould in the glycerine.
c Cover with a coverslip, lowering it carefully to avoid trapping air bubbles.
d Examine the slide under low and high power. Draw and label the mycelium and sporangia as seen
under high power.
PART B
AIM
To investigate budding in yeast (unicellular fungus)
MATERIALS
• yeast (1 packet active dry baker’s yeast)
• 80 mL warm water
• 15 g sugar
• slide and coverslip (1 per student group)
• dropper
• microscope (1 per student group)
9780170408851 CHAPTER 2 » SEXUAL AND ASEXUAL REPRODUCTION 57
02_bio_InFocus12_2e_sb_08851_txt.indd 57 08/08/18 6:30 pm
METHOD
1 At least 2–3 hours before examining the yeast, combine the sugar, yeast and warm water, mixing well. (This
step could be done the day before and the mixture left overnight.)
2 Place a drop of the yeast mixture on a slide, cover with a coverslip and observe under low and high power.
Alternative method: If the yeast is on agar plates, pick yeast off the plate using a toothpick. Dip the tip of the
toothpick containing yeast into a drop of water/methylene blue on a microscope slide.
3 Draw and label a diagram to show yeast budding, identifying the parent cell and the bud.
Note: If methylene blue is used to stain cells, it is important to remember that yeast cells that are alive will
appear opaque (enzymes in yeast actively break down the dye) and cells that appear blue are dead. Look
for living yeast cells that are undergoing asexual reproduction by means of budding.
4 You may choose to film the process with a mobile phone through the eyepiece of the microscope.
5 If no active budding is seen, find a short video clip on the Internet, and watch the process of yeast budding.
PART C
AIM
To investigate budding and binary fission using prepared microscope slides
MATERIALS
Prepared microscope slides of:
• hydra budding
• amoeba undergoing binary fission
• yeast budding.
METHOD
1 Examine the prepared slides using a microscope, under low power and high power.
2 Identify the type of asexual reproduction observed in the named organism on the slide.
3 Draw and label the organism reproducing asexually. Write a heading for your diagram and record the
magnification at which the specimen was viewed.
RESULTS
Copy and complete Table 2.6 to record the results of parts A to C of the investigation. Include accurately drawn
scientific diagrams to show:
a spore production in fungi
b budding in yeast
c binary fission in Amoeba
d budding in Hydra.
Each row of your table will need to be large enough to include your diagram.
TABLE 2.6
NAME OF SPECIMEN MODE OF ASEXUAL REPRODUCTION DIAGRAM
CONCLUSION
Write a general statement summing up the forms of asexual reproduction that you observed in the variety of
organisms examined in this investigation.
58 MODULE FIVE » HEREDITY 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 58 08/08/18 6:30 pm
PART D
AIM
To investigate other forms of asexual reproduction in plants and animals, using secondary sources and/or
primary investigations
METHOD
Working in groups of 3–4 students, divide up the following tasks and carry out this part of the practical as a group.
1 Research a method and/or grow a plant using vegetative propagation – from, for example, a plant cutting,
bulb, tuber or runner.
2 Find a video clip on the Internet or create a multimedia presentation that shows an example of the modes
of asexual reproduction listed below. Create either a voice-over or subtitles to explain to your peers the
mode of asexual reproduction and the advantages/disadvantages of this type of reproduction for the
continuity of the species. You may conduct research and prepare a presentation on any organisms that
display these forms of asexual reproduction – the organisms listed below are only examples.
a Fragmentation and regeneration – e.g. sea stars and flatworms, such as Planaria
b Parthenogenesis – e.g. Binoe’s gecko (Heteronotia binoei), stick insects (Order Phasmatodia).
RESULTS
Present your results to your group. From the presentations, summarise in a table what you have learned from Personal and
social capability
others in your group. Carry out peer assessment on the presentations created by each member of your group.
Present the best one from your group to the whole class.
Some areas and questions you may wish to review when assessing the presentations of your peers are:
• Coverage – does the presentation cover the topic completely or partially, or is it too brief and just a summary?
• Illustrations – are they relevant and clear, and do they enhance understanding?
• Context – are the subtitles and/or voice-overs clear and relevant, and do they explain the advantages and Peer evaluation
disadvantages clearly and in context? Peer contribution –
assessing the value
You may also wish to evaluate your team work. See the weblinks for ideas and scaffolds for peer assessment. of the contribution
of members of our
DISCUSSION QUESTION group
1 Copy and complete Table 2.7 to compare the processes of budding, binary fission and spore production
in the organisms that you have reviewed in the presentations. Explain the conditions under which each
occurs. Discuss the role of each mode of asexual reproduction in contributing to the continuity of species.
TABLE 2.7 Comparison of budding, binary fission and spore production
Group
evaluation
HOW IT ENSURES CONTINUITY OF
NAME OF SPECIMEN MODE OF ASEXUAL REPRODUCTION DIAGRAM THE SPECIES Assessing the
effectiveness of
your teamwork
EX TENSION
Asexual reproduction is not limited to protista, fungi and plants. Some animals are able to reproduce by means
of budding and other forms of asexual reproduction. Parthenogenesis is a form of asexual reproduction in
animals that falls into the category of apomixis (page 50). The term is derived from the Greek word ‘Parthenos’
meaning virgin, and ‘genesis’ meaning creation. Parthenogenesis involves the production of offspring from an Parthenogenesis
unfertilised gamete, usually an egg (ovum). This unusual form of reproduction, although classified as asexual,
may also be thought of as ’incomplete’ sexual reproduction. It is common in some insects (aphids, ants,
bees and wasps, for example), and has been found to occur fairly commonly in reptiles as well. The young
that are produced are genetic clones of their mother. There are many Australian lineages that demonstrate
parthenogenesis. (See the weblink.) This raises a good question for discussion: Is there a need for males in
animal species that have parthenogenesis? Research the advantages and disadvantages of parthenogenesis
and prepare arguments for and against the discussion question posed.
9780170408851 CHAPTER 2 » SEXUAL AND ASEXUAL REPRODUCTION 59
02_bio_InFocus12_2e_sb_08851_txt.indd 59 08/08/18 6:30 pm
KEY CONCEPTS
● Budding occurs in yeast and some multicellular organisms such as Hydra and brain coral.
● Binary fission is the most common form of asexual reproduction in bacteria and protists.
● Asexual reproduction in bacteria occurs in a series of steps: a cell grows to twice its size; DNA
replicates; DNA separates; protein accumulates at the cleavage site; the cytoplasm divides; and
a new wall is synthesised.
● Both binary fission and budding involve only one parent, so no mate is required, allowing rapid
proliferation of genetically identical organisms that are well suited to survive in their particular
environment.
● Disadvantages of asexual forms of reproduction: lack of genetic variation in offspring, which
may lead to their demise in unexpected harsh conditions or as a result of other changes in
selecting agents; the large numbers of offspring produced may compete with each other for
resources.
CHECK YOUR
UNDERSTANDING 1 Using examples, explain how the transfer of gametes during sexual reproduction occurs in plants and
animals.
2.2 2 Describe two pollination mechanisms in plants and explain how they ensure the continuity of the species.
3 Describe two reproductive mechanisms in named examples of animals, to ensure the survival of the young.
4 In a table, compare the structure of a gamete, a seed and a spore, and explain the role of each in
reproduction, using examples.
5 In a table, compare forms of asexual reproduction including budding, binary fission and propagation.
2.3 Sexual reproduction in mammals
As you now know, from reading section 2.1, sexual reproduction involves fertilisation – the fusion of male
WS and female gametes (sex cells) to form a zygote (fertilised egg). The zygote contains a new combination
of genetic material from both parents. Because a variety of offspring are produced, this genetic variation
The male
and female increases the chances of survival of the population in the case of environmental change. For the energy
reproductive expenditure of sexual reproduction to be worthwhile, the chances of reproductive success must be
systems
maximised.
Mammals have several reproductive mechanisms to maximise reproductive success, including:
The three classes
of mammals are: ◗ internal fertilisation to increase the likelihood that gametes will meet (this occurs in all three subclasses
• monotremes of mammals)
(egg-laying)
◗ implantation of the embryo into the uterine wall, with internal development of the embryo (marsupials
• marsupials
(pouched) and eutherians) (Fig. 2.32) to increase the embryo’s chance of survival
• eutherians ◗ pregnancy to allow the developing young to be protected from the external environment, have
(placental).
a constant nutrient supply and complete a gestation period (short in marsupials; prolonged in
eutherians, whose young are well developed when they are born).
All stages of sexual reproduction are carefully timed and synchronised by a combination of hormones
that coordinate the reproductive cycle to ensure greater reproductive success.
Strategies such as the timing of reproductive cycles, embryonic development in utero, reduced
number of young produced and quality of parental care have evolved to further increase the likelihood
that the young will develop and grow to become reproductive adults. All stages of sexual reproduction in
mammals, from gametogenesis to courtship behaviour, pregnancy and birth, are carefully regulated by
hormones. Successful offspring will survive to become adults, competing in turn for mates of their own.
The cycle must be self-perpetuating, to ensure the continuity of the species.
60 MODULE FIVE » HEREDITY 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 60 08/08/18 6:30 pm
Implantation
Fertilisation 1 week 2 weeks
Embryo
3 weeks 4 weeks 5 weeks 6 weeks 7 weeks 8 weeks
Foetus
9 weeks 12 weeks
FIGURE 2.32 Fertilisation and embryonic development in humans, to foetus stage
Hormones
Hormones are chemical substances that act as messengers in the body, coordinating many aspects of
functioning, including metabolism and reproduction, so that actions within the body are synchronised. See Chapter 14,
pages 488–92
The pituitary gland is an endocrine gland about the size of a pea, attached to the base of the brain and just for more
above the roof of the mouth. Referred to as the master gland, it secretes hormones that stimulate or inhibit information on
hormones.
other endocrine glands, regulating the release of their hormones for growth, metabolism and reproduction.
Hormones that specifically affect the growth or functioning of the reproductive organs or the
development of secondary sex characteristics are called sex hormones. They are produced in special
tissues in the ovaries and testes and in the pituitary gland and adrenal cortex. Hormones play a vital
role in all aspects of the development and functioning of the male and female reproductive systems.
The reproductive organs in mammals are present at birth, but only mature and begin their reproductive
function when stimulated by hormones secreted during puberty.
In humans, puberty generally occurs between age ten and fourteen in girls, and twelve to sixteen
in boys. The gonads (reproductive organs) become functional at puberty and the reproductive cycle
commences. Gametes are produced in the male and female gonads by a process known as gametogenesis.
Hormonal control of breeding seasons
Hormones regulate the sexual behaviour of mammals by limiting the ability of some mammals to
reproduce to certain times of the year, known as breeding seasons. Breeding cycles in these mammals
involve periods of female fertility being limited to once or twice a year. In these seasonal breeders (such
as sheep and cattle), mating occurs only during periods of female fertility, commonly referred to as the
animal being ‘on heat’ or ‘in season’. The biological term is that the animal is ‘in oestrus’.
9780170408851 CHAPTER 2 » SEXUAL AND ASEXUAL REPRODUCTION 61
02_bio_InFocus12_2e_sb_08851_txt.indd 61 08/08/18 6:30 pm
Higher order primates (including humans) and some other mammals (such as pigs, rats, mice and
rabbits) are called continuous breeders. Female fertility occurs in a cycle that repeats throughout the year
and, rather than having a breeding season, these animals are sexually active all year round.
There are advantages to both types of breeding cycle. The young of mammals that have a limited
Hormones in the breeding season are usually born when temperatures are warm and food is plentiful, increasing the
oestrus cycle chance of offspring surviving. The parents benefit from the reduced period of time during which mating,
gestation and raising of young takes place, a period during which their energy reserves become limited
and their vulnerability to predators increases. The obvious advantage to continuous breeders is the
ability to reproduce all year around.
In the discussion that follows, humans are used as an example to explain the reproductive cycle of
Detecting oestrus
in a farm animal
mammals. The oestrus cycle in seasonal breeders is similar in physiology and hormonal control, the
main difference being in the timing.
Hormones involved in mammalian reproduction
There are three types of sex hormones.
◗ Androgens (from the Greek andro meaning ‘male’) are commonly referred to as male hormones.
Androgens control the development and functioning of male sex organs and secondary sex
characteristics such as deepening of the male voice, increase in the growth and thickness of hair and
in the size of muscles and bones. Cells in the testes secrete the androgen testosterone, which plays a
A precursor molecule primary role in spermatogenesis (production of sperm).
is a chemical that Androgens are present in both males and females, and their production increases during
is transformed into
another compound. puberty in both sexes, but their levels are much higher in males. Androgens are precursors (margin
note) of oestrogens (a group of female hormones).
◗ Oestrogens (from the Greek word oistros meaning ‘mad desire’, referring to willingness of a female
to mate when she is at the fertile part of her cycle) are the main group of female hormones. They
control the development and functioning of the female reproductive system and secondary sex
characteristics, such as enlarged breasts, pubic hair and widening of the hips.
Oestrogens are present in both males and females, but occur in much higher levels in females
of reproductive age. In males, together with testosterone, oestrogens play a role in the maturation of
sperm. Oestrogens are responsible for the onset of oestrus (in heat) just before ovulation in female
mammals that are seasonal breeders. The main function of oestrogens in mammalian reproduction
is ovarian functioning and therefore fertility in females.
◗ Progestogens, a second group of female hormones, have been named from the words pro (one) and
gestare (latin for ‘to carry about’, as in gestation). Progesterone is the most common progestogen and it
plays a primary role in pregnancy. It also stimulates the secretion of milk in mammary glands (lactation)
and a drop in its levels plays a role in initiating menstruation.
Using current biotechnology, female hormones can be artificially manufactured and used either as
a form of contraception to prevent pregnancy, or to increase fertility and help women become pregnant.
For example, progestin is the synthetically produced version of the hormone progesterone. Oestrogens
and progesterone may be used in combination or individually. Oestrogens and progestogens may also
be used in:
– hormone replacement therapy for women during menopause (if required)
– the treatment of prostate cancer and some forms of breast and endometrial cancers.
Hormonal control of the female reproductive cycle
Endocrine glands regulate and control the ovarian and menstrual cycles in a coordinated manner
(Fig. 2.33), synchronising these cycles to ensure fertility. The result is an increase in the probability of
successful reproduction, biological fitness and, therefore, the continuity of the species.
62 MODULE FIVE » HEREDITY 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 62 08/08/18 6:30 pm
Hypothalamus FIGURE 2.33
Hormone production
(–) and action in the
female reproductive
1 GnRH system
stimulates 6 Increase in
anterior lobe progesterone, FHS = follicle-
(–) oestrogen in stimulating hormone
cells to secrete
FSH and LH blood inhibits LH = luteinising
Pituitary hormone
3 Blood level FSH, LH
of oestrogens secretion GnRH = gonadotrophic-
rises, stimulating during last releasing hormone
a surge in phase of cycle
LH secretion LH
FSH
LH
4 Mid-cycle surge
of LH triggers
ovulation, then
formation of
corpus luteum
Uterus
Progesterone
Oestrogen
2 In ovary, FSH and LH 5 Progesterone
promote follicle growth and (and small amounts
oocyte maturation, of oestrogen) secreted
oestrogen production, by corpus luteum
priming the endometrium maintain the
and initiating other endometrium if
reproductive events pregnancy occurs
In humans, the pituitary gland secretes a number of hormones that regulate other endocrine glands,
including the ovaries of females. Hormones of the pituitary and gonads are therefore the key players in
regulating reproductive cycles in mammals. Revise female
Oestrogen and progesterone, produced by the ovaries and controlled by hormones of the pituitary, reproductive
hormones and
regulate the: their functions
◗ ovarian cycle by controlling the production and maturation of gametes (ova) in the ovaries
◗ menstrual cycle by preparing the uterus for implantation of a fertilised egg each cycle; if fertilisation
does not take place, the levels of oestrogen and progesterone decrease and, as a result, the lining of
the uterus tears away, accompanied by bleeding, known as menstruation
◗ maintenance of pregnancy
◗ preparation for and maintenance of lactation.
The pituitary secretes two gonadotropic hormones:
◗ follicle stimulating hormone (FSH), which is important for stimulating maturation of follicles in the
ovaries of females
◗ luteinising hormone (LH), which promotes final maturation of the ovarian follicle, ovulation and
development of the corpus luteum in females. It also stimulates the secretion of testosterone.
In addition to gonadotropic hormones, the pituitary gland secretes a lactogenic hormone called prolactin
in females. This acts on breast tissue to prepare for and maintain milk production to suckle the young.
The interaction of the pituitary gland with the ovaries and testes is synchronised by feedback loops,
which you will learn more about in Chapter 14.
9780170408851 CHAPTER 2 » SEXUAL AND ASEXUAL REPRODUCTION 63
02_bio_InFocus12_2e_sb_08851_txt.indd 63 08/08/18 6:30 pm
The balance in the levels of sex hormones in the body at any point in time determines the fertility of
a female and whether she can conceive a child.
The ovarian cycle
Female babies are born with all the eggs (ova) that they will produce during their lifetime, but these ova
are immature and have partly developed in their ovaries. During puberty, the ovarian and menstrual
cycles begin (referred to as menarche). The ova in the ovaries become surrounded by a single layer of
cells that envelop them and begin to divide, resulting in the formation of primary (dormant) follicles
in the ovary (Fig 2.34). Hormones that are secreted during puberty (and for approximately the next
36–40 years) trigger the development and maturation of ova each month (except during periods
of pregnancy), until menopause is reached. At the start of each monthly cycle, a few follicles begin to
develop, but usually only one enlarges more than the others to reach maturity (Fig. 2.34). In humans, the
cycle repeats approximately every 28 days, although this varies from one female to another.
FIGURE 2.34 Corpus Fully formed
Diagrammatic luteum corpus luteum
representation of
Ovum forming
the ovarian cycle,
including ovulation
Ovulation
Corpus
Ruptured
albicans
follicle
Blood
vessels
Mature
ovarian
follicle
(Graafian
follicle) Ovarian Dormant
follicle follicle
approaching (primary
Developing
maturity follicle)
follicles
The follicular phase
The follicle cells secrete fluid, which pushes the egg to one side of the follicle. The enlarged, dominant
follicle moves to the surface of the ovary and creates a bulge. It is now mature and termed a Graafian
follicle. The development from primary follicle to Graafian follicle takes approximately 10–14 days.
During this follicular phase, the cells lining the follicle secrete oestradiol (an oestrogen hormone).
This causes a surge in the production of LH, which results in ovulation. The LH surge also stimulates the
next phase of the ovarian cycle, during which the corpus luteum forms and progesterone is synthesised.
The Graafian follicle bursts, releasing the egg – a process known as ovulation. The funnel-shaped,
open ends of the uterine tubes contain cilia that beat, drawing the egg into the tube. The egg (with some
follicle cells still clinging to it) moves down the tube towards the uterus. If sperm are present, fertilisation
may occur (page 67). Ovulation usually occurs mid-cycle (Table 2.6, page 66). Once released, the female
ovum is only viable for 12–24 hours.
The luteinising phase
The luteinising phase is usually 14 days. It begins after ovulation, when the burst follicle in the ovary
enlarges and changes colour, building up a yellow protein called lutein. The large mass of vacuolated
cells is now called the corpus luteum (Latin for ‘yellow body’). The corpus luteum secretes the hormone
progesterone, which acts on the uterus, preparing it for pregnancy.
64 MODULE FIVE » HEREDITY 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 64 08/08/18 6:30 pm
The menstrual cycle
The cycle of changes in the ovaries is accompanied by a cycle of changes in the uterus, known as
the menstrual cycle (Fig. 2.35). An average menstrual cycle repeats every 28 days, but there can be
considerable variation in the actual length of the cycle.
Ovarian phases Follicular phase Ovulation Luteal phase FIGURE 2.35
Hormonal control
of the ovarian and
menstrual cycles
Days 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28
Uterine phases Menses Pre-ovulation Secretion Pre-menstruation
Hormone level
LH
FSH
Oestrogen
Progesterone
Ovarian cycle
Primary Secondary Vesicular Ovulation Corpus luteum Regression Corpus
follicle follicle follicle forms albicans
Uterine cycle – lining of the uterus
Menstrual phase Proliferative phase Secretory phase
Uterine cycle
Menstrual flow
Functional layer
Basal layer
1 3 5 7 9 11 13 15 17 19 21 23 25 27 1
The menstrual cycle starts with menses (the menstrual period), which lasts about four days. During
this time, the endometrium (lining of the uterus) breaks down and tears away. This is accompanied by
bleeding, which is known as menstruation. The first day of menses marks the beginning of the follicular
Ovarian and
phase, which ends on the day of ovulation (Table 2.6). menstrual cycle
Following menstruation, a new endometrial lining forms in the uterus over about 5–12 days,
known as the pre-ovulation phase. Ovulation takes place in an ovary about 13–15 days after the start of
menstruation, but this timing varies from person to person.
After ovulation, the corpus luteum, which is enlarging within the ovary, secretes the hormone
progesterone, as well as some oestrogen, into the bloodstream. Progesterone acts on target cells in
the uterus, preparing the endometrium for implantation of the fertilised ovum and pregnancy. The
endometrium becomes highly vascularised, reaching a peak eight or nine days after ovulation (secretory
phase), around the time of expected implantation. The endometrium has glands that secrete a watery
mucus in this phase.
9780170408851 CHAPTER 2 » SEXUAL AND ASEXUAL REPRODUCTION 65
02_bio_InFocus12_2e_sb_08851_txt.indd 65 08/08/18 6:30 pm
If a fertilised ovum implants in the uterus, pregnancy results and the uterine wall is maintained by the
secretion of progesterone and oestrogen. These are produced by the corpus luteum at first and later by
the placenta. During pregnancy, a placenta forms, attaching the developing embryo to the uterine wall.
The placenta secretes hormones including progesterone, oestrogen and human chorionic gonadotropin
(HCG) to maintain pregnancy. Once the placenta is able to secrete these hormones, the corpus luteum
in the ovary begins to degenerate.
TABLE 2.6 Stages in the ovarian and menstrual cycles
STAGE TIME SPAN* (DAYS) EVENTS
Hormonal control Menstruation 1–4 Uterine bleeding, accompanied by shedding of the endometrium
of the menstrual
cycle
Pre-ovulation 5–12 Endometrial repair begins; development of ovarian follicle; uterine
lining gradually thickens
Ovulation 13–15 Rupture of mature follicle, releasing egg
Secretion 16–20 Secretion of watery mucus by glands of endometrium, cervix and
uterine tubes; movement and breakdown of unfertilised egg;
development of corpus luteum
Pre-menstruation 21–28 Degeneration of corpus luteum; deterioration of endometrium
*Time spans are average, but vary widely between women.
Hormonal control of the male reproductive cycle
The production of sperm, or spermatogenesis, is controlled by hormones. In humans, spermatogenesis
involves the interaction of three glands: the hypothalamus in the brain, the pituitary gland at the base of
the brain and the Leydig cells in the testes. In males, LH stimulates the production of testosterone and
FSH stimulates the production of a protein by Sertoli cells in the testes, to maintain testosterone at a level
high enough to promote spermatogenesis. When the hormone inhibin is secreted, it reduces the levels of
FSH in the body (Fig. 2.36).
FIGURE 2.36 Brain
Hormonal control of
sperm production: Hypothalamus
LH and FSH from the
pituitary stimulate GnRH
spermatogenesis and
testosterone secretion
by the testes. Pituitary
Testosterone inhibits
the secretion of GnRH
by the hypothalamus, 1 1 2
and testosterone
and inhibin from the LH FSH Inhibin
testes inhibit the Testes
secretion of LH and 2 2
FSH by the pituitary. Sertoli cells
(facilitate spermatogenesis) Testosterone
1 Stimulates
2 Inhibits Leydig cells
66 MODULE FIVE » HEREDITY 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 66 08/08/18 6:30 pm
Sperm production in the male
Sperm are produced by meiosis inside sperm tubules in the testes, and are stored until they are mature.
Each sperm is microscopic and shaped like a tadpole, with an enlarged head that contains the haploid
nucleus and a long tail that whips from side to side to enable the sperm to move. During copulation,
semen containing sperm is introduced into the vagina of the female, and must undertake an epic race
to reach the egg cell. Although half a million sperm may begin the journey, only a few hundred to a few
thousand will reach the ovum. (See the image on page 33.) Contractions of the vaginal wall assist the
movement of sperm. The whipping action of the tail of the sperm is thought to keep the sperm afloat
in the semen and assist the sperm in penetrating the egg. Sperm can survive in the female reproductive
tract for a couple of days.
Fertilisation
Sperm are attracted to the egg by rheotaxis – movement through a fluid – for internal fertilisation.
Oviducts secrete a fluid that travels down the female reproductive tract, and sperm swim upstream
(positive rheotaxis). Sperm that reach the oviduct are held in storage and are released in small batches.
The presence of progesterone and an alkaline pH cause sperm to mature so that they can penetrate the
egg. These sperm become hypermobile and their tails beat strongly to propel them towards the egg.
When sperm reach the egg cell, they must cross three layers. They physically push through the first
membrane (Fig. 2.37), which still has follicle cells attached. These protective cells release enzymes to WS
assist penetration by the sperm. When the acrosome (protective cap) of a sperm comes into contact
What are the social
with glycoproteins of the next barrier, the zona pellucida, the acrosome fuses with the cell membrane and ethical implications
of applying IVF
of the sperm head, allowing the tip of the sperm to release enzymes that assist its penetration. Many technology?
sperm may reach the cell membrane (plasma membrane), which is the last barrier. Surface proteins
allow only one sperm to penetrate this barrier, triggering the release of enzymes by the egg that destroy
the glycoproteins in the zona pellucida and cause electrical changes, preventing other sperm from
entering. The first sperm to penetrate this inner barrier causes the ovum to immediately undergo its
second meiotic division.
FIGURE 2.37
Oocyte cytoplasm Acrosome reaction
during fertilisation.
Cell membrane Acrosome A single sperm
Sperm succeeds in
Sperm receptors in burrowing through
nucleus
cell membrane the corona radiata
Zona pellucida and zona pellucida
and making contact
Corona radiata with the oocyte’s
cell membrane.
The sperm’s cell
membrane fuses with
that of the oocyte and
the sperm releases
its nucleus into the
cytoplasm of the
oocyte.
Fertilisation occurs when the haploid nucleus of the egg fuses with that of the sperm, forming a diploid See Chapter 4,
fertilised egg, called the zygote. At this stage, most epigenetic markers from the parents are ‘wiped’ off the pages 131–2
for information
DNA, so all genes are switched on – how this occurs is an area of current research. Following fertilisation, on epigenetic
the egg divides as it travels along the oviduct and begins developing into an embryo. markers.
9780170408851 CHAPTER 2 » SEXUAL AND ASEXUAL REPRODUCTION 67
02_bio_InFocus12_2e_sb_08851_txt.indd 67 08/08/18 6:30 pm
Hormonal control of pregnancy and birth
When the embryo implants into the uterine wall, this marks the beginning of pregnancy.
Once the embryo implants, the corpus luteum in the ovary continues to grow and secrete hormones
for the first three months of pregnancy. In the latter six months of pregnancy, the corpus luteum shrinks
and degenerates slowly (although it is still present in its degenerate form at childbirth). The placenta
Structure and
function of the takes over the role of producing hormones to maintain pregnancy. Following pregnancy, the ovarian
placenta and
secretion of
cycle usually only resumes once the mother stops breastfeeding the baby.
hormones If the egg is not fertilised, the corpus luteum begins to degenerate about 8–10 days after ovulation,
forming a mass of fibrous tissue known as the corpus albicans. An unfertilised egg degenerates
during the phase known as pre-menstruation, after which
menstruation occurs and the ovarian cycle begins again.
Getty Images/iStock/Leptospira
The environment in which the baby develops (Fig. 2.38) is
rigorously controlled by hormones and is important not only
for the growth and development of the foetus to birth, but
also for its long-term health.
Hormones that maintain pregnancy are secreted by the
pituitary gland and ovaries of the mother at first, but once
the placenta is established it begins secreting hormones
too (Fig. 2.39).
The levels of oestrogen and progesterone are optimised
FIGURE 2.38 Baby developing in utero (note the umbilical cord and
placenta) during the ovulation cycle to create ideal conditions for
implantation. Oestrogen promotes the growth of the
endometrium (lining) of the uterus and progesterone
stimulates the secretion of mucus by the cells lining the
Pituitary endometrium and the growth of blood vessels. Once
implantation has occurred, the main role of progesterone
+
becomes that of suppressing uterine activity, thereby
supporting foetal development and reducing the risk of the
Oxytocin foetus being disturbed or expelled by uterine contractions.
Progesterone also reduces the mother’s immune response
Positive feedback
Prolactin to foetal antigens. Adequate progesterone production by
the corpus luteum is essential in maintaining the pregnancy
until the placenta takes over this function at around seven to
nine gestational weeks.
Breasts Other hormones are also important in maintaining
produce milk
pregnancy and ensuring the normal development and
growth of the baby. Some hormones prevent foetal
overgrowth and others inhibit overgrowth at various stages
Oxytocin of pregnancy, mainly by regulating the amount and types
of nutrients that cross the placenta. Table 2.7 outlines the
hormones that coordinate foetal development and maintain
Uterine pregnancy.
contractions
(labour)
The placenta is a large disc of tissue formed of both
maternal and foetal tissue (Fig 2.40). Each side produces
OT
PG finger-like extensions, called villi – extensions from the
+ uterine wall of the mother form some villi, which interlace
Placenta produces with extensions from the chorion membrane surrounding
prostagladins
the foetus (chorionic villi). The placenta, embedded in the
FIGURE 2.39 Hormone secretion during pregnancy. OT: oxytocin, PG: uterine wall, is connected to the foetus by an umbilical cord,
prostaglandins
which carries blood vessels to and from the baby. The role
68 MODULE FIVE » HEREDITY 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 68 08/08/18 6:30 pm
of the placenta is to transport oxygen and nutrients from mother to foetus and to remove wastes such
as carbon dioxide and urea from the foetus and pass them to the mother for excretion. These gases,
nutrients and wastes diffuse across the narrow space between the villi. The mother’s and baby’s blood do
not come into direct contact.
FIGURE 2.40
Science Photo Library/Asklepios Medical Atlas
Border of placenta
Placenta showing
maternal and
embryonic tissues and
Path followed by blood supply
maternal blood
through the
intervillous spaces
Chorionic membrane
Umbilical artery
Umbilical artery Mother’s
circulation
Umbilical vein
Foetal
circulation
inside villosities
Tree of villosities
Chorion Placenta Myometrium
TABLE 2.7 The role of hormones in pregnancy and foetal development
ACTIVE PERIOD DURING
HORMONE SECRETED BY PREGNANCY EFFECT ON PREGNANCY EFFECT ON FOETAL DEVELOPMENT
Maternal Mother’s thyroid From 12 gestational Low levels increase the Low levels result in low birth
thyroxin gland weeks risk of detachment of the weight and immature lungs
placenta and pregnancy loss
Insulin Foetal pancreas From 10 gestational No effect Promotes foetal growth,
(mother’s insulin weeks allowing glucose to become
does not cross the available for tissue growth and
placenta) fat deposition
Human Developing embryo First trimester of Maintains the corpus No effect
chorionic pregnancy. Note: luteum, which in turn helps
gonadotropin pregnancy tests maintain the endometrium
(hCG) measure the presence
of this hormone to
confirm a pregnancy
Insulin-like Uterine wall of No effect IGF I: alters placental Promotes growth of foetal tissue
growth factors mother transport of nutrients,
(IGF) matching this to foetal
demand
IGF II: stimulates growth of
the placenta
Glucocorticoids Foetus Increase during third Alcohol intake by the mother Limits foetal growth;
(cortisol and trimester during pregnancy stimulates promotes and coordinates the
cortisone) Elevated if mother glucocorticoid secretion, specialisation and development
becomes stressed or which leads to low birth of foetal tissues and organs (e.g.
anxious weight and affects organ brain, heart and lungs)
development
9780170408851 CHAPTER 2 » SEXUAL AND ASEXUAL REPRODUCTION 69
02_bio_InFocus12_2e_sb_08851_txt.indd 69 08/08/18 6:30 pm
Birth
Two things must happen for the baby to be born.
◗ The muscles in the uterus must contract to expel the baby.
Hormonal ◗ The tissue of the cervix must soften so that the cervix can dilate (widen) to allow the passage of the
regulation of baby.
labour and birth
What triggers the process of childbirth is largely unknown. Prostaglandins secreted by the wall of the
uterus initiate labour. They act by making the tissue in the uterus more sensitive to another hormone,
oxytocin.
Oxytocin promotes coordinated contraction of the smooth muscle of the uterus and softening
(ripening) of the cervix, so that the baby can be born. The hormone relaxin is also produced and this
further aids the softening of the cervix.
Progesterone and oestrogen levels decline during labour and contractions become stronger.
As the contractions increase in intensity, beta-endorphin hormones are released. These act as a
natural form of pain relief and also promote feelings of elation. Very close to the birth, a surge of adrenaline
is released by the mother’s body and this causes some very strong contractions that lead to the birth.
After the birth of the baby, oxytocin secretions continue for a while, causing the uterus to contract
and expel the placenta (sometimes referred to as the ‘afterbirth’). The contractions also limit blood flow
to the uterus, reducing the risk of the mother bleeding.
Prolactin is a hormone produced mainly in the pituitary gland (but at times also in the uterus and
breasts). It stimulates milk production in the breasts (Fig. 2.39). Levels of prolactin begin to rise during the
second trimester of pregnancy and this causes enlargement of the mammary glands for milk production.
Prolactin and oxytocin release are further stimulated by suckling of the baby. Prolactin and oxytocin are
also thought to play an important role in maternal behaviour and bonding.
KEY CONCEPTS
● Sperm are attracted to the egg by (positive) rheotaxis – movement (upstream) through a fluid.
● Fertilisation occurs when the haploid nucleus of the egg fuses with that of the sperm, forming a
diploid fertilised egg called the zygote.
● Oestrogen and progesterone levels are optimised during the ovulation cycle to create ideal
circumstances in the uterus for implantation.
● When the embryo implants into the uterine wall, pregnancy occurs. Pregnancy is controlled by
the secretion of progesterone by the corpus luteum in the first three months and later by the
placenta.
● The hormone oxytocin promotes coordinated contraction of the smooth muscle of the uterus
during labour, resulting in the birth of the baby.
CHECK YOUR 1 Describe the formation of an egg cell (ovum) and its maturation.
UNDERSTANDING
2 What is a Graaffian follicle and what does it become once it has ruptured?
2.3 3 If fertilisation does not occur, what happens to the:
a Graaffian follicle
b ovum
c endometrium?
4 What is menstruation and when does this take place in the menstrual cycle?
5 Draw a labelled diagram to show the structure of a mature sperm cell.
6 Create a flow chart to represent the steps that occur during fertilisation.
70 MODULE FIVE » HEREDITY 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 70 08/08/18 6:31 pm
7 The flow chart and graph shown in figures 2.41 and 2.42 summarise hormonal control of fertilisation, implantation
and pregnancy in humans. The graph (Fig. 2.42) represents hormone levels in females at various points in WS
the menstrual cycle. Analyse information from the flow chart and the graph to complete the accompanying
Hormonal control
worksheet on hormonal control of reproduction. of reproduction
Pituitary gland
Secretes FSH Stops secreting FSH Secretes FSH Stops secreting FSH
1 2 3
Ovaries
An egg Ovaries secrete An egg is 4 Ovaries secrete
matures oestrogen released progesterone
2 8
Preparation of lining to receive 5
Uterus
egg when it is released
Maintenance of lining of uterus
6 7
Fertilisation No fertilisation Oestrogen and
Pregnancy maintained Lining of uterus comes away and progesterone
bleeding occurs (menstruation) levels drop
FIGURE 2.41 Hormonal control of reproduction in females
Amount of hormone
Hormone A Hormone B
Menstruation Ovulation
0 2 4 6 8 10 12 14 16 18 20 22 24 26 28
Menstrual cycle: time in days
FIGURE 2.42 Hormone levels at different stages of the menstrual cycle
8 Using Figure 2.39 and the text on pages 68–9 as a starting point, create a flow chart depicting the control
of pregnancy and lactation. You may need to add more arrows to the diagram and you will need to provide
labels and annotations. Number the annotations to show the cyclical flow of hormone secretion in the
order in which it occurs.
9780170408851 CHAPTER 2 » SEXUAL AND ASEXUAL REPRODUCTION 71
02_bio_InFocus12_2e_sb_08851_txt.indd 71 08/08/18 6:31 pm
Manipulation of reproduction
2.4 in agriculture
Agriculture is the cultivation and breeding of animals, plants and fungi for food, biofuels, fibre, timber
and other products used to sustain and enhance human life. It includes both crop and livestock farming,
forestry and fisheries and their products, to meet a wide range of human needs such as clothing,
medicines, tools, furniture, artistic display and economic gain or profit.
Humans have been manipulating plant and animal reproduction for many hundreds of years. The
techniques of manipulation have become more sophisticated as scientific knowledge of reproductive
processes has advanced. The purpose of this human intervention is to improve the quality and yield
of food. The term reproductive technology applies to any use of technology to assist and improve
reproduction.
INVESTIGATION 2.3
IVF is dealt
with in Chapter 9,
A secondary source investigation of scientific knowledge and its
together with application to reproductive technologies in agriculture
other reproductive
technologies.
BACKGROUND
WS
Reproductive technologies range from those that manipulate fertilisation (such as artificial insemination, IVF, artificial
pollination) to those that split up embryonic stem cells and involve embryo implantation (including embryo
Human embryonic splitting and cloning, as well as embryo sexing and selection). Reproductive technology depends on scientific
stem cell debate knowledge and an understanding of the reproduction process, such as control of seasonal breeding, hormonal
regulation of ovulation and the oestrous cycle (Fig. 2.43), pregnancy and embryonic development.
FIGURE 2.43
Shutterstock.com/Nature Art
The role of hormones 1
and minerals in
FSH & LH produced by Hormone
controlling the anterior pituitary travel system
oestrous cycle of a through the blood to Hypothalamus
cow Corpus luteum produces ovaries (Ca, Cu, Zn)
progesterone (Mg, Mn)
CL
3 Before calving Blood flow
Ovaries
Uterus releases PGF2a
to cause regression of After calving Ca & Cu stimulate
the corpus luteum (Cu) hypothalamus to
produce GnRH,
2 which signals the
Udder pituitary to release
K stimulates ovaries
LH & FSH
to produce oestrogen
(Cu, K, Mg, Zn) Blood flow heavy after calving
72 MODULE FIVE » HEREDITY 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 72 08/08/18 6:31 pm
The use of such technologies raises concerns about ethical issues such as stress on animals as well as
Ethical issues
environmental stress. The aim is to reduce these concerns while optimising the benefit for both farmers and related to
consumers. reproductive
technologies
AIMS are dealt with in
more detail in
1 To investigate the reproductive techniques that have been implemented in agriculture as a result of Chapter 8.
advances in knowledge about reproduction in plants and animals Reproductive
2 To analyse three techniques used to manipulate reproduction of plants and animals in agriculture technologies
and their use in
3 To evaluate the impact of this knowledge, taking into account any advantages, disadvantages and ethical agriculture are
concerns that result from these techniques dealt with in
more detail in
Chapter 9.
METHOD
Using examples such as the diagram in Figure 2.43, your own research and the information in this chapter,
evaluate the impact of scientific knowledge on the manipulation of plant and animal reproduction in
agriculture, by finding out:
Ethical
• what scientific knowledge was needed to make possible the specific manipulations of plant or animal understanding
reproduction that are now in use
• the name of the reproductive technique that was developed using this knowledge, and when the Literacy
technique was introduced
• how reproduction is manipulated using this technique
• the impact of the scientific knowledge on the introduction of the technique. Include advantages,
disadvantages and ethical issues.
RESULTS
To present your results, copy and complete the table below.
HOW REPRODUCTION IS IMPACT OF KNOWLEDGE:
SCIENTIFIC REPRODUCTIVE MANIPULATED IN PLANTS ADVANTAGES AND/OR
KNOWLEDGE ABOUT TECHNIQUE (AND WHEN IT AND/OR ANIMALS USING DISADVANTAGES (OR ETHICAL
REPRODUCTION WAS INTRODUCED) THIS TECHNIQUE CONCERNS) OF THIS TECHNIQUE
EX TENSION
For students who wish to explore further, investigate the role of minerals in activating or promoting the action
of hormones. Some examples are shown in Figure 2.43.
CONCLUSION
Write a few sentences summarising your findings about the impact of scientific knowledge on the
manipulation of plant and animal reproduction in agriculture.
9780170408851 CHAPTER 2 » SEXUAL AND ASEXUAL REPRODUCTION 73
02_bio_InFocus12_2e_sb_08851_txt.indd 73 08/08/18 6:31 pm
2 CHAPTER SUMMARY
Sexual and asexual reproduction: How does reproduction ensure the continuity
of the species?
aa bb BUDDING
BINARY FISSION
Amoeba
Euglena
In bacteria (Listeria sp.) In protists (amoeba, euglena) In fungi (yeast) In animals (hydra)
Asexual reproduction: One
parent, genetically identical
offspring, well suited to
survive in their enviroment
Leaves
SPORES: PROPAGATION
Sporangia (n)
Bulb
Scale leaves
Sporangium
ruptures, Main bud store food
Spores
releasing
(n)
spores Axillary buds
Basal plate
(stem) give rise to
Stolon
Spore Roots new plants
germinates
Plant: Allium cepa
Hyphae Hyphae Tuber Rhizome Apomixes In plants (bulbs)
(rhizoids)
Hyphae (n)
In fungi (mould)
Sexual reproduction:
Two parents, offspring with genetic variability and
new gene combinations that increase chance of
survival in the face of sudden enviromental change
Mother’s Father’s Meiosis
chromosomes chromosomes
2n 5 46 2n 5 46
Anther
of Pollen
stamen grain
Meiosis Egg cell
(haploid)
Specialised cells in the ovaries Specialised cells in the testes
Male gametes Ovule
Stigma (haploid)
of Petal
gynoecium Sepal Fertilisation
Egg cells n 5 23 Sperm cells n 5 23 Flower
Fertilisation stalk
Embryo (diploid)
Leaf
Seed
Zygote (2n) 5 46
(fertilised egg cell) or
Seed is dispersed
Mitosis
Mitosis
Each cell
Stem
Embryo
is 2n 5 46
chromosomes
Germination
of diploid
embryo
Female child Male child Meiosis and fertilisation in flowering plants
74 MODULE FIVE » HEREDITY 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 74 08/08/18 6:32 pm
Strategies for reproductive success:
mechanisms to bring male and female
cells together
Pollination in flowering plants External and internal fertilisations in animals
Large number
of gametes
mature and
are released
together
External fertilisation in coral
Smaller
number of
gametes
assured of
meeting;
energy
expended in
finding a mate
Pollination in flowering plants Internal fertilisation in reptiles
Hormonal control of the female reproductive Manipulation of reproduction
cycle and maintenance of pregnancy and birth in agriculture
1
Oestrogen and Pituitary
FSH & LH produced by Hormone
anterior pituitary travel system
progesterone + through the blood to Hypothalamus
Corpus luteum produces
levels regulate progesterone (Mg, Mn)
ovaries (Ca, Cu, Zn)
ovarian and Oxytocin
CL
menstrual cycles 3 Before calving Blood flow
Positive feedback
Ovaries
and create ideal Prolactin
Uterus releases PGF2a
conditions to cause regression of After calving Ca & Cu stimulate
for ovulation, the corpus luteum (Cu) hypothalamus to
Breasts produce GnRH,
implantation produce milk 2 which signals the
Udder pituitary to release
and maintaining K stimulates ovaries
LH & FSH
to produce oestrogen
pregnancy. (Cu, K, Mg, Zn) Blood flow heavy after calving
Oxytocin is Oxytocin
released to
Uterine
stimulate uterine contractions
Scientific knowledge including understanding of seasonal
contractions and (labour)
OT breeding, hormonal regulation of ovulation and the oestrus
birth. PG
+
cycle, pregnancy and embryonic development is necessary
Placenta produces
prostagladins
for manipulation of reproduction in agriculture.
9780170408851 CHAPTER 2 » SEXUAL AND ASEXUAL REPRODUCTION 75
02_bio_InFocus12_2e_sb_08851_txt.indd 75 08/08/18 6:33 pm
2 CHAPTER REVIEW QUESTIONS Qz
Review quiz
1 Distinguish between the following terms: 13 Using words and arrows, construct a flow chart to show
a sexual and asexual reproduction each step in the process of sexual reproduction in a
flowering plant.
b gamete and zygote
c eutherians, marsupials and monotremes 14 In a table, compare reproduction by means of spores in
ferns and seeds in flowering plants.
d fertilisation and pollination
e seed dispersal and seed germination 15 Use a Venn diagram to compare wind, bird and insect
pollination in flowering plants.
f budding and binary fission.
16 Analyse asexual reproductive mechanisms in plants, fungi
2 Using the examples of coral and amphibians, explain
and protists, and explain how these mechanisms ensure
mechanisms that ensure male and female gametes can
continuity of the species.
find each other when they are released, so that fertilisation
can take place. 17 Distinguish between the terms:
3 Explain why internal and external fertilisation are each a seasonal breeders and continuous breeders
suited to a particular type of environment. b gonads and gametes
4 Using a table, compare the advantages and disadvantages c ovulation and menstruation
of internal and external fertilisation. d progestogen and progesterone.
5 Explain how the relationship between the number of 18 Explain why offspring produced by asexual reproduction
gametes produced and the type of fertilisation ensures are similar to their parents, whereas offspring produced by
continuity of the species. sexual reproduction differ from their parents.
6 Using a Venn diagram, compare the processes of sexual 19 Why does DNA need to replicate before cell division?
and asexual reproduction.
20 Describe the journey of a human ovum from the ovary to
7 What is a hermaphrodite? Using an example, give one when it is fertilised.
advantage and one disadvantage of hermaphroditism in
21 Use words and arrows to describe the journey of a sperm
ensuring the continuity of species.
until it reaches the ovum.
8 Construct a table to compare oviparous, viviparous and
22 Draw a diagram of a sperm and an egg at the exact
ovo-viviparous development, using examples.
point in time that fertilisation occurs. Nuclear detail
9 Describe two reproductive mechanisms in Australian is important.
animals to ensure the survival of the embryo.
23 Describe the hormonal control of gamete production and
10 Use examples to illustrate vegetative propagation of roots, fertilisation.
stems and leaves as forms of asexual reproduction in plants.
24 Explain why, during the reproductive cycle, ovulation
11 Draw a sequence of diagrams to show: cannot occur in a pregnant female.
a binary fission in bacteria 25 Name two hormones secreted by:
b budding in fungi a the pituitary gland, that act on the ovary in human
c binary fission and budding in protists reproduction, and describe their action
d spore production in bread mould. b the ovary, that act on the uterus of a female during
sexual reproduction.
12 Draw a scientific diagram of a longitudinal section through
a flower and label the male and female reproductive parts. 26 Create a flow chart to model the hormonal control of
a Write the function of each part next to the label. pregnancy in human reproduction.
b Draw arrows on the diagram to show how self-pollination 27 Referring to the graphs in Figure 2.35, explain the
occurs. relationship between FSH, LH, oestrogen and
c Explain how self-pollination may reduce the chances of progesterone in:
the continuity of species under some conditions, but a bringing about ovulation
increase the chances under other conditions. b bringing about menstruation.
76 CHAPTER FIVE
MODULE 11 » »CHEMISTRY
HEREDITY 9780170408851
02_bio_InFocus12_2e_sb_08851_txt.indd 76 08/08/18 6:33 pm
28 Explain the mechanisms in human reproduction that b the biological process of birth, including an
ensure: explanation of hormonal regulation
a sperm find the egg cell c the time of the month when a female is most fertile
b only one sperm fuses with the egg. and ovulating, including an explanation of hormonal
levels
29 Construct a table to summarise the hormones involved in
d the conditions necessary for implantation of an
the control of pregnancy and birth, and the functions of
embryo and maintenance of pregnancy in a female,
these hormones.
including the influence of hormone levels
30 Create a brochure for a healthcare facility to explain two of e the conditions necessary for healthy sperm production
the following: in a male, including an explanation of hormonal levels.
a the role of the placenta in supporting foetal
31 Using examples, explain why farmers rely on vegetative
development. Explain the necessity for correct
propagation as a form of asexual reproduction in plants.
hormone levels
9780170408851 CHAPTER 2 » SEXUAL AND ASEXUAL REPRODUCTION 77
02_bio_InFocus12_2e_sb_08851_txt.indd 77 08/08/18 6:33 pm
3 Cell replication
Students:
INQUIRY QUESTION • model the processes involved in cell replication, including but not limited to:
– mitosis and meiosis (ACSBL075) CCT ICT
How important is it for
– DNA replication using the Watson and Crick DNA model, including nucleotide composition, pairing and
genetic material to be bonding (ACSBL076, ACSBL077)
replicated exactly?
• assess the effect of the cell replication processes on the continuity of species (ACSBL084) ICT
Biology Stage 6 Syllabus © NSW Education Standards Authority for and on behalf of the Crown in right of the State of New South Wales, 2017
Shutterstock.com/Spectral-Design
78 9780170408851
03_bio_InFocus12_2e_sb_08851_txt.indd 78 08/08/18 6:34 pm
Have you ever wondered why it is so
Nature Picture Library/Andrew Parkinson
important for genetic material to be
replicated exactly? Each living creature
has a different genetic code that carries
instructions for its own production. How
do the genetic instructions for wombats
differ from those for koalas, dogs, penguins
or even mushrooms? Parents give rise to
offspring of the same species, with a similar
genetic makeup to their own, so they can
survive in the same environment. It is
essential that organisms pass on their own FIGURE 3.1 Genetic instructions for a sheep differ from those of
unique genetic instructions or information a bird, grass or flowers.
from one generation to the next, to ensure
the continuity of the species.
How can something as tiny as a cell carry all the instructions needed to make a large, complex, living
organism? When scientists began searching for the ‘code of life’ in cells, they realised that the genetic
code would need to be in molecular form to be small enough to fit all the instructions into a cell. As
chromosomes are composed of DNA (deoxyribonucleic acid) and protein, scientists deduced that the
genetic code must be carried by one of these two macromolecules – either in proteins or in DNA.
It was expected that the genetic code would be complex, because it needs to store large amounts of
information accurately over long periods of time. The genetic code would also need to be copied exactly
and any errors that arose during copying would need to be easily fixed. Most scientists favoured protein
as the carrier of the genetic instructions, because proteins are complex and varied, being made up of at
least twenty different amino acids.
In 1953, James Watson and Francis Crick discovered the structure of DNA and how it held the ‘code
of life’. What surprised most biologists was that genetic information could be carried by a molecule that
uses an ‘alphabet’ made up of only four ‘letters’: the bases adenine (A), cytosine (C), guanine (G) and
thymine (T). In the decade following 1953, the combined work of many scientists led to an understanding
of how the information in DNA can lead to specific proteins being produced.
In this chapter, you will find out how Watson and Crick worked out the structure of DNA, as well as
when and how genetic material is replicated and why it is so important for replication to be exact.
3.1 Cell division – mitosis and meiosis
Why do cells need to divide? What mechanisms are in place for the faultless transmission of genetic
information from parent to daughter cells during division? When a cell divides, how does every daughter
cell get an exact copy of the genetic instructions? As you study the mechanisms of cell division, you will
discover how this is achieved.
There are two types of cell division: mitosis and meiosis.
In unicellular protist organisms, cell division by asexual binary fission is common – one organism
becomes two and no sex cells or gametes are involved. In multicellular organisms, cell division by mitosis
leads to the formation of two new identical cells that contribute to the growth of the organism.
Meiosis is a different type of cell division. It gives rise to gametes that transmit genetic material
from one generation to the next during sexual reproduction. Meiosis will be dealt with in more detail in
Chapter 5.
9780170408851 CHAPTER 3 » CELL REPLICATION 79
03_bio_InFocus12_2e_sb_08851_txt.indd 79 08/08/18 6:35 pm
The role and importance of mitosis
Mitosis plays an important role in:
◗ growth of multicellular organisms – from fertilised egg to embryo, from infant to adult, growth relies
on mitotic division followed by cell assimilation, enlargement and differentiation
◗ repair of damaged tissue and replacement of worn-out cells
◗ asexual reproduction – for example, growth of plants from cuttings, and the cloning of organisms
◗ genetic stability – mitosis ensures the precise and equal distribution of chromosomes to each daughter
nucleus, so that all resulting cells have the same chromosome number and genetic information as
each other and the original parent cell.
Most multicellular organisms start life as a single fertilised egg cell or zygote, which grows into an
See Chapter 4, embryo. Embryonic cells are able to divide repeatedly and are pluripotent (that is, they have the potential
page 129 for
information on to develop into any type of tissue) (Fig. 3.2). These cells are termed embryonic stem cells. You may have
stem cells and gene heard of these already, because the use of embryonic stem cells is a subject that often draws media
expression.
attention and discussion among people. This is because the use of these cells in therapeutic medicine
and for research involves the destruction of the embryo, a contentious issue. This will be dealt with in
greater detail in Chapter 8.
In mature organisms, not all cells continue to divide. As cells differentiate and specialise, they form
tissues, and some of these cells lose the ability to divide by mitosis. Dividing cells remain at particular
locations within the adult body; for example, dividing
2-cell stage 4-cell stage 64-cell stage cells in the basal layer of the skin replace dead
surface skin cells, and cells in bone marrow give rise
to blood cells. Adult stem cells occur in almost every
type of tissue but they are pre-specialised; for example,
brain stem cells can only make brain tissue and heart
stem cells can only make cardiac tissue. Cells in bone
marrow can give rise to all types of blood cells, and so
they are termed ‘multipotent’. These adult stem cells
Blastula can therefore not be used as widely in all types of tissue
regeneration as pluripotent embryonic cells. Researchers
are continuing to investigate how adult stem cells can
be made pluripotent, so they can be used in tissue
Cells have the and organ regeneration. Unfortunately, reversing pre-
potential to
become any
specialisation of cells in tissue culture tends to make
cell type. cells turn cancerous, so there is still much research to be
done in this area.
FIGURE 3.2 Early stages of mammalian embryonic development: mitotic In plants, tissue that can divide to form any other
division of pluripotent embryonic stem cells tissue is known as meristem and occurs at particular
locations in the plant, such as the tip of the stem and
the tip of the root.
The role and importance of meiosis
Refer to Chapter 2 Meiosis is the type of cell division that occurs in the sexual reproductive organs of a plant or animal, and
for information on results in the formation of gametes (sex cells).
asexual and sexual
reproduction, and During sexual reproduction, two parents are involved in passing genetic material to the offspring.
to Chapter 9 for To prevent the chromosome number from doubling in each successive generation, a mechanism must
information on
cloning. exist to ensure that each parent contributes only half of his or her chromosomes to the new offspring.
This mechanism is meiosis, a type of reduction division in cells in the reproductive organs of both plants
and animals. Meiosis ensures that the chromosome number of each species is maintained (not doubled)
during sexual reproduction (Fig. 3.3).
80 MODULE FIVE » HEREDITY 9780170408851
03_bio_InFocus12_2e_sb_08851_txt.indd 80 08/08/18 6:35 pm
FIGURE 3.3 Life
cycle of humans
showing the
importance of meiosis
Fusion to (formation of haploid
form zygote Zygote (2n) gametes) and mitosis
(n to 2n) (differentiation and
growth)
Egg (n) Sperm (n)
Juvenile (2n)
Meiosis
(2n to n)
Meiosis Mitosis
(2n to n) (differentiation
and growth)
Adults (2n)
Haploid stages
Diploid stages
When a cell divides by meiosis, DNA replicates before division. The cell then undergoes two
successive divisions:
◗ meoisis I, where the diploid cell divides into two haploid cells and the chromosome number is halved
◗ meiosis II, where the two cells each divide again, resulting in four haploid daughter cells (called
a tetrad).
Each daughter cell has half the original number of chromosomes that the parent cell had.
These resulting daughter cells, or gametes in plants and animals, are:
◗ egg cells (in ovaries) and sperm cells (in testes) in animals
◗ pollen grains (in anthers) and egg cells (in ovules) in seed-producing plants.
Gametes are often referred to as ‘vehicles of inheritance’ because they carry genes from one generation
to the next.
Meiosis is also the process by which genetic variation is introduced into a species. The process of
meiosis and its contribution to genetic variation is dealt with in detail in Chapter 5.
Cell division: why does DNA need to replicate exactly?
An organism’s genetic code contains instructions for every feature of the individual, from its
biochemistry, which allows it to function properly, to its physical features and body size. The genetic
code even holds instructions for how its own genes are expressed and therefore for how all biological
information in the organism is read, processed and converted (translated) from its coded form (DNA)
to its end product (protein).
When a cell divides into two, it is vital that the DNA passed on to each daughter cell is an exact
copy, so that each generation of cells contains the same genetic instructions. In unicellular organisms,
the genetic code passed from parent cells to offspring maintains the genetic stability of the species. In
multicellular organisms, all cells making up the body must contain the same genetic code so that they
can function in a controlled and coordinated way.
9780170408851 CHAPTER 3 » CELL REPLICATION 81
03_bio_InFocus12_2e_sb_08851_txt.indd 81 08/08/18 6:35 pm
Along the chromosome are long sequences of base pairs in specific regions of DNA that form units
called genes. Genes code for the production of proteins, which in turn make up a large proportion of the
structure of cells and also regulate the functioning of cells. For example, many body parts such as bones,
hair, skin, muscles and connective tissue contain proteins, which are coded for by genes. Some proteins
are enzymes (as you learned in Year 11), and these carry out and control all cell functions. Each step of
every biochemical reaction in cells, such as chemical respiration and photosynthesis, is controlled by
enzymes.
It is therefore vital for the functioning of cells and the stability of species that the genetic code is
passed on without error. During mitosis, DNA is replicated precisely and the copies of all genes are
divided up equally between the resulting cells. The cells are therefore clones of each other. In exploring
the process of mitosis, you will see how this happens in somatic (body) cells.
All cells need to make particular end-products and function in a coordinated manner. DNA codes for
proteins used inside the cell, as well as proteins such as hormones and enzymes that are exported and
coordinate functioning or direct protein synthesis in other cells. A change in DNA, known as a mutation,
may change the end product and, as a result, may have a harmful effect on the cell, by interfering with
its structure and/or functioning. Sometimes mutations have no effect, and occasionally they may be
beneficial. You will learn more about mutations and genetic variation in chapters 5 and 7.
KEY CONCEPTS
● Binary fission is cell division that occurs in prokaryotes for asexual reproduction.
● Mitosis is the nuclear division of eukaryotic cells for asexual reproduction (in unicellular
organisms and propagation in plants) and for growth and repair (in multicellular organisms).
● Meiosis is the nuclear division of eukaryotic cells for gamete formation in sexual reproduction.
● Many protists, plants and fungi can reproduce by mitosis (asexual reproduction).
● Mitosis in multicellular organisms is a mechanism for tissue growth, maintenance and repair.
● Meiosis is the type of cell division that occurs in the sexual reproductive organs of a plant
or animal and it results in the formation of gametes (sex cells) with the haploid number of
chromosomes. It also introduces genetic variation into a population.
● In 1953, James Watson and Francis Crick discovered and modelled the double-helical structure
of DNA.
● The sequence/order of the bases A, T, C and G in DNA holds information in a coded form.
● DNA replication is vital for the continuation of a species, as it allows an organism to reproduce
its genetic code and pass it on.
The cell cycle
Cell cycle
Play the animation Cell division and enlargement occur in a repetitive sequence called the cell cycle (Fig. 3.4). Mitosis is only
and do the quiz
to check your one part of this cycle and usually takes about an hour or two. A complete cell cycle in actively dividing
understanding.
cells may take about 18–22 hours. The cell spends a large amount of time preparing for division (a stage
called interphase, which precedes mitosis).
The cell cycle has four main phases.
◗ G1 is a gap phase for cell growth before DNA replication. During this phase, cell enlargement takes
Cell cycle game place. Metabolic changes prepare the cell for division and the cell reaches a point at which it is
committed to division, then enters the next phase.
◗ S is a synthesis phase during which DNA replicates – that is, the DNA in the cell is copied so that each
dividing cell has two identical copies at the start of mitosis. At the end of cell division, one full copy
Cell cycle
ends up in each resulting daughter cell.
animations ◗ G2 is a second gap phase after replication, when enzymes in the cell check the duplicated chromosomes
Watch the five short for any errors and correct these, and the cytoplasmic materials accumulate in preparation for division.
animations on the cell
cycle and cancer. ◗ Mitosis (division of the nucleus) then occurs, followed by cytokinesis (division of the cytoplasm).
Cytokinesis marks the separation of one cell into two.
82 MODULE FIVE » HEREDITY 9780170408851
03_bio_InFocus12_2e_sb_08851_txt.indd 82 08/08/18 6:35 pm
G0 FIGURE 3.4 The cell
Cell cycle stops cycle
G1 – cell growth
INT
Cellular contents,
ERP
excluding the
S – synthesis
HASE
chromosomes,
Each of the 46
are duplicated
chromosomes is
duplicated by the cell
Cytokinesis
Cytoplasm
divides
M – mitosis
Nucleus G2 – 9proof reading9
divides The cell checks the
duplicated chromosomes
for errors, making
any needed repairs
IT
M
O SI S
In actively dividing tissue, following cytokinesis, each cell will enter G1 again to repeat the cell cycle.
This begins with a period of assimilation and cell enlargement, where cells increase in size by assimilating
new materials into the cell boundaries and cytoplasm. This new material is made from the nutrients that Cell cycle
an organism acquires. For example, these nutrients are the end products of digestion in animal cells and revision
Explore in more
of photosynthesis in plant cells. detail the cell
Not all cells continue to go through cyclical divisions. The basal layers of cells that need to be replaced cycle and mitosis,
explained in
often, such as skin cells and cells lining the digestive tract, divide rapidly. Some adult cells do not divide diagrams and text.
frequently and others, such as nerve cells, may last a lifetime. These cells are said to be terminally
differentiated. They are in a phase called the G0 phase and only re-enter the cell cycle under special
circumstances.
Mitosis: division of the nucleus
Mitosis is the type of nuclear division that ensures that daughter cells receive the same number and
form (exact copies) of chromosomes as the parent cell. Therefore, before a parent cell can divide it must
make an accurate and complete replica of the genetic information encoded in its DNA. This needs to
be accurately and equally distributed to the resulting daughter cells. Mitosis is a gradual and continuous
process, but is usually described in four phases: prophase, metaphase, anaphase and telophase.
In order to understand the stages of mitosis, you need to be familiar with the following concepts:
◗ In a non-dividing cell, the DNA wound around protein is known as chromatin (Fig. 3.5).
◗ Chromosomes contain linear sequences of genes, the units of heredity that code for the inherited
characteristics of an organism; for example, there are genes on human chromosomes that determine
eye colour, hair colour and height.
9780170408851 CHAPTER 3 » CELL REPLICATION 83
03_bio_InFocus12_2e_sb_08851_txt.indd 83 08/08/18 6:35 pm
◗ Each organism has a set number of chromosomes ( for example, humans have 46 chromosomes, a
platypus has 52 and a lettuce has 18).
◗ During the S phase, chromosomes replicate and the two chromosome copies or chromatids are held
together by a structure called a centromere. These sister chromatids (Fig. 3.5) separate and move to
opposite poles during mitosis. They are now known as daughter chromosomes and are distributed
into two daughter nuclei. Following this, the cytoplasm divides, separating the two daughter nuclei
from each other (cytokinesis).
FIGURE 3.5
Structure of a
chromosome at the Sister Daughter
start of mitosis chromatids chromosomes
Centromere
Chromosomes
Supercoil within
chromosome
Chromatin fibre
Coiling within
supercoil
Chromatin
DNA
Central Nucleosome
histone
(protein)
Histone
(protein)
DNA DNA double helix (duplex)
Stages of mitosis
At the start of mitosis, DNA is so condensed or highly folded that the chromosomes are visible with a
light microscope.
Although mitosis is a continuous process, it is easier to understand if we divide it into identifiable stages.
There are four main stages of nuclear division in mitosis: following interphase (the S phase during which DNA
replication takes place) are prophase, metaphase, anaphase and telophase. The late stages of nuclear division
are accompanied by the start of cytokinesis. The process of cell division is summarised in Table 3.1. To keep
the diagrams simple, only two pairs of chromosomes (four chromosomes in total) are shown in each cell.
84 MODULE FIVE » HEREDITY 9780170408851
03_bio_InFocus12_2e_sb_08851_txt.indd 84 08/08/18 6:35 pm
TABLE 3.1 Mitosis in an animal cell
STAGE DESCRIPTION DIAGRAM
Interphase occurs in the S phase of the cell cycle, where DNA Cell
Nucleolus
Parent
synthesis occurs: DNA replicates (makes an identical copy of membrane cell
itself ). It appears diffuse and spread out and is termed ‘chromatin’.
Interphase/early
It is not yet recognisable as individual chromosomes.
prophase
In early prophase (seen in this image), DNA begins to separate
into chromosomes.
Nuclear
membrane Centrioles
Chromatid
G2, early prophase: DNA replication complete
In prophase, the chromatin material shortens and thickens by Sister Chromosome splits
longitudinally
coiling and the DNA separates out into chromosomes, which are chromatids
now visible with a light microscope.
Each chromosome contains two copies of the DNA.
Prophase
Each copy is called a sister chromatid and these are joined by
a single centromere.
Nuclear
The nuclear membrane begins to break down and is no longer membrane
breaks down
visible; a spindle begins to form from the broken-down material Spindle fibres
Centromere begin to form
and extends across the cells (like the imaginary lines of longitude
that are drawn on a globe of the world). Prophase: chromosomes condense, become visible and
spindle apparatus forms
In metaphase, the chromosomes line up across the centre or Spindle fibres
‘equator’ of the cell, each attached to the spindle fibres by a
centromere. Each chromosome consists of two identical sister
chromatids.
Metaphase
Mitosis
Centromere Chromatid
Metaphase: chromosomes align along the equator of the
cell
Anaphase begins when proteins in the centromere are cleaved, which Centromere
allows the sister chromatids to separate. Each chromatid becomes a
chromosome. The spindle fibres contract and the chromosomes are
pulled by their centromeres to opposite ends of the cell.
Anaphase
The spindle fibres contract and, as the sister chromatids
begin to separate, they are now known as daughter
chromosomes. They are pulled towards opposite poles of the cell
Spindle
and their movement is assisted by the centromere. fibres Daughter
contract chromosome
Anaphase: sister chromatids separate to opposite poles
of cell
The daughter chromosomes gather at opposite poles of the cell.
The spindle breaks down.
The nuclear membrane and nucleolus reappear.
Nucleolus
Nuclear division or mitosis is now complete. The result is
two nuclei with chromosomes identical to each other and to the
original nucleus in the parent cell.
Daughter
The nuclear membrane forms around the two nuclei, now
Telophase
nuclei
called daughter nuclei. Mitosis is now complete.
Nuclear
membrane
re-forms
Chromosome
Nucleolus
Telophase: nuclear membranes assemble around two nuclei
9780170408851 CHAPTER 3 » CELL REPLICATION 85
03_bio_InFocus12_2e_sb_08851_txt.indd 85 08/08/18 6:35 pm
STAGE DESCRIPTION DIAGRAM
Division of the cytoplasm occurs, separating
the two daughter nuclei so that each is in its
own cell.
Cytokinesis differs in plant and animal cells.
• Animal cells: the cytoplasm constricts in the
centre of the cell between the two daughter Cell Nuclei
nuclei, and ‘pinches off’ (similar to squeezing membrane
constricts
a round balloon in the centre until the edges Daughter
cells
meet and then giving it a twist to separate it
into two bubbles).
Cytokinesis in animal cells: division of cytoplasm into
two; G1, cell growth of daughter cells
Cytokinesis
• Plant cells: a cell plate forms while the Nucleus Cell plate Nucleus Chromatin
nucleus is still in telophase; thickenings forms material
appear on the spindle fibres in the region of
the equator and join up to form a cell plate
made of pectin compounds. Cellulose is
then deposited on either side, forming a cell Cell wall
wall to separate the two daughter nuclei.
Cytokinesis in plant cells
Mitosis poster
and video
Download or print
the poster of mitosis, Cytokinesis
Science Photo Library/Steve GSchmeissner
then scroll down and
watch the video clip of Cytokinesis is the final step in cell division (Table 3.1,
live plant cell mitosis
using time lapse
Fig. 3.6). It is the division of the cytoplasm and
photography. begins while the nucleus is completing its division.
Cytokinesis is important because it separates the
newly formed daughter nuclei and ensures that each
cell has only one nucleus. The outcome at the end of
Narrated video – mitosis and cytokinesis is two daughter cells with
mitosis chromosomes that are identical to each other and
Watch the video clip
of mitosis, presented to the original parent cell. The daughter cells then
diagrammatically. enlarge until they are the same size as the original
adult cell (during G1, assimilation as well as cell
enlargement occurs). The nucleus of each cell controls
FIGURE 3.6 Root tip cells undergoing mitosis and all cell activities. The ratio between the proportion
cytokinesis, showing mitotic stages (in order from top
Interactive left to bottom right) interphase, prophase, metaphase,
of nucleus and cytoplasm remains constant. If the
animation – anaphase, telophase and cytokinesis. Chromosomes cytoplasm exceeds a certain proportion of the cell,
mitosis have been stained with toluidine blue.
the ability of the nucleus to control its functioning
decreases and this may help trigger cell division.
86 MODULE FIVE » HEREDITY 9780170408851
03_bio_InFocus12_2e_sb_08851_txt.indd 86 08/08/18 6:35 pm
Telomeres and ageing
As people age, some of the cells in their dividing layers reach Short arm
a point where they can no longer divide. Scientists have
Long arm
discovered that there is a change in the structure of the ends of
the chromosomes in these cells. A telomere is a DNA–protein
Centromere
region at each end of a chromosome that seems to function in
preventing chromosomes from sticking to each other (Fig. 3.7).
Telomeres seem to have additional functions in extending the Chromosome A AU C C C
TTAGGG TTAGGG TTAGGG TTAGGG
life of a cell, such as protecting the genome from degradation
and unnecessary recombination and repair. Children have AATCCC AATCCC AATCCC AATCCC
Telomeres
longer telomeres than older people. With successive divisions,
a small amount of DNA is lost from the telomeres in a cell
and they become shorter. Once the telomeres reach a certain FIGURE 3.7 A telomere is a region at the end of a chromosome that
shortens as we age.
predetermined length, the cell stops dividing and this leads to
cell senescence and/or death. There seems to be variation in
the length of telomeres that people are born with and in the rate at which they shorten. Lifestyle choices
may also influence telomere shortening. This has become an interesting area of research into ageing
and disease.
INVESTIGATION 3.1
A practical and secondary-source investigation of mitosis
INTRODUCTION
Mitosis can be observed relatively easily in cells in the growing region of a root tip. In prepared slides, these
cells have been dyed using a stain (such as acetic orcein or a counterstain with toluidine blue) that is taken up
specifically by chromosomes.
Because the tissue in the prepared slide is no longer living, you will see the cells in the stages of division
that they were in when the root tip was killed with a fixative.
The division of cells at any one time is not synchronised – different cells are in various stages of division. The
phase that is most commonly represented in the slide is the phase that cells remain in for the longest period of
time. Review the cell cycle and predict which phase you would expect this to be.
Using the formula for the mitotic index, you can calculate the proportion of cells in the field of view that are
undergoing mitosis compared with the number not undergoing mitosis (and instead are in the interphase or
growth phase).
The prepared slides that you will look at show stained tissues that are no longer living. Modern advanced
microscopy techniques (not usually available in schools) would allow you to view and record living tissue that is
actively dividing. Videos taken using this technology are available for viewing on the Internet, often on YouTube.
You are encouraged to view video clips taken in real time of cells dividing. Record all the references that you use.
AIM
To gather information on the sequence of changes in the nucleus of plant cells undergoing mitosis
PREDICTION
Review the cell cycle and predict which phase you would expect to see the most number of cells in.
MATERIALS
• compound light microscope
• prepared slides of onion root tip
9780170408851 CHAPTER 3 » CELL REPLICATION 87
03_bio_InFocus12_2e_sb_08851_txt.indd 87 08/08/18 6:35 pm
RISK ASSESSMENT
! Complete the table to assess the risks and outline how you can safely manage these.
RISK
ASSESSMENT WHAT ARE THE HAZARDS? WHAT RISK DOES THIS HAZARD POSE? HOW CAN YOU SAFELY MANAGE THIS RISK?
Microscope
Glass microscope slides
METHOD
Revise microscope
safety and risk 1 Using correct microscope technique, observe a prepared slide of a root tip using the compound light
assessment from microscope.
Biology in Focus
Year 11. 2 Under low power, locate and identify the apical meristem. This is found just behind the root cap and is
easily identified by numerous small cells that appear square in shape and have nuclei that are large relative
to the whole cell area. Look for cells with darkly stained chromosomes, indicative of mitosis occurring.
Move the slide so that these are in the centre of your field of view and then change to high power to
observe them in detail.
3 Under high power, identify cells in at least four different stages of mitosis. Use figures 3.6 and 3.8 to assist you.
FIGURE 3.8
Cell cycle stages in an onion root tip
A photomicrograph
of onion root tip cells
Science Photo Library/Steve GSchmeissner
undergoing mitosis,
with examples of
the different phases
highlighted
Telophase
Prophase Telophase
Prophase
Metaphase
Metaphase
Cytokinesis
Cytokinesis Anaphase
Interphase
Interphase Anaphase
RESULTS
1 Record your results in the form of fully labelled diagrams. Remember to include a heading for each diagram
and state the magnification used. Write a brief description of what is happening at each stage in the
diagram.
2 You may wish to take photographs of your field of view using your mobile phone. Print the photograph and
label on it the various stages of cell division that you can see.
3 Calculate the mitotic index of your field of view (refer to Introduction) using the formula:
number of actively dividing cells in field of view
Numeracy Mitotic index =
total number of cells in field of view
4 Write a practical report using a procedure text type, under the headings Aim, Risk assessment, Materials,
Method, Results and Conclusion.
88 MODULE FIVE » HEREDITY 9780170408851
03_bio_InFocus12_2e_sb_08851_txt.indd 88 08/08/18 6:35 pm
DISCUSSION
Discuss the accuracy, reliability and validity of data you gathered during the investigation. Estimate the
uncertainty of measurements in your data. (See Chapter 1, page 20 for estimating uncertainty.)
CONCLUSION
Write a summary statement that relates to the aim and your prediction in this investigation, including a brief
outline of what you found.
EX TENSION
Carry out one of the following optional extension activities.
1 Find a video clip of mitosis filmed under a light microscope or fluorescence microscope in real time. Record
the weblink so that your peers can view it.
2 Estimate the duration of each stage of mitosis by recording data on the observed frequencies of each stage
of cell division in your field of view. Present your data in table format, using Table 3.2 as a guide.
TABLE 3.2 Observed frequencies of stages of cell division in a root tip field of view
OBSERVED OCCURRENCE IN REPRESENTATIVE
MICROSCOPE FIELDS DURATION Mitosis
animation and
% OF TOTAL ESTIMATED TIME quiz
STAGE OF CELL DIVISION NUMBER OF CELLS % OF TOTAL CELLS TIME (MINUTES)
Work through the
quiz to check your
Interphase understanding.
Prophase
Metaphase
Anaphase
Telophase
Cytokinesis
Replication of DNA outside the nucleus
Although each cell has one nucleus, it will have many organelles such as mitochondria and chloroplasts
in the cytoplasm. The number of each type of organelle depends on the functions of the tissue. Cells
that require large amounts of energy have many millions of mitochondria. Photosynthesising cells in the
leaves of plants have many chloroplasts. Just as cells divide, these organelles must also divide to maintain
their numbers for normal tissue functioning.
A small amount of DNA is located in organelles such as mitochondria and chloroplasts, in the
cytoplasm. This DNA, called non-nuclear DNA or extrachromosomal DNA, carries genes that are
important to cell metabolism.
In cytokinesis, when the cytoplasm divides in half, organelles in the cytoplasm such as mitochondria
and chloroplasts reduce in number per cell, as they are now distributed between two daughter cells. To
avoid a repeated reduction in quantity with each cell division, mitochondria and chloroplasts need to be
able to replicate themselves. These organelles contain their own small amounts of DNA and replicate You will learn
independently of the nucleus, in this way maintaining their numbers in successive generations of cells. By more about the
structure of
the time the daughter cells have grown to the size of the original cell, organelle replication has occurred mtDNA, maternal
to restore the organelle number to that of the original cell. Assimilation is important in the growth of inheritance and
applications
many organelles, such as the endoplasmic reticulum. of mtDNA
The DNA in mitochondria is referred to as mtDNA (mitochondrial DNA). Molecules of mtDNA are sequencing in
Chapter 4.
much shorter than nuclear DNA molecules and are arranged in a single circle.
9780170408851 CHAPTER 3 » CELL REPLICATION 89
03_bio_InFocus12_2e_sb_08851_txt.indd 89 08/08/18 6:35 pm
In gamete production in humans, all mitochondria inherited by offspring are located in the cytoplasm
of the egg cell. Sperm cells are tiny and have very little cytoplasm, because they are made up predominantly
of a nucleus and a tail for swimming. Therefore children inherit all their mtDNA from their mother. No
mtDNA is inherited from the father. Therefore, studies of mtDNA reflect maternal inheritance over many
generations.
KEY CONCEPTS
● There are two types of nuclear division – mitosis and meiosis.
● The repeating sequence of cell growth and division that a cell passes through is called the
cell cycle, with phases G1, S, G2 and M.
● Specialised cells are differentiated and no longer go through the cell cycle.
● Mitosis has five phases: interphase, prophase, metaphase, anaphase and telophase.
● Interphase is G1, S and G2 of the cell cycle. DNA replication takes place during the S phase.
● In metaphase, sister chromatids held together by a centromere line up on the equator of the
cell.
● In anaphase, the sister chromatids separate from each other and move towards opposite poles,
drawn by contraction of the spindle fibres.
● Cytokinesis is division of the cytoplasm and begins as nuclear division is ending.
● Cells that form by mitosis have the same genetic material as their parent cell and each other.
● Organelles in the cytoplasm that have their own DNA, such as mitochondria and chloroplasts,
replicate independently of the nucleus.
● Telomeres decrease in length with each division, and short telomeres are a sign of ageing.
CHECK YOUR
UNDERSTANDING 1 Define each of the terms below and draw a fully labelled diagram to distinguish between them:
chromatin, chromosome, chromatid, centromere.
3.1 2 Explain the difference between a chromatid and a chromosome.
3 Distinguish between cell division and mitosis.
4 a Describe the main difference between unicellular organisms and multicellular organisms with respect
to the role of mitotic cell division.
b State two other important roles of mitosis in multicellular organisms.
5 Compare cytokinesis in plant cells with that in animal cells.
a Draw a fully labelled comparative diagram, to compare early prophase with metaphase in a cell that is
dividing by mitosis.
b Explain why more cells are found in interphase than in any other phase of mitosis in the field of view of
the dividing region of a root tip cell.
DNA structure – the Watson
3.2 and Crick model
Today we know that cells carry their biological information in a molecule called DNA (deoxyribonucleic
acid). However, the actual chemical nature and chemical structure of the hereditary material and
genes was a mystery until the middle of the 20th century.
A brief history of the discovery of DNA
In 1869, Swiss scientist Friedrich Miescher discovered a chemical he called ‘nuclein’, and showed that
this distinct chemical was commonly found in the nuclei of cells in a variety of tissues. His ‘nuclein’
proved to be made up of DNA and associated proteins from cell nuclei. Miescher is therefore credited
with being the first scientist to identify DNA as a distinct molecule.
90 MODULE FIVE » HEREDITY 9780170408851
03_bio_InFocus12_2e_sb_08851_txt.indd 90 08/08/18 6:35 pm
By 1910, chromosomes had been discovered. At that stage, scientists knew that they were made up
of a mixture of DNA and protein and that they carried the units of heredity called genes (named in 1909
by William Johannsen).
Over the next 30 years or so, the common expectation among scientists was that the secret of
heredity would be found in proteins, because their building blocks were more varied – twenty amino
acids, compared with DNA’s four bases. However, by the mid-20th century, a number of scientists were
moving towards the idea that DNA carried the genetic information.
In 1944, Oswald Avery and his team, working on bacteria at the Rockefeller University hospital in New
York, first provided experimental proof that DNA, not protein, is the hereditary material.
Many biologists were not convinced, as they were suspicious of Avery’s methodology and thought he
may have obtained his results using DNA that had been ‘contaminated’ by protein. The race was on in
laboratories around the world to try to solve the puzzle – the structures of both protein and DNA were
being investigated.
Two leading teams in England were working on the molecular structure of biological molecules at
the time:
◗ James Watson and Frances Crick worked in the Cavendish laboratory at Cambridge University, under WS
the leadership of Lawrence Bragg. The discovery
◗ Maurice Wilkins and Rosalind Franklin worked at King’s College in London, under the leadership of of DNA
John Randall.
By 1951, highly competitive teams of scientists in these British laboratories were doing similar
research, as was the American laboratory of Linus Pauling. There was a longstanding rivalry between
Lawrence Bragg and Linus Pauling (who had won a Nobel prize for his work on chemical bonds). Early in
1953, Linus Pauling proposed that DNA was the heredity molecule and that its structure was a triple helix.
Watson and Crick used chemical and X-ray evidence to construct a model of the molecular structure
of DNA (Fig. 3.9). The model revealed a stable molecule that could store large amounts of information. It
was a two-stranded molecule, with paired bases twisted into a spiral ladder. Because of its structure, they
called the DNA molecule a ‘double helix’ (and the name of the book that Watson later wrote, describing
their journey of discovery, was The Double Helix). An interesting and critical feature of their model was
that it could be used to explain how the molecule could self-replicate.
Science Photo Library/A. Barrington Brown, Gonville and Caius College
a Alamy Stock Photo/Science History Images
b
FIGURE 3.9 a James Watson (left) and Francis Crick (right) with their model of DNA structure (1953); b James Watson in later
years, with some of the many books he wrote about DNA and science
9780170408851 CHAPTER 3 » CELL REPLICATION 91
03_bio_InFocus12_2e_sb_08851_txt.indd 91 08/08/18 6:35 pm
Watson and Crick’s model of DNA showed a large linear molecule arranged as a double helix or
‘twisted ladder’, with four nitrogenous bases that were held in pairs by hydrogen bonds. Their model
suggested that genetic information could be stored in the order or sequence of the bases that make up
the middle of the DNA structure. On 28 February 1953, Watson and Crick won the race, and announced
that afternoon, at a pub called The Eagle, that they had discovered ‘the secret of life’.
Alamy Stock Photo/Martin Parker
a
Getty Images/Chris Radburn-PA Images
b
FIGURE 3.10 a The Eagle pub in Cambridge, England, and b the plaque outside the pub to commemorate where Crick and Watson celebrated
their discovery
Watson and Crick had worked collaboratively, evaluating the processes, claims and conclusions
of other scientists. They had asked questions of colleagues such as Maurice Wilkins who, in response,
had shown them Rosalind Franklin’s X-ray crystallography photograph of DNA (without first asking her
TED talk: James
Watson speaking permission) to Watson when he visited the laboratory. Watson and Crick applied critical and creative
about how he
discovered DNA
thinking, both in predicting what to expect and in analysing the primary and secondary chemistry and
crystallography data they had gathered.
They considered the quality of all available evidence from a variety of scientists and used reasoning to
construct their scientific predictions and arguments, subjecting the model they were building to rigorous
testing and validation. As a result of their innovation, their attention to sound scientific detail and their
Discovery of the
structure of DNA collaborative approach, they came to the valid conclusion that won them a Nobel Prize in 1962. Avery
The full story of the and his team may also have been in line for a Nobel Prize but, like Rosalind Franklin, Avery died before
scientific advances
preceding Watson this prize could be awarded to him.
and Crick’s insightful
discovery
DNA structure – the Watson and Crick model
Crick realised that each DNA strand, comprising a sugar-phosphate backbone, is antiparallel to the
other, meaning that the twisting strands run parallel to each other but in opposite directions. X-ray
crystallography photographs of the DNA structure suggested a set distance between the ‘backbones’
of the molecule. Thus, each base could have one end attached to the backbone and the other end
hydrogen-bonded to another base. So the bases lined up between the backbones, like the rungs of a
ladder (Fig 3.11).
Nucleotide pairing and bonding
Watson and Crick realised that in their DNA model, to ensure the DNA backbones remain equidistant
from each other, a double-ringed purine base needs to bond with a single-ringed pyrimidine base. The
purine base adenine must therefore bond with the pyrimidine base thymine (A and T), and the purine
base guanine must bond with the pyrimidine base cytosine (G and C).
92 MODULE FIVE » HEREDITY 9780170408851
03_bio_InFocus12_2e_sb_08851_txt.indd 92 08/08/18 6:35 pm
a b
Adapted from Pray, L. (2008) Discovery of DNA structure and function: Watson and Crick.
Nature Education 1(1):100 (Figure 4: Base pairing in DNA)
39 end 59 end
H
H N H O N O P O2
C C C C HC Sugar-phosphate
O O
39 H CH C N H N G C N O 59 backbone
H N C C N H2C
H
H H O H N H H
59 C H2 H H
O H 39
CH3 H
O O
2O
P O H O O P O2
N H C C G C
O N HC O
39 H CH C C H N T N O 59 C H A T
N C A N C 2
H H G C
H H N C O H H
H H
59 C H2 H 39 G C
O H
H H O
O
2O P O H N O P O2 C G
O C C HC
O N O T A
39 H CH C C N C N 59
H C O H2C C G
H H N C G N
H H N C O H H A T
N H H H
59 C H2 O 39 G C
H H
O H O T A
CH3 H N N
2O
P O O HC O P O2 C G
C C C C
O CH O
H T N H N A C N
39 C O 59 C
H N C N H2 G C
H
H H H H H
59 C H2 O O H H A T
Hydrogen bond 39
H G C
O O
2O P O
39 end Base pairs
59 end
FIGURE 3.11 The chemical structure of DNA, showing its antiparallel backbone and base pairing: a the molecular structure of DNA showing the
sugar-phosphate bonding and hydrogen bonding of base pairs; b a simplified version of DNA
From the chemistry of this pairing, they also predicted that the DNA strands would be held together
by weak hydrogen bonds between the paired bases: a double bond between A and T, and a triple bond
between G and C (Fig. 3.12). Watson and Crick found evidence for this pairing, as it fitted with Chargaff ’s
‘parity rule’. In 1951, Austrian biochemist Erwin Chargaff discovered that, in DNA, the ratio of the bases
A : T and C : G was always 1 : 1.
Watson and Crick realised that this complementary base pairing could also be used to predict how
DNA could be copied. They published their research paper, titled, ‘Molecular structure of nucleic acids’, in
1953. In this paper they stated: ‘It has not escaped our notice that the specific pairing we have postulated
immediately suggests a possible copying mechanism for the genetic material’.
DNA serves as a template for replication DNA double
helix
Watson and Crick’s DNA model showed all the requirements expected of hereditary material.
◗ DNA can carry, in coded form, all the instructions for the formation and functioning of cells, despite
the fact that its ‘alphabet’ consists of only four nitrogenous bases.
◗ The structure of DNA allows for its own replication. To copy DNA, each strand can serve as a template
for enzymes to synthesise a new complementary DNA strand.
9780170408851 CHAPTER 3 » CELL REPLICATION 93
03_bio_InFocus12_2e_sb_08851_txt.indd 93 08/08/18 6:35 pm
◗ DNA can be transferred from one generation to the next, packaged in the form of chromosomes and
carried by gametes. It was discovered that proteins associated with DNA in chromosomes have the
The double helix
role of keeping DNA ‘neatly packaged’. DNA is coiled around these proteins (called histones), in much
Watch this 16-minute the same way that cotton thread is wound around a cotton reel. This holds the long threads of DNA
film about the in a compact way so that DNA is easy to sort and separate during cell division and can be efficiently
discovery of DNA.
transported from one generation to the next. Histones are also thought to play a role in exposing
sections of DNA, so that genes can be expressed.
The vertical sides of the ladder are
made up of alternating sugar and
phosphate molecules (a
sugar-phosphate backbone) and
the ‘rungs’ of the ladder are pairs of
nitrogenous bases (adenine, thymine,
guanine and cytosine or A, T, C and
G).
Sugar-phosphate ‘backbone’
Each nucleotide is made up of a
Hydrogen bonds between O
phosphate group, a sugar
P
nitrogenous bases (deoxyribose sugar), and a
O
P nitrogenous base attached to the
G
sugar.
O C
P
C O
O G P
P A
O
O There are four types of nitrogenous
T
P bases: adenine, guanine, cytosine
P G and thymine.
O
O
C
P
OH T
3 end
Chemically, bases pair in a particular
O manner: adenine with thymine and
The DNA molecule is a long-chain A guanine with cytosine (i.e. A–T and
molecule consisting of two G–C). They are held together in the
complementary strands. Each P centre by hydrogen bonds, forming
strand is made up of a sequence of Phosphodiester two complementary strands.
many nucleotides and the strands are bond
held together by weak hydrogen O
bonds in the centre. The two strands
in the double helix model have an
‘antiparallel’ arrangement – they run
in opposite directions. P
5 end
FIGURE 3.12 An annotated diagram of the DNA double helix molecule, showing sugar-phosphate backbone and base pairing
94 MODULE FIVE » HEREDITY 9780170408851
03_bio_InFocus12_2e_sb_08851_txt.indd 94 08/08/18 6:35 pm
TABLE 3.3 Validation of the model: Watson and Crick’s findings, and the evidence on which they were based
FINDING EVIDENCE-BASED REASONING
The whole DNA ‘ladder’ molecule, instead of being Evidence: X-ray crystallography suggested a helix measuring 3.4 nm for every turn,
flat, spirals and is therefore known as the ‘double and this fitted the model where exactly 10 base pairs would measure 3.4 nm in
helix’. length and make up one twist of the helix.
The four types of nitrogenous bases: adenine (A), Evidence: Chargaff’s rule stated that DNA from any cell has a 1:1 ratio of pyrimidine
guanine (G), cytosine (C) and thymine (T) always pair and purine bases and, more specifically, that the amount of guanine is equal to
as A–T and C–G. cytosine and the amount of adenine is equal to thymine. Watson and Crick found
complementary base pairing of pyrimidine–purine (that is, A–T and G–C) was
critical in keeping the backbones of DNA equidistant.
The two complementary strands of DNA are held Reasoning: Chemically, when A bonds to T, a double hydrogen bond may form and
together in the centre by hydrogen bonds that form when G bonds to C, a triple hydrogen bond may form.
between the complementary bases.
The strands of the backbone must be identical and Evidence: DNA crystal images, generated by Rosalind Franklin, looked the same
run in opposite directions (antiparallel). when they were turned upside down or backwards.
Reasoning: The backbones are made of sugar-phosphate molecules, based on the
ratio of these in the chemical analyses.
Each DNA strand serves as a template for the Reasoning: The two complementary strands of DNA could ‘unzip’ or open up if the
production of a complementary strand, allowing the hydrogen bonds break between the base pairs, allowing them to replicate.
double-stranded molecule to self-replicate.
Watson and Crick could form hypotheses about DNA’s structure by building physical models of how the atoms fit together. Sometimes
they used cardboard cut-outs to represent the four nitrogenous bases and other subunits of DNA. They played with these on a desk,
like a jigsaw puzzle. They initially made an error in the configuration of the rings in thymine and guanine. By changing the arrangement
of atoms and making new cut-outs, based on a suggestion from Jerry Donahue, an American scientist, they found the perfect fit:
complementary base pairing, ratios to reflect Chargaff’s rule and the hydrogen bonding of purines to pyrimidine bases.
Nucleic acids as we know them today
There are two types of nucleic acids – DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). Nucleic
acids contain the chemical elements carbon, hydrogen, oxygen, nitrogen and phosphorous. WS
All nucleic acids are polymers made up of simple repeating units (monomers) called nucleotides.
Chromosomes –
Nucleotides may be linked together to form single chains, as in RNA, or double strands, as in DNA the key to
inheritance
(Fig. 3.13). These DNA strands may be very long. For example, human chromosome 1 contains 249 million
base pairs of DNA, representing approximately 8 per cent of the total DNA content of a human cell.
Each nucleotide is made up of three parts: a simple sugar (ribose in RNA, deoxyribose in DNA), a
phosphate and a nitrogenous base.
The genetic code is created in the consecutive sequence of bases. These base sequences differ in each
gene, providing the ‘genetic code’ for a cell.
Revise the
structure of
Comparing the roles of DNA and RNA in cells nucleic acids from
Biology in Focus
◗ DNA stores the genetic information that controls the cell and thereby the whole organism. Year 11, Chapter 3
◗ DNA is the main chemical making up chromatin in the nucleus, although small amounts of DNA are
also found in mitochondria and chloroplasts.
◗ DNA is responsible for transmitting inherited information from one cell to another during cell division
and from one generation to another during reproduction. WS
◗ RNA is a nucleic acid found in small amounts in the nucleus, and in larger amounts in the cytoplasm;
The structure of
it is usually associated with ribosomes. nucleic acids
◗ RNA has the base uracil (U) instead of thymine (T).
9780170408851 CHAPTER 3 » CELL REPLICATION 95
03_bio_InFocus12_2e_sb_08851_txt.indd 95 08/08/18 6:35 pm
The three types ◗ There are three types of RNA:
of RNA and their – messenger RNA (mRNA), which is involved in carrying information from DNA, transporting a
functions are dealt
with in more detail transcribed copy from the nucleus to the cytoplasm
in Chapter 4. See – ribosomal RNA (rRNA), which is associated with proteins in ribosomes, bringing mRNA and
Fig. 4.12.
tRNA together during translation
DNA instructing
the formation of
– transfer RNA (tRNA), which assists in ‘translating’ the mRNA message into proteins. (You will
proteins is also dealt learn more about this in the next section.)
with in Chapter 4.
P
a b Coiled DNA
S B
P
P
S B P Nucleus
S
P S B B
P Chromosome
S B P
B B
S
P S
P
S B P
S B P DNA double helix
Nucleotide S
P S B B
P
S B P Guanine The four bases
S
P S B B Thymine
P Adenine
S B P Cytosine
39 59
P DNA
S B Sugar–phosphate
backbone of DNA
RNA
FIGURE 3.13 a The nucleotide monomer is made up of base–sugar–phosphate, a single-stranded RNA polymer molecule or polynucleotide, and
a double-stranded DNA molecule (a polymer of nucleotides). b The four bases and sugar-phosphate backbone make up the DNA, which forms a
chromosome. Here the chromosome is composed of two identical (sister) chromatids, held together by the centromere.
DNA instructs the formation of proteins
See page 125 for the
In 1955, Crick proposed that the order of the four bases (A, T, G, C) on the DNA molecule determines the
genetic codes for sequence of amino acids in a protein. Their ‘sequence hypothesis’ could explain how the order of bases
amino acids.
in genes along the chromosome can be translated into the language of proteins. By 1966, scientists had
cracked the genetic code and could show exactly which three-base sequences code for each amino acid.
KEY CONCEPTS
● Each nucleotide consists of three parts – a phosphate, a sugar (deoxyribose sugar in DNA, ribose
sugar in RNA) and a nitrogenous base.
● There are four types of nitrogenous bases and each nucleotide is named after the base that it
carries – adenine, thymine, guanine or cytosine nucleotides. These are often simply referred to
by their first letters – A, T, G and C.
● A and G are the larger double-ringed purine bases, and C and T are the smaller single-ringed
pyrimidine bases.
● Each DNA molecule is made up of two chains or strands that have an antiparallel arrangement
– that is, they are parallel but run in opposite directions.
● Each strand is made up of a sequence of many nucleotides, and the strands are held together by
weak hydrogen bonds between the bases in the centre of the DNA molecule.
● The advantage of these weak hydrogen bonds is that little effort is required to pull the bases
apart so that DNA can replicate or be decoded to form proteins.
96 MODULE FIVE » HEREDITY 9780170408851
03_bio_InFocus12_2e_sb_08851_txt.indd 96 13/08/18 5:56 PM
● The vertical sides of the ladder are made up of alternating sugar and phosphate molecules (a
sugar-phosphate backbone) and the ‘rungs’ of the ladder are pairs of a purine base linked to a
pyrimidine base: adenine-thymine (A-T) and guanine-cytosine (G-C). The bases are attached to
the backbone through the sugar component.
● The bases are arranged in a sequence along each strand of DNA (e.g. GGTCAGGCTTGAACGA)
and the length of a DNA molecule is presented as the number of base pairs (bp).
● The two strands of DNA unzip (weak hydrogen bonds break) for replication and gene
expression.
● RNA is a single-stranded molecule made of nucleotides, with a ribose sugar attached to each
phosphate to form the backbone; on the other end it attaches to a base, either A, U, C or G. RNA
does not have thymine, which is replaced by the base, uracil (U).
CHECK YOUR
1 Create a timeline to summarise the contributions made by scientists in the discovery of the hereditary
UNDERSTANDING
material in cells. List the scientists in the chronological order of their discoveries and summarise their
findings under headings such as: Date, Name(s), Laboratory/Place of work, Contribution (theory/law/ 3.2
hypothesis), and a brief description of findings in their research.
2 Describe the main features of DNA that Watson and Crick discovered, under the headings: Nucleotide
composition, Base pairing and Bonding.
3 Compare, using examples, the structure of a purine with a pyrimidine base.
4 Explain, in terms of the structure of DNA, why a purine had to combine with a pyrimidine to create a
double helix.
5 What is meant by the term ‘antiparallel’ in describing the backbones of DNA?
6 Outline the three main requirements of hereditary material for it to be able to carry out its functions.
7 How does the structure of DNA support the idea that it can self-replicate?
8 Compare the structure and functions of DNA and RNA.
9 Evaluate the benefits and limitations of the two DNA models shown in Fig. 3.11.
DNA replication – the Watson
3.3 and Crick model
DNA replication is the production of two identical double-stranded molecules of DNA from one original
double helix molecule. DNA replicates during interphase prior to mitosis, and each cell receives one
exact copy of the coded instructions that control the basic life functions of the cell.
Watson and Crick noted that their model suggested a possible copying mechanism for the genetic
material. If the strands separated, each strand could act as a template for the synthesis of a new,
complementary strand. This is indeed what happens. This process of DNA replication in cells is termed
‘semi-conservative’, as each resulting double-stranded DNA molecule has one new strand and one ‘old’ or
conserved strand. This mechanism should ensure that the genetic material is copied exactly every time.
However, DNA replication is not quite as simple as it appears. The following features add complexity
to the process:
◗ DNA has to be unwound from its spiral configuration before the strands can be separated.
◗ A large number of physical and chemical reactions take place simultaneously during DNA replication,
and so a collection of enzymes is required to control each reaction.
◗ The two strands of DNA run in opposite directions (antiparallel) and nucleotides can be added in one
direction only (onto the free 3′ end).
◗ DNA replication errors sometimes occur and these need to be corrected.
9780170408851 CHAPTER 3 » CELL REPLICATION 97
03_bio_InFocus12_2e_sb_08851_txt.indd 97 08/08/18 6:35 pm
The process of DNA replication
DNA replication occurs in four main steps.
1 The DNA double helix unwinds.
Each DNA molecule is a double-stranded helix. An enzyme called helicase causes the DNA helix to
progressively unwind and the strands to separate (Fig 3.14a).
WS P P
P P P P Weak hydrogen bonds
DNA replication S G C S S G C S break, catalysed by
S G C S
DNA helicase.
P P P P P P
S S C G S S C G S
P C G P P P P P
DNA is
S S unwound S T A S S T A S
P T A P by helicase. P P P P
1 2
S S S C G S S C G S
C G DNA polymerase
P P P P P P adds nucleotides
S S T A S S T A S to make new
DNA strands.
P T A P P P P P
S S S G C S S G C S
P P P P S
P C G P G
P
S
Free P
a The DNA double helix unwinds. C nucleotides
A S S
G
3 P A P
S
P
b DNA unzips and the two strands separate.
P P P P P P P P
S G C S S G C S G C G C
S S S S
Hydrogen
P P P P P P P P
bonds form
S C G S S C G S S S
P P P P P P P P
G C G C
S T A S S T A S S S S S
P P P P A T A T
P P P P
4
S C G S S C G S S G C S S G C S
P P P P P P P P
S T A S S T A S S S
P P P P P P P P
T A T A
S G C S S G C S S S S S
P P P P P G C P G C
P P
Original Newly Original
strand synthesised strand
strands
c Nucleotides are added alongside both strands, d The resulting DNA molecules each contain half
opposite their complementary bases, to create a new of the original DNA molecule and a newly
strand along each original strand. synthesised strand (semi-conservative replication).
FIGURE 3.14 DNA replication – a simplified diagrammatic sequence
98 MODULE FIVE » HEREDITY 9780170408851
03_bio_InFocus12_2e_sb_08851_txt.indd 98 08/08/18 6:35 pm
2 DNA unzips – the two strands separate.
Complementary Original
Using ATP as the energy source, helicase disrupts the weak hydrogen chains of DNA DNA helix
bonds between the complementary bases of the nucleotides on
opposing strands. The DNA strands separate, exposing the nucleotide
bases (Fig. 3.14b). If you think of DNA as a ‘ladder’, each ‘rung’ splits
down the middle, starting at the bottom of the long DNA molecule Replication
fork
and creating a replication fork further up, where the DNA is still
Pool of
joined (Fig 3.15). Single-stranded binding proteins (SSBs) bind to and nucleotides
stabilise the newly separated single-stranded DNA.
3 Nucleotides are added against each single strand. Building
units
Each separate strand of the DNA molecule acts as a template for the DNA
T A T A
DNA
G C G C
production of a new strand of DNA. For synthesis to be initiated, a polymerase polymerase
short strand of RNA needs to be made and attaches to the DNA – this
is known as a primer. RNA primers are made by the enzyme primase.
Okazaki fragments
Next, the enzyme DNA polymerase III adds DNA nucleotides, Template joined on this
to continue the synthesis of the new strand. It picks up free strand by ligase
nucleotide units (made of sugar–phosphate–base) floating in the
liquid background of the nucleus and inserts them opposite their New
complementary base partner, using the existing strands as templates chain
and keeping the nucleotide pairing specific:
Leading Lagging strand
Adenine (A) always pairs with thymine (T) nucleotides. strand
5' end
3' end
Guanine (G) always pairs with cytosine (C) nucleotides. Original
complementary strands
Note: The two strands in a double-stranded DNA molecule run
in opposite directions – they are antiparallel. Each DNA strand has a FIGURE 3.15 DNA replication showing a replication fork,
three prime (3′) end and a five prime (5′) end. Nucleotides are always free nucleotides and DNA polymerase synthesising the
new complementary strands (drawn in yellow)
added from the three prime (3′) end of a DNA strand. Therefore
nucleotide insertion during replication is also antiparallel along the
two template strands.
On one strand of DNA, nucleotides are added in a long chain, growing in the same direction as the
replication fork opens up. This is called the leading strand and replication is continuous. Base mismatch
On the other strand (the lagging strand), nucleotides are added in ‘chunks’ (called Okazaki pairs are dealt
with in more
fragments), from the replication fork backwards (Fig. 3.15). Replication in this strand is therefore detail on page
discontinuous and the fragments are then joined up by an enzyme called ligase, to form one 104 (Fig. 3.18).
continuous strand.
4 Replication errors are identified and corrected.
DNA polymerase I is a complex enzyme that can backtrack to ‘proof read’ and ‘edit’ the strand. It
corrects any base pair errors by splicing out the incorrect base that was inserted into the new strand Interactive
explanation of
and replacing it with the correct base. DNA replication
Click on terms in
Finally, the two new strands are sealed together by the enzyme called ligase. The final base pairing the explanation
is checked by another DNA polymerase enzyme, which recognises base pairing errors and carries out of DNA replication
for simplified
base mismatch repairs, to ensure accuracy. meanings.
Despite these checking mechanisms, a small number of errors in DNA replication still occur –
about one in every ten billion base pairs. Incorrect base pairing results in a change in the DNA base
sequence, known as a mutation.
Cells may delay the progression of the cell cycle until DNA repair (during the G2 phase) is complete.
DNA replication
Each resulting DNA molecule contains one strand of the existing DNA molecule and a newly simulations
and other
synthesised strand. The replicated DNA molecules rewind into the double helix conformation, like interactives
9780170408851 CHAPTER 3 » CELL REPLICATION 99
03_bio_InFocus12_2e_sb_08851_txt.indd 99 08/08/18 6:35 pm
the original molecule. The end result is that there are two molecules of DNA, each a double-stranded
helix, identical to each other and to the original molecule from which they formed.
Enzymes ensure exact replication of DNA
Replication of DNA is a complex process and each step is controlled by one or more enzymes (Table 3.4,
Fig. 3.16). Most spontaneous changes in DNA are temporary because they are immediately corrected by
repair enzymes.
TABLE 3.4 Enzymes that regulate DNA replication
ENZYME FUNCTION IN DNA REPLICATION
Topoisomerase
• Relaxes DNA from its supercoiled state, always working ahead of the replication fork
(e.g. gyrase)
Helicase • Follows topoisomerase and unwinds the double helix by breaking hydrogen bonds
between bases, causing the two strands to separate and creating a replication fork
Primase • Connects RNA primer to a strand to initiate DNA replication
• Synthesises a short complementary RNA molecule, which binds to DNA, serving as the
starting point for DNA synthesis by polymerase
DNA polymerase III • Synthesises new DNA strands, using existing strands as a template. Nucleotides are
added to a growing strand from the 3′ end
• Joins the phosphate group of each nucleotide to the previous one, creating
phosphodiester bonds between these molecules to make the sugar-phosphate backbone
DNA polymerase I • Mainly functions in ‘editing’ – recognises and repairs base pairing errors (exonuclease)
• Also has a function in replication (removing primers ahead of the main polymerising enzyme)
DNA polymerase II • Editing function, but no exonuclease activity
Ligase • Connects and seals the two strands of the DNA molecule and also connects Okazaki
fragments
• On the leading strand – DNA moves along in the same direction as the developing replication fork, and
nucleotides are added in one long chain.
• On the lagging strand, DNA is added one ‘chunk’ at a time – called Okazaki fragments (about 100–150
nucleotides long) and these are then joined up.
FIGURE 3.16
Enzymes involved in
DNA replication
Helicase unwinds Binding proteins stabilise Primase adds a short
parental double helix. the strands. primer to template strand.
DNA polymerase binds Exonuclease removes Ligase joins Okazaki
nucleotides to form RNA primer and inserts fragments and seals nicks in
new strands. correct bases. sugar-phosphate backbone.
100 MODULE FIVE » HEREDITY 9780170408851
03_bio_InFocus12_2e_sb_08851_txt.indd 100 08/08/18 6:35 pm
INVESTIGATION 3.2
Modelling DNA replication using the Watson and Crick model
BACKGROUND: USING SCIENTIFIC MODELS AND WRITING A HYPOTHESIS
Following their landmark paper on DNA structure, in 1954 Watson and Crick proposed a mechanism by which Information and
communication
DNA could be copied. This mechanism was based on their DNA model in that each DNA strand could serve as technology
a template for the synthesis of a new strand. In their own words, ‘prior to duplication, the hydrogen bonds are capability
broken, and the two chains unwind and separate. Each chain then serves as a template for the formation … of Critical and
two pairs of chains, where we only had one before. Moreover, the sequence of the pairs of bases will have been creative
thinking
duplicated exactly.’ So the final result is two identical double helix DNA molecules (sister chromatids), each
made up of one old and one newly synthesised strand – a model of semi-conservative replication.
© 1953 Nature Publishing Group. Watson, J. D., and Crick, F. H. C., Nature volume 171, pages 964–967 (1953). doi:10.1038/171964b0. All rights reserved
PREDICTIONS AND VALIDATIONS OF THE WATSON AND CRICK MODEL OF SEMI-CONSERVATIVE REPLICATION
The semi-conservative model that Watson and Crick proposed was tested and validated by scientists using the
DNA of both prokaryotes and eukaryotes. Hypotheses
used to test
Scientists realised that, to test the Watson-Crick proposal for DNA replication, they needed to find a way to DNA replication
distinguish between the old and the newly synthesised strands. proposal
In 1958, Matthew Meselson and Franklin Stahl carried out experiments that supported and verified Watson Investigative
methods used to
and Crick’s proposal of semi-conservative replication of DNA. They used heavy isotopes of nitrogen, which were test the hypothesis
incorporated into the nitrogenous bases that would be added to the newly synthesised strand. A centrifuging that DNA
replication is semi-
technique was then used to determine the density of the DNA strands, determined by the buoyancy of DNA. conservative
The results of the buoyancy tests supported predictions made for semi-conservative replication.
VALIDATING SCIENTIFIC MODELS
Scientific models are developed to represent an idea, object, process or system that cannot be observed directly.
Models are simplified representations; they do not try to explain every detail in the ‘real world’ process, object or Writing
a formal
idea. Scientists are usually aware of the limitations of the models that they propose and have critically analysed. The hypothesis (self-
models that are most valuable in science are those that allow us to make and test predictions. If a prediction is made assessment)
and the model holds true, the prediction is said to validate the model. Sometimes, as new evidence is found, models
need to change to reflect a more accurate understanding of an idea or process. If a model cannot hold true in the
light of new evidence, the model may be rejected. Models are therefore indicative of the tentative nature of science.
AIM Cut and paste
DNA
To model DNA replication, showing semi-conservative replication
In this investigation, you are required to generate a model to represent the structure of DNA and the process
of DNA replication. Because each model created will demonstrate only some aspects of the structure and
process, the models built by students will all be different. You will be required to peer assess the models that
you view. You will need to identify the structural and conceptual differences between the models and use your DNA with
confectionary
critical analysis skills to discuss the advantages and limitations of each model.
METHOD
1 Working in groups of three to four, build a working model of DNA structure, showing the double helical
nature of the molecule. You need to build a working model with features and spare parts that will be used
Jewellery DNA
by another group to demonstrate how your DNA can act as a template to demonstrate semi-conservative
replication. Your teacher may assign one or two specific features (a to e below) that your model needs to
show, or each group may be allowed to select which features they wish to show.
2 Using the Internet, carry out research to review different types of DNA models that may be created to show
structure and/or replication. You will discover that models may be created from a wide variety of materials, Digital DNA
from edible models using lollies, to models that use materials such as pipe cleaners and beads, or easily
available recyclable materials such as cardboard and toothpicks, or waste materials such as styrofoam and
plastic. See the online resources linked to this page for ideas. You will also need to analyse models of DNA
9780170408851 CHAPTER 3 » CELL REPLICATION 101
03_bio_InFocus12_2e_sb_08851_txt.indd 101 08/08/18 6:36 pm
replication to determine whether they can be used to demonstrate the feature of replication you have
selected or been assigned.
3 Your model of semi-conservative replication of DNA should demonstrate some or all of the following:
a complementary pairing of bases
b creation of Okazaki fragments
c unwinding of DNA with helicase action, creating a replication fork
d addition of nucleotides by DNA polymerase, using an old strand as a template and creating a new strand
e mutation during DNA replication.
4 Label the structures in the DNA model. Labels should include all the features listed in Table 3.5. In addition
to these labels, also label any additional features, such as enzymes or assigned features.
Common labels: sugar-phosphate backbone, nucleotide, nitrogenous base, hydrogen bond, 3′ end, 5′ end.
PREPARING YOUR MODEL FOR VALIDATION
5 Create the following to be placed with your model in the next lesson:
a instructions to your classmates on how to replicate your DNA molecule
b raw materials, so that another group can carry out the replication process on your model
c a copy of Table 3.5, completed to describe the features of your model
d a printout of a photograph of your model (before it is replicated).
TABLE 3.5 Key to DNA model
FEATURE MATERIAL COLOUR
Sugar-phosphate backbone
Nitrogenous bases
Hydrogen bonds
One nucleotide
Feature to be demonstrated during replication
Limitations
GROUP ROTATION ACTIVIT Y: VALIDATING MODELS
6 Set up your model and provide spare parts and clear instructions for the next group on how to replicate your
DNA molecule. Copy and complete Table 3.5 to accompany your model as a key, identifying what materials
have been used to represent each feature. You also need to provide a printout of a photo of your model.
7 Rotate groups: A → B; B → C; C → D; D → E; E → A.
a Identify the parts of the DNA model you have rotated to, using the key provided. Take a photo of the
model before you replicate it.
b Use the spare parts provided to carry out replication, showing the main feature listed at the bottom of
the table. You may use your textbook to revise exactly what this feature is. Take a photo of the replicated
model. Complete a peer assessment of the model, listing its advantages and limitations.
8 Move to the next group and take on the proof reading and editing role of DNA polymerase. Check
whether the model has any errors of replication (mutations). Take a photo of the replicated model. Turn the
explanatory table over (or cover it with a piece of paper) so that the next group cannot see it.
9 Move to the next group and complete a blank copy of Table 3.5 for the model you are viewing. Do not
cheat by turning over the key. Take a photo of the model and your completed table.
10 Move to the last model. Compare it with the model that your group made, writing down two similarities
DNA replication and one difference between this model and your model. Take a photo of the model.
Build strands of
DNA by inserting EX TENSION
complementary bases
DNA replication – try the DNA replication simulation in class or complete it for homework. (See the weblink.)
102 MODULE FIVE » HEREDITY 9780170408851
03_bio_InFocus12_2e_sb_08851_txt.indd 102 08/08/18 6:36 pm
KEY CONCEPTS
● The two DNA strands unzip for replication.
● DNA polymerases are complex enzymes that move along the DNA molecule, linking nucleotides
to their complementary base partners to make new DNA chains.
● Each strand of DNA is used as a template to make a new, complementary strand – this is known
as semi-conservative DNA synthesis.
● Accurate DNA replication is important so that daughter cells have exact copies of the genetic
information for synthesising proteins.
● Some DNA polymerase enzymes have the ability to ‘proof read and edit’ the DNA, correcting its
own errors. There are also complex enzymes to repair other damage to DNA caused by mutagens.
1 What is meant by ‘DNA replication’?
CHECK YOUR
UNDERSTANDING
2 Create a flow chart that accurately shows the steps in the process of DNA replication. Indicate any enzymes
that act at particular steps and what their function is. 3.3
3 What is an error in the DNA base pairing called and how does it arise?
4 Why is DNA replication called ‘semi-conservative’?
The importance of accuracy during
3.4 DNA replication
Because the sequence of bases in DNA makes up the genetic code of an individual, exact copying of this
sequence during replication is critical, for two main reasons:
◗ heredity (inheritance of genes) – the genetic material transmitted from cell to cell (by mitosis) and
from generation to generation (by gametes from meiosis) needs to be accurate
◗ gene expression (protein synthesis) – the genetic instructions given to a cell to create its structure Causes of
and ensure its correct functioning must be accurate. mutation and
types of mutation
It is therefore very important that no errors are made when this information is replicated. This is are dealt with in
termed fidelity of replication. more detail in
Chapter 7.
However, studies show that DNA is at constant risk of mutation. It is therefore not surprising to find
that cells have enzymes that are able to repair incorrect base insertions and other DNA damage that may
arise during replication.
Errors in replication
Natural errors that arise at random during DNA during replication are called spontaneous mutations. Other
errors that arise as a result of exposure of cells to environmental factors such as radiation or chemicals are
called mutagenic mutations. Environmental factors such as radiation, chemicals and viruses that change
DNA are called mutagens. As the length of time that the cells are exposed to mutagens increases, and the
intensity of exposure rises, so the risk of mutation also increases.
Shutterstock.com/nobeastsofierce
There are enzymes in cells to repair both types of mutation, but sometimes DNA
errors go undetected and this results in a permanent mutation. This uncorrected
mutation will be replicated in successive divisions and, if occurring in meiosis, passed
on to later generations of individuals.
DNA repair
The insertion of an incorrect base is common during DNA replication. When this
occurs, a repair enzyme recognises the mismatched base pair, excises the incorrect
base (cuts it out) and replaces it with the correct base. This is called DNA mismatch FIGURE 3.17 An uncorrected mutation in
DNA will be passed on to future generations.
repair and is a function of the enzyme DNA polymerase I.
9780170408851 CHAPTER 3 » CELL REPLICATION 103
03_bio_InFocus12_2e_sb_08851_txt.indd 103 08/08/18 6:36 pm
AT AT AT However, if a mismatched pair is missed by the enzyme, harm
CG CG CG
GC AC AT
may arise the next time the cell divides and the DNA replicates. For
TA TA TA example, if an error occurs in which a ‘C’ nucleotide is accidentally
AT Error AT Replication AT paired with an ‘A’ nucleotide (instead of the correct ‘G’) (Fig. 3.18),
then the next time this DNA strand acts as a template and replicates,
FIGURE 3.18 Mismatch error in DNA
replication the error will cause a strand to form that has an incorrect base pair
(AT instead of GC).
This strand is now permanently mutated. The error will not be recognised by a DNA repair enzyme,
because the pairing of bases is not incorrect. However, the sequence of bases within the strand now
Variation and the differs from that of the original strand. A permanent mutation such as this often has a harmful effect,
advantages of
biodiversity in terms
but some mutations have a beneficial effect on the organism. Some mutations have no effect at all. It is
of evolution are dealt important to remember that mutation is a mechanism that can give rise to variation in organisms and
with in Chapter 5.
this may be beneficial to a species in terms of biodiversity and evolution.
There are different types of enzymes that carry out repairs on different types of DNA damage, to
ensure accurate replication and normal functioning of cells.
Gene expression and the need for accurate replication
Different types of
DNA damage and Now that you understand the structure of DNA and its ability to serve as a template during replication,
their effects, as well
as DNA repair are you might ask how the genetic code actually works. The answer lies in the production of proteins.
dealt with in Enzymes are proteins; they control the synthesis of cell materials and the biochemistry (metabolism)
Chapter 7.
within each cell and within the whole organism. Besides storing exact copies of instructions in every cell,
the sequence of bases in DNA also plays a vital role in the translation of the genetic code into proteins.
In multicellular organisms, different genes are activated and expressed in each type of cell. The entire
genetic code passed on to each cell must contain a full and accurate set of instructions, so that when the
A comparison of
two major DNA relevant gene is activated, it functions correctly to make proteins that determine the type of cell it will
repair pathways become. The activation of genes is regulated by other molecules, such as enzymes (which are proteins),
Analyse the
information in and therefore they also need to be accurately coded for by DNA. Errors in genes that control the cell cycle
the diagrams to may lead to changes in cell division and cell death, leading to cancer. Mismatch repair of these genes is
understand a visual
representation of DNA particularly important (Fig. 3.19). Replication errors in genes that code for DNA repair enzymes are also
mismatch repair.
linked to cancer.
Genes that regulate FIGURE 3.19
cell division to The cell cycle, Oncogenes
prevent cancer are showing the stage G1 promote cell growth
discussed in more at which mismatch
(cell growth)
detail in Chapter 15, repair enzymes M (mitosis)
pages 525–6. (coded by genes)
correct errors in DNA
during replication
G2
S (synthesis)
Mismatch repair G0 (resting)
genes code for enzymes that
correct replication errors Suppressor genes Modifier genes
influence cell function
inhibit cell cycle and
promote apoptosis
(programmed cell death)
104 MODULE FIVE » HEREDITY 9780170408851
03_bio_InFocus12_2e_sb_08851_txt.indd 104 08/08/18 6:36 pm
KEY CONCEPTS
● Accurate DNA replication is important for two main reasons:
– heredity: the genetic material of a cell must be transmitted accurately, from:
∎ one cell to another during mitosis, allowing growth, repair and maintenance of an organism
∎ one generation to another during meiosis (e.g. when gametes are formed for sexual
reproduction)
– gene expression: the genetic material of a cell must be transmitted accurately to give the
correct instructions to a cell to ensure the correct structure, functioning and behaviour of an
organism, essential for its survival.
CHECK YOUR
1 Explain the importance of having inbuilt mechanisms for correcting mistakes in DNA replication.
UNDERSTANDING
2 Distinguish between a spontaneous mutation and a mutagenic mutation.
3 List three mutagens. 3.4
4 How is an error in replication, such as a mismatch repair, corrected?
5 How could an error in DNA replication end up affecting a whole organism?
3.5 The continuity of species
All living organisms arise from other living organisms. The continuity of species refers to the ongoing
survival of species as a result of characteristics being passed from parents to offspring in a continuous
lineage. This inheritance of characteristics from ancestors to currently living organisms relies on
the passing on of consistently accurate genetic information (genetic stability) and the occasional
introduction of variation of some genetic information, so that species can adapt and survive in a
changing environment.
Accurate DNA replication brings about genetic stability, whereas mutation results in genetic
Genetic
variation. Although variation is important for evolution of species, genetic stability is important continuity
for the survival of the individual. Both genetic stability and variation play a role in ensuring the
continuity of the species.
Genetic continuity
Dreamstime.com/Vbaleha
Genetic continuity is a way of preserving genetic information across generations
and is dependent on two things:
◗ when a cell divides by mitosis, the resulting two daughter cells must have the
same number and type of genes as the original cell.
◗ when two sexually reproducing organisms breed, the resulting offspring must
have the same number of genes as the parent organisms and variations in these
genes must not be extremely detrimental or lethal.
Genetic continuity ensures continuation of a species, because it ensures that
new cells or organisms have all the genes they need, in working order, to survive. A
lack of genetic continuity results in disease and sometimes in death and extinction. FIGURE 3.20 Genetic continuity across
generations
Ensuring the continuity of species – genetic stability
In asexual reproduction, offspring inherit identical characteristics from one parent if replication is
consistent. In sexually reproducing organisms, offspring inherit a mix of characteristics from two
parents.
9780170408851 CHAPTER 3 » CELL REPLICATION 105
03_bio_InFocus12_2e_sb_08851_txt.indd 105 08/08/18 6:36 pm
In both cases, the correct number of chromosomes and
Shuttestock.com/Volodymyr Burdiak
characteristics are passed on in family lineages. At a genetic level,
stability arises when chromosomes are replicated accurately to
give rise to identical daughter chromosomes.
For continuity at the species level, successful desirable traits
must be passed on, along with some random errors (chance
errors may be introduced by mutation). This allows a species
to evolve if an environmental change occurs. Natural selection
acts so that individuals in a population that are best suited to
FIGURE 3.21 Genetic continuity at the species level involves
conservation of diversity of traits. the environment survive and reproduce, passing on their genes
to their offspring. This mixing of parent genes during sexual
reproduction, including some that have arisen due to mutation, increases genetic diversity and helps
maintain continuity of the species.
The mechanisms that have evolved to ensure genetic continuity (passing on of genetic traits) and the
survival and continuity of species include:
◗ consistent replication prior to cell division (mitosis and meiosis)
◗ an orderly distribution of chromosomes when cells divide and when gametes form
◗ fertilisation methods that ensure that individuals of the same species breed successfully
◗ methods to ensure embryo survival, such as production of large numbers or protection
and nourishment of developing embryos and parental care
◗ natural selection so that the fittest survive to reproductive age and pass on their genes.
Mechanisms that result in genetic variation in species include:
◗ mutation – changes in DNA due to mutation may be spontaneous or mutagen-induced
◗ mixing of parental genes during sexual reproduction (brought about by crossing over
and independent assortment during meiosis, and random fertilisation of gametes).
Genetic errors that threaten the continuity of species
You have learned that many variations that arise due to spontaneous changes in DNA are temporary and
are immediately corrected by enzymes that bring about DNA repair. The number of DNA repair enzymes
present in cells is an indication of how important accurate replication and DNA repair are for survival.
In humans, a range of diseases have been linked to the reduced ability of cells to repair DNA during or
after replication. Research shows that people who have a reduced ability to repair DNA tend to be more
susceptible to some cancers. A decrease in the ability of cells to repair DNA during replication is also
thought to be responsible for accelerated ageing and may give rise to neurodegeneration. There is a great
deal of current research in this area.
When a mutation is present in a DNA repair gene, the gene may be expressed in an altered form
or not expressed at all. For example, it has been found that people who have the disease Xeroderma
pigmentosum (XP) are unable to repair DNA and so they are more vulnerable to DNA damage from
ultraviolet rays and, as a result, to skin cancer. Recent research shows a link between germline mutations
in DNA repair genes and lethal forms of prostate cancer. Research in animal embryology shows that if
one of the genes for DNA repair (the base excision repair gene) is missing, this results in the death of the
embryo. Mutations such as these are termed lethal mutations.
Genetic information can only be stored in a stable form and passed on consistently if DNA repair
enzymes continuously scan the DNA for errors in replication and replace incorrect or damaged
nucleotides. Natural selection is a mechanism that ensures individuals carrying damaged genes are
removed from populations so that the continuity of species is not at risk.
106 MODULE FIVE » HEREDITY 9780170408851
03_bio_InFocus12_2e_sb_08851_txt.indd 106 08/08/18 6:36 pm
INVESTIGATION 3.3
Literature review of the effect of cell replication processes on the Literacy
continuity of species
Information and
TASKS communication
technology
A Assess the effect of cell replication processes on the continuity of species. capability
B Present your findings in the form of a literature review.
C Acknowledge and evaluate your sources.
You will complete secondary-source research to review the effect of accurate replication as opposed to Threats to
inaccuracies in replication on the continuity of species. genetic
continuity
PART A: RESEARCH
Focus question: In what ways do cell replication processes support or threaten the continuity of species?
1 Draw up a chart in which you list the following in relation to the focus question:
– What you know: list any facts relevant to the topic that you have learned during this section of the course. What happens
when mitosis
– What you think you know: list anything based on prior knowledge, or that you think you understand. goes wrong?
– What you need to find out: outline some research questions (key concepts) and write some key words.
2 Read the articles listed in the weblinks provided and find your own articles, and use these to gather valid
and reliable information relevant to your research questions.
3 Interpret and analyse your search results. (You may need to modify your search strategy as you go.)
Cancer-specific
4 Make a judgement and use your findings to support your concluding judgement in answering the focus question. defects in DNA
repair pathways
PART B: PRESENT YOUR FINDINGS
5 Write a literature review of approximately 400 words (page 9), with:
WS
– an introduction, where you define the topic
– a body, where you group the literature and your findings according to common themes Evaluating
resources
– a conclusion, where you explain the link between your research question and the literature you have
reviewed, creating an evidence-based argument.
Evaluate your
PART C: ACKNOWLEDGE SOURCES sources using the
CRAAP technique.
6 Acknowledge and evaluate your sources using an accepted referencing style. (See page 10.)
KEY CONCEPTS
● Genetic continuity relies on:
– consistent replication of genetic information that is passed from a parent cell to daughter
cells, resulting in continuity in the traits being passed from parents to offspring
– the effect of natural selection and evolution on the gene pool as a result of:
∎ introduction of variation during sexual reproduction
∎ random errors arising by mutation, being replicated and passed on to offspring.
● Random variations that confer an advantage may be selected over those that confer no
advantage or are harmful.
1 Explain the role of DNA replication in:
CHECK YOUR
UNDERSTANDING
a maintaining genetic continuity in a species b introducing genetic variation in a species.
2 Explain how natural selection can remove harmful variations from a species. 3.5
9780170408851 CHAPTER 3 » CELL REPLICATION 107
03_bio_InFocus12_2e_sb_08851_txt.indd 107 08/08/18 6:36 pm
3 CHAPTER SUMMARY
Cell replication: How important is it for genetic material to be replicated exactly?
PROCESSES INVOLVED IN CELL REPLICATION: MITOSIS AND MEOISIS
Roles in life cycle Importance of mitosis and meiosis
Mitosis
Fusion to
form zygote Zygote (2n)
• Embryonic development: zygote blastula embryo
(n to 2n) • Growth of multicellular organisms – meristem (plants); stem
cells (animals)
Egg (n) Sperm (n) • Tissue maintenance and repair
Juvenile (2n)
• Asexual reproduction and genetic stability in populations
Meiosis
(2n to n)
Meiosis Mitosis
(2n to n) (differentiation Meiosis
and growth)
• Production of gametes
• Halving the chromosome number
Adults (2n)
Haploid stages • Introduction of genetic variation
Diploid stages
G0
Cell cycle stops
The cell cycle
G1 – cell growth
INT
Cellular contents,
ERP
excluding the
S – synthesis
HASE
chromosomes,
Each of the 46
are duplicated
chromosomes is
duplicated by the cell
Cytokinesis
Cytoplasm
divides
M – mitosis
Nucleus G2 – 9proof reading9
divides The cell checks the
duplicated chromosomes
for errors, making
any needed repairs
IT
M
O SI S
Stages of mitosis
Interphase – DNA replicates
Prophase – chromosomes appear and split into chromatids
Metaphase – chromosomes align on equator
Anaphase & telophase – daughter chromosomes segregate
and move to poles
Cytokinesis – cytoplasm divides
108 MODULE FIVE » HEREDITY 9780170408851
03_bio_InFocus12_2e_sb_08851_txt.indd 108 08/08/18 6:36 pm
DNA STRUCTURE AND REPLICATION: THE WATSON CRICK DNA MODEL
Nucleotide composition, complementary base pairing and bonding
Nucleotide = phosphate − sugar − nitrogenous base
Nitrogenous base pairing:
Sugar-phosphate ‘backbone’
adenine + thymine; cytosine + guanine
Hydrogen bonds between
Bonds = weak hydrogen
O
P
nitrogenous bases
O
P
G
O C
P
C O
O G P
P A Complementary Original
O
T
O
chains of DNA DNA helix
P
P G
O
O
C
P
OH T
3 end
A
O
Replication
P
fork
Phosphodiester
O
bond
Pool of
nucleotides
P
5 end
Building
units
T A T A
DNA DNA
Semi-conservative DNA replication polymerase
G C G C
polymerase
• DNA unzips and a replication fork can
be seen. Okazaki fragments
• Each strand acts as a template. Template joined on this
strand by ligase
• DNA polymerase adds nucleotides
from 3’ to 5’ end.
• New molecules consist of one old New
chain
and one new strand.
Leading Lagging strand
strand
3' end 5' end
Original
complementary strands
Ensuring exact replication (enzyme regulation) Accurate DNA replication ensures the
survival of the species.
Oncogenes
G1 promote cell growth
(cell growth)
M (mitosis)
Helicase unwinds Binding proteins stabilise Primase adds a short
parental double helix. the strands. primer to template strand.
G2
DNA polymerase binds Exonuclease removes Ligase joins Okazaki
nucleotides to form
new strands.
RNA primer and inserts
correct bases.
fragments and seals nicks in
sugar-phosphate backbone.
S (synthesis)
Mismatch repair G0 (resting)
genes code for enzymes that
correct replication errors Suppressor genes Modifier genes
influence cell function
inhibit cell cycle and
DNA polymerase binds Exonuclease removes Ligase joins Okazaki promote apoptosis
nucleotides to form RNA primer and inserts fragments and seals nicks in (programmed cell death)
new strands. correct bases. sugar-phosphate backbone.
9780170408851 CHAPTER 3 » CELL REPLICATION 109
03_bio_InFocus12_2e_sb_08851_txt.indd 109 08/08/18 6:37 pm
3 CHAPTER REVIEW QUESTIONS Qz
Review quiz
1 Name the three types of cell division found in all living c Draw a sequence of diagrams of a dividing cell (to
organisms and the purpose of each. scale) to show how the cell changes in cell volume
during the process of mitosis and use data from the
2 Identify the components of chromatin.
graph to justify your explanation.
3 Explain why chromosomes are only visible during cell division. d Describe the relationship between the cell volume and
4 Name the phases of the cell cycle and outline what the amount of DNA in the cell.
happens in each phase. e The cell volume graph is divided into ten units of time.
At what time does cytokinesis occur? (Express this in
5 Give three reasons why it is important for the cell cycle to
numbers of time units.) Give a reason for your answer.
be regulated.
7 Distinguish between mitosis and cytokinesis.
6 The graphs in Figure 3.22 show cell volume (the size of a
cell) and the amount of DNA in a cell at various stages of 8 Explain why it is important for DNA to replicate before cell
the cell cycle. division.
a How many cell cycles (cell divisions) has the cell shown 9 Draw and label a diagram of an RNA nucleotide.
in the graphs completed? Justify your answer.
10 State the rule of base pairing of nitrogenous bases in a
b Explain the change in the amount of DNA during the
DNA molecule.
cell cycle, as shown in the lower graph. Use correct
terminology for the phases of the cell cycle and the
stages of mitosis.
Cell volume
Time
Amount of DNA
G1 S G2 M 1 cell cycle
FIGURE 3.22
110 MODULE FIVE » HEREDITY 9780170408851
03_bio_InFocus12_2e_sb_08851_txt.indd 110 08/08/18 6:37 pm
11 Based on the timeline in Figure 3.23, create a table to summarise the contributions made by scientists in the discovery of the
hereditary material in cells.
Left to right: Alamy Stock Photo/Pictorial Press Ltd; Walter S. Sutton Collection, University of Kansas Medical Center
Archives, Kansas City, KS; Getty Images/Hulton Archive/Stringer; Alamy Stock Photo/PF-(bygone1); Getty Images/
Bettmann Science Photo Library; Bottom: Alamy Stock Photo/Paul Fearn
1944
Avery,
1930s McLeod
Hammerling and 1952
1902 shows that McCarty Hershey
1865 Sutton 1927 hereditary 1931 show that and Chase
Mendel and Boveri Muller information McClintock DNA is the use radioactive 1990s
documents propose shows that is contained demonstrates ‘transforming labelling to Genome
patterns of chromosome X-rays in the nuclei genetic principle’ prove that DNA sequencing
heredity in theory of induce of eukaryotic recombination responsible is responsible projects
pea plants heredity mutations cells in corn for heredity for heredity begin
1869 1915 1928 1941 1950 1953 1961
Miescher Morgan Griffith’s Beadle Chargaff Watson Jacob
first identifies and his ‘Fly Room’ ‘transformation and Tatum discovers and Crick and
DNA (‘nuclein’) colleagues confirm experiments’ describe the that A 5 T propose Monod
the chromosome transform ‘one gene–one and C 5 G the double propose
theory of heredity non-pathogenic enzyme’ (Chargaff’s helix the
bacteria strains hypothesis rules) structure existence
to pathogenic of DNA of mRNA
FIGURE 3.23 Timeline of contributions by scientists to our understanding of genetics and inheritance
12 List two hypotheses that Watson and Crick tested when 18 Explain the following features of the Watson and Crick
creating the models listed below, and explain how their model of DNA, supplementing your explanation with
findings supported their hypotheses: simple diagrams where necessary:
a DNA structure a nucleotide composition
b DNA replication. b nucleotide pairing
13 Explain how nucleotides are added to both strands during c nucleotide bonding.
DNA replication. Use a diagram to illustrate your answer. 19 Assess the effect of the following processes on the
14 Predict the DNA sequence for a complementary strand continuity of species:
of DNA made from the following sequence of bases: a DNA replication
AATTGGCTGACGAATCAT. b action of polymerase enzymes during DNA replication
15 Outline the role of four named enzymes in cell replication. c separation of daughter chromatids during mitosis
16 Explain why DNA replication is referred to as ‘semi- d formation of identical cells in multicellular organisms
conservative’ replication. e cell replication in unicellular organisms
17 Explain, giving examples, the importance of exact f replication of cell organelles during G1 phase.
replication of DNA in cell division and explain the role 20 Answer the inquiry question at the start of this chapter:
that enzymes play in ‘proof reading’ the molecule after How important is it for genetic material to be replicated
replication. exactly? Use information from this chapter to support your
answer.
9780170408851 CHAPTER 3 » CELL REPLICATION 111
03_bio_InFocus12_2e_sb_08851_txt.indd 111 08/08/18 6:37 pm
4 DNA and polypeptide synthesis
Students:
• construct appropriate representations to model and compare the forms in which DNA exists in eukaryotes and
INQUIRY QUESTION prokaryotes (ACSBL076) ICT
Why is polypeptide • model the process of polypeptide synthesis, including: (ACSBL079)
synthesis important? – transcription and translation
– assessing the importance of mRNA and tRNA in transcription and translation (ACSBL079)
– analysing the function and importance of polypeptide synthesis (ACSBL080)
– assessing how genes and environment affect phenotypic expression (ACSBL081) CCT L
• investigate the structure and function of proteins in living things L
Biology Stage 6 Syllabus © NSW Education Standards Authority for and on behalf of the Crown in right of the State of New South Wales, 2017
Shutterstock.com/ESB Professional
112 9780170408851
04_bio_InFocus12_2e_sb_08851_txt.indd 112 08/08/18 6:44 pm
Have you ever wondered how our genes give us
Science Photo Library/Gunilla Elam
visible features? How they play a part in determining
characteristics such as height and build, eye colour and
skin colour – and what influence, if any, the environment
has? To understand the continuity of life at the organism
level, we need to explore how genes translate into physical
and behavioural features in our bodies and chemical
structures such as proteins in our cells.
As you learned in the previous chapter, the continuity
of life describes how new organisms arise from living
organisms of the same type. The continuity of life is
maintained at the cellular level by cell division (mitosis
and meiosis) and at the molecular level by DNA. At the
whole-organism level, continuity of life depends on
physical and chemical features in organisms that result
when the instructions in DNA are translated into proteins.
FIGURE 4.1 DNA base sequences are expressed
Questions in science drive research. After the structure as proteins.
and mode of replication of DNA were discovered, the next
questions asked were:
◗ Is the genetic code universal?
◗ Are the structure and function of DNA in prokaryotes the same as in eukaryotes?
◗ How does the coded sequence of nucleotides in DNA produce proteins?
Research into gene functioning continued after the development of the Watson and Crick model
and the more scientists learned, the more they wanted to find out. Scientists began investigating gene
regulation – how and why some genes ‘switch on’ to produce a product in some cells and not in others.
For example, why is it that skin cells make the pigment melanin, but bone cells do not? And why is it that
bone cells make bone, but skin cells do not?
In this chapter you will study DNA in prokaryotes and eukaryotes, and how DNA codes for proteins.
4.1 DNA in prokaryotes and eukaryotes
The basic principles of molecular biology and genetics apply to both prokaryotes and eukaryotes, and
genetic evidence points towards all present-day cells having evolved from a common ancestor. The
genetic code is universal – the same nucleotide base-pairing code is used in all living organisms, both
prokaryotes and eukaryotes, to instruct protein synthesis. Both types of cells use a similar mechanism to
translate information from DNA into polypeptides and proteins within the cell.
The basic principles learned from experiments performed with one type of cell have been found to
apply to other cell types. This has led to a common model system used in the study of molecular biology,
whereby the study of the functioning of genes in simple cells is also applied to more complex organisms.
The bacterium E. coli is commonly used to study genetics at the molecular level. These bacteria grow
easily, divide every 20 minutes when kept at 37°C and model the same type of translation (how mRNA
is decoded for the production of proteins) as eukaryotic cells. The metabolism of E. coli is very precisely
regulated and so it is an ideal example for molecular biologists to use in experiments to research
how genes are regulated and expressed. The main differences between bacterial genetics and that of
eukaryotes is at the level of gene expression (how instructions in DNA are converted into a product such
as a protein).
9780170408851 CHAPTER 4 » DNA AND POLYPEPTIDE SYNTHESIS 113
04_bio_InFocus12_2e_sb_08851_txt.indd 113 09/08/18 9:19 am
Prokaryotic DNA
The DNA of prokaryotes and eukaryotes is chemically the same, but it differs in how it is structurally
arranged into chromosomes and packaged inside the cells. Its location inside these cells is also different,
and there are slight differences in the processes of DNA replication and transcription (how instructions
in DNA are used to make mRNA and initiate protein synthesis).
Cell wall Ribosomes Location and structure
Pili
As you learned in Year 11, prokaryotic cells are ‘primitive’
cells with a much simpler structure than eukaryotic
cells. They contain a single chromosome in the form of
a circular strand of DNA (Fig. 4.2). This chromosome has
no membrane around it and floats in the cytoplasm, in
a dense region known as the nucleoid. The DNA codes
for proteins that will be made on ribosomes in the
surrounding cytoplasm.
The circular, double-stranded prokaryotic DNA
is not a helix, but two circles of single-stranded DNA
twisted around each other like two pieces of string,
each joining at its own ends. The direction and number
Bacterial of twists contributes to the coiling and supercoiling of
flagellum
circular DNA.
Cytoplasm
Non-chromosomal DNA
Capsule Chromosome: Plasma Plasmid:
DNA membrane DNA Prokaryotic cells may have one or more small rings
of non-chromosomal DNA, called plasmids, floating
FIGURE 4.2 A prokaryotic cell, with DNA in a chromosome and in
plasmids separately in the cytoplasm (Fig. 4.2). The genes on these
plasmids code for features that are not essential to the
survival of the cell, but often provide bacteria with a
Science Photo Library/Dr. Gopal Murti
selective advantage, such as resistance to antibiotics.
Plasmids replicate independently of the chromosome.
Packaging of prokaryotic DNA
The circular chromosomal DNA of prokaryotes is about
1300 µm in length. It needs to fit into a cell such as
E. coli, which is only about 3 µm in length. When E. coli
DNA is isolated intact, the circular DNA is found to be
supercoiled and forms loops around a central protein
to form a nucleoid. The dense protein differs from the
histone proteins that package DNA in eukaryotic cells.
The dense protein is sometimes referred to as the
scaffold (Fig. 4.3).
Prokaryotes have evolved over millions of years, having
been exposed to many and varied selective pressures.
Scientists believe that, as a result, they have evolved a more
refined mechanism for regulating gene expression (an
operon system) than complex eukaryotic organisms such
FIGURE 4.3 Electron micrograph of a ruptured E. coli showing a
nucleoid – looping strands of DNA around a central protein (scaffold) as humans.
114 MODULE FIVE » HEREDITY 9780170408851
04_bio_InFocus12_2e_sb_08851_txt.indd 114 08/08/18 6:45 pm
Eukaryotic DNA
Eukaryotic DNA is located in a membrane-bound nucleus within the cell. Individual DNA molecules are
arranged into a number of separate chromosomes, and each chromosome is larger and more complex
than the chromosome in a prokaryotic cell. The DNA of a single chromosome in the fruit fly Drosophila
is 1.2 cm in length. Each human cell contains approximately 2 metres of DNA arranged as a total of
46 chromosomes.
Although eukaryotes have many more chromosomes than prokaryotes, the number of chromosomes
is not a measure of how complex the organism is. For example, the Chinese giant salamander has
60 chromosomes, but is less complex than a human (Table 4.1).
TABLE 4.1 Chromosome number in eukaryotes
ORGANISM NUMBER OF CHROMOSOMES (2n)
Fruit fly (Drosophila melanogaster) 8
Eastern grey kangaroo 16
Earthworm 36
Cat 38
Peanut 40
Human 46
Orangutan 48
Platypus 52
Sheep 54
Chinese giant salamander 60
Horse 64
Black mulberry 308
In most eukaryotic cells there is a large proportion of non-coding DNA (DNA that is not used directly
to make products such as proteins or RNA) in sequences called introns. In humans, only 3% of DNA is
coding DNA (DNA that contains sequences that code for products such as proteins or RNA). These coding
sequences in DNA are called exons. The exact function of non-coding DNA is still being researched; it
is thought to play a role in the spatial organisation of genes as well as in the control of gene expression.
Introns are almost never found in prokaryotes. There are two schools of thought on this – introns may
have accumulated during the evolution of eukaryotes, or they may have been lost from prokaryotes as
they evolved, simplifying their genome to allow them to divide rapidly.
Packaging of eukaryotic DNA
The DNA of eukaryotes is linear rather than circular and it also winds around proteins (called histones)
tightly, but it does not supercoil. It coils in a way that forms nucleosomes – bead-like structures made
up of long sequences of DNA wrapped around eight histone protein cores, similar to the way cotton is The effect
wrapped around a cotton reel (Fig. 4.4). Unlike nucleiods, which have only one type of protein, there are of histone
binding on gene
five main types of histones in eukaryotic cells, and all play a role in packaging DNA. DNA has a series expression is
of folding patterns, around different histones. Histones contain a large number of positively charged dealt with on
page 131
amino acids, which allow them to bind to the negatively charged phosphates of DNA. As a cell progresses (Fig. 4.21).
through the cell cycle, the nature of chromatin changes (page 84 and Fig. 5.3, page 152) and these changes
are thought to be linked to histone binding.
9780170408851 CHAPTER 4 » DNA AND POLYPEPTIDE SYNTHESIS 115
04_bio_InFocus12_2e_sb_08851_txt.indd 115 08/08/18 6:45 pm
a b Chromosome
Histones
Science Photo Library/Gunilla Elam
1400 nm
Linker DNA
DNA wound around Centromere
a cluster of histone
molecules
2 nm
Nucleosome Chromatin Nucleosome
(10 nm diameter)
30 nm
700 nm
DNA
10 nm
FIGURE 4.4 Eukaryotic DNA: a DNA coiled into nucleosomes; b top: a chromosome, showing chromatin; bottom: nucleosomes condensed into chromatin
Non-nuclear DNA in eukaryotes
Mitochondria and chloroplasts are organelles in eukaryotic cells that contain their own DNA. This DNA,
referred to as non-nuclear DNA, is inherited independently of nuclear (chromosomal) DNA. Non-nuclear
mitochondrial DNA (mtDNA) is found in the respiratory organelles of cells. The discovery of mtDNA has
proved extremely useful in studies of evolutionary relatedness.
mtDNA can be used to trace maternal inheritance. During sexual reproduction, the egg and sperm
each contribute half the zygote’s total DNA. However, sperm cells have very little cytoplasm and the larger
egg cell therefore contributes all the cytoplasm (and the organelles within it, including mitochondria).
Because mitochondria have their own mtDNA and replicate independently of the nucleus, all
mitochondria in a female lineage possess identical mtDNA (unless there is a mutation).
Mitochondrial DNA (mtDNA) is a very small (70 nm in diameter), circular molecule with only 37 genes
(Fig. 4.5). Thirteen of these genes make proteins that function in the electron transport chain during
chemical respiration in mitochondria. The other 24 genes make RNA molecules (22 make tRNA and
2 make rRNA, which you will learn about later in this chapter).
Each mitochondrion contains
rRNA Cytochrome b about 5–10 circular DNA molecules
and each cell has between 100 and
Human ancestry 1000 mitochondria. As a result,
testing Non-coding
Read about mtDNA region
small samples of tissue yield a
used to determine large amount of mtDNA. This
human ancestral lines.
DNA is easy to sequence because
NADH it is so short (16 500 base pairs in
Cytochrome c dehydrogenase
oxidase humans), compared with nuclear
tRNA DNA (around 3 billion base pairs in
Forensics and
humans).
mtDNA ATPase The rate of mutation of mtDNA
Read about mtDNA
used in human
is about ten times that of nuclear
identification. DNA.
Sequencing of mtDNA is used
FIGURE 4.5 A model of a mitochondrial DNA molecule, showing
some genes (70 nm diameter) more often than sequencing of
nuclear DNA, because the increased
variability of mtDNA makes it very useful for evolutionary studies (such as relatedness testing) as well as
for forensic biology (identity testing) and human ancestry studies.
116 MODULE FIVE » HEREDITY 9780170408851
04_bio_InFocus12_2e_sb_08851_txt.indd 116 08/08/18 6:45 pm
The use of mtDNA is of advantage, because mitochondria:
Mixing of paternal
◗ are inherited only from the mother, which allows tracing of a direct genetic line and maternal
genes during
◗ do not combine paternal and maternal genes, as nuclear DNA does (mixing genes during gamete crossing over in
formation and fertilisation) meiosis is dealt
with in Chapter 5.
◗ occur in large numbers in every cell, so they are easy to access and sample
◗ evolve very quickly because mtDNA does not have repair enzymes, and so mutations arise often
during replication.
You may wonder how, if mtDNA can undergo so many mutations, the mitochondria are still able to
function. Most changes in mtDNA are in sequences that do not code for proteins and so those mutations Mitochondrial
disease
are usually not harmful. In some instances, if mutations occur in DNA that does code for respiratory
Read about
proteins, mitochondrial disease may result. (See the weblinks for more information.) mitochondrial
disorders, genetic
testing and diagnosis.
KEY CONCEPTS
● Nuclear DNA is present inside the nucleus of each of our cells, and has about 3 billion base
pairs and around 20 000 protein-coding genes.
● The mitochondrial genome exists outside the cell nucleus, and has 13 protein-coding genes,
24 genes coding for RNA and about 16 500 base pairs.
● mtDNA has a higher rate of mutation than nuclear DNA, making it easier to identify differences
between closely related individuals.
● mtDNA is used to study evolutionary relatedness, construct evolutionary trees, investigate
family relatedness and identify people in forensic science.
INVESTIGATION 4.1
Modelling DNA in prokaryotes and eukaryotes
INTRODUCTION
Scientists have used several kinds of cells and organisms as models, to try to investigate and explain aspects Information and
of molecular biology such as DNA structure and replication, and its role in gene expression. In simple cells or communication
technology
organelles that have their own short, single molecule of DNA, the features of DNA are much easier to study. capability
Initially molecular biologists used these simple cells as experimental models to work out how DNA functioned.
As technology improved and biologists gained a greater understanding of DNA structure and functioning, they
moved on to studying similar processes in more complex cells to find out whether they followed the same pattern.
Table 4.2 outlines the features of some simpler cells and organelles that make them particularly
advantageous as experimental models.
TABLE 4.2 Genomes used as models for studies of molecular genetic mechanisms, compared with the human genome
mtDNA (HUMAN) PROKARYOTE (E.coli ) YEAST (S. cerevisiae) EUKARYOTE (HUMAN)
Genome size (base pairs) ± 16 500 4.6 million 12 million ± 3 billion
Number of genes 37 ± 4 300 ± 6 000 ± 20 000
Types of proteins encoded 13(and 24 RNAs) 4 000 5 000 100 000
Number of chromosomes 1 1 16 46
Significance of genome for Maternal inheritance allows study Small size makes Three times larger Complex and large
study of direct lineages. High rate of analysis easy. than E.coli, but amounts of non-
substitution mutations makes much simpler than coding DNA makes
it easier to distinguish between humans. it more difficult to
individuals. study.
9780170408851 CHAPTER 4 » DNA AND POLYPEPTIDE SYNTHESIS 117
04_bio_InFocus12_2e_sb_08851_txt.indd 117 08/08/18 6:45 pm
Alamy Stock Photo/Science Photo Library/Molekuul
Science Photo Library/Alfred Pasieka
a b
FIGURE 4.6 a Linear DNA of eukaryotes and b circular DNA of prokaryotes
TASK
1 You are required to use a model to describe, simplify, clarify and/or provide an explanation of the
structure of DNA in eukaryotes and prokaryotes. Make sure you consider which features of DNA you
Cells as intend demonstrating in your model (benefits of the model) and which features you will not be showing
experimental (limitations of the model).
models for
molecular biology 2 Write up your investigation as a scientific report, under the headings: Aim, Materials, Risk assessment
Prokaryotes such and safety, Method, Results (the model itself ), Discussion (benefits and limitations of the model) and
as E. coli, through
invertebrate Conclusion.
eukaryotes such as
yeast, fruit flies and 3 Peer review the models produced by at least two other groups of students. Using what you have learned
many others from these models, the information you have researched and information in this textbook, draw up a table
to compare the forms in which DNA exists in eukaryotes and prokaryotes.
Compare DNA under the following headings:
• Chromosomal structure
Comparison of • Packaging
prokaryote and
eukaryote DNA • Genetic information stored.
RESOURCES
Use the weblinks as a starting point for your research.
The complexity EX TENSION
of eukaryotic
genomes In your model, include one aspect of the functioning of DNA (such as replication and/or the start of
polypeptide synthesis).
KEY CONCEPTS
● Prokaryotic DNA is a circular, double-stranded DNA molecule, supercoiled to form a nucleoid
and found in the cytoplasm.
● Eukaryotic DNA is a linear double-stranded helix wound around histones to form
nucleosomes.
● Eukaryotic cells also have non-nuclear DNA, such as mtDNA in mitochondria in the cytoplasm.
Prokaryotic cells have non-chromosomal DNA in the form of plasmids.
118 MODULE FIVE » HEREDITY 9780170408851
04_bio_InFocus12_2e_sb_08851_txt.indd 118 08/08/18 6:46 pm
CHECK YOUR
1 Explain the meaning of the following terms:
UNDERSTANDING
a gene expression
b genome 4.1
c nucleosome
d nuceloid.
2 Explain what is meant by the statement: ‘The genetic code is universal’.
3 Give one similarity and two differences between prokaryotic and eukaryotic chromosome structure.
4 Compare the structure and functioning of non-chromosomal DNA in eukaryotes and prokaryotes.
5 Calculate the length of one human chromosome in comparison with the chromosome of a fruit fly.
4.2 Polypeptide synthesis
In the 1950s, Francis Crick proposed that DNA led to the formation of RNA, which in turn led to the
synthesis of proteins. Experimental evidence supported his proposal. The ‘flow of genetic information’
became known as the ‘central dogma of molecular biology’ (Fig. 4.7). In 1961, Francis Crick and Sydney
Brenner provided the missing link to decoding DNA, with their discovery that genes use three-letter
‘words’ or triplets of bases called codons to code instructions for each amino acid in a protein chain.
FIGURE 4.7 The
central dogma of
DNA RNA Protein molecular biology –
a summary of the
Replication Transcription Translation flow of genetic
information resulting
in gene expression
Scientists already knew that polypeptides were chains of amino acids and that these polypeptides
Assumed
joined to form proteins. It took about five more years to reveal specifically which triplet coded for which knowledge: refer
particular amino acid. In 1968, Marshall Nirenburg received a Nobel Prize for his work in cracking the to Biology in
Focus Year 11,
genetic code for protein synthesis, listing the 60 triplets that code for each of the 20 amino acids in Chapter 3,
proteins (Fig. 4.15, page 125). Section 3.2, Cell
requirements:
A polypeptide is a molecule made up of a chain of many amino acids, joined by peptide bonds proteins and
(Fig. 4.8). There are about 20 different amino acids that can be linked together in a linear sequence, to nucleic acids.
form chains of up to 300 amino acids in length.
Amino acid Peptide bond FIGURE 4.8 Amino
acids joined together
by peptide bonds
form the polypeptide
chains that make up
proteins.
9780170408851 CHAPTER 4 » DNA AND POLYPEPTIDE SYNTHESIS 119
04_bio_InFocus12_2e_sb_08851_txt.indd 119 08/08/18 6:46 pm
One or more polypeptides twist and join together into a particular three-dimensional shape, forming
proteins in cells. The sequence and arrangement of amino acids determines the configuration of the
protein (Fig. 4.9). Any change in the amino acid sequence may result in a change in the shape of the
protein molecule and this could affect the ability of the protein to carry out its function in the cell.
a b
Shutterstock.com/chromatos
Science Photo Library/Laguna Design
Chain A Chain A
FIGURE 4.9 A protein, the hormone insulin: a a simple model showing that insulin is made up of two polypeptide chains
joined at the points indicated (see red arrows); b a 3D molecular model of the structure of insulin
The ‘gene concept’ in molecular biology is that genes in a cell contain all the information for the
synthesis and functioning of cellular components. When the end product of a gene has been made by
the cell, we say the gene has been ‘expressed’. In specialised cells in multicellular organisms, only certain
genes are expressed in each cell type. Coded instructions for the production of a particular protein
(or group of proteins) are said to be ‘switched on’ in the DNA of that cell. This ensures that each cell
develops the necessary structures, in keeping with the type of tissue to which it belongs. For example, in
skin tissue, genes for the pigment protein melanin and the protein keratin are switched on in each cell,
ensuring that the cells become skin cells. Different genes are expressed in nerve cells, muscle cells and
bone cells (Fig. 4.10).
Attribution 4.0 License (https://creativecommons.org/licenses/by/4.0/)
OMICS International All Rights Reserved © 2018. Creative Commons
Mesenchymal stem cells The process of polypeptide synthesis
DNA never leaves the nucleus – the molecules are too large
to pass through the pores in the nuclear membrane. This is
just as well, as DNA molecules hold the original copy of all
Adipocytes
Neurons instructions for future generations of cells. In order for a cell to
make the particular group of proteins it needs, not all the DNA
Muscle cells
is needed; only the relevant instructions for proteins required in
that cell are accessed in the DNA nucleotide sequence. Because
Chondrocytes the DNA remains in the nucleus, an intermediate molecule
called messenger RNA (mRNA) is created and this carries a
Osteoblasts
transcribed copy of the relevant instructions from the nucleus
FIGURE 4.10 Cells differentiate and specialise as a result of to the ribosomes in the cytoplasm. The ribosomes are the cell
gene expression. ‘machinery’ that subsequently translates the message carried by
the mRNA into a cell product such as protein (Fig. 4.11).
120 MODULE FIVE » HEREDITY 9780170408851
04_bio_InFocus12_2e_sb_08851_txt.indd 120 08/08/18 6:46 pm
Shutterstock.com/Designua
DNA
tRNA
1 1. DNA is transcribed
into RNA.
4. More amino
acids are added.
mRNA 3. Amino acid
Gr
Nucleus 3
ow
5 attaches to tRNA.
in
g
Transcription
pr
5. tRNA breaks
o
4
te
off and picks up
in
Amino acid
another amino acid.
2
2. mRNA attaches to
a ribosome.
Ribosome
NA
mR Translation
FIGURE 4.11 Gene expression involves the information in DNA being decoded during transcription into RNA (1) and
subsequently translated into a product such as a protein (2–4).
Nucleic acids involved in polypeptide synthesis: DNA, mRNA and tRNA
Two types of nucleic acids are essential in the process of polypeptide synthesis: DNA and RNA. There are
three types of RNA, each with a specific role to play.
DNA
DNA consists of long chains of nucleotides wound into a double helix. The sequence of nucleotide bases
determines the meaning of the message – this is because it codes for the sequence of RNA nucleotides
and, ultimately, the sequence of amino acids that form the polypeptide chain.
RNA
Like DNA, RNA is a nucleic acid made up of a chain of nucleotides, but it differs from DNA in the following
ways:
◗ Most RNA is single-stranded.
◗ The sugar in RNA is ribose sugar (not deoxyribose sugar as in DNA).
◗ RNA has the nitrogenous base uracil (U) instead of thymine (T).
There are three types of RNA: messenger RNA (mRNA), transfer RNA (tRNA) and ribosomal RNA (rRNA).
◗ messenger RNA (mRNA) is single-stranded and is not twisted into a helix (Fig. 4.12a). mRNA molecules
are a few thousand bases long, much shorter than DNA. They are found in both the nucleus and the
cytoplasm. mRNA functions as an intermediate molecule, carrying information from DNA in the
nucleus to the ribosomes in the cytoplasm.
◗ transfer RNA (tRNA) molecules occur in the cytoplasm. Each molecule is 75 nucleotides long and
twisted into the shape of a clover leaf (Fig. 4.12b). At one end of the tRNA are three unpaired bases,
called an anticodon, which attach the tRNA to its complementary bases (codon) on the mRNA strand.
The other end of the tRNA is able to bind with an amino acid temporarily. Each tRNA molecule will
only attach to one particular amino acid. The specific sequence of three bases at the anticodon end
determines which amino acid will be carried by that tRNA.
◗ ribosomal RNA (rRNA) forms a structural part of ribosomes (Fig. 4.12c) and is made in the nucleolus
of the cell.
9780170408851 CHAPTER 4 » DNA AND POLYPEPTIDE SYNTHESIS 121
04_bio_InFocus12_2e_sb_08851_txt.indd 121 08/08/18 6:46 pm
Using a computer analogy, you could say that DNA is the operating system, mRNA is the software,
tRNA is the machinery (such as a 3D printer) and protein is the product created.
a b c
Amino acid Ribosome
Uracil
Anticodon
Messenger RNA (mRNA) Transfer RNA (tRNA) Ribosomal RNA (rRNA)
FIGURE 4.12 Three types of RNA: a mRNA, b tRNA and c rRNA (combined with protein to make a ribosome)
Transcription
Transcription occurs when an enzyme, RNA polymerase, binds to a section of DNA and begins building
Transcription
animation a chain of RNA nucleotides to form a complementary strand of RNA. Figure 4.13 shows the details of this
Work through the process. (The number of each step in the description below matches the sequence of numbered steps in
interactive animation
and make notes as Figure 4.13.)
you go, to create a
summary of the steps 1 RNA polymerase binds to a part of the DNA called the promoter and the DNA ‘unzips’ – that is, the
involved.
DNA unspirals, hydrogen bonds between the two strands break, and the strands separate over a short
length. This happens only in that part of the DNA that contains the gene to be used. Only one strand
of DNA contains the genetic information to make a protein; rather confusingly, it is called the non-
coding strand or sense strand; the other strand is called the coding strand (it has the same code as the
Translation (basic)
mRNA being made) or antisense strand.
Work though the 2 Transcription of the gene is controlled by the enzyme RNA polymerase. The sense strand of the DNA
interactive animation
and draw a flow chart acts as a template and RNA nucleotides are assembled, forming a complementary single-stranded
of the steps involved. mRNA molecule (that is, DNA is transcribed into mRNA). The sequence of nucleotide bases on
the mRNA molecule is the same as the DNA coding strand, except that it has U instead of T. (In
eukaryotes, ‘editing’ or splicing of pre-mRNA may take place at this point. This is dealt with in more
detail on page 124.)
3 The mRNA moves out of the nucleus and into the cytoplasm, where it encounters some of the millions
Translation
(advanced) of ribosomes in the cell. Usually one mRNA molecule is read by a large number of ribosomes, so
Play the interactive multiple chains of the same polypeptide product are produced from one mRNA template molecule.
animation and make a
summary of the steps
involved.
Translation
4 Translation occurs when the ribosomes move along the mRNA molecule and, as they do so, they
attach tRNA molecules to mRNA by temporarily pairing the bases of the tRNA anticodons with their
complementary triplets of bases (codons) on the mRNA.
Translation 5 The amino acids from the tail end of each tRNA are linked to one another by an enzyme to form a
Watch the video of
translation in real polypeptide chain. Each amino acid is then spliced off its tRNA carrier.
time.
6 The tRNAs move away from the mRNA, leaving the growing chain of amino acids, and move back into
the cytoplasm where they can pick up another amino acid and be reused.
122 MODULE FIVE » HEREDITY 9780170408851
04_bio_InFocus12_2e_sb_08851_txt.indd 122 08/08/18 6:46 pm
7 The polypeptide chain is then processed in the cell. It may be joined to one or more other polypeptides
and be further processed and folded into the correct shape for its functioning, forming the final
protein end product.
8 The mRNA is broken down into its individual nucleotides, which can be reused.
Cell nucleus
$
(
(
$
5
" 2 Transcription
Antisense strand
(coding strand)
C
( of DNA
(
$
5
‘Sense’ strand " "
or ‘non-coding’ 5 mRNA being
5
strand of DNA 6 " transcribed from DNA
" $ (the nucleotide U is
"
5 5 used in mRNA in the
$
( " place of T)
6
1 RNA $
" "
polymerase
5 $ "
5
( "
5 ( Nuclear membrane
G 6
A " "
C (
$
U "
RNA 5 6
nucleotide $ 4 Translation
pool
mRNA leaves through
3 nuclear pore
U C
U A C U A C A U G A 5
U A G
7 mRNA
6 U A C enters the
Peptide
bond A U G C ribosome
U A C U A C A U G A U
Amino acid
tRNA
tRNA moves into Ribosome
cytoplasm to ‘Start’ triplet 8
pick up a new A UG or codon
amino acid A A G
$ Anticodon
Pool of amino acids "
6
$ 6
(
RNA nucleotides
Key DNA RNA amino acids tRNA
FIGURE 4.13 The biochemical process of protein synthesis in a cell
9780170408851 CHAPTER 4 » DNA AND POLYPEPTIDE SYNTHESIS 123
04_bio_InFocus12_2e_sb_08851_txt.indd 123 08/08/18 6:46 pm
TABLE 4.3 Types of nucleic acids in cells and their role in polypeptide synthesis
DEOXYRIBONUCLEIC ACID (DNA) Macromolecule made of a double strand of nucleotides held together by weak hydrogen bonds between
base pairs; the ladder-like structure is twisted into a double helix and may be circular (prokaryotes) or linear
(eukaryotes); contains the sugar deoxyribose and the bases adenine, thymine, cytosine and guanine
NUCLEAR DNA (nDNA) DNA arranged as chromosomes in the nucleus of a eukaryotic cell
MITOCHONDRIAL DNA (mtDNA) Small molecules of DNA found in mitochondria; also known as extra-chromosomal DNA or non-nuclear DNA
RIBONUCLEIC ACID (RNA) Single-stranded molecule of nucleotides containing the sugar ribose and the bases adenine, uracil,
cytosine and guanine
MESSENGER RNA (mRNA) A single-stranded long RNA molecule containing the sugar ribose and the bases adenine, uracil,
cytosine and guanine; it is transcribed from a DNA template (non-coding strand); carries codons
(base triplets) that instruct amino acid assembly by ribosomes
TRANSFER RNA (tRNA) A small RNA molecule folded into a clover shape; carries an anticodon of three bases at one end and
a specific amino acid at the other end; works with the ribosome to transfer the correct amino acid for
inclusion in sequence to form a polypeptide
RIBOSOMAL RNA (rRNA) The RNA component of a ribosome which, together with protein, forms the ribosome subunits
needed to translate mRNA into a polypeptide chain
KEY
CONCEPTS
● Transcription occurs when the double helix DNA unzips and a single strand of mRNA is made,
using part of the non-coding strand of a DNA molecule as a template.
● Translation occurs when mRNA is ‘read’ by ribosomes and translated into a polypeptide, with
the help of tRNA.
RNA processing
In eukaryotic cells, mRNA that is transcribed from DNA is termed pre-mRNA, as further editing of this
RNA takes place in the nucleus before it acts as a template for translation into a polypeptide. Pre-mRNA
contains coding sequences of nucleotides, called exons, which will be translated into amino acid chains
(remember, exons are expressed as proteins). What scientists did not realise at first was that in between
these exons are sequences of nucleotides called introns, which do not code for amino acid assembly.
Directly after transcription, mRNA is edited (or spliced) and introns are removed (Fig. 4.14) by a
complex molecule called a spliceosome. The result of this splicing is the formation of a mature mRNA
RNA splicing of
molecule, which then moves from the nucleus to the cytosol for translation by ribosomes. The instructions
introns for splicing the mRNA are found within the introns – they code for their own removal.
FIGURE 4.14 mRNA Exon Exon Exon Exon
splicing and gene DNA Intron 1 Intron 2 Intron 3 Intron 4
regulation: following
gene transcription,
Transcription and removal of introns
mRNA alternative
splicing takes place, 1 2 3 4
whereby non- Pre-mRNA
coding intervening Alternative splicing
intron sequences
are removed by a
'spliceosome' to form
mature mRNA. Mature mRNA 1 2 3 1 2 4
Protein X Protein Y
Splicing is the second step in gene regulation and serves an important purpose in complex
organisms. A strand of mRNA produced from one gene is not always spliced in the same way. Alternative
ways of splicing mRNA give rise to different versions of the same protein. For example, in humans,
Alternative immunoglobulins (antibodies) are produced in response to a particular pathogen, such as a bacteria
splicing
or a virus (pages 398 and 402–403). Within a short space of time, the body produces different forms of
Read about how
alterative splicing antibodies or immunoglobulins specific to the invader. This is done by alternative splicing of mRNA,
introduces protein
diversity.
producing proteins that have a similar structure and/or function but are not identical. These are termed
isoproteins. Many complex organisms such as vertebrates have up to five times as many proteins in their
124 MODULE FIVE » HEREDITY 9780170408851
04_bio_InFocus12_2e_sb_08851_txt.indd 124 08/08/18 6:46 pm
bodies as invertebrates (such as worms and beetles), but only twice as many genes. Alternative splicing
provides a mechanism to explain this.
Eukaryotes have a large amount of non-coding DNA, originally termed ‘junk DNA’ (by Japanese
American biologist Susumo Ohno in 1972), as scientists did not know its purpose. For many years,
biologists ignored this DNA, but recent studies of non-coding DNA using advanced technology show that
its removal disrupts development of individuals in the embryonic state. Further research is showing that
non-coding DNA affects the shape of chromatin and how tightly DNA is wound around histones. When
some parts of this non-coding DNA are expressed, chromatin is less tightly packed, leading to the likelihood Non-coding
and ‘junk’ DNA
that non-coding DNA determines whether or not certain genes are read. Large portions of non-coding are dealt with
DNA may therefore be involved in regulating which genes are expressed in particular cells, resulting in the in more detail
in Chapter 7 on
differentiation of cells into particular tissue types. The term ‘junk’ DNA today is reserved only for that part pages 243–4.
of non-coding DNA that is not involved in gene regulation, DNA for which no known function has been
found. With the completion of the Human Genome Project, a large team of researchers has now joined a
project called ENCODE to work through the huge amounts of non-coding DNA to find out its function.
As mentioned previously, the universal genetic code of nucleotides in DNA and its transcribed
sequence in mRNA determines the amino acid sequence in proteins that are synthesised. Figure Is ‘junk DNA’
our genome’s
4.15 outlines the nucleotide codons in mRNA that correspond with the 20 amino acids made during equivalent of
translation on the ribosomes. The codon AUG is the start codon, signifying where translation should be a high-level
operating system?
initiated. There are three stop codons: UAA, UAG and UGA. The mRNA codon table (Fig. 4.15) can be Does ‘junk DNA’ play
used to work out the sequence of amino acids that will be created in a polypeptide, based on a DNA and a role in embryo
development? Read
mRNA sequence. Note that there is more than one codon that codes for each amino acid, creating some about the ongoing
debate.
flexibility for errors in the genetic code.
Amino acid key Second base
Ala = alanine U C A G
Arg = arginine
UUU UCU UAU UGU U
Asn = asparagine Phe Tyr Cys
UUC UCC UAC UGC C
Asp = aspartic acid U Ser
UUA UCA UAA Stop UGA Stop A
Cys = cysteine Leu
UUG UCG UAG Stop UGG Trp G
Gln = glutamine
Glu = glutamic acid CUU CCU CAU CGU U
His
Gly = glycine CUC CCC CAC CGC C
C Leu Pro Arg
His = histidine CUA CCA CAA CGA A
Third base
First base
Gln
Ile = isoleucine CUG CCG CAG CGG G
Leu = leucine
Lys = lysine AUU ACU AAU AGU U
Asn Ser
Met = methionine A AUC Ile ACC AAC AGC C
Thr
Phe = phenylalanine AUA ACA AAA A
AGA
AUG Met/ ACG Lys Arg G
Pro = proline AAG AGG
Start
Ser = serine
Thr = threonine GUU GCU GAU GGU U
Asp
Trp = tryptophan GUC GCC GAC GGC C
G Val Ala Gly
Tyr = tyrosine GUA GCA GAA GGA A
GCG Glu
GUG GAG GGG G
Val = valine
Use the bases along the sides and top of the table to find the base sequence you are looking for.
The cell where the three converge gives the abbreviation of the amino acid that is coded.
Note: Each amino acid may be coded by more than one codon.
FIGURE 4.15 mRNA codon table
9780170408851 CHAPTER 4 » DNA AND POLYPEPTIDE SYNTHESIS 125
04_bio_InFocus12_2e_sb_08851_txt.indd 125 08/08/18 6:47 pm
INVESTIGATION 4.2
A practical and secondary-source investigation to model
polypeptide synthesis
In this investigation, you will gather and process information from several sources to gain an understanding
of the process of protein synthesis, and develop your own simple model to explain the sequence of steps
involved in the process.
A model of protein synthesis can be developed in a number of ways:
1 class activity: video and group model creation
2 role play: students role play the processes of transcription and translation (also find YouTube video clips on
protein synthesis and other relevant websites)
3 assessment task: model and oral presentation
4 computer-generated model.
PART A: SECONDARY-SOURCE INFORMATION/STIMULUS MATERIAL
Watch the video Protein synthesis or another suitable video showing an animated version of protein synthesis.
Protein synthesis (See the weblink.)
PART B: PRODUCING A MODEL
Working in groups of up to four, use the materials provided to build a working model to demonstrate
polypeptide synthesis.
1 Decide as a group:
a what materials you will use to depict the structures involved in the process
b how you will make the necessary structures out of the materials provided
Literacy
c how the parts will be assembled on the butcher’s paper to create your working model
d who will make which structures
e any colour-coding that may make the model easier to understand
f the minimum number of nucleotide sequences you need to use so the resulting polypeptide chain
that your model makes contains at least four amino acids.
2 Remember to include in your model a representation of:
a both the nucleus (or part of a nucleus) where transcription
occurs, and the cytoplasm where translation occurs
b the four different nucleotide bases present in your DNA
and RNA strands
c ribsosomes, tRNA and amino acids.
3 Labels, arrows and/or numbers are useful to indicate the
sequence of events (Fig. 4.16).
PART C: PRESENTING THE MODEL FIGURE 4.16 Creating a model of protein
synthesis
Use the model to give a short oral explanation (as a group) of the
process of protein synthesis to your classmates. Be aware of the
limitations of your model – these will be assessed by the class at the end of each presentation.
You may be asked to explain any of the following concepts, using your model.
1 Outline how a change in DNA sequence can result in changes in proteins produced and therefore changes
in cellular activity.
2 Explain how mutations in DNA may lead to the production of a non-functional protein.
3 Explain why the ‘one gene – one protein’ hypothesis was altered to the ‘one gene – one polypeptide’
hypothesis.
126 MODULE FIVE » HEREDITY 9780170408851
04_bio_InFocus12_2e_sb_08851_txt.indd 126 08/08/18 6:47 pm
PART D: REPORT
WS
Write a report on the model that you and your group presented.
The process
1 Outline the purpose of developing this model. of protein
2 List the materials. synthesis
3 Justify the validity of your model.
4 Discuss any limitations of your model.
5 Acknowledge all secondary sources, using an accepted referencing style. WS
PART E: DO IT YOURSELF Protein
synthesis
View the presentation and complete the worksheet, The process of protein synthesis, using the mRNA codon presentation
table in Figure 4.15 to translate a protein from a given DNA sequence. (See the link provided.)
Function and importance of polypeptide synthesis: genes
to proteins
A gene is considered the smallest unit of heredity. Chemically, each gene is a portion of DNA with a
specific sequence of bases that encodes for a particular trait that can be passed from parent to offspring.
A locus is the position of a gene on a chromosome. The coded information within genes determines how How much
DNA codes for
living things look, behave and function – that is, it influences particular characteristics (phenotypes). protein?
A chromosome can therefore be described as a linear sequence of genes. The total amount of genetic List the following
structures in
material that an organism has in each of its cells is called its genome. order of size, from
Specific staining techniques are used to show banding patterns on chromosomes (Fig. 4.17) and smallest to largest:
chromosome, gene,
these bands correspond on homologous pairs of chromosomes. The banding patterns can also be used DNA, nucleotide,
base, genome.
to identify the positions of particular genes on chromosomes (Fig. 4.18). With modern technology,
particular genes can be marked with fluorescent tags that show up on the chromosome, assisting gene
mapping. Specific genes can therefore be associated with a particular physical feature or trait. Alleles are
different forms of the same gene (Fig. 4.18).
Maternal Paternal
chromosome chromosome
Science Photo Library/L. Willat, East Anglian Regional Genetics Service
Locus 1 a A
This locus contains
genes A and B b B
Locus 2
This locus contains C c
gene C
Centromere
d D Gene D : alleles D or d
E e Gene E : alleles E or e
f F Gene F : alleles F or f
FIGURE 4.17 Human karyotype with 46 chromosomes,
showing the banded patterns of gene loci FIGURE 4.18 Genes located on homologous chromosomes
9780170408851 CHAPTER 4 » DNA AND POLYPEPTIDE SYNTHESIS 127
04_bio_InFocus12_2e_sb_08851_txt.indd 127 08/08/18 6:47 pm
Changing definition of a gene
The definition of a gene has changed as biologists come to understand more about how genes
function. At first, a gene was defined as a sequence of nucleotides that codes for one protein. Advances in
understanding of the biochemical functioning of cells have led to the definition changing to a sequence
of nucleotides that codes for one polypeptide chain. More recent research has shown that some genes
code for rRNA and tRNA, which are not proteins at all, and that in other instances one gene may
code for more than one polypeptide sequence (due to the splicing and rearrangement of blocks of
mRNA before translation). Therefore the definition of a gene may need to change to a more functional
concept: a sequence of nucleotides that codes for any molecular cell product.
KEY CONCEPTS
● A gene is made up of linear sequences of nucleotides that code for a cell product, such as a
polypeptide chain.
● In eukaryotes, mRNA may be processed after transcription (introns are spliced out) before it
passes into the cytoplasm and binds with ribosomes to direct the formation of a polypeptide.
● mRNA is translated, with the help of tRNA on ribosomes, into polypeptide chains. A table of
mRNA codons has been created from researched evidence, showing which triplets of bases code
for which amino acid.
● The process of polypeptide synthesis may be modelled, but all models have limitations.
● Homologous chromosomes carry genes for the same traits in the same position (locus), but
these genes may have alternative forms (alleles).
● Specific genes are associated with specific traits and are expressed in specialised cells.
CHECK YOUR
UNDERSTANDING 1 Compare DNA and mRNA in terms of structure and function.
2 Distinguish between the three types of RNA, state where each is found and outline the role of each in
4.2 polypeptide synthesis.
3 The genetic code is sometimes described as a triplet code. Explain what this means.
4 Draw a diagram to show the meaning of the following terms: chromosome, gene, allele, locus.
5 Distinguish between the terms gene, genome and trait.
6 Draw a flow chart to model the process of polypeptide synthesis. Identify two benefits and one limitation
of your flow chart model.
How genes and the environment
4.3 affect phenotypic expression
Is the ability to play sport inherited? Why does tightrope walking tend to run in families? Is shyness
The genotype is
the set of genes in genetically determined or does the environment in which we grow up influence this? What about
an organism’s DNA intelligence? Why do identical twins who are separated at birth and later reunited often show unexpected
that is responsible
for a particular similarities, such as having the same hobbies, liking the same foods and even choosing the same career?
trait. Genotype can If they are genetically identical, why do these twins have differences, such as different susceptibility to
be determined by
biological testing. certain diseases?
The phenotype is the The phenotype of an organism is often defined as its physical appearance, but today we know that
physical expression,
or characteristics, phenotype includes the sum of all gene products. The term phenotype in this context includes the
of that trait and can structure, behaviour and physiology of an organism.
be determined by
observation. We also know that the genotype (genetic blueprint) of every cell is the same, yet each cell becomes a
specific type of cell in a particular tissue. This specialisation of cells is brought about by controlling the
expression of genes within the cells. Gene expression is the translation of genes into their protein end
128 MODULE FIVE » HEREDITY 9780170408851
04_bio_InFocus12_2e_sb_08851_txt.indd 128 08/08/18 6:47 pm
products. These products determine the physical and chemical features typical of each cell type and the
overall phenotype of an organism.
Some variations in organisms are genetically determined (‘nature’), whereas others are influenced
by the environment (‘nurture’). Many variations arise as a result of an interaction between the two – the
environment can influence how genes are expressed. The term ‘nurture’ here refers to a wider influence
of the environment than just the nurturing one of the home; it includes all environmental influences.
Gene expression has been studied for
over half a century, with biologists intent on
Getty Images/hartcreations
finding out how the gene sequence shows up
as the phenotype. For example, how does DNA
determine what blood group a human belongs
to, what colour fur an animal has and how tall a
plant grows?
Studies of both plants and animals show
that, although genes may be direct determinants
of phenotype, gene expression can be enhanced
or masked by factors in the environment. In twin
studies, the phenotypes of identical twins (with FIGURE 4.19 Identical twins: any differences are due to
identical genotypes) have been analysed. The effects of the environment.
Identical twins
reasoning behind this is that any phenotypic have identical
genes, but may
differences between identical twins must reflect the influence of the environment. Studies of twins not have identical
separated at birth have formed a major part of these studies, because the effect of ‘nature’ (genotype) and gene expression,
a difference
‘nurture’ (environment) can then be explored independently. that may be
More recent research involves biologists investigating how the environment influences gene influenced by
epigenetics.
expression at a molecular level, leading to a field of study called epigenetics. Some results suggest that
the environment may chemically modify DNA in individuals and in this way affect gene expression. This
chemical modification is not a change in the sequence of bases in the genome (as in mutations), but WS
instead seems to involve chemical markers or tags being added to DNA.
Extension: Investigating
alcoholism, IQ and
height
Gene expression and phenotype
Genes that are expressed dictate the types of proteins in cells and, as a result, the overall phenotype of
organisms. A great deal of current research involves using stem cells to try to find out how cells ‘know’
what kind of cell to become. Stem cells are unspecialised cells that are capable of dividing and becoming
specialised tissue. Embryonic stem cells are capable of dividing and giving rise to any type of tissue within
an organism, and so they are termed pluripotent (pluri = many; potent = potential). Stem cells also occur in The epigenetics
some adult tissue (adult stem cells) but these are not pluripotent, as they are only able to give rise to cells of identical
twins
of one tissue type. Stem cells undergo asymmetric division – they give rise to two daughter cells, one of Describe the
model that was
which will continue to divide and another that will follow the path of differentiation. Studies have shown used to represent
that when stem cells differentiate, special proteins called transcription factors appear to control which epigenetic
modification of
genes in the cells are transcribed. These transcription factors therefore determine the developmental chromosomes.
pathway of a cell and the type of tissue it will become.
It is interesting to note that, because each step in the process of gene expression is regulated by
WS
proteins, genes must produce the proteins that regulate their own expression. The accurate synthesis of
proteins according to DNA instructions is therefore of ultimate importance in assembling amino acids Epigenetics: chemical
modification of gene
in the correct order in each polypeptide, as this gives rise to the three-dimensional structure of each expression that may be
protein – essential for the correct functioning of cells and to produce an overall phenotype in organisms inherited
that is free of disorders.
9780170408851 CHAPTER 4 » DNA AND POLYPEPTIDE SYNTHESIS 129
04_bio_InFocus12_2e_sb_08851_txt.indd 129 08/08/18 6:47 pm
Environmental effects on gene expression and phenotype
The coat colour of Siamese cats is determined by a colour mutation (Fig. 4.20a, b). Cats that have the
allele C have uniform pigmentation of their fur over all parts of their bodies. However, cats that are
homozygous recessive for the mutant allele c have dark pigmentation at the extremities of their bodies –
the tips of their ears, tail, legs and face. These are also the areas of poorer circulation – the last to obtain
heat from the blood (think of which parts of your body get cold first in really low temperatures). Pigment
can be produced by the allele c only at low temperatures. Other parts of the cat’s body are subjected to
higher body temperatures and so no dark pigment is produced. As the cat gets older, these areas may
darken more as circulation becomes poorer and a greater proportion of each extremity is colder. The
phenotypic expression of colour is therefore influenced by the temperature of the environment.
An example of the effect of the environment on plant phenotype is seen in flower colour in hydrangeas.
The acidity or alkalinity of the soil influences the colour of the flowers. Hydrangeas growing in acidic soil
develop blue flowers, whereas those grown in alkaline soil develop pink flowers (Fig. 4.20c, d).
Another example of how the environment affects phenotype is when a change in temperature or pH
causes a change in the shape of the active site of an enzyme, increasing or decreasing its binding with the
substrate and therefore affecting its functioning (refer to Year 11 work on enzymes).
A simple example of how the environment affects gene expression can be seen in the growth of
humans. Human height and infant birth weight have a genetic basis, but lack of nutrients or the presence
of toxins (such as those in cigarette smoke) can restrict growth. Another well-researched example is
that of the disease phenylketonuria (PKU). This is a rare genetic disease whereby the amino acid
phenylalanine builds up in the body and results in symptoms that become increasingly severe as time
passes. These symptoms range from behavioural and emotional problems through to developmental
delays such as stunted growth, seizures and brain damage. Early intervention with a diet low in proteins
that contain phenylalanine can affect gene expression, slowing down the onset of the disease and keeping
the symptoms at bay.
Getty Images/iStock/catman73
Getty Images/iStock/pixalot
a b
Getty Images/iStock/dkapp12
c d
Getty Images/lillisphotography
FIGURE 4.20 The effect of environment on phenotype: a young Siamese cat; b dark-tipped older Siamese cat; c blue
hydrangea in acidic soil; d pink hydrangea in alkaline soil
130 MODULE FIVE » HEREDITY 9780170408851
04_bio_InFocus12_2e_sb_08851_txt.indd 130 08/08/18 6:47 pm
Regulation of genes for phenotypic expression
Gene expression can be understood in terms of the switching on and off of genes, as needed. Investigations
into gene expression have shown that gene expression may be regulated at various stages of DNA
transcription into RNA and its subsequent translation into proteins, as discussed below. An interesting
part of this research is that gene expression may also be affected by changes in the cellular environment.
Gene regulation by modifying DNA for transcription
Initiation of transcription seems to be determined by how densely DNA is bound to histones and this in
turn affects gene expression. Epigenetics explores how chemical modifications to either the histones or the
chemical structure of DNA (without changing the base sequence) may affect the density of DNA binding
and, in turn, affect the switching on or off of genes. Regions of DNA that are tightly bound are inaccessible
to RNA polymerase, the enzyme that starts transcription. Chemical changes such as methylation (adding
a methyl group) and acetylation (adding an acetyl group) to non-base parts of DNA or to histones has been
found to affect transcription. Generally, DNA methylation represses transcription, and loss of methylation
activates genes. This is because methylation appears to increase the density of binding between DNA
and histones, acting as a ‘muffler’ in silencing gene expression, whereas adding an acetyl group seems to
have the reverse effect, making DNA accessible to RNA polymerase and thereby promoting transcription
(Fig. 4.21). Methylation and/or acetylation of histones may have similar effects on DNA binding and
gene expression. This raises the question of whether these epigenetic changes can be inherited from
one generation to the next. Research shows that most epigenetic markers are wiped clear at the start of
embryonic development, but some are not, leading to interesting current research into whether changes
in the environment that cause ‘tagging’ of DNA with epigenetic markers can cause heritable variations.
Shutterstock.com/ellepigrafica
DNA inaccessible, gene inactive
Methylation
Me Me
Methyl group Me Me
b
Acetylation 10 nm
Histone tail
Ac Ac
Ac Ac
Acetyl group DNA accessible,
gene active
Histone
Ac
Ac
Ac Ac
FIGURE 4.21 Chemical changes affect transcription and gene expression: a methylation of DNA makes it tightly packed,
which ‘silences’ the genes because they cannot be accessed by transcription factors and be expressed; b acetylation of DNA
promotes transcription.
Cancer was the first human disease to be linked to epigenetics. In 1983, researchers investigated the
chemical structure of DNA in diseased tissue from patients with colorectal cancer and compared it with
DNA in normal tissue from the same patients. The DNA in the cancerous cells of these patients had less
methylation than DNA in normal tissue from the same patients. DNA that is not being transcribed in a
9780170408851 CHAPTER 4 » DNA AND POLYPEPTIDE SYNTHESIS 131
04_bio_InFocus12_2e_sb_08851_txt.indd 131 08/08/18 6:47 pm
cell is normally methylated (it has a methyl group added to its cysteine base) and this turns off the genes.
A decrease in DNA methylation can cause abnormally high gene activity – this is typical of cancer cells,
which divide uncontrollably. Too much methylation can also be harmful, by not allowing the action of
protective tumour suppressor genes. This has led to a flourish in research to investigate links between
epigenetics and disease.
Gene regulation during the transcription process
Elongation of RNA and the termination of transcription are other steps in the process of transcribing
DNA to mRNA where regulation of gene expression may occur. Protein factors influence whether mRNA
elongation continues or terminates, and production of these factors relies on other genes. If the production
or binding of transcription factors is affected, gene expression will be affected. These proteins that regulate
transcription are also produced by genes, so this means that some genes encode their own functioning.
Post-transcription gene regulation – modifying and processing RNA
Processing of mRNA before it leaves the nucleus is thought to be one of the most common forms of gene
regulation in eukaryotes. RNA processing and modification may involve:
◗ alternative splicing (removing introns) – as described on page 124 (Fig. 4.14)
◗ regulating the length of time for which mRNA remains stable. The longer an mRNA molecule lasts,
the more protein will be translated. If the mRNA degrades more quickly, less protein will be made.
Small non-coding RNA molecules called microRNA (miRNA) can silence mRNA after transcription.
The miRNA molecules may pair with and silence mRNA by:
◗ cutting RNA into two pieces
◗ making RNA unstable by shortening its poly(A) tail
◗ interfering with the translation of RNA on ribosomes.
Post-translation gene regulation – modifying proteins
After translation, the protein product made from mRNA may be inactive until a chemical is added, or it
may be active until a chemical group is removed, regulating phenotypic expression.
A summary of stages at which gene expression in eukaryotes may be regulated is shown in Figure 4.22.
Nucleus
Degraded mRNA
Pre-mRNA
Mature
Open DNA mRNA mRNA
Polypeptide Active protein
Chromatin
6 Post-translational
modification (folding,
An operon is a set glycosylation,
of genes that is transport, activation,
transcribed under 1 Chromatin 2 3 RNA 4 mRNA 5 degradation of protein)
the control of an remodelling Transcription processing stability Translation
operator gene.
It includes the Cytoplasm
structural genes, an
operator gene and a
regulatory gene. FIGURE 4.22 Regulation of gene expression in eukaryotes
132 MODULE FIVE » HEREDITY 9780170408851
04_bio_InFocus12_2e_sb_08851_txt.indd 132 08/08/18 6:47 pm
The regulation of gene expression in prokaryotes differs from that of eukaryotes, because prokaryotes
do not have introns. Bacterial gene regulation has been studied in detail by looking at the LAC operon.
The LAC operon relies on the fact that some bacteria use lactose for sustenance, but most bacteria use
glucose. If no glucose is present, bacteria turn on a gene that allows them to turn lactose into glucose.
INVESTIGATION 4.3
A secondary-source and practical investigation into the effects
of environment on gene expression and resulting phenotype
You may do either investigation A or B, or both. Or you might wish to conduct investigation A and design (but
not conduct) investigation B. Conducting investigation B is an advanced option and your choice will depend
on the resources available in your school, your areas of interest and investigative skills, and the time and
resources available to your teacher. Conducting investigation B may be part of a depth study.
INVESTIGATION A
You are to plan and conduct an investigation to demonstrate the effect of environment on the phenotype of
‘genetic barley’.
BACKGROUND INFORMATION
Both genotype and environment may influence the phenotype of an organism. For an investigation to be
valid, there can be only one variable – in this case, either genotype or environment. Because this investigation
explores the effect of environment on phenotype, the genotypes of the organisms used in this investigation
must be kept the same (genotype is a controlled variable). This will ensure that any change evident in
phenotype has been influenced by the change made to the environment. Genetic barley is an F1 hybrid where
all seedlings are genetically similar. This is an example of a plant that may be used to allow you to determine
the effects of environment on the phenotype of a plant. There are others that may be used, depending on your
preferences and those of your teacher, and on the availability of equipment.
METHOD
1 Identify and clearly express the problem.
2 Form a clear hypothesis.
Refer to
3 Choose appropriate equipment and conduct a risk and safety assessment. Chapter 1 to
revise how to
4 Use a logical scientific method – select a suitable strategy to investigate the question, one that allows valid formulate a
and reliable results to be collected. hypothesis, plan a
valid investigation
5 Identify controls and variables and use an adequate sample size. and communicate
6 Measure, observe and record results in accessible and recognisable forms; carry out repeat trials as your findings.
appropriate.
7 Use appropriate data collection techniques.
8 Assess the accuracy of your measurements and calculations, and the relative importance of the data
gathered.
9 Draw valid conclusions from the data – identify trends and patterns, justify inferences and conclusions, and
generate plausible explanations related to your observations and to contradictions in data and information.
RESULTS
Use appropriate methods to analyse, process and present your results.
Present your investigation in the form of a scientific report.
9780170408851 CHAPTER 4 » DNA AND POLYPEPTIDE SYNTHESIS 133
04_bio_InFocus12_2e_sb_08851_txt.indd 133 08/08/18 6:47 pm
DISCUSSION
1 Conduct a secondary-source investigation to find results of other similar investigations. Assess whether
they support or refute the findings of your own practical investigation, and how they may add to your
findings.
Evaluate the methodology that you used and describe how you could improve your investigation plan.
Revise experimental
error in Chapter 1, 2 Explain what may have given rise to the patterns, trends and/or relationships in your discussion. Use
pages 19-21. secondary resources to help you explain the science behind your findings.
3 Justify why you could/could not make a valid deduction as to whether the changes in phenotype that
you observed and measured were due to the effect of the environment and were not due to genetic
differences.
4 Assess the reliability and accuracy of your investigation, discussing any errors that may have arisen due to
experimental error.
5 Evaluate the methodology that you used in your investigation and use secondary sources to help you
suggest improvements to this method. Explain how you would modify your investigation plan to improve
it for a future investigation of this type.
6 As a whole class, discuss the advantages and disadvantages of conducting this investigation.
CONCLUSION
Draw a valid conclusion based on your results. (There should be no inferences or explanations in your
conclusion.)
INVESTIGATION B (ADVANCED)
This part is a secondary-source and practical investigation into the effects of environment on gene expression
and resulting phenotype in prokaryotes.
1 Secondary source investigation – research theoretical background information.
Go to the weblink and read the Jacob-Monod hypothesis for gene regulation.
Jacob-Monod 2 Practical investigation – research practical background information on experimental design for an
hypothesis for
gene regulation investigation of this kind.
In the weblink Gene induction, read the experimental design to investigate the expression of a gene in the
bacterium E. coli that is switched on in the presence of lactose, noting how both qualitative and quantitative
data can be collected for the investigation.
3 Design a practical investigation (optional for advanced study).
Gene induction Using your understanding of the practical methodology, as well as your knowledge of how the β-galactose
structural, regulator and operator genes work together, design an investigation to find out what would happen
to the production of β-galactosidase if one of the genes was mutated or a different sugar was introduced. To
help you decide on your investigation question and design, follow these steps:
a Create a chart:
What do we know?
LAC operon
Explain how a What do we think we know?
repressor protein
prevents the What do we want to find out?
transcription of RNA
and how the presence
Think of a specific question, such as:
of lactose in the – What would happen if the regulator gene was deleted by a mutation?
environment affects
this. – Does glucose have a similar effect on the enzyme to that of lactose?
b State the hypothesis of the original experiment described in step 2. Create your own (revised)
hypothesis for what you wish to find out.
c Design an investigation to test your hypothesis.
Using your understanding of the procedure above and the functioning of the structural, regulator and
operator genes for β-galactose manufacture, design a practical investigation that could be conducted using
134 MODULE FIVE » HEREDITY 9780170408851
04_bio_InFocus12_2e_sb_08851_txt.indd 134 08/08/18 6:47 pm
the equipment available in a school. Research methods that may be applied using simpler equipment, if
necessary.
d Conduct the experiment (if your school has the resources).
e Use secondary sources to find results of other similar investigations and assess whether they support or
refute the findings of your primary investigation, or to add to your findings. Use your secondary-source
investigation to research answers to the questions that have arisen as a result of your investigation, to
find out whether or not your experimental results are as expected in the literature, and to explain the
science behind your findings. Evaluate the methodology that you used and describe how you could
improve on your investigation plan.
f As a class, formulate new, revised hypotheses that could be researched further. (You do not need to
conduct this further research.)
INVESTIGATION 4.4
Secondary source investigation to assess how genes
and environment affect gene expression
You are to research, analyse and evaluate the available literature to assess how genes and the environment Literacy
affect phenotypic expression. You will need to identify and research the effect of both genes and the
environment on at least one phenotypic trait.
Critical and
Your research may lead you to studies that explore epigenetics as well. If so, take care to evaluate the validity, creative
reliability and accuracy of your sources and use your critical thinking skills to draw an evidence-based conclusion. thinking
Once you have read widely, formulate a research question or hypothesis. When gathering information, Personal
bring together the results of different studies, pointing out where researchers agree or disagree, and where and social
capability
significant questions remain. Draw your own conclusions, presenting your perspective as an evidence-based
argument, and identify any gaps in the research to indicate directions for future research.
The difference between a research question and a research hypothesis depends on how much is known in
the field. If a large amount of literature is already available and you are able to make a prediction about results, Review
formulate a hypothesis. If little is known and you need to explore to find information, use a research question. proposing
Remember to group the literature according to common themes and then explain the link between the a research
question and
research question/hypothesis and the literature reviewed. formulating a
Follow the three rules of effective research: hypothesis in
Chapter 1,
• variety (use a range of key words and multiple sources) pages 11–12.
• reliability (use information from trusted sources)
• consistency (ensure information is relevant to the topic).
At the end, pair up so that you can peer assess a literature review written by another member of your class.
As a class, determine criteria for peer assessment before you begin writing your literature reviews.
PART A: CRITIQUE A LITERATURE REVIEW Literature
review: Is the
Read how to write a literature review (Chapter 1, page 9) and then read the example of a simple literature ability to dance
determined by
review at the weblink provided here. Critique the example on the weblink, outlining three strong points and genes?
two areas where it could be improved.
9780170408851 CHAPTER 4 » DNA AND POLYPEPTIDE SYNTHESIS 135
04_bio_InFocus12_2e_sb_08851_txt.indd 135 08/08/18 6:47 pm
PART B: CONDUCT YOUR LITERATURE REVIEW
1 Do wide reading to define the topic and make some notes on opposing points of view.
2 Formulate (write) a research question or hypothesis to narrow down your secondary-source investigation.
(See page 8 on proposing a hypothesis or research question.) Write a list of key words that you could use to
find answers to your research question.
3 Find relevant articles using databases, Internet search engines and library catalogues. Outline opposing
points of view in the research and critically analyse the validity of views expressed in your sources. (See
page 10 on evaluating sources.) Draw a conclusion to your research question through an evidence-based
argument. Acknowledge your sources using an accepted referencing style.
4 Communicate your information clearly and accurately. Use the correct structure for writing a literature
review: introduction, body and conclusion. See page 9 for more details on how to structure a literature
review and what type of information to include in each part.
Remember to use correct scientific terms and keep the language at a level that is suitable for Year 12
students to peer review your work.
5 Draw your own conclusions about the research, based on your findings. Express your perspective on the
strengths and weaknesses of the research you are reviewing and use your findings to support your judgement.
Your literature review should be 400–800 words. This may vary, depending on your research question and
the depth of your research. Seek permission from your teacher before making your literature review longer
than this. Remember: it is quality, not quantity, that counts.
6 Peer review at least one literature review written by someone else in your class, using criteria drawn up by
the class. See page 4 in Chapter 1 for a reminder of what to look for when conducting a peer review.
KEY CONCEPTS
● Gene expression is the switching on and off of genes to make the required proteins and other
end products in particular cell types.
● Phenotypic expression is the result of gene expression – the structure, physiology and
behaviour of an individual as a result of genes that have been expressed.
● Some variations within a population are due to the influence of the environment, rather than
having a genetic (DNA sequence) basis.
● Identical twins have identical genotypes, and therefore any phenotypic differences can be
attributed to environmental influences.
● An example of variation brought about by the environment is the difference in colour of flowers
in hydrangeas (dependent on pH of the soil).
● Chemical modifications of DNA that do not involve a change in the sequence of nucleotides are
termed ‘epigenetic’ modifications. They may be the mechanism by which some environmental
factors bring about variation. The result is a change in phenotype without a change in genotype.
● Epigenetic changes show links to disease, including cancers and metabolic diseases.
CHECK YOUR
UNDERSTANDING 1 Using examples, explain how:
a genes affect phenotype
4.3 b the environment may affect phenotype in a manner that is not heritable
c the environment may affect phenotype in a manner that is heritable.
2 Identify reasons why cells do not express all the genes in their genomes.
3 Outline how the packaging of DNA affects gene expression.
4 Compare the effects of methylation and acetylation of DNA on gene expression.
5 Explain, using an example, how epigenetics may account for a phenotypic change.
6 How do scientists account for the fact that humans have fewer genes than the number of types of proteins
in cells?
136 MODULE FIVE » HEREDITY 9780170408851
04_bio_InFocus12_2e_sb_08851_txt.indd 136 08/08/18 6:47 pm
The structure and function
4.4 of proteins in living things
Proteins are the most abundant organic molecules in cells. They are responsible for forming the basic
Revise your
structure of cells and for carrying out all the work in cells, by controlling all chemical reactions. Year 11 work on
protein structure.
Structure of proteins
Proteins are made up of one or more long chains of nitrogen-containing amino acids. Each chain is called WS
a polypeptide. Each protein within an organism is folded into a particular shape that is crucial to its Protein revision
functioning. Proteins bind with other molecules to carry out their functions, and so their shape and
chemical properties (such as electrical charge and attraction to water) allow the proteins to function in
a particular way. If a single chain
of amino acids is
longer than 40-
Chemical structure of proteins 50 amino acids
and folded in a
Proteins contain the chemical elements carbon, hydrogen, oxygen and nitrogen, and sometimes sulfur. specific manner,
These elements combine to form amino acids, which are the building blocks of proteins. There are about it is termed a
protein. If the
20 amino acids; they can be put together in chains of up to 300 amino acids. The amino acids in each chain is shorter
linear sequence or polypeptide chain are held together by chemical bonds (forces of attraction) known than 40-50
amino acids and
as peptide bonds. One or more polypeptides can be twisted together into a particular shape, resulting in combines with
the overall structure of a protein. The sequence and arrangement of the amino acids determines the type other chains
to fold into a
of protein, in the same way that sequences of the letters of the alphabet can be used to make words and functional protein,
then sentences. it is termed a
polypeptide.
Models of the
a protein insulin
can be seen on
H ‘Acid’ page 120
group (Fig. 4.9).
‘Amino’
group HN C COOH H CH COOH
Nitrogen C CH2
present
CH2 Represented NH2
as
Proline Glycine
b Polypeptide
S S
Protein
S S
Specific sequences of amino acids
FIGURE 4.23 Protein structures: a structural formula of two amino acids, proline and glycine. The hydrocarbon chains
of amino acids differ in length and are known as the ‘R’ group; b two polypeptide chains of amino acids held together by
peptide bonds (chain), with chains held together by sulfide bonds, making up a protein (e.g. insulin)
Physical structure of proteins
The structure of proteins can be described at four levels: primary, secondary, tertiary and quaternary
(Fig. 4.24).
9780170408851 CHAPTER 4 » DNA AND POLYPEPTIDE SYNTHESIS 137
04_bio_InFocus12_2e_sb_08851_txt.indd 137 08/08/18 6:47 pm
a Primary structure b Secondary structure
The amino acid sequence With folding as a result of hydrogen bonding
HO O
H
C C C
N
H O C
C C H
H N C O N C
N C C
C O H N O
Peptide C C
C
HO
bond N H O C
C
N C
H
C N
O C N H O
C
C C H HO
H N C O or N C O
N C
O
Amino C O H N O
HO
C C
acids C
N C
H
N H O C C N
O
O C N H O
C C
H N C O
Alpha helix
C O H N
C C
H Pleated sheet
N
H
d Quaternary structure c Tertiary structure
The relationships between With secondary folding caused by interactions between
individual subunits the polypeptide and its immediate environment
FIGURE 4.24 The four levels of protein structure: a primary, b secondary, c tertiary and d quaternary
The basic structure of a protein is a polymer of amino acids, arranged in linear chains or polypeptides,
and is termed its primary structure. However, it is the shape of the protein, not merely the amino acid
sequence, that determines its function. Proteins have a hierarchy of folding that gives them their specific
Proteins made up shapes.
of a single
polypeptide chain The secondary structure is the three-dimensional arrangement of the polypeptide chain. The
have primary, secondary structure forms as a result of the amino acid chain becoming linked by hydrogen bonds, either
secondary and
tertiary structure. twisting the polypeptide into a spiral (alpha helix) typical of a fibrous protein, or folding it into a pleated
Proteins made up sheet rather than a spiral, also held together by hydrogen bonds.
of more than one
polypeptide chain Further folding leads to the tertiary structure that is seen in more complex proteins such as globular
have quaternary proteins. Certain forces of attraction between alpha helices and pleated sheets (such as disulfide bonds)
structure.
cause the polypeptide to fold into a more complex three-dimensional shape.
Quaternary protein structure occurs in proteins that are made up of two or more polypeptide chains
that link to create a more complex three-dimensional structure.
A single protein molecule may contain more than one type of protein structure. For example, the silk
of a spider contains pleated sheets joined by less ordered alpha helices.
Some proteins, called conjugated proteins, are linked to a non-protein part called a cofactor. If the
cofactor is tightly bound, it is termed a prosthetic group and may be organic or an inorganic metallic ion.
138 MODULE FIVE » HEREDITY 9780170408851
04_bio_InFocus12_2e_sb_08851_txt.indd 138 08/08/18 6:47 pm
The blood pigment haemoglobin contains inorganic iron as its prosthetic group. If a cofactor is loosely
bound to an enzyme, it is known as a coenzyme (often an organic molecule such as a vitamin).
The primary structure of a protein (the linear amino acid sequence) determines the secondary and
tertiary structure of the protein, particularly those amino acids that are involved in forming bonds to
create the spiral or pleated sheets. If the incorrect amino acid is inserted in a polypeptide chain, this may
lead to a change in the bonding properties of an essential part of the protein and therefore change its
secondary, tertiary and quaternary structures, which could change the functioning of the protein. The
resulting protein often functions less effectively and the change may even be lethal. For example, in the
inherited red blood cell disease known as sickle cell anaemia, a single amino acid change in the protein
haemoglobin is the cause. The amino acid glutamate is replaced by a valine. This distorts the shape of Sickle cell
anaemia is dealt
the haemoglobin protein (changes it to long fibres) and affects its ability to transport oxygen. This is with in more
not a lethal mutation, unless inherited in both maternal and paternal copies of the gene. Occasionally, a detail in chapters
5 and 7.
change in an amino acid may lead to improved functioning of a protein. Changes such as these are the
cause of random variation in a population that is subject to natural selection. For example, if a change in
an enzyme has no effect on the organism at the natural ambient temperature, but allows it to function
more efficiently in high temperatures, then an environmental change such as global warming may result
in that individual surviving and passing on its gene to the next generation.
Types of proteins in cells
As you have learned, the structure and shape of proteins determine their functions, which range from
structural support to cell communication, movement, defence against diseases and cell biochemistry.
Different types of tissues contain different proteins, coded by DNA that is switched on during cell
differentiation.
Fibrous proteins form structural components of cells and tissues; together with water, they form
the basic structure of protoplasm (the cytoskeleton). Fibrous proteins are long and insoluble in water.
Collagen is an example of a long, stringy protein that is coiled and very strong (Fig. 4.25a). It is commonly
found in skin, along with another fibrous protein, elastin. These proteins are also present in ligaments
and tendons. Keratin is a fibrous protein in hair and nails.
Globular proteins are usually spherical in shape and are compact and soluble in water. They are
often transport proteins, such as haemoglobin in the blood (Fig 4.25b). Immunoglobulins (antibodies),
hormones and enzymes are other examples of globular proteins.
Getty Images Plus/iStock.com/ HYPERLINK "https://www.gettyimages.com.au/search/
photographer?family=creative&photographer=Molekuul" Molekuul
a b
Shutterstock.com/Blamb
Polypeptide
chain
b chain
Iron
Heme
a chain
Collagen Haemoglobin
FIGURE 4.25 Fibrous and globular proteins: a collagen, a fibrous protein; b haemoglobin, a
globular protein
9780170408851 CHAPTER 4 » DNA AND POLYPEPTIDE SYNTHESIS 139
04_bio_InFocus12_2e_sb_08851_txt.indd 139 08/08/18 6:47 pm
KEY CONCEPTS
● Proteins are macromolecules (polymers) made up of one or more polypeptide chains that are
formed by sequences of amino acids linked by peptide bonds.
● Proteins contain the chemical elements nitrogen, carbon, hydrogen, oxygen and sometimes
sulfur.
● Proteins have a primary structure (sequence of amino acids in polypeptide chains), secondary
structure (polypeptide chain arranged in a helix or pleats), tertiary structure (3D shape formed
by folding the secondary structure) and quaternary structure (two or more polypeptide chains
combined).
● The sequence of amino acids in a protein is responsible for the overall bonding, folding and
3D shape of a protein, which determines its ability to function. A change in one or more amino
acids in the sequence has the potential to alter the entire structure of a protein.
● There are three main types of protein: fibrous, globular and conjugated.
CHECK YOUR
UNDERSTANDING 1 Name four structural proteins in cells and state the function of each.
2 Identify three types of functional proteins in cells and, using an example of each, explain how they
4.4a function.
3 Name the types of bonds that form between amino acids in a polypeptide and explain how they form.
4 Outline the primary, secondary and tertiary structure of a protein.
5 Using examples, explain how an amino acid substitution in a polypeptide may affect its functioning.
Functions of proteins
The biological properties of proteins depend on the interactions of the proteins with each other and with
other molecules. For example, enzymes bind with substrates to catalyse reactions, regulatory proteins
control DNA replication and turn on genes, antibodies bind with pathogens, and hormones bind with
receptors on target cells.
The tertiary structure and three-dimensional shape of a protein determines its ability to bind tightly
and specifically with these molecules, and therefore determines its ability to function effectively.
Proteins are reusable, and reactions between them and their binding molecules (called ligands) are
reversible.
Proteins can be classified into categories according to their functions. In the section that follows,
Types of proteins proteins are grouped into five categories according to function. Note that each category may be
Explore the different
types of proteins and
subdivided into further groups – see the weblink for proteins grouped into nine categories, according to
their function. function.
Structural proteins – support and movement
Structural proteins are often fibrous and stringy (such as collagen and elastin), and found in connective
tissues such as skin, cartilage, bone, tendons and ligaments. Structural proteins also make up shells in
invertebrates, and are in hair, nails and hooves in vertebrates.
Structural proteins such as tubulin (in microtubules) are responsible for forming the cytoskeleton,
which maintains the shape of cells. Microtubules also allow movement in cells. For example, cilia and
flagella in cells move as microtubules slide along each other, and a similar action causes spindle fibres to
contract.
Contractile proteins also occur in cells, allowing movement to occur. For example, in muscle, the
protein actin slides along another protein, myosin, to allow the muscle to contract (Fig. 4.26). Actin is
also found in microfilaments in cells and these are responsible for contraction of the cytoplasm, allowing
the cell membrane to pinch off during cytokinesis in animal cells, and the crawling movement of protists
such as amoeba.
140 MODULE FIVE » HEREDITY 9780170408851
04_bio_InFocus12_2e_sb_08851_txt.indd 140 08/08/18 6:47 pm
Enzymes – control of biochemical reactions
Enzymes are protein molecules involved in all biochemical aspects of cellular metabolism. (See Year 11
Review Biology
course work.) They catalyse reactions such as those in the chemical respiration pathway and in digestion. in Focus Year 11,
The shape of an enzyme’s active site determines its binding specificity and therefore its ability to function. Section 3.3 on
enzymes.
Enzymes are particularly important in gene functioning, replicating, repairing and transcribing DNA to
make new proteins.
Shutterstock.com/Blamb
Sarcomere
Myofibril or fibril (complex organelle
composed of bundles of myofilaments) Sarcomere
(contractile
unit of a myofibril)
Sarcomere
(relaxed muscle)
Thin (actin) filament Thick (myosin) filament
FIGURE 4.26 Thick myosin filaments in muscle slide along thin actin
filaments, allowing the muscle to contract.
Proteins for cell communication, cell signalling and
biological recognition
Cells communicate by means of chemical signals. Some proteins embedded in membranes form channels
See Biology in
to carry substances that are essential for cell functioning between cells and the environment (Fig. 4.27). Focus Year 11,
(Revise your Year 11 work on the structure and functions of cell membranes.) For example, nerve cells Chapter 3, on the
structure of the
and cells in kidney tubules rely on proteins embedded in the cell membrane to act as a sodium pump, cell membrane.
regulating the intake and output of sodium ions so that the cell can function.
Extracellular environment
Protein Exterior surface of
Carbohydrate cellular membrane
Cholesterol
Transport Receptor Recognition Adhesion Phospholipid
protein protein protein protein bilayer
Intracellular environment
FIGURE 4.27 A view of the fluid mosaic model of part of the cell membrane, showing embedded and surface proteins.
9780170408851 CHAPTER 4 » DNA AND POLYPEPTIDE SYNTHESIS 141
04_bio_InFocus12_2e_sb_08851_txt.indd 141 08/08/18 6:47 pm
Cell signalling and biological recognition
Some proteins, such as hormones and neurotransmitters, act as chemical messengers between cells.
They communicate messages to a cell about the environment around it and trigger responses in the
target cell’s functioning. Receptor proteins in the membranes of cells are responsible for receiving these
signals. Biological recognition between chemical messengers and their target cells is essential. Receptor
proteins must therefore have a shape that is exactly reciprocal to the shape of the molecule with which
it binds.
Some receptors on the surfaces of cells are genetically determined. Some of these receptors act as
markers that allow a body to recognise its own cells and the cells of foreign invaders (pathogens) that
need to be destroyed. This helps the body to fight disease. Antibodies are defence proteins that may be
attached to cell membranes or floating freely in body fluids. Antibodies (also called immunoglobulins)
Antibodies are dealt
with in more detail recognise foreign invaders by the different proteins on the surfaces of their cells (called antigens); the
in Chapter 11. antibodies bind with these antigens to signal to other defence cells in the body that the invading antigens
need to be destroyed (See Chapter 12 for more details.)
Transport and storage proteins
Some proteins bind to and carry or store chemicals in the body. These are termed ligand-binding proteins
and must be able to bind easily with the chemical (ligand) and also release it when and where it is needed.
How a firefly’s tail
An example is haemoglobin, which has an affinity for (attraction to) oxygen, particularly when oxygen
makes light is present in high concentrations. Haemoglobin loses its affinity for oxygen in areas where there is a low
Identify the series of oxygen concentration (and high carbon dioxide concentration), such as in active tissues. The protein
proteins involved in
generating light, and changes shape when the oxygen level changes, and this adaptive ability of the protein is essential to its
classify each into a
group according to its functioning.
function.
Some proteins store chemicals for use by the organism – for example, ferritin stores iron, while
albumin (in egg whites) and casein (in milk) store amino acids.
Sensory proteins – responding to stimuli
Refer to Chapter 18, Some proteins change their shape or biochemical activity in response to stimuli (changes in the
page 612 to learn environment). For example, opsins are proteins in the retina (innermost layer) of the eye that detect light.
more about the
functioning of the When light is absorbed by cells in the retina, these proteins undergo a change in molecular arrangement
protein opsin in and start a series of reactions in which light energy is transformed into electrical and chemical signals
vision.
that can be interpreted by the brain.
KEY CONCEPTS
● Proteins are grouped according to their structure or functioning to make it easier to remember
and compare them.
● Structural proteins form the structural and functional part of cell membranes. Some proteins in
the cell membrane also function in communication and regulate the movement of substances
across the cell membrane.
● Some proteins, such as myosin and actin in muscle cells, are responsible for cell motility,
joining together to form filaments that allow movement.
● Storage and transport proteins bind and store or carry other molecules in cells. For example,
histones package DNA in a compact form, the protein ferritin stores iron and haemoglobin
carries oxygen.
● Some proteins regulate metabolic functioning – these include enzymes (chemical catalysts) and
chemical messengers such as hormones and neurotransmitters.
● Proteins involved in cell recognition include antibodies, which defend against disease.
142 MODULE FIVE » HEREDITY 9780170408851
04_bio_InFocus12_2e_sb_08851_txt.indd 142 08/08/18 6:48 pm
Technology, big data and the investigation of protein structure
and function
Today, we can predict expected amino sequences in proteins, as we have increased our understanding
of how the millions of nucleotides in a sequence of DNA are decoded. Sequencing the nucleotides of
complete sets of genes in organisms is a field known as genomics. Proteomics is the large-scale study of
sets of proteins produced in an organism or biological system to find out how the proteins in a variety
of cell types work together. Studies of both genomics and proteomics have made major leaps in recent
years as a result of advances in computer technology. (See the weblink.)
The genome of an organism remains more or less the same in different cells over time, but the
proteome is more complex. Various cell types produce different sets of proteins and these are often
modified after translation. Different genes are expressed in different cell types, so there are an enormous
number of proteins to be identified and studied.
Analysis of proteins has also made rapid advances over the past 30 years or so, as has analysis of DNA
and gene functioning.
X-ray crystallography was first used over a century ago. Over the past 60 years or so, it has been used
to study biological macromolecules (large molecules). Advances in the study of proteins were slow at first,
as X-ray diffraction technology needed to evolve to produce sufficiently strong X-ray beams to provide
diffraction images that could be measured. The images and methods of gathering data were sufficient
Timeline of
for small molecules, but collecting data for large molecules such as proteins took many days or weeks. genomics and
The study of the first protein (myoglobin) whose entire structure was recorded was published in proteomics
Record in order ten
1958. By 1971, a worldwide database, the Protein Data Bank (PDB), had been created and seven protein major discoveries
structures had been deposited in the PDB, all determined using single-crystal X-ray diffraction. The relating to our
understanding of
numbers increased slowly – by 1973, two more proteins had been deposited. DNA and protein
synthesis.
Because one protein may have between five and 50 different modified forms, each allowing the
protein to perform a different function, the process of determining protein structure was slow and the
goal enormous. What was needed were high-brilliance sources of X-ray radiation to speed up the crucial
diffraction measurements, and a way to analyse the data quickly.
These requirements were met over the next ten to twenty years. The development of the synchrotron
(a particle accelerator) brought about this change. A synchrotron emits electromagnetic radiation where Human
charged particles can be accelerated to move at speeds close to the speed of light. The particles can Genome
Project
be forced to change direction by a magnetic field. Synchrotron technology improved and by the 1990s,
the construction of a third-generation synchrotron with a ring size of over a kilometre gave the high-
resolution images required. This, together with the advent of high-performance computing and the use
of recombinant methods for protein production, advanced the study of proteins. Molecular biologists
were able to record and create models of the structures of thousands of proteins and bank this data in
a relatively short space of time. The graph in Figure 4.28 compares the numbers of protein structures
determined using synchrotron radiation (orange) and conventional sources of radiation (blue) between
1985 and 2009.
The field of combined computer science and genetics is known as bioinformatics. People who work
in this field develop methods and software for analysing and interpreting biological data. It is an area
of science that combines the disciplines of biology, computer science, mathematics, statistics and
engineering.
Advances in computer technology have led to the rapid storage and manipulation of big data
(extremely large volumes of data), greatly accelerating the study of proteomics. Today, the detailed
analysis of protein structure to identify functions and interactions is assisted by 3D visualisation
computer technology. For example, some programs allow protein structure to be ‘sorted’ according to
the arrangement of particular chemical elements within the molecule, bonding patterns, the line-up of
atoms in sequence or the overall structure and shape of the protein. This is extremely useful for exploring
how changes in amino acid sequences affect protein structure. A number of proteins targeted by medical
research for cancers are currently being studied in this way, using big data.
9780170408851 CHAPTER 4 » DNA AND POLYPEPTIDE SYNTHESIS 143
04_bio_InFocus12_2e_sb_08851_txt.indd 143 08/08/18 6:48 pm
Source: US National Library of Medicine
6000
Conventional radiation source
Synchrotron
5000
4000
Number of deposits
3000
2000
1000
0
1985 1990 1995 2000 2005 2010
Year of deposit
FIGURE 4.28 The number of protein structures deposited
annually in the Protein Data Bank
INVESTIGATION 4.5
Information and Secondary-source investigation into protein structure
communication
technology and function
capability
You are required to investigate a specific protein and create a multimedia presentation of your information
(Investigation part 1), after which you will research one of two specific named proteins (Investigation part 2).
PART 1: INVESTIGATING A PROTEIN OF YOUR CHOICE
Rotatable and Investigate the structure of a particular protein of your choice (list of suggestions in point 3 below) and how a
zoomable 3D
structure of change in its structure could affect its functioning.
proteins
1 Create a multimedia presentation of 8–10 slides, outlining information about the structure of a protein of
your choice, its functions and its potential applications.
2 Find a video clip of the protein functioning, as well as a weblink to a computer simulation program that
allows visualisation of the protein in three dimensions. Insert the sites as hyperlinks in your multimedia
Cn3D presentation.
A visualisation tool
for biomolecular
3 Outline the impact that a change in the structure of this protein may have on its functioning. Some
structures, sequences examples of proteins that you may wish to select for your research are: motor protein kinesin; proteins
and sequence
alignments.
involved in DNA replication such as bacterial DNA gyrase; reverse transcriptase; tumour suppressor
proteins such as p53; metabolic protein such as haemoglobin; proteins implicated in diseases such as
cardiovascular disease, Alzheimer’s disease, Parkinson’s disease; proteins involved in defence against
disease, such as immunoglobulins; major histocompatibility complexes (MHCs) or any protein of your
choosing.
144 MODULE FIVE » HEREDITY 9780170408851
04_bio_InFocus12_2e_sb_08851_txt.indd 144 08/08/18 6:48 pm
Some weblinks are provided for you to begin your research. You need to find similar sites to complete the
research on your selected protein.
PART 2: HAEMOGLOBIN OR CY TOCHROME C 3D visualisation
of the structure
Research the importance of the amino acid sequence in a haemoglobin molecule or in cytochrome C and how of the p53
protein
these molecules may be used for relatedness studies in evolution. Use one of these molecules to explain the
importance of DNA transcription and translation being accurate when creating the amino acid sequence of
the polypeptides that make up the selected protein.
PART 3: BIOINFORMATICS (OPTIONAL – ADVANCED)
p53 and how
it functions
1 Do research to answer the following questions. in tumour
a What is bioinformatics? suppression
b What kind of work does a molecular diagnostics researcher do?
2 Explain how bioinformatics may be used in the work of a molecular diagnostics researcher.
OR
Write a job advertisement for a molecular diagnostician, outlining the knowledge and skills the person TED talk using
data to create
would need to have, to apply for this position. computer-
generated 3D
images
Personal and social
capability
Work and enterprise
KEY CONCEPTS
● The study of a set of proteins in an organism is called proteomics.
● Bioinformatics is a field of study that involves developing computer technology including
software tools for understanding and visualising enormous amounts of biological data. It is a
combination of biology, computer science, mathematics and engineering.
CHECK YOUR
1 Construct a table like the one below to compare the main functional categories of proteins in cells. UNDERSTANDING
CATEGORY OF
PROTEIN FUNCTION DESCRIPTION EXAMPLE 4.4b
Structural Support
Movement
Regulating Enzymes
metabolic
Hormones
functioning
Cell communication Signalling
Biological
recognition
Sensory proteins Response to
stimuli
Storage and Storage
transport
Transport
2 Distinguish between proteomics, genomics, big data and bioinformatics.
9780170408851 CHAPTER 4 » DNA AND POLYPEPTIDE SYNTHESIS 145
04_bio_InFocus12_2e_sb_08851_txt.indd 145 08/08/18 6:48 pm
4 CHAPTER SUMMARY
DNA and polypeptide synthesis: Why is polypeptide synthesis so important?
DNA IN PROKARYOTES
Bacterial
flagellum
Cytoplasm
Capsule Chromosome: Plasma Plasmid:
DNA membrane DNA
Chromosomal DNA: circular, double-stranded and supercoiled Non-chromosomal DNA: small rings of non-
into a nucleoid chromosomal DNA
DNA IN EUKARYOTES
Chromosome rRNA Cytochrome b
1400 nm
Non-coding
region
Centromere
NADH
Cytochrome c dehydrogenase
oxidase
2 nm
tRNA
Chromatin Nucleosome
ATPase
30 nm
700 nm
DNA
10 nm
Nuclear DNA: chromosome Non-nuclear DNA: mitochondrial DNA
Nuclear DNA is linear DNA packaged around histones (to mtDNA occurs in mitochondria in the cytoplasm, is
form nucleosomes), which play a role in regulating gene inherited down the maternal line and mutates at a
expression. higher rate than nuclear DNA.
POLYPEPTIDE SYNTHESIS
Step 1 DNA codes protein synthesis Step 2
DNA RNA pre-mRNA mRNA
Exon Exon Exon Exon
DNA Intron 1 Intron 2 Intron 3 Intron 4
Cell nucleus
Transcription and removal of introns
$
(
(
$
"
5
2 Transcription
Pre-mRNA 1 2 3 4
Antisense strand
Alternative splicing
(coding strand)
C
( of DNA
(
$
5
‘Sense’ strand " "
or ‘non-coding’ 5 mRNA being
5
strand of DNA 6 " transcribed from DNA
" $ (the nucleotide U is
"
5 5 used in mRNA in the
$
( " place of T)
6
1 RNA
polymerase
"
5
"
$
$
" Mature mRNA 1 2 3 1 2 4
5
( "
A
G 5
"
6
(
(
"
Nuclear membrane
Protein X Protein Y
C
U $ "
RNA
nucleotide
pool
5 6
$ Introns are spliced out (regulate gene expression).
3
mRNA leaves through
nuclear pore
Types of RNA:
U C
U A C U A C A U G A
Amino acid Ribosome
Transcription Uracil
Instructions copied in a coded form from DNA,
carried by mRNA into the cytoplasm Anticodon
Messenger RNA (mRNA) Transfer RNA (tRNA) Ribosomal RNA (rRNA)
mRNA tRNA rRNA
146 MODULE FIVE » HEREDITY 9780170408851
04_bio_InFocus12_2e_sb_08851_txt.indd 146 08/08/18 6:48 pm
POLYPEPTIDE SYNTHESIS
Step 3 Translation into polypeptide chains
RNA protein
DNA
tRNA
1 1. DNA is transcribed
into RNA.
4. More amino
acids are added.
mRNA 3. Amino acid
Gr
Nucleus 3
ow
5 attaches to tRNA.
in
g
Transcription
pr
5. tRNA breaks
ot
4
ein
off and picks up Amino acid
another amino acid.
2
2. mRNA attaches to
a ribosome.
Ribosome
NA
mR Translation
Translation
mRNA is ‘read’ by ribosomes and translated into polypeptides, with the help of tRNA.
THE ENVIRONMENT CAN AFFECT PHENOTYPIC EXPRESSION
Gene expression is the switching on and off of
genes to make the required protein end products
in cells. Environment and epigenetics play a role.
Identical twins have the
same genotype. Any Hydrangea colour is affected by pH in the
differences are due to environment.
environmental influence.
Proteins produced Protein function
a Primary structure b Secondary structure
The amino acid sequence With folding as a result of hydrogen bonding
HO O
H
C C C
N
HO C
C C H
H N C O N C
N C C
C O H N O
Peptide C C
C
HO
bond N H O C
C
N C
H
C N
O C N H O
C
C C H HO
H N C O or N C O
N C
O
Amino C O H N O
HO
C C
acids C
N C
H
N H O C C N
O
O C N H O
C C
H N C O
Alpha helix
C O H N
C C
H Pleated sheet
N
H
d Quaternary structure
The relationships between
c Tertiary structure
With secondary folding caused by interactions between (DNA polymerase enzyme)
individual subunits the polypeptide and its immediate environment
depends on shape.
9780170408851 CHAPTER 4 » DNA AND POLYPEPTIDE SYNTHESIS 147
04_bio_InFocus12_2e_sb_08851_txt.indd 147 08/08/18 6:49 pm
4 CHAPTER REVIEW QUESTIONS Qz
Review quiz
1 Draw a diagram and annotate it to explain the structure of 17 Draw a diagram to represent a thymine nucleotide of
a eukaryotic chromosome. DNA, labelling the three distinct chemical components.
Describe any changes you would need to make to your
2 Compare the chromosome of a eukaryote with that of a
diagram if this was a nucleotide of RNA.
prokaryote.
18 Compare the structure of fibrous and globular proteins.
3 Distinguish between the following structures:
a nucleoid and plasmid 19 Distinguish between a proteome and a genome, using
examples.
b scaffold and histone
c nuclear DNA and non-nuclear DNA in eukaryotes. 20 Construct a flow chart with words, arrows and diagrams,
to represent:
4 Identify one similarity and two differences between a
a the process of transcription of pre-RNA from DNA
plasmid and mtDNA.
b the subsequent editing of RNA to become mature RNA
5 Explain why mtDNA is useful for evolutionary studies.
c the process of translation.
6 List the following in order of genome size, from largest to
21 Create a flow chart with words and arrows to outline
smallest: prokaryote circular DNA, eukaryote nuclear DNA,
the sequence of events that occurs during transcription
yeast DNA, mtDNA.
and translation. Indicate on your flow chart which steps
7 What are histones? Describe their role in the nucleus of occur inside the nucleus and which steps occur in the
eukaryotic cells and in regulating gene expression. cytoplasm.
8 Using diagrams, explain how DNA is packaged in a 22 Compare transcription and translation in the DNA of
prokaryotic cell. prokaryotes and eukaryotes.
9 Define ‘gene’. Explain why the definition has changed over 23 Explain the difference between coding and non-coding
time. DNA.
10 Give three examples of how the environment affects gene 24 Identify the sequence of amino acids that would
expression and two examples of how the environment result from an mRNA molecule with the sequence
affects phenotype in a way that is not hereditary. AUUCGUGUAGCCGGUCGA.
11 Draw a Venn diagram to compare DNA and RNA. 25 Draw the non-coding strand of DNA that would have
given rise to the mRNA molecule in Question 24.
12 Use words and arrows to represent the central dogma of
molecular biology. 26 Discuss the importance of using models in biology,
referring to the discovery of the structure of DNA by
13 Give the full name of each of the following types of
Watson and Crick as an example.
nucleic acids in cells and outline the function of each:
a DNA 27 Construct a simplified diagram of a strand of DNA to show
a sequence of nucleotides 24 bases in length, following
b mRNA
the instructions below.
c rRNA
a Use a single line to represent the sugar-phosphate
d tRNA backbone and letters to represent the bases.
e mtDNA b Use the mRNA codon table in Figure 4.15 to make sure
f miRNA that the first triplet of bases on the DNA strand you
construct codes for a start codon in mRNA and that the
14 Do more complex organisms have a larger number of
last triplet of bases codes for a stop codon.
chromosomes? Use data to justify your answer.
28 Draw a diagram to show how the strand of DNA that you
15 List the following in order of size, from smallest to largest:
created in Question 27 would be:
a polypeptide, protein, amino acid, dipeptide
a transcribed into mRNA
b nucleic acid, nucleotide, chromosome, gene.
b translated into a polypeptide chain (use the mRNA
16 Draw a diagram to represent: codon table in Figure 4.15).
a a protein molecule, and label all parts listed in 29 Write two changes in bases that could occur in the DNA
Question 15a strand that you created in Question 27 that would not
b part of a chromosome, and label all parts listed in result in a change in the sequence of amino acids. Explain
Question 15b. why this is so.
148 MODULE FIVE » HEREDITY 9780170408851
04_bio_InFocus12_2e_sb_08851_txt.indd 148 08/08/18 6:49 pm
30 Explain the importance of twin studies in genetics. 35 Explain what is meant by ‘gene expression’ and its
significance in living organisms. What, then, is the purpose
31 Describe three ways in which gene expression can
of polypeptide synthesis?
be regulated. You may use diagrams to assist your
explanation. 36 Design an investigation that a scientist could conduct to
show that exons are the only coding sequences expressed
32 Explain the importance of literature reviews in research.
in a protein.
33 Discuss the importance of bioinformatics in
understanding both DNA and protein functioning. Use the
information in Figure 4.28 to support your answer.
34 Write an extended response to discuss whether genes or
the environment have a greater influence on phenotype.
Support your arguments with current biological
knowledge.
9780170408851 CHAPTER 4 » DNA AND POLYPEPTIDE SYNTHESIS 149
04_bio_InFocus12_2e_sb_08851_txt.indd 149 08/08/18 6:49 pm
5 Genetic variation
INQUIRY Students:
QUESTION
• conduct practical investigations to predict variations in the genotype of offspring by modelling meiosis,
How can the genetic including the crossing over of homologous chromosomes, fertilisation and mutations (ACSBL084)
similarities and • model the formation of new combinations of genotypes produced during meiosis, including but not
differences within and limited to:
between species be – interpreting examples of autosomal, sex-linkage, co-dominance, incomplete dominance and
compared? multiple alleles (ACSBL085) CCT
– constructing and interpreting information and data from pedigrees and Punnett squares
• collect, record and present data to represent frequencies of characteristics in a population, in order to identify
trends, patterns, relationships and limitations in data, for example: ICT N
– examining frequency data
– analysing single nucleotide polymorphism (SNP)
Biology Stage 6 Syllabus © NSW Education Standards Authority for and on behalf of the Crown in right of the State of New South Wales, 2017
Shutterstock.com/wjarek
150 9780170408851
05_bio_InFocus12_2e_sb_08851_txt.indd 150 08/08/18 6:52 pm
Why do a high proportion of African people have the allele for sickle cell anaemia, which gives rise to
a detrimental blood disorder, even though it occurs in low frequencies in other populations? If there is
cystic fibrosis in my extended family, what is the percentage chance that I may have a child with cystic
fibrosis? If my mother has breast cancer, am I likely to develop it too? Is prostate cancer hereditary?
What is the likelihood that my child will inherit my sporting ability or my partner’s musical talent, or
both? These are common questions and, using mathematical models and advanced understanding of
inheritance patterns, scientists are becoming better able to answer them.
In earlier chapters you learned that,
while traits are passed on as the result
Getty Images/©Ingetje Tadros
of accurate replication of chromosomes,
variation that arises during sexual
reproduction is also important in the
process of natural selection for the
adaptation and survival of species.
In this chapter you will explore heredity
patterns and the frequencies of variations,
which can be used to compare genetic
similarities and differences within and Cultural kinship
between species. Population geneticists Compare cultural
kinship with genetic
conduct such comparisons to predict, kinship
with a fair degree of accuracy, the chance
FIGURE 5.1 Studying heredity patterns can enable geneticists to
of certain features being represented predict features within a family or population.
within a family, population or species.
Genetic variation – meiosis, fertilisation
5.1
and mutations
Alamy Stock Photo/Anna Idestam-Almquist
Variation and variability both imply the presence
of genetic differences. What, then, is the difference
between these two terms? In the Year 11 course, in
the section on evolution, you learned that variation
is evident in individuals (for example, differences in
fur colour or height). In genetics, the term variability
relates to the different forms of a gene within a
population – that is, the total of all alleles present in
the gene pool of a population (for example, coat colour
in a population of Australian kelpie dogs includes
black, red, blue or fawn, with or without tan markings)
(Fig. 5.2). The genetic inheritance of coat colour in horses,
rabbits and many other animals is similarly variable.
There are several ways in which variation arises
during sexual reproduction, including during
the processes of meiosis (gamete formation) and
fertilisation. Both these processes randomly mix
two sets of parental chromosomes, resulting in
individuals with unique and varied genotypes.
Mutation is another way of introducing genetic FIGURE 5.2 Australian kelpies, showing fur variability: coat colours include
variation, and this is discussed in Chapter 7. black and tan (considered the true colour of the working kelpie), red and black.
9780170408851 CHAPTER 5 » GENETIC VARIATION 151
05_bio_InFocus12_2e_sb_08851_txt.indd 151 08/08/18 6:52 pm
Meiosis: chromosome number, variation and gamete formation
Every species has a characteristic number of chromosomes in every body cell ( for example,
Equine genetics
Watch at least two
46 chromosomes in humans) and this number does not change from one generation to the next. Meiosis
video clips from this maintains a constant chromosome number from one generation to the next.
site about equine
genetics. Meiosis is sometimes called the ‘reduction division’, because a diploid cell divides into four haploid
daughter cells (a tetrad), reducing the chromosome number. A diploid parent cell contains two sets of
chromosomes – one paternal and one maternal set. Each pair of chromosomes in the cell is termed
a homologous pair, because the two chromosomes carry alleles for the same genes (Fig. 5.3). When
homologous pairs of chromosomes align in early meiosis, each pair is called a bivalent.
A homologous pair
of chromosomes
(bivalent) consists Similarities between meiosis and mitosis
of two similar
chromosomes that In both mitosis and meiosis:
carry genes for the
same traits: one of
◗ The names of the stages – interphase, prophase, metaphase, anaphase and telophase – are the same.
the pair is maternal ◗ Interphase occurs first, prior to nuclear division. During this stage, the DNA replicates, so each
in origin and the
other is paternal.
chromosome makes an identical copy of itself (Fig. 5.3a).
◗ Chromatin material transforms into chromosomes in the same way during prophase in the first
meiotic division (Fig. 5.3b and c).
◗ The breaking down of the nuclear material and the formation of the spindle are the same.
◗ Cytokinesis in meiosis takes place in the same manner as in mitosis, depending on whether the cell
WS that is dividing is a plant or an animal cell.
You studied mitosis in detail in Chapter 3. Revise your understanding of terminology for mitosis
Chromosome
terminology using Figure 5.3 and the worksheet Chromosome terminology.
Arms of chromatids of
each homologous pair
Each chromosome of chromosomes wrap
splits longitudinally into around each other,
chromatids, attached break and rejoin,
by a centromere. exchanging material.
DNA replicates
Chromosomes Early Homologous Bivalent : homologous pair
Interphase of chromosomes
separate out. prophase chromosomes
pair up. Homologous pair
of chromosomes
or ‘bivalent’
Homologous Chromatids
Chromosome pair of
chromosomes Centromere
Two identical
strands of DNA
One chromosome
a Replication of DNA b Pairing of homologous c Formation of sister d Crossing over of
during interphase chromosomes during early chromatids during prophase chromosomes to
prophase introduce generic
variation
FIGURE 5.3 Early stages of division in meiosis – interphase and prophase of meiosis I
152 MODULE FIVE » HEREDITY 9780170408851
05_bio_InFocus12_2e_sb_08851_txt.indd 152 08/08/18 6:52 pm
Meiosis I and genetic variation
WS
Meiosis occurs in two stages: meiosis I (the first meiotic division) and meiosis II (the second meiotic
division). The reduction in chromosome number occurs in meiosis I. Meiosis
Meiosis I
The sequence of steps described below is summarised in diagrammatic form in Figure 5.6 (page 154).
1 Chromosomes line up in pairs (one maternal and one paternal chromosome in each pair) during
prophase I.
2 Crossing over or synapsis occurs – the arms of a pair of homologous chromosomes, termed a bivalent,
wrap around each other and the points at which they meet are called chiasmata (singular chiasma).
The arms of homologous chromosomes break where they meet, exchanging genetic material between
paternal and maternal chromosomes (Fig. 5.4).
Genes that occur on the same chromosome are said to be linked. Crossing over (synapsis) ensures
that not all linked genes on a chromosome are inherited together. The exchange of genes during crossing
over causes mixing of paternal and maternal genes and introduces genetic variation. No two chromatids
are identical (Fig. 5.5).
A B C D Paternal genetic
Chromosome 1 material only
Chiasmata A B C d
Science Photo Library/Science VU/
B. John, Visuals Unlimited
Mixed paternal and
maternal genetic
material
a b c D
a b c d Maternal genetic
material only
Chromosome 2
FIGURE 5.5 A bivalent (homologous pair of chromosomes) showing exchange of
FIGURE 5.4 Electron micrographs of a bivalent with genetic material as a result of crossing over (synapsis), which introduces genetic
chiasmata variation
3 Each pair of chromosomes separates (during anaphase I), and one entire chromosome of each pair
moves into a daughter cell. (Each chromosome still has two sister chromatids attached to each
other.) This separation of maternal and paternal chromosomes not only halves the chromosome
number in gametes, but also leads to genetic variation, depending on which chromosome (paternal
or maternal) of each pair ends up in which daughter cell. This is termed independent assortment
of chromosomes and produces different combinations of genes in different gametes (Fig. 5.6).
Meisois II
The two daughter cells that result from meiosis I each undergo meiosis II, which is similar to mitosis.
4 The centromere divides and the chromatids separate from each other (during anaphase), moving
to opposite poles (telophase), where a nuclear membrane forms around each set of chromosomes.
Cytokinesis follows, resulting in four daughter cells (a tetrad), each with half the original
chromosome number. Genetic variation has also been introduced, because the combination of
paternal and maternal chromatin material in each resulting daughter cell is different.
5 Many combinations of chromosomes are possible in gametes as a result of meiosis, resulting in a
variety of gametes forming. Further variation is introduced during fertilisation, depending on which
gametes fuse.
9780170408851 CHAPTER 5 » GENETIC VARIATION 153
05_bio_InFocus12_2e_sb_08851_txt.indd 153 08/08/18 6:52 pm
In the annotated diagrams in Figure 5.6, meiosis is represented in a hypothetical (model) organism
that has only two pairs of chromosomes, keeping the representation of the process simple.
Early prophase Nuclear • Chromosomes separate into homologous pairs
membrane
breaks down
Late prophase • Nuclear membrane breaks down
• Chromosomes spilt into chromatids
• Crossing over occurs: genetic variation
introduced
Crossing over
Metaphase I One • Chromosomes align in pairs in the middle of
chromosome the cell
pair
• Random segregation
• Each pair lines up independently of the
Other next (independent assortment), so various
chromosome combinations of paternal and maternal
pair chromosome alignment are possible
Anaphase I • Chromosome pairs separate and each
chromosome moves to the opposite end of the
cell
Telophase • Two daughter cells form
• Chromosome number is halved
• Chromosome combinations in cells differ
Cytokinesis I • Daughter cells are not identical to each
other and have half the original number of
chromosomes
FIGURE 5.6 The process of meiosis in animal cells
154 MODULE FIVE » HEREDITY 9780170408851
05_bio_InFocus12_2e_sb_08851_txt.indd 154 08/08/18 6:52 pm
Metaphase II • Chromosomes align at the equator
Anaphase II • Daughter chromosomes move apart, to
opposite poles
Cytokinesis II: tetrad • Four resulting daughter cells are not genetically
identical to each other and have half the
original chromosome number
Four haploid cells
FIGURE 5.6 (Continued)
As a result of both independent assortment and random segregation of maternal and paternal
chromosomes during meiosis, further genetic variation is introduced. There are 223 possible
combinations of chromosomes in the formation of a human gamete, based on independent assortment
only.
The process of fertilisation, which involves the random meeting of any two gametes, ensures further
mixing of genetic material, producing variations in phenotype that may be acted on through natural
selection in the process of evolution.
Another source of variation is mutation, which may arise at any point in the process but
most commonly occurs during replication of DNA prior to the start of cell division (for example, during
meiosis).
Fertilisation and new combinations of genotypes
Gametes are haploid and contain different, recombined genetic material in their single set of chromosomes.
This variation is introduced by synapsis and independent assortment during meiosis. In the process of
fertilisation, there are many possible combinations of gametes that may fuse (depending on which sperm
cell fuses with which egg cell). This further increases variation within the individual in the form of new
combinations of genes, leading to greater variability within the population.
Self-fertilisation or cross-fertilisation?
Sexual reproduction between genetically dissimilar parents of the same species produces offspring that
are likely to differ from each other more than offspring produced by sexual reproduction where male and
female organs are on the same individual. For example, offspring arising from cross-fertilisation between
plants will have greater genetic diversity than those that arise from self-fertilisation, and offspring arising
from gametes produced by unisexual animals will have greater genetic diversity than those arising from
hermaphroditic (bisexual) animals.
9780170408851 CHAPTER 5 » GENETIC VARIATION 155
05_bio_InFocus12_2e_sb_08851_txt.indd 155 08/08/18 6:52 pm
INVESTIGATION 5.1
Information and
Secondary-source and practical investigation to model meiosis,
communication
technology
fertilisation and mutations
capability
During meiosis, genetic variation arises as a result of the behaviour of chromosomes during:
Literacy
• synapsis and crossing over
• independent assortment and random segregation.
In your investigation, you need to model how variation is introduced in the process of meiosis, fertilisation
and mutation.
Independent
assortment and AIMS
gamete diversity
Watch the animation, 1 To model meiosis (including crossing over, independent assortment and random segregation) and predict
listen to the narration
and then work variations in the gametes produced (Part A)
through the quiz.
2 To model fertilisation in order to predict variations in the genotype of offspring (Part B)
3 To predict variations in the genotype of offspring if a mutation was to arise during meiosis and/or
subsequent fertilisation (Part C)
RESOURCES
Meiosis with
crossing over To research how meiosis may be modelled and gain ideas for creative approaches, refer to secondary source
material. This may include information in this textbook, as well as online websites, video clips and animations,
such as the weblink resources.
PART A: CHROMOSOME BEHAVIOUR DURING MEIOSIS LEADS TO GENETIC VARIATION
AIM
To model meiosis, including crossing over, segregation, independent assortment of chromosomes and the
production of haploid gametes
MATERIALS
Pipe cleaners (or playdough/plasticine/strips of paper) in two different colours, to represent chromosomes –
one colour represents paternal and the other maternal chromosomes. Make each homologous pair of
chromosomes a different length – long, medium and short. To keep your model simple, demonstrate meiosis
in a parent cell with three pairs of chromosomes.
METHOD
1 In your model of meiosis, use a cell with:
– at least three pairs of chromosomes made out of pipe cleaners, strips of paper or strings of beads
– two colours to distinguish between maternal and paternal chromosomes
– different-sized chromosomes to distinguish between the three homologous pairs (for example: long,
medium and short).
2 Move the chromosomes through each stage of meiosis on templates of cells drawn on A3 paper, or use the
Modelling meiosis template worksheet. Select a method of recording your results from ideas suggested in
the results section.
Model how variation is introduced by the process of meiosis, showing the processes described below.
Meiosis I
1 Crossing over – linked genes are exchanged between paternal and maternal chromosomes, increasing the
possible combinations of genotypes.
156 MODULE FIVE » HEREDITY 9780170408851
05_bio_InFocus12_2e_sb_08851_txt.indd 156 08/08/18 6:52 pm
2 Independent assortment – chromosomes line up across the cell centre in homologous pairs, with paternal
and maternal assortment being independent.
3 Random segregation and halving of the chromosome number – whole chromosomes in each bivalent
separate and move into different cells, with random separation of paternal and maternal chromosomes.
There are 223 possible combinations of chromosomes in the formation of a human gamete. Predict how
many combinations would be possible in your hypothetical cell with three pairs of chromosomes.
Meiosis II
The two daughter cells that result from meiosis I each undergo meiosis II, which is similar to mitosis, but each
cell ends up with its own unique set of daughter chromosomes.
Whether annotating or narrating your model, make sure you use the correct scientific terminology in context.
You may wish to make a list of the terminology that you will use to describe each stage of meiosis, referring to
the glossary of terms at the back of this textbook to assist you before you begin annotating or narrating.
RESULTS
Record your model using one of the options below. WS
Option 1: Draw around each chromosome, using coloured pencils, at each stage of your model. Label all
diagrams and provide a heading for each. Write a brief annotation outlining what is happening in each Modelling meiosis:
template
stage.
Option 2: Use a digital camera or your mobile phone to take a photograph of each stage of meiosis as you
model the process. Print photos and arrange them in a table (use Table 5.1 as a guide). Label each diagram
and provide a brief annotation outlining what is taking place at each stage.
Option 3: Use a digital camera or your mobile phone to make a video of the process of meiosis as you
model it. Create a voice over to narrate what is happening in your video.
Option 4: Use a stop motion software app on an iPad or iPhone to record your model, and narrate the
presentation or add your own text. (You may wish to view YouTube clips to learn how to use the app.)
TABLE 5.1 Results of modelling meiosis
STAGE OF MEIOSIS DIAGRAM/PHOTOGRAPH ANNOTATION
COMMUNICATING YOUR INVESTIGATION
Write a practical report, outlining the aim, materials, method, results and conclusion. In your report, include the
answers to the discussion questions below.
DISCUSSION
1 Explain why two different colours were used for chromosomes.
2 Draw a diagram of the stage where the chromosome number was halved and describe how this was
modelled.
3 Draw alternative arrangements of these chromosomes as they undergo independent assortment and
segregation, to show all possible variations of gametes that may arise.
4 Predict how many combinations would be possible in your hypothetical cell with three pairs of
chromosomes. Explain your reasoning.
Review accuracy,
5 How many chiasmata are visible in the bivalent in Figure 5.6? Draw a diagram to predict the result of this precision
crossing over. and errors in
measurement in
6 Assess the validity, accuracy and limitations of your model. Chapter 1 page 16.
PART B: FERTILISATION INTRODUCES GENETIC VARIABILIT Y
1 Design and develop a model to demonstrate how fertilisation may introduce genetic variability in
offspring. You may wish to use the gametes you created in your meiosis model to demonstrate how
fertilisation introduces genetic variation. Predict the possible variations that may arise in the genotypes of
offspring.
9780170408851 CHAPTER 5 » GENETIC VARIATION 157
05_bio_InFocus12_2e_sb_08851_txt.indd 157 08/08/18 6:52 pm
2 Test your prediction and record the results.
3 Explain any limitations in data obtained.
4 Evaluate how you could improve your investigation plan.
PART C: PREDICTING VARIATIONS CAUSED BY MUTATION
1 Develop a model to demonstrate mutation during meiosis and predict the variation in the genotype
of offspring. (You may wish to make adjustments to the design of your model, taking into account your
answer to Question 4 in Part B.)
2 Test your prediction and record the results.
3 Evaluate the benefits and limitations of your model.
KEY CONCEPTS
● The genetic consequences of meiosis:
– One cell undergoes two meiotic divisions to generate four haploid cells.
– The genes in each haploid cell are a new combination of the parental genes.
– The new combination results from both crossing over and random segregation, allowing the
individual alleles of maternally and paternally derived chromosomes to assort independently.
● The genetic consequences of fertilisation:
– Two haploid gametes fuse to form a diploid zygote.
– The genes in the zygote are a combination of the genes contributed by the parents:
50% paternal and 50% maternal (not taking into account material that was exchanged during
crossing over).
● Variability:
– Variations in gene content of the gametes give rise to individuals in the population with new
gene variations, increasing variability.
– Mutations may further contribute to genetic variation in an individual and genetic variability
within a population.
● Models of meiosis are simplifications of the actual process, designed to demonstrate specific
aspects, such as the introduction of genetic variation. These models have limitations, for
example in not demonstrating all aspects of a process.
CHECK YOUR
UNDERSTANDING 1 Draw a Venn diagram to compare the processes of mitosis and meiosis. Suggested areas to consider
are the:
5.1 • type of cells in which division occurs
• number of divisions and resulting daughter cells
• chromosome behaviour:
– prior to division (interphase)
– in the early stages of division (prophase)
– during segregation (metaphase/anaphase of the first meiotic division)
– at the end of cytokinesis (mitosis) and cytokinesis I and II (meiosis)
• end result – number of cells; number of chromosomes.
2 Explain the biological importance of crossing over during meiosis.
3 Describe how two processes other than meiosis in sexual reproduction introduce genetic variation.
4 Calculate how many combinations of chromosomes would be possible in the gametes formed when a cell
with eight chromosomes undergoes meiosis. Show your working.
158 MODULE FIVE » HEREDITY 9780170408851
05_bio_InFocus12_2e_sb_08851_txt.indd 158 08/08/18 6:52 pm
5.2 Genotypes and inheritance patterns
Alamy Stock Photo/World History Archive
Inheritance patterns have been a subject of fascination for many years.
Mendelian inheritance, proposed over 170 years ago by Gregor Mendel, is the
basis of all inheritance patterns. Using mathematical calculations, Mendel
proposed a model whereby one could predict the ratios of various types of
offspring from any two specific parents.
When Charles Darwin and Alfred Russel Wallace proposed their theory of
evolution by natural selection in 1858, there was no knowledge of what was
responsible for the differences in individuals within a population or of how such
variations in characteristics could be passed from one generation to the next.
Once Mendel’s laws were explained in terms of modern genetics, the model
known as modern synthesis arose, combining the understanding of Mendelian
genetics with Darwinian evolution and giving us our modern-day theory of
evolution (sometimes called neo-Darwinism).
Autosomal recessive inheritance
FIGURE 5.7 Gregor Mendel, the father of
genetics
Mendel’s model of inheritance was based on a specific set of conditions and
this model still holds true today if these same conditions prevail – this pattern
of inheritance is known as autosomal recessive inheritance. WS
Autosomal recessive inheritance occurs under the following conditions:
Mendel’s laws
◗ A version of each characteristic or trait in an individual is inherited from both parents and is therefore
controlled by a pair of inherited factors (called alleles).
◗ Alleles pass from one generation to the next according to set ratios.
◗ The alleles in an individual may be the same (in pure-breeding or homozygous individuals) or may
differ (in hybrid or heterozygous individuals).
◗ In hybrid individuals, the trait that is expressed (appears) is known as the dominant allele, whereas the
one that is hidden or masked is the recessive allele (Mendel’s first law – dominance). For a recessive
trait to be expressed, both alleles in an individual need to be recessive.
◗ During gamete formation, the pair of alleles for a trait segregate (separate) and each gamete receives
only one allele for the trait/gene (Mendel’s first law – segregation).
◗ When the inheritance of more than one trait/gene is studied, the pairs of alleles for each trait separate
independently of the other pairs of alleles (Mendel’s second law – independent assortment).
Modern genetics terminology used to describe inheritance patterns
In modern-day studies of genetics, we know that different genes influence different characteristics. For
example, in pea plants, one gene may determine seed colour, while another determines stem length.
In humans, a range of different alleles for each gene may determine characteristics such as height, eye
colour and hair colour.
◗ Genes on chromosomes determine characteristics that are inherited.
◗ Alleles are different forms of the same gene and occur in pairs in diploid individuals.
◗ Alleles are found in identical positions or loci (singular locus) on pairs of homologous chromosomes
within cells (Fig. 5.8).
◗ Diploid individuals have two alleles of each gene, and haploid cells (gametes) have only one allele of
each gene.
◗ The phenotype of an organism, simply put, is its appearance (the expression of an organism’s genes).
The genotype of an organism is the combination of genes that is present in each cell.
9780170408851 CHAPTER 5 » GENETIC VARIATION 159
05_bio_InFocus12_2e_sb_08851_txt.indd 159 08/08/18 6:52 pm
Alleles: different forms
(e.g. T or t) of the same gene
(gene for stem length)
Recessive allele (e.g. ‘short’ pea plants)
Heterozygous condition:
chromosomes have different
alleles (T and t) of the same
gene (for stem length).
T T t t
Dominant
allele
(e.g. ‘tall’ pea
plants)
Homozygous dominant condition: S S S S Locus: position of a gene
both chromosomes have the on a chromosome
dominant allele S. r r r r Gene: for a particular trait
Homozygous recessive condition:
both chromosomes have the recessive
allele r.
Maternal Paternal
chromosome chromosome
Homologous pair of chromosomes as seen during meiosis
(DNA has replicated and formed identical arms or chromatids as seen during meiosis)
FIGURE 5.8 Pairs of chromosomes showing alleles, gene, locus, and homozygous and heterozygous genotypes
Today we know that, at a molecular level, the phenotype is more complex than just an organism’s
appearance. It is the sum of the gene products (proteins and RNA) that are made and these give rise to
not only the physical appearance, but also the behaviour and functioning of organisms.
The phenotype of an organism is determined to a large extent by the genetic makeup or genotype
of the individual, but the phenotype may also be influenced or modified by interaction with the
environment. For example, the final height of a human adult depends on a combination of that person’s
genotype as well as their nutrition – if they are underfed or receive insufficient protein while growing,
they may never attain their full potential height as determined by their genotype. (See Chapter 4.)
Autosomal recessive inheritance and genetic crosses
Autosomal recessive inheritance was proposed as a result of Mendel’s experiments with garden
pea plants. He investigated their breeding patterns to determine the inheritance of a variety of
characteristics or traits. Pea plants are ideally suited because they can easily be grown and cross-bred,
they have a short life cycle (they are annual plants), and their flowers have both male and female parts.
Mendel studied the inheritance of each trait individually (for example, trait = stem length), investigating
the inheritance of one pair of contrasting features at a time (for example, tall or short stem length). He
studied the following traits and their alternative forms:
◗ stem length – tall or short
◗ colour of seed contents – yellow or green
◗ colour of seed coat – grey or white
◗ shape of seeds – round or wrinkled peas
◗ colour of unripe pod – yellow or green
◗ flower position – axial or terminal
◗ pod shape – inflated or constricted.
The traits Mendel studied were typical examples of the autosomal recessive inheritance pattern we
know today. That is, if two alleles of a gene are present in a population, one allele is dominant (seen in
160 MODULE FIVE » HEREDITY 9780170408851
05_bio_InFocus12_2e_sb_08851_txt.indd 160 08/08/18 6:52 pm
the phenotype) and the other allele is masked or recessive. Autosomal recessive inheritance also assumes
that these alleles are located on one of the non-sex chromosomes (autosomes).
For simplicity, a letter of the alphabet is used to represent each allele of a trait (such as stem length
in plants). The different alleles are distinguished by using a capital letter for the dominant allele (for
example, T ) and a lower case version of the same letter for the recessive allele (t).
Note: Capital and lower case versions of the same letter signify dominant and recessive alleles of the
same genetic trait.
Mendel’s monohybrid cross
Mendel carried out a pure-breeding cross followed by a monohybrid cross (Fig. 5.9). That is, he crossed
two parents (P) who were pure-breeding (homozygous) for both characteristics – for example, TT and
tt. All offspring (F1 or first filial generation) appeared phenotypically tall, but when they were cross-bred,
their offspring (F2 or second filial generation) gave the phenotypic ratio of 3 tall :1 short.
Mendel used mathematical calculations to show that this type of inheritance pattern required one
factor to be passed on from each parent to the F1 generation, who were hybrids (Tt). When these F1
hybrids were bred, they gave a genotypic ratio in the F2 generation of 1TT : 2Tt : 1tt (Fig. 5.9). It was from
these ratios that Mendel derived his first law of dominance and segregation.
Pure-bred tall Pure-bred short
P
TT tt
Segregation
Gametes T T t t
Fertilisation
F1 Tt Tt Tt Tt
Hybrid offspring
Tt Tt
Segregation
Gametes T t T t
Fertilisation
F2 TT Tt Tt tt
3 tall offspring : 1 short offspring
FIGURE 5.9 Mendel’s monohybrid cross showing autosomal recessive inheritance
Mendel’s laws
What makes Mendel’s discoveries so remarkable is that chromosomes and genes were not discovered
Refer to Chapter 1
for another 35 years. His laws still hold true today. Theories and laws in science are concepts founded on page 5, ‘Models in
clearly identified assumptions, can be tested experimentally and give reproducible results. They can be science’.
used to explain and predict a wide range of observed phenomena.
9780170408851 CHAPTER 5 » GENETIC VARIATION 161
05_bio_InFocus12_2e_sb_08851_txt.indd 161 08/08/18 6:52 pm
Mendel’s first law of dominance and segregation
The characteristics of an organism are determined by factors that occur in pairs. Only one member of
a pair of factors can be represented in any gamete (segregation). Offspring inherit one factor from each
parent. When two hybrids breed, statistically they will produce a ratio of three offspring showing the
same trait as the parents (termed the dominant trait) to one offspring showing the contrasting recessive
trait – that is, the ratio of dominant to recessive trait will be 3 : 1.
Mendel’s second law of independent assortment
Mendel’s second law relates to how variation arises in meiosis. Mendel carried out more complex
experiments involving dihybrid crosses to establish his second law, studying two pairs of factors and their
separation. In this law, he established further ratios showing that when individuals with two or more
pairs of unrelated, contrasting characteristics are crossed (for example, tall plants with yellow pods ×
short plants with green pods), the different pairs of factors (tall/short and yellow/green) separate out
independently of each other. That is, tall is not always inherited with yellow and short with green –
some tall green offspring and some short yellow offspring will result. This law assumes that the genes are
located on different chromosomes.
Autosomes and sex chromosomes
Every cell in the human body contains 23 pairs of chromosomes: 22 pairs of autosomes (chromosomes
that code for general traits within the body) and 1 pair of sex chromosomes (Fig. 5.10). Sex chromosomes
carry genes that determine the sexual characteristics of a person and therefore influence whether they
are biologically male or female.
Science Photo Library/Dr. Gopal Murti
Science Photo Library/CNRI
a b
X Y
FIGURE 5.10 a The human karyotype of a male; b scanning electron micrograph image of human X and Y chromosomes
Sometimes within a population there are more than two alleles for a particular gene. For example:
◗ alleles for flower colour in sweet peas – pink, white, purple, red
◗ alleles for hair colour in Labrador dogs – black, brown or yellow (golden).
However, an individual can have only two alleles, and which alleles they possess depends on which
pair of alleles have been passed on to them by their parents. Multiple alleles in a population give the
group greater genetic variability and result in greater diversity.
162 MODULE FIVE » HEREDITY 9780170408851
05_bio_InFocus12_2e_sb_08851_txt.indd 162 08/08/18 6:53 pm
KEY CONCEPTS
● A gene:
– is a segment of DNA on a chromosome
– specifies a particular characteristic (e.g. seed colour)
– has two alleles in an individual and two or more alternative alleles in a population.
● Alleles:
– are alternative forms of the same gene
– occur in pairs in a diploid individual, but two or more alleles for each gene may be present in
a population
– segregate during gamete formation (meiosis)
– occur individually in each haploid gamete
– pair during fertilisation, when the diploid condition of an organism is restored during zygote
formation.
● Homozygous and heterozygous genotypes:
– Mendel’s terms ‘pure-breeding’ and ‘hybrid’ are known in modern genetics as ‘homozygous’
(e.g. TT or tt) and ‘heterozygous’ (e.g. Tt) respectively.
– The term ‘homozygous’ is derived from two words: homo = the same; and zygote = a fertilised
egg that has received half its genetic material from each parent.
● Genotype and phenotype:
– The genetic makeup or genotype of an organism determines its physical appearance or
phenotype.
– Phenotype is not only the physical appearance of an organism, but may also include its
physiology (functioning) and aspects of its behaviour. On a molecular level, phenotype is the
sum of the gene products (proteins and RNA) that are made.
CHECK YOUR
1 How did the model known as modern synthesis arise? UNDERSTANDING
2 Explain autosomal recessive inheritance, using an example.
3 Allocate letters to represent each of the alleles of the characteristics that Mendel studied in pea plants. 5.2a
Assume the first allele is the dominant allele.
4 In poodles, black coat colour is dominant to white coat colour. Assign letters to represent each allele.
Following Mendel's laws and the genetic crosses shown in Fig 5.9, work out what the offspring would look
like if you crossed a homozygous black poodle with a white poodle. What genotypic ratio would you expect?
5 Distinguish between autosomes and sex chromosomes.
Solving genetics problems
Genetic problems come in many forms. To solve a genetics problem, you need to use the information
given – read it, analyse it and see what deductions you can make from it. To make predictions in any
genetic cross, it is important to determine which trait is dominant – this information may be known
(visible in the phenotype), or it may be worked out by deductive reasoning. Sometimes it remains
unknown.
Representing autosomal inheritance using a Punnett square
A useful problem-solving technique for organising information and representing a genetic cross is to
draw a Punnett square. (See Worked example 5.1, on page 164.)
A Punnett square is a model used to represent inheritance patterns such as autosomal inheritance, as
shown in Mendel’s monohybrid cross. Models such as this can be used in predicting possible outcomes
when certain individuals are cross-bred. This is a very useful problem-solving tool, as it allows scientists
to calculate the probability of a genetic trait (such as blue eyes or dimples) being passed on.
Punnett squares are often used to calculate the probability that a genetic defect will be inherited by
offspring of two parents of known genotype. A Punnett square shows the basic pattern of inheritance – how
9780170408851 CHAPTER 5 » GENETIC VARIATION 163
05_bio_InFocus12_2e_sb_08851_txt.indd 163 08/08/18 6:53 pm
two factors in each parent separate during the formation of gametes (segregation) and the possible
combinations of alleles that could arise during fertilisation. The probability of any particular genotype or
phenotype arising can then be calculated from the results.
Probability in genetics
You have seen how the phenotypic ratio of offspring (3 dominant : 1 recessive) was derived from
Mendel’s typical monohybrid cross. This means that, taking the gene for height as an example, three-
quarters of the offspring will be tall and one-quarter will be short. The probability can also be written as
a percentage – there is a 75% probability that offspring will be tall and a 25% probability that they will
be short.
This result will only be obtained with a large sample size, as it is based on probability. Even if a large
number of plants are studied, the ratio will be approximate. For example, when Mendel studied height in
garden peas, he obtained 787 tall and 277 short plants (a ratio of 2.84 : 1). For yellow peas and green peas,
he obtained 6022 yellow peas and 2001 green peas (3.01 : 1). These ratios are close to, but not precisely, 3 : 1.
The more individuals that are counted, the more closely the observed ratios approach the expected
values.
Mendel’s ideas and logic can easily be represented using a Punnett square to predict the features of
offspring in a genetic cross, as shown in the worked example.
WORKED EXAMPLE 5.1
1 Use a Punnett square to predict the ratio of offspring produced if two individuals that are heterozygous for height are
crossed.
ANSWER LOGIC
Let T = tall and t = short • Write the parent genotypes that are to be crossed.
F1: Hybrid tall Hybrid tall
Tt Tt
Segregation
Gametes T t T t • Show how the gametes segregate during meiosis.
Gametes T t • Draw up a 3 × 3 grid. Write the genotypes of one set of
gametes across the top of the grid and the other set of
gametes down the side.
T TT Tt • In the centre of the grid, write the genotypes that would
result from each combination of gametes.
t Tt tt
TT : Tt : Tt : tt • Write the genotypic ratio.
3 tall : 1 short • Write the phenotypic ratio.
TRY THESE YOURSELF
1 In Labrador dogs, black hair, B, is dominant to white hair, b. Predict the expected genotypic and phenotypic ratios
resulting from the crosses below.
a homozygous black dog × white dog
b two heterozygous black dogs
c heterozygous black dog × white dog
164 MODULE FIVE » HEREDITY 9780170408851
05_bio_InFocus12_2e_sb_08851_txt.indd 164 08/08/18 6:53 pm
2 In fruit flies, curly wing is dominant to straight wing. Two curly-wing fruit flies produce 51 offspring with
straight wings and 149 curly-wing offspring. WS
a What are the probable genotypes of the parent flies? (Hint: Work out the ratio of curly-wing to
Dominant and
straight-wing flies.) recessive traits
b Justify your answer using a Punnett square.
c Calculate what proportion of the curly-wing offspring would be heterozygous.
A test cross
When you consider an organism’s phenotype, it is not always possible to tell what its genotype is. For
example, in Mendel’s pea plants, a phenotypically tall plant may have the genotype TT or Tt. To determine
the genotype in cases such as this, geneticists use a technique called a test cross.
For example, in the fruit fly Drosophila melanogaster, wing length is determined by a single gene. The
allele for long (normal) wings (Fig. 5.12a) is dominant and can be represented by the letter V. The allele
for short (vestigial) wings (Fig. 5.12b) is recessive and can be represented by the letter v. To determine
whether a fly with long wings is homozygous (VV) or heterozygous (Vv), it can be crossed with a fly that
is homozygous for the recessive gene (vv). Using Mendel’s expected ratios, we can predict that if the fly is
homozygous for long wings, all offspring will have long wings, because they will all inherit a V allele from
the long-winged parent and a v allele from the short-winged parent, resulting in all offspring having the
genotype Vv.
Visuals Unlimited/Science VU/
Science Source/Andrew Syred
Dr. F. Rudolph Turner
a b
FIGURE 5.12 Drosophila fruit flies with a normal wings and b vestigial wings
However, if the long-winged parent fly is heterozygous (Vv), it will pass one V allele to half its offspring
and one v allele to the other half. The offspring will all receive a v allele from the short-winged parent. Probability of
inheritance
Therefore the ratio of long-winged (VV or Vv) to short-winged (vv) offspring will be 1 : 1. Do the quiz,
working through
The two crosses can be represented in a Punnett square, as shown below. the questions and
Punnett squares.
Cross 1 Cross 2
P: VV × vv P: Vv × vv
Gametes V V Gametes V v
v Vv Vv v Vv vv
v Vv Vv v Vv vv
100% of F1 offspring are Vv and 50% of F1 offspring are Vv and have long wings,
therefore have long wings. 50% of F1 offspring are vv and have short wings.
Test crosses are carried out between an organism that exhibits a dominant trait and an organism that
exhibits a recessive trait, to determine whether the dominant organism is homozygous or heterozygous
for the dominant trait.
9780170408851 CHAPTER 5 » GENETIC VARIATION 165
05_bio_InFocus12_2e_sb_08851_txt.indd 165 08/08/18 6:53 pm
Pedigree analysis
If the traits expressed in a family over several generations are observed, a pedigree chart (family tree) can
be constructed to record phenotypes. This may be used to work out the genotypes of family members,
some of which may be more easily determined and some of which may be unknown. A pedigree chart and
analysis is often used to study heredity patterns in families by tracing the inheritance of any particular
characteristic, and to make predictions about the expected phenotypes and genotypes of future offspring.
Pedigree charts can be used to identify inheritance patterns in a variety of organisms. Their usefulness
may range from studying mutations in humans that result in disease or disorders, to studying desirable
phenotypic traits in horses for breeding purposes. The traits that appear in each generation are recorded
using particular symbols and lines to show relationships. Analysis of pedigree charts is based on using
logic and reasoning to work out the genotypes of parents and offspring.
It is often necessary to study at least three generations to find out the genotypes of individuals. This
is because masked recessive genes cannot be detected by simply examining the phenotype of one or two
individuals. Studying a trait over several generations may reveal the genotypes, because recessive traits
may be masked and appear to ‘skip’ a generation, reappearing in later generations. (See Fig. 5.14 and
Worked example 5.2.)
Pedigree charts or diagrams are drawn in a universally accepted scientific format, using standard
symbols. They show an individual’s biological relatives and their partners as a series of circles and
squares, linked by lines. The occurrence of a particular trait within the family is represented by
shading.
A pedigree can therefore be defined as a graphical representation of the inheritance patterns of a
particular trait in related individuals over a number of generations. Analysis of the pedigree chart is
carried out to record:
◗ how many family members have the trait
◗ the gender (male or female) of the affected individuals
◗ how individuals in the pedigree are related.
This information may be used to:
◗ determine inheritance patterns
◗ assign genotypes to individuals where possible
◗ make predictions about the probability (sometimes the risk) of an individual inheriting a trait
(for example, a genetic disorder, abnormality or disease).
Constructing pedigrees and analysing inheritance
Constructing and analysing a pedigree chart (Fig. 5.13) for a particular trait is done through a series
of steps.
1 Gather phenotypic records of that trait in family members over several generations.
2 Use symbols to represent the various family members, showing whether they are male (square) or
female (circle) and whether or not they possess the trait being studied (shaded = trait being studied is
present).
3 Assign a number (Roman numeral) to each generation of the family tree and another number (Arabic
numeral) to each individual in that generation.
4 Use linking lines to represent relationships between people – marriage (horizontal line) and offspring
(vertical line).
166 MODULE FIVE » HEREDITY 9780170408851
05_bio_InFocus12_2e_sb_08851_txt.indd 166 08/08/18 6:53 pm
a
Gender
Male Male
Sex unspecified
Female Female
Unaffected individuals/do not Affected individuals/
display trait being studied display trait being studied
Marriage and descent Twins Descent line
Marriage
line
Dizygotic (non-identical) twins
Descent
line Descent line
Marriage
of blood Monozygotic (identical) twins
relatives
Affected/unaffected
Unaffected Affected Heterozygote carrier
for X-linked recessive
b Sample pedigree
I
1 2
II
1 2 3 4 5 6
Arabic numerals
represent individuals
III in pedigree.
1 2 3 4 5
Method of
Roman numerals identifying
represent generation this individual
number. in a pedigree: II-2
FIGURE 5.13 a Symbols used in human pedigree construction and analysis; b a sample pedigree
Table 5.2 summarises features of autosomal inheritance patterns for dominant and recessive genes.
Use this table to assist with logical deductions that you need to make when analysing pedigree charts.
9780170408851 CHAPTER 5 » GENETIC VARIATION 167
05_bio_InFocus12_2e_sb_08851_txt.indd 167 08/08/18 6:53 pm
TABLE 5.2 Some inheritance patterns evident from pedigree analysis
TYPE OF INHERITANCE FEATURES EXAMPLES
Autosomal Trait follows Mendelian inheritance pattern.
Autosomal recessive • The trait is expressed as the result of a recessive Albinism
gene. Tay-Sachs disease
• The affected individual must carry two affected Cystic fibrosis
alleles (be homozygous recessive) for this gene to Sickle cell anaemia
be expressed.
• The gene can be passed on to both males and
females in equal proportions.
• The trait appears to skip a generation.
Autosomal dominant • The trait is expressed as a result of a dominant Huntington’s disease
gene. Achondroplastic dwarfism
• The affected individual must carry at least one Polydactyly
affected allele for this gene to be expressed.
• The gene can be passed on to both males and
females in equal proportions.
• The trait does not skip a generation.
WORKED EXAMPLE 5.2
Figure 5.14 shows three generations of one family. If the
trait of fair hair colour is selected for study:
i Construct a pedigree for the family shown.
ii Analyse the pedigree to determine the genotype
with respect to hair colour (where possible) of each
individual in the pedigree chart.
FIGURE 5.14 Family photo showing how hair colour may ‘skip’ a
generation . The daughter in the middle of the photo is with her
parents on the left and her husband and child on the right.
ANSWER LOGIC
i Pedigree To construct a pedigree chart:
• Record the phenotype of each individual – males are
I represented by a square, females by a circle.
1 2 • Shade individuals who express the trait being studied – in
II this case, fair hair.
1 2 • Use linking lines to represent relationships between people.
III • Assign a Roman numeral to each generation of the family
tree and a number (Arabic numeral) to each individual.
1
FIGURE 5.15 Family pedigree
showing hair colour
168 MODULE FIVE » HEREDITY 9780170408851
05_bio_InFocus12_2e_sb_08851_txt.indd 168 08/08/18 6:53 pm
ii Genetic cross and analysis To analyse the pedigree chart and determine the genotypes of
individuals:
Cross from phenotype
• Record the known genotypes, working these out from the
Let B = black hair and b = fair hair
phenotypes given. Let B represent dark hair and b represent
P: B_ × bb (grandparents) fair hair. If an allele is unknown, put an _ (underscore).
F1: B_ × B_ (parents)
F2: bb (grandson)
Analysis
Two individuals that express the dominant trait produce an • Analyse the cross, using logic.
offspring that expresses the recessive trait.
Deduction
The parent individuals with the dominant trait must have • Make a deduction (conclusion), using reasoning.
been heterozygous for that trait (each passed a ‘b’ allele to
their son).
Genotypes
P: Bb × bb • Complete the cross by filling in the missing genotypes (red
alleles) that you determined.
F1: Bb × Bb
F2: bb
TRY THESE YOURSELF
WS
1 Skippy the kangaroo is descended from a line of kangaroos that have a history of albinism. Albinos are
unable to make pigment and therefore their coat colour is white. Skippy has brown fur and he mates
Interpreting
with a brown female kangaroo named Bouncer. They produce two offspring: joey 1 is an albino and pedigrees
joey 2 has brown fur. Skippy’s mother was an albino and his father had brown fur. Both of Bouncer’s
parents had brown fur.
a Construct a family pedigree to show the inheritance of albinism in the kangaroo family described.
b Analyse the pedigree to determine the genotype (where possible) of each individual in the pedigree
chart. Explain your reasoning.
INVESTIGATION 5.2
Practical investigation to gather data and construct
a family pedigree chart
WS
Pedigree charts are used in science to trace the appearance of a phenotypic trait across several generations, to
determine the type of inheritance pattern of the trait. You are to represent an autosomal trait across a family of Traits and
three generations and include a total of at least seven individuals. information that
may be used
for constructing
AIM
pedigrees
To construct a pedigree or family tree to trace the inheritance of selected characteristics
METHOD
1 Select a genetically determined trait in a family to construct a family pedigree chart. Conduct research to
decide on a suitable genetic trait to use for gathering data for this purpose. Traits that are coded by a single
gene and that have two allelic variations tend to be easiest to study. Use your own family or the family of a
friend or neighbour. You will need to interview them to gather information about other family members.
9780170408851 CHAPTER 5 » GENETIC VARIATION 169
05_bio_InFocus12_2e_sb_08851_txt.indd 169 08/08/18 6:53 pm
2 Using correct scientific notation, construct a family tree to show the inheritance of the characteristic you
have selected. If you do not have direct data about some family members, predict their characteristics
using any information you have (such as photos, stories, your own traits). Use the correct symbols to
represent individuals, the correct lines to show relationships and the correct numbering system for
generations and individuals.
Important note: The pedigree chart must contain at least three generations and at least seven individuals.
3 Carefully label your pedigree chart with the names of family members (first names only, for confidentiality,
or change the names). Also include an illustration of the characteristic you selected, such as a diagram or
photograph and/or a brief description.
RESULTS
Critical and 4 Analyse your pedigree chart to determine whether the gene responsible is dominant or recessive, or if
creative thinking
dominance cannot be determined, explain why.
5 Using information in your pedigree chart, write:
a three questions that other students could answer, based on the pedigree you have constructed
b two questions that they would need more information to answer
c one question that could form the basis of further research.
As a start, you may wish to consider whether the trait is dominant or recessive, which genotypes of family
members are known and unknown, the scientific basis for the phenotype, and/or how, when and why the
gene is expressed.
KEY CONCEPTS
● A test cross is used to determine whether an individual is homozygous dominant or
heterozygous for a particular trait.
● A pedigree chart is used to trace the inheritance of a particular trait through several generations
of a family.
● There are accepted symbols for constructing a pedigree chart.
CHECK YOUR
UNDERSTANDING 1 It is not known whether a Labrador dog is homozygous dominant for black coat or heterozygous.
a Describe a cross that would enable you to find out.
5.2b b What is this type of cross called?
2 A cross between peas homozygous for green pods and peas homozygous for yellow pods results in
offspring that all have green pods.
a Identify which gene is dominant and explain why.
b If two of the resulting offspring with green pods are crossed, calculate the expected genotypic and
phenotypic ratios. Show your working using either a Punnett square or a branching diagram.
3 Jordan has blue eyes. Both his parents are brown-eyed. He marries a brown-eyed woman, Claire, whose
father has brown eyes and mother has blue eyes. Jordan and Claire have a child, Chloe, who has blue eyes.
a State the genotypes of Jordan, Claire and Chloe.
b Using a Punnett square, work out the chance of them having another blue-eyed child.
c Draw a pedigree chart for the family.
170 MODULE FIVE » HEREDITY 9780170408851
05_bio_InFocus12_2e_sb_08851_txt.indd 170 08/08/18 6:53 pm
4 Use the information in Table 5.2 and Worked example 5.2 i ii
to help you to analyse the four pedigrees in Figure 5.16
and to solve the problems that follow. I I
1 2 1 2
a State whether the trait being investigated in each
pedigree (i–iv) is dominant or recessive, or whether
the information given is insufficient to allow a
II II
valid deduction. Explain how you arrived at your
conclusion for each. 1 2 3 1 2 3
b Based on pedigree (ii), describe how individual II-2 is
related to: iii iv
a individual II-1
I I
b individual I-2.
1 2 1 2
c Based on information given in pedigree (iii), use a
Punnett square to determine the probability that the
II
next child born would be homozygous recessive. II
d Based on pedigree (iv): 1 2 3
1 2 3
a Assign genotypes to each individual in the pedigree. III 1
b Determine the probability that individual III-1 will
be affected. FIGURE 5.16 Pedigrees i – iv
c Explain how individuals II-2 and II-3 are related.
5.3 Deviations from Mendel’s ratios
Although Mendelian inheritance provides a solid model for inheritance patterns, later studies showed
that at times there are deviations from Mendel’s ratios under certain conditions. It is not known whether
Mendel was aware that his ratios did not always hold true, or whether he chose to ignore results that did
not fit in with his ratios.
Deviations from Mendelian ratios that have been observed over the years can be attributed to the
following changes in typical Mendelian conditions:
◗ Some genes are not dominant or recessive; they may both be expressed (codominance) or a blending
of their characteristics may be expressed (incomplete dominance).
◗ Some genes do not assort independently; they are linked. For example, genes on sex chromosomes
show sex-linked inheritance, where ratios differ between male and female individuals.
Sex determination
Sex determination is the way in which sex chromosomes separate during meiosis and then recombine
during fertilisation to determine whether the offspring will be male or female.
During meiosis, the sex chromosomes segregate, just like any other homologous pair of chromosomes,
where only one of each chromosome pair passes into a gamete. Because a female has 44 autosomes + XX,
when the chromosome number is halved, each female gamete (egg cell) receives 22 autosomes + X. In
males, half the gametes (sperm cells) receive 22 autosomes + X and the other half receive 22 autosomes + Y.
Fertilisation follows and in the recombination of sex chromosomes in the zygote, the sex chromosome
donated by the male gamete dictates the sex of the child (Fig. 5.17):
◗ A zygote that inherits an X chromosome from both the mother and the father will be female (XX).
◗ A zygote that receives an X chromosome from the mother and a Y chromosome from the father will
be male (XY).
9780170408851 CHAPTER 5 » GENETIC VARIATION 171
05_bio_InFocus12_2e_sb_08851_txt.indd 171 08/08/18 6:53 pm
FIGURE 5.17 Sex
determination in
humans Man Woman
P: genotype
XY Meiosis XX
X X
No Ovaries Female
Y chromosome develop child
X XX XX
Gametes
Y chromosome Testes Male
Y develop child
XY XY
In humans, genes on the X and Y chromosome code for the production of sexual reproductive
organs and the development of secondary sexual characteristics that define whether an individual is
phenotypically male or female. The Y chromosome carries the testis-determining gene and therefore, if
present, the Y ensures that the child will be male. This does not apply to all animals.
Occasionally, non-disjunction of chromosomes occurs during meiosis, whereby the chromatids do
Sex
determination not separate from each other. This results in an incorrect number of chromosomes in the offspring ( for
Watch the video – example, 45 or 47 instead of 46). (See Chapter 7 – Chromosomal mutations.) If this occurs in the sex
parts 4 and 5.
chromosomes and only one X chromosome is present, the child will be female. An individual with XXY
will be male (Chapter 15).
WS
Sex linkage
Additional
information on sex
Sex linkage occurs when some genes carried on the X and Y chromosomes code for characteristics other
determination than the gender of the individual. If a gene occurs on the X chromosome, females will have two alleles for
that gene whereas a male will only have one, because he has only one X chromosome. Therefore recessive
disorders appear more frequently in males.
WS For example, in humans, genes for red–green colour vision are carried on the X chromosome. The
mutant form may result in the person being red–green colour blind (unable to distinguish between
Sex linkage diagrams red and green). Haemophilia (a bleeding disorder) is an X-linked disorder. Alleles for this gene occur
and additional
information on colour on the X chromosome. A male who inherits one copy of the mutant allele (on the X chromosome
blindness
from his mother) will suffer from the condition. Because the male has no equivalent allele on the
Y chromosome to mask this defective allele, a single copy of this recessive gene results in the male
WS
being affected by the recessive gene.
Females have two X chromosomes, one from each parent. Therefore if a female inherits a mutant
Summary of sex linkage allele for haemophilia on one X chromosome, she will not suffer from the disorder if her other allele
in humans
is dominant. Such a female is termed a carrier – the defective allele does not affect her, but may be
passed to her sons (who would be affected) or to her daughters (who may be carriers or affected,
depending on the allele they inherit from their father). If a daughter inherits a pair of defective alleles
for haemophilia (one from each parent, on each X chromosome), the condition is lethal. (Fig. 5.18 shows
inheritance of haemophilia in the royal families of Europe.)
172 MODULE FIVE » HEREDITY 9780170408851
05_bio_InFocus12_2e_sb_08851_txt.indd 172 08/08/18 6:53 pm
Some sex-linked genes are found on the Y chromosome (termed ‘Y-linked’) and appear in males only,
but these tend to be less common. An example of a Y-linked gene is Y chromosome infertility.
a
George III
Generation
Edward Louis II
Duke of Kent Grand Duke of Hesse
I Prince Albert Queen Victoria
King
II Edward VII
Frederick Victoria Alice Duke of Alfred Helena Arthur Leopold Beatrice Prince
III Hesse Henry
No haemophilia No haemophilia
German King
III Royal George V
House Irene Czar Czarina Earl of Princess Maurice Leopold Queen Alfonso
Nicholas II Alexandra Athlone Alice Eugenie King of
Spain
IV ? ? ? ?
Duke of King Earl of Waldemar Prince Henry Anastasia Alexis Viscount Alfonso Jamie Juan Gonzalo
Windsor George VI Mountbatten Sigismond Tremation
Prussian Russian
V
Royal Royal ? ?
Queen Prince Margaret House House King Juan
Elizabeth II Philip Carlos
No evidence No evidence
VI ? of haemophilia of haemophilia
Princess Prince Anne Andrew Edward
Diana Charles Spanish Royal House
British Royal House
VII
William Henry
Alamy Stock Photo/Chronicle
FIGURE 5.18 a Pedigree showing sex-linked haemophilia in the British Royal family; b Queen Victoria and her
family, who were affected by this disease
9780170408851 CHAPTER 5 » GENETIC VARIATION 173
05_bio_InFocus12_2e_sb_08851_txt.indd 173 08/08/18 6:53 pm
Symbols used to represent alleles in sex-linked crosses
When the inheritance of a sex-linked gene is being represented, the alleles of that gene (for example,
H = normal blood clotting, h = haemophilia) as well as the type of chromosome on which it is carried
(X or Y) must be shown in the genetic cross. The letters H and h are assigned in keeping with the symbols
used to show dominant and recessive alleles of a gene. These are then written as a superscript on the
chromosome on which they are attached.
For example:
Virtual Lab:
sex-linked traits XH XH = normal female
Watch a video, work XH Xh = carrier female (heterozygous)
through sex-linked
genetics problems Xh Xh = haemophiliac female (homozygous = lethal)
using Punnett
squares and then XH Y = normal male
breed fruit flies in
virtual laboratory Xh Y = haemophiliac male
experiments. Segregation of both the chromosome and the attached alleles can therefore be represented (Fig. 5.19).
FIGURE 5.19 Parental phenotypes: Haemophiliac male 3 Carrier female (hybrid)
Genetic cross of two
hybrid parents for Parental genotypes: Xh Y 3 XH Xh
the sex-linked trait
haemophilia
Meiosis
Gametes:
Xh Y 3 XH Xh
Fertilisation
Drag and drop
genetics
Create Punnett Punnett square
squares and answer Gametes XH Xh
questions about
haemophilia.
Xh XH Xh Xh Xh
Y XH Y Xh Y
Colour vision
F1 genotypic ratio: 1 XH Xh : 1 Xh Xh : 1 XH Y : 1 Xh Y
Read the
information on
F1 phenotypic ratio: 1 normal female : 1 haemophiliac female (lethal) : 1 normal male : 1 haemophiliac male
the types of
colour blindness,
explore pedigrees
of inheritance
and view images The results of this sex-linked genetic cross can be analysed as follows:
presented as they
would appear to ◗ The ratio of males to females = 1 : 1
colour blind people ◗ Looking at the males only, there is a phenotypic ratio of 1 normal male : 1 affected male.
and to normal
trichromats. ◗ There is a 25% probability that any offspring will be affected by the disease. There is a 50% probability
that a boy is affected.
Not all sex-linked disorders are lethal in homozygous recessive females. Examples where the
homozygous recessive is not lethal is red–green colour blindness in humans and white eye colour in
Colour vision
tests and charts fruit flies.
Incomplete dominance and codominance
Incomplete dominance and codominance are two more examples of inheritance that does not show
Sex-linked
inheritance online a Mendelian pattern. This is because in the genes of some organisms, pairs of alleles do not show
problems
dominance of one allele over the other.
174 MODULE FIVE » HEREDITY 9780170408851
05_bio_InFocus12_2e_sb_08851_txt.indd 174 08/08/18 6:53 pm
Incomplete dominance
In incomplete dominance there is a blending of the features of the two P
alleles expressed, giving a hybrid that is intermediate; for example,
red snap dragon flowers crossed with white snapdragon flowers give
3
pink flowers. Incomplete dominant pink hybrids are also seen in
tulips, carnations and roses.
Special notation is used to represent alleles that do not show CRCR CrCr
complete dominance. A letter is chosen to represent the gene – for
F1
example, C for colour. The alleles are written as superscripts next to
the gene, so the allele for red would be CR and the allele for white
would be Cr (Fig. 5.20).
Codominance in animals
In codominance both alleles are expressed, creating a new phenotype.
The term ‘codominant’ describes this (co = together; both alleles CRCr CRCr CRCr CRCr
behave as dominant alleles because they are both expressed).
Pure-breeding (homozygous) cattle may have a red or white coat FIGURE 5.20 Incomplete dominance in snapdragon flowers
colour. Hybrid individuals (heterozygotes), which have one allele for
red and one for white coat colour, have a roan appearance – both red
and white hairs are present, not in patches but interspersed. That is, both colours of hair are present,
indicating that both alleles are expressed, a typical example of codominance (Fig. 5.21).
FIGURE 5.21
Red bull White cow
Getty Images/Encyclopaedia Britannica/UIG; Shutterstock.com/Faenkova Elena;
Shutterstock.com/tanshy Codominance in
cattle: a red bull and
a white cow produce
a roan calf. Close
inspection of the
roan calf reveals a
mottled appearance
of red and white
interspersed hairs.
Pure-bred CRCR Pure-bred CWCW Incomplete
dominance and
codominance
Roan calf
Genetic
diagrams
and pedigree
analysis
Hybrid CRCW Work through the
online examples
on each web page
and then complete
the quiz.
Another example of codominance occurs in Andalusian chickens. If a homozygous black fowl is
crossed with a homozygous white fowl, the heterozygous offspring in the F1 generation appear ‘blue’.
At first this was thought to be a ‘blending’ of characteristics (incomplete dominance), but closer
WS
examination revealed that the blue Andalusian fowls have both black and white feathers present –
a typical example of codominance. Deviations from
simple Mendelian
Special genetic notation is used to represent codominance. A letter is chosen to represent the gene – ratios
for example, C for colour. The alleles are written as superscripts next to the gene. Because both alleles are
expressed, each allele is given a capital letter. Therefore red would be CR and white would be CW. The roan
cow would be represented as CRCW.
9780170408851 CHAPTER 5 » GENETIC VARIATION 175
05_bio_InFocus12_2e_sb_08851_txt.indd 175 08/08/18 6:53 pm
KEY CONCEPTS
TABLE 5.3 Comparison between autosomal recessive inheritance and other inheritance patterns
CONDITIONS FOR AUTOSOMAL
RECESSIVE INHERITANCE TYPE(S) OF INHERITANCE AND CONDITIONS THAT CAUSE VARIATION
(MENDELIAN RATIOS) FROM THE MENDELIAN INHERITANCE
Individuals have two alleles for Sex-linkage: the heterogametic sex may have only one factor. For
each characteristic; alleles may example, in humans, males have one X and one Y chromosome (and
be the same (such as in pure- the Y is much smaller than the X because it lacks some of the genes
breeding individuals) or they may present on the X). The male genotype is XY and so X-linked genes are
differ (as in hybrid individuals). absent from the Y chromosome, and therefore only one copy is present.
Genes are inherited as ‘discrete Sex-linkage: some genes coding for non-sexual characteristics are
units’ and are not dependent on located on the sex chromosomes. These show inheritance patterns
whether they come from the male similar to the sex chromosomes on which they occur. For example,
or female parent. the sex-linked recessive trait for colour-blindness, present on the
X chromosome and not on the Y, appears more frequently in the
phenotype of males because there is no paired allele (no second
X chromosome) to mask its effect.
The trait that is expressed in Codominance: both alleles in the hybrid are expressed, and so
hybrid individuals is dominant, one allele is not dominant to another (e.g. roan cattle, which are
and the trait that is hidden or hybrids resulting from cross-breeding a red parent with a white,
masked is the recessive trait have both red and white hairs).
(Mendel’s first law – dominance). Incomplete dominance: both alleles are expressed as a blending of
the two characteristics (e.g. red flowers crossed with white flowers
give offspring with pink flowers).
When two hybrids breed, Ratios change for both sex-linked and codominant genes:
statistically they will produce • Sex-linkage: any recessive genes on the X chromosome in males
a ratio of 3 : 1 offspring – three will be expressed in the male phenotype of offspring, because
offspring showing the same they are unpaired (there is no equivalent dominant gene present).
trait as the parents (termed the • Codominance and incomplete dominance: an offspring that is
dominant trait) to one offspring hybrid does not resemble either pure-breeding parent. It has a
showing the contrasting recessive different phenotype of its own, as the genes of both parents are
trait. expressed in the individual (codominance) or a blending of the
parental genes is expressed (incomplete dominance). Therefore
the ratio of a monohybrid cross will be 1 : 2 : 1.
CHECK YOUR
UNDERSTANDING 1 For each of the following figures, draw a Punnett square to represent the cross. Give the expected
genotypic and phenotypic ratios, and explain the type of inheritance pattern shown.
5.3a a Figure 5.9 (one Punnett square for each cross)
b Figure 5.12a × Figure 5.12b
c Figure 5.14
d Figure 5.20
e F1 cross in Figure 5.21
2 Draw a pedigree chart to show the trait roan colour in cattle, using Figure 5.21. Assume that the roan calf
in the figure is male. Add to the pedigree, showing the next generation where the roan calf, once mature,
mates with a white cow, giving rise to twin male calves (one roan and one red) and to a white female calf.
3 Distinguish between ‘codominance’ and ‘incomplete dominance’.
4 If a white chicken is mated with a brown chicken, the offspring have both brown and white feathers.
a Identify the type of inheritance.
b Use a Punnett square to predict the expected genotypes and phenotypes of the offspring if two of the
hybrid offspring are hatched.
5 Explain why genes that are sex-linked do not give Mendel’s predicted ratios when individuals are crossed.
176 MODULE FIVE » HEREDITY 9780170408851
05_bio_InFocus12_2e_sb_08851_txt.indd 176 08/08/18 6:53 pm
Multiple alleles
Individuals usually have only two alleles for each gene (or one, in the case of sex-linkage). Within a
population, however, there may be three or more alleles for a single gene trait. Such a trait is termed
multi-allelic. For example, in humans, the gene for human blood type has three alleles in the population:
A, B and O.
Blood groups are one of the most commonly studied genetic variations in human populations. This
is mainly because transfusions of the wrong type of blood can lead to death. Blood cells have molecular
markers on their surfaces and these play an important role in allowing a person’s own body cells to be
recognised by the immune system as ‘self ’ (that is, cells belonging to that individual).
To represent multi-allelic blood groups using correct genetic notation, the gene is denoted as I
and the three alleles are represented by superscripts: IA, IB and Ii. Alleles A and B are codominant, as
they each produce a molecular marker on red blood cells. If both alleles are present, the blood cells
have both markers. The i allele produces no molecular marker on the red blood cells and is recessive
to both A and B. As a result, there are four possible phenotypes for the ABO blood system: a person
may have blood group A, B, AB or O. There are, however, six possible genotypes (Fig. 5.22, Table 5.4).
Range of genotypes IA IA IB IB
or or
I A Ii I A IB IBIi IiIi
Blood types (phenotypes) A AB B O
FIGURE 5.22 ABO blood types in humans – a range of genotypes showing multi-allelic
inheritance
TABLE 5.4 Human blood groups: genotypes and phenotypes
MOLECULAR MARKERS PHENOTYPE DOMINANCE OR
ALLELES GENOTYPE PRESENT (BLOOD GROUP) CODOMINANCE
AA Homozygous A A —
BB Homozygous B B —
AB Heterozygous AB AB Codominance
AO Heterozygous A A Dominance
BO Heterozygous B B Dominance
OO Homozygous O O —
Another example of a gene that has multiple alleles is the gene for coat colour in rabbits. There are
four alleles, called normal, chinchilla, himalayan and albino.
It is important not to confuse a phenotypic trait that has multiple alleles with phenotypic traits that
are coded for by multiple genes. For example, height and eye colour in humans are termed polygenic
traits as they have two or more genes coding for them and each gene has its own set of alleles. As an
example, height in humans shows continuous variation, with a smoothly graded range of heights from
short to tall, the result of many genes coding for the single trait (human height). This is in contrast to the
single-gene inheritance of Mendel’s garden peas, where there are only two alleles for height – tall or short
(discontinuous variation).
9780170408851 CHAPTER 5 » GENETIC VARIATION 177
05_bio_InFocus12_2e_sb_08851_txt.indd 177 08/08/18 6:53 pm
INVESTIGATION 5.4
Modelling inheritance patterns
You are required to model inheritance patterns, showing the formation of new combinations of genotypes
Video: Genetics
in everyday life. produced during meiosis. The inheritance patterns you are required to model include autosomal inheritance,
Make notes to clarify sex-linkage, codominance, incomplete dominance and inheritance of multiple alleles.
your understanding of Use pairs of homologous chromosomes on which you mark the different types of alleles (Fig. 5.23).
inheritance patterns.
In your model, include the process of fertilisation to predict how variation arises in genotypes of offspring.
RESOURCES
In a pair of homologous chromosomes,
Use the weblinks to design your model. You may one is inherited from the male parent,
wish to create your model using your own version of and the other from the female parent.
Making Reebops ‘Reebop’ genes – see weblink – or genes in a model Paternal
Review the model
Maternal
of your own design, to explain each of the inheritance homologue homologue
on the website as
a starting point for patterns listed below.
designing your own A genetic locus is
model to explain the PART A: INHERITANCE PAT TERNS the location of a
different types of
particular gene on
inheritance patterns. Model the following inheritance patterns passed from a chromosome.
parents to the F1 generation: r r
At each genetic
A: autosomal inheritance locus, an individual
B: sex-linkage P P has two alleles, one
on each homologous
C: codominance chromosome.
Conduct your own
virtual experiments D: incomplete dominance AA = homozygous A A
with fruit flies dominant Three gene pairs at
E: multiple alleles. bb = homozygous b b three different loci
1 Take photographs of the phenotypes of the parents recessive
Cc = heterozygous c C
you use and of the offspring that you create. Record
the genotypes and phenotypes in a table.
FIGURE 5.23 Homologous chromosomes with pairs of
Explore dihybrid PART B: PUNNET T SQUARES AND PEDIGREES alleles showing possible combinations
crosses
2 Using your model, create Punnett squares to
explain each inheritance pattern (A to E) that you
have modelled. (You may wish to divide this up among the members of the group so that each member
creates one or two Punnett squares.)
3 Create a pedigree chart for each inheritance pattern A to E, to show inheritance of genes from parents to F1
as modelled. Then continue the pedigree chart to predict the possible types of offspring if F1 are crossed to
produce the F2 generation.
4 Work collaboratively as a group to present your results in a table.
EX TENSION
Use the weblinks to conduct virtual experiments online using fruit flies, or explore inheritance of two or more
genes (dihybrid crosses).
KEY CONCEPTS
● In a multiple allele system, one gene has three or more alleles present in the population – an
example is the ABO blood group system.
● A and B alleles are codominant in the heterozygous form, as they are both expressed.
● The allele for O blood type is recessive to both alleles A and B.
● Multiple alleles are many different versions of the same gene, whereas polygenic traits have
many genes that determine one trait.
178 MODULE FIVE » HEREDITY 9780170408851
05_bio_InFocus12_2e_sb_08851_txt.indd 178 08/08/18 6:54 pm
CHECK YOUR
1 Define ‘sex-linked trait’. UNDERSTANDING
2 Write the correct genetic notation to show ABO blood groups.
3 Using the ABO blood system as an example, draw a Punnett square to show a genetic cross that can
5.3b
produce all four possible phenotypes in this inheritance. Use examples from this to explain the difference
between dominant and codominant alleles.
4 Distinguish between multiple alleles and polygenic traits.
5 Write three genetic problems for a classmate to answer. The questions should target three different
inheritance patterns.
5.4 Population genetics
The genetic similarities and differences within and between species may be determined at the phenotype,
genotype, allele or molecular level. To do this, scientists conduct frequency studies. They gather
quantitative data that can be analysed and applied to understand variation in individuals, populations
and whole species. Scientists use this data to predict the potential of populations to adapt, as well as the
future resilience and survival of the species.
Population genetics is the study of how the gene pool of a population changes over time, leading to a
species evolving. It relates directly to the inquiry question at the start of this chapter, which asks how the
genetic similarities and differences within and between species can be compared.
The gene pool is the sum total of all the genes and their alleles within a population. Genetic diversity is
the total of all the genetic characteristics in the genetic makeup of a species. It is dependent on genetic
variability, the tendency of individual genetic traits in a population to vary. Species that have a greater Review Biology
in Focus Year 11,
degree of genetic diversity have a greater potential to adapt and survive. Chapter 9, on
Population genetics combines the concepts of Mendelian genetics and Darwinian evolution to macroevolution
and microevolution.
explain how changes in allele frequencies arise in populations and how these changes can lead to
microevolution (over a relatively short period of time) and macroevolution (over a long period of time).
Populations differ in the extent of their genetic variation for particular genes (Fig. 5.24). By measuring
the degree of genetic variation within a population over time, scientists can make predictions about how
populations adapt to their environments and which populations are more likely to flourish, evolve into
new species or die out.
Population geneticists study factors that cause changes in allele frequency within a population.
For example, they may investigate how a temperature change (selective pressure) affects the allele
frequency in a particular population. They use a model based on allele frequencies typical of a stable
population with Mendelian inheritance (a population in equilibrium) and then compare this with
allele frequencies in a real population exposed to selective pressures. External factors other than
natural selection that cause changes to allele frequency are studied, such as gene flow and genetic drift,
which you will learn about in Chapters 6 and 7.
To conduct a scientifically valid study, population geneticists gather quantitative data – they measure
gene and allele frequencies within real populations – and then apply an abstract mathematical model to
predict how external factors will influence these frequencies. They test their conclusions against empirical
data (data obtained by observation and experimentation) so that they can draw valid conclusions about
patterns of genetic variation within populations over time.
9780170408851 CHAPTER 5 » GENETIC VARIATION 179
05_bio_InFocus12_2e_sb_08851_txt.indd 179 08/08/18 6:54 pm
FIGURE 5.24 The
Shutterstock.com/Rawpixel.com
frequencies of
characteristics in
populations change
over time.
Genetic variation and frequencies of characteristics
As you know, genetic variability within a population is essential for evolution by natural
selection. Microevolution can be studied by examining a change in the frequency of alleles
in a population over several generations. For example, skin colour in the red-eyed tree frog
Shutterstock.com/worldswildlifewonders
Agalychnis callidryas is determined by a gene that has two alleles: A (normal colour) and a
(albino) (Fig. 5.25).
Genetic variability in a population can be determined by analysing the relative proportion
(ratio or percentage) of a given phenotype, genotype or allele within that population. The
discussion of genetic crosses using Punnett squares, earlier in this chapter, looked at the
different phenotypic and genotypic ratios in offspring. Another important factor is allele
frequency in a population.
Allele frequency is a measure of how common an allele is within a population. Many genes
are bi-allelic – that is, they have two variants or two possible alleles within a population ( for
Getty Images/Science Source
example, T and t for height of pea plants). Allele frequency can be calculated by counting the
number of copies of an allele in a population and then dividing by the total number of copies
of all alleles of the gene:
Number of copies of allele (G) in the population
Frequency of allele G =
Total number of copies of the gene (G + g) in the population
Some genes may be multi-allelic (more than two allele variants per gene) – an example is
FIGURE 5.25 Skin colour in the gene for blood group. In this case, to calculate the total number of copies of the gene, we
the red-eyed tree frog. Normal
colour (A) is dominant over would need to add together all the different alleles (three for ABO blood groups) within the
albino (a).
population.
180 MODULE FIVE » HEREDITY 9780170408851
05_bio_InFocus12_2e_sb_08851_txt.indd 180 08/08/18 6:54 pm
WORKED EXAMPLE 5.3
If you conduct a study of a small population of tree frogs over time, you can measure the change in allele
frequency. Tables 5.5a and 5.5b represent a hypothetical frog population, showing phenotypes present in the
first generation (Table 5.5a) and seven generations later (Table 5.5b).
1 For each generation of the frog population, calculate the:
a phenotypic frequencies
b genotypic frequencies
c allele frequencies.
2 Propose possible reasons for the change in allele frequencies.
3 Propose a research question or hypothesis that you as a population geneticist may decide to test, to find
out whether a particular factor is the basis for the change in allele frequency.
TABLE 5.5a Frog population in first generation (generation 1)
AA Aa AA aa
aa
AA AA AA
AA Aa AA Aa
TABLE 5.5b Frog population in generation 7
aa Aa Aa aa
AA AA Aa aa
AA Aa aa Aa
9780170408851 CHAPTER 5 » GENETIC VARIATION 181
05_bio_InFocus12_2e_sb_08851_txt.indd 181 08/08/18 6:57 pm
ANSWER
Generation: First (1) Later (7) LOGIC
(i) Phenotypic • Count the number of normal and albino frogs in each
frequencies: generation.
Normal frogs 10 8 • Calculate the phenotypic frequencies by dividing the
= 0.83 = 0.67
12 12 number of each type of frog by the total number of frogs.
Albino frogs 2 = 0.17 4 Round to two decimal places.
= 0.33
12 12
(ii) Genotypic • Count the number of each type of genotype (AA, Aa and
frequencies: aa) in each generation.
7 3
AA = 0.58 = 0.25 • Calculate the genotypic frequencies by dividing the
12 12 number of each type of genotype by the total number of
Aa 3 5 frogs. Round to two decimal places.
= 0.25 = 0.41
12 12
aa 2 = 0.17 4
12 12 = 0.33
(iii) Allele • Count the number of each type of allele (A and a) in each
frequencies: generation.
A 17 11 • Calculate the allele frequencies by dividing the number of
= 0.71 = 0.46
24 24 each type of allele by the total number of alleles. Round to
a 7 13 two decimal places.
= 0.29 = 0.54
24 24
Possible reasons Yellow colour has a selective advantage. • Think of as many reasons as possible with a genetic and/
for change or evolutionary basis.
More yellow frogs moved into the population.
Thinking I wonder if the colour affects which frogs • State what you are thinking/wondering.
are captured by predators.
Research question What effect does the albino colour of frogs • Narrow this down to a more specific research question.
have on capture by predators?
Hypothesis If a frog is albino, then its rate of capture by • Turn the research question into a hypothesis.
predators will be less frequent.
TRY THESE YOURSELF
1 Calculate genotype, phenotype and allele frequencies for this population of peppered moths over three generations.
Assume black moths are homozygous dominant. Give reasons for the possible change in colour and write a hypothesis
that could be tested experimentally.
Generation 1 Generation 2 Generation 3
Imagefolk/Bill Coster/ardea.com;
Getty Images/iStock/Henrik_L
Eaten by predators
FIGURE 5.26 Change in peppered moth colour over three generations
FIGURE 5.27
2 Calculate the phenotypic, genotypic and allele frequencies
for the ABO blood groups in the family shown in the pedigree
(Fig. 5.27). Their genotypes are as follows: father AO, mother
Father
BO, son AB, daughter AO, baby O. Mother
Son Daughter Baby
(recombination of
recessive traits)
182 MODULE FIVE » HEREDITY 9780170408851
05_bio_InFocus12_2e_sb_08851_txt.indd 182 08/08/18 6:57 pm
INVESTIGATION 5.5
Examining frequency data in genetic studies
There are many ways to answer common questions on genetics, such as:
Numeracy
‘What is the probability that an individual will inherit the genetic trait x?’
‘Is it likely that population y will be able to adapt and survive as a result of a change in the environment?’
‘Is gene z more common in people of particular ethnic groups, or those living in certain countries in the Critical and
creative thinking
world?’
To make accurate predictions and provide answers to these and other questions relating to population
genetics, quantitative frequency data is used.
PART A: INTERPRETING FREQUENCY DATA FROM GRAPHS
Examining the frequencies of blood groups of humans around the globe shows differences between people
from different countries and ethnic origins.
Analyse the data in the graph in Figure 5.28 and identify any trends, patterns and relationships that are
evident.
60
O B
A AB
50
40
Percentage (%)
30
20
10
0
)
g)
y)
se
n)
y)
d)
n)
)
on
re
ed
te
ba
an
pa
ica
kin
an
ne
po
hi
at
nt
m
om
(W
ol
(Ja
pa
er
Pe
m
ga
Ca
er
(P
Am
sti
Ja
e(
(B
nu
US
Sin
e(
(G
ish
(E
es
n-
Ai
es
e(
ish
nd
w
ic
in
ca
in
es
an
Je
w
Ch
Hi
Ch
fri
in
Je
sp
(A
Ch
Hi
US
FIGURE 5.28 Frequencies of blood groups of humans around the world
1 Does the frequency data represent phenotype, genotype or allele frequencies? Justify your answer.
2 State which blood types are most and least common among most groups of people.
3 Which two groups differ most significantly in their blood group frequencies compared with groups from
the rest of the world?
4 Calculate the average frequency of each blood group in all sectors of people represented in the graph.
5 Draw two pie graphs to represent the blood group distribution of Japanese and Ainu Japanese people.
Construct a table to compare the distribution of blood groups in these two groups.
6 Formulate three questions of your own – two that can be answered from the graph and one that you find
interesting and would like to research further.
7 Conduct a secondary-source investigation and write a paragraph to answer the research question that you
formulated.
9780170408851 CHAPTER 5 » GENETIC VARIATION 183
05_bio_InFocus12_2e_sb_08851_txt.indd 183 08/08/18 6:57 pm
8 Pair with another student and each answer the other’s questions related to the graph. Share your findings
on your researched questions.
9 Brainstorm with your partner as many reasons as you can to explain why the frequency data represented in
Analysis of gene
frequency of Figure 5.28 would have relevance for the Red Cross. (The international Red Cross is a global organisation
two alleles in a that helps with blood donations during conflict, in response to human-made or natural disasters or due to
population of
wild rabbits conditions of chronic poverty.)
Calculate the gene
frequency of the PART B
alleles for each
generation, and then 1 Research why the frequency of the gene for sickle cell anaemia, a detrimental mutation that affects red
graph the frequency
of the two alleles over blood cells, has a higher frequency in African people than in other populations. Find a graph to support
10 generations. this claim.
2 Extension: Model gene frequency change in a population affected by natural selection (evolution).
Conduct an investigation using allele frequency, as outlined in the weblink.
KEY CONCEPTS
● Population genetics combines Mendelian genetics and Darwinian evolution to explain
how changes in allele frequencies arise in populations and how these changes can lead to
microevolution and macroevolution.
● Population geneticists study mathematical changes in gene and allele frequencies in
populations to develop quantitative ways of exploring different evolutionary hypotheses.
● Allele frequency is a measure of how common an allele is in a population:
Number of copies of allele (G) in the population
Frequency of allele G =
Total number of copies of the gene (G + g) in the population
CHECK YOUR
UNDERSTANDING 1 What is population genetics?
2 How do population geneticists gather, process and apply data to make predictions about populations?
5.4a 3 Write out a mathematical formula for calculating:
a phenotypic frequency
b genotypic frequency
c allele frequency.
4 Give one application for gathering each of the types of data listed in Question 3.
Mutations are dealt Single nucleotide polymorphisms
with in more detail
in Chapter 7. In genetics, the term polymorphism refers to individuals with different phenotypes. Literally translated, it
means ‘many forms’ (poly = many, morph = form). Polymorphisms usually arise as a result of a mutation –
an error in DNA replication.
A single nucleotide A single nucleotide polymorphism (SNP) is like a typing error in DNA, where one nucleotide is
polymorphism or
SNP is pronounced replaced by another (Fig. 5.29). SNPs usually arise during DNA replication, where a single nucleotide is
‘snip’. incorrectly inserted, creating an error in the DNA sequence at a particular location on a chromosome.
To be termed a SNP (rather than simply a mutation), this altered DNA sequence must occur in at least
one per cent of the population.
Why are SNPs useful in genetic studies?
Variations in organisms, including SNPs, may be associated with phenotypic change, such as a change
in appearance, enzyme functioning, disease susceptibility or response to drugs. Most SNPs, however,
184 MODULE FIVE » HEREDITY 9780170408851
05_bio_InFocus12_2e_sb_08851_txt.indd 184 08/08/18 6:57 pm
FIGURE 5.29 Single
nucleotide
polymorphism (SNP)
C G C G
SNP
T A C G
G C G C
occur in non-coding regions of DNA and do not lead to observable differences. What, then, is the
importance of studying these SNPs?
SNPs are important genetic markers that are currently used to distinguish individuals and to What are SNPs?
identify things such as disease susceptibility in individuals. A genetic marker can be defined as an
identified sequence of DNA at a known site (locus) on a chromosome – for example, a SNP or a STR
You will learn
(short tandem repeat). more about STRs
Individuals within a population show great variation in the genetic markers they have on their DNA. in Chapter 6.
This gives scientists a relatively easy way to tell individuals apart. For example, there are approximately
10 million known SNPs in the human genome.
Some genetic markers are associated with specific traits or disorders, but do not necessarily cause
them. In studies of genetic markers, called genome-wide association studies (GWAS), computer technology
is used to rapidly scan genetic markers across the genomes (complete sets of DNA) of many people to find
genetic variations associated with a particular disease. A data bank of SNP genetic markers is currently
being built to record associations between the presence of specific markers and particular diseases or
disorders.
Progress in DNA manipulation techniques and advances in bioinformatics technology (computer
analysis of biological data) has allowed very large numbers of SNP markers to be identified in particular You will learn
about the
regions of chromosomes. Genome-wide association studies are based on the presence of a group of SNP application of
markers (called a haplotype) associated with a trait, rather than trying to link an individual SNP with a haplotype studies
in Chapter 6.
trait. Some applications of identifying haplotypes are:
◗ as indicators of disease
◗ to establish family lineage and determine the genetic relatedness of individuals
◗ to study evolutionary relatedness (Chapter 6).
Frequency of SNPs and genome-wide association studies
On average, the frequency of SNPs is approximately one in every 300 nucleotides in the human genome,
giving a total of approximately 10 million SNPs, most of which occur in the non-coding regions (introns)
of the DNA.
9780170408851 CHAPTER 5 » GENETIC VARIATION 185
05_bio_InFocus12_2e_sb_08851_txt.indd 185 08/08/18 6:57 pm
In genome-wide association studies (GWAS), scientists look for SNPs that occur in higher frequencies
in people with a particular disease, compared with people who do not have the disease. The SNPs that
Making SNPs
occur in a higher frequency are said to be associated with that disease. Advances in technology allow
make sense hundreds or thousands of SNPs to be analysed at the same time, and this is much faster and cheaper
SNP data can than sequencing whole genomes. By studying SNPs in groups of 25–50 people, scientists are able to
be applied, for
example, to choosing detect polymorphisms occurring in 1 to 3 per cent of the population with approximately 95 per cent
prescription drugs.
confidence. (See Chapter 1, Accuracy, precision and errors in measurement.)
Data from studies such as these are entered into data banks that other scientists and researchers
can access. Haplotype analysis to date has shown an association between particular SNPs and
human diseases, such as osteoporosis, asthma, diabetes and Alzheimer’s, to mention only a few. The
HapMap project (short for ‘haplotype mapping’) is an international project that involves scientists
collectively cataloguing markers inherited together on chromosomes, including markers such as
SNPs) and short tandem repeats (STRs), to create databases that can be searched to examine these
common genetic variants in detail. Over the past decade, data such as this has been gathered on an
enormous scale.
Limitations of SNP data
Scientists have found that many biological questions can be answered using smaller regions
of the genome that show polymorphisms. This data is reliable as long as the regions selected
are fairly evenly distributed throughout the genome. Selection of markers is also important –
genetic markers that are closer together give more accurate data. This is because, for a haplotype
study, one must look at SNPs that have been inherited from one parent. If there is crossing over during
meiosis, the SNPs on a chromosome might not all be inherited together. Keeping these and other more
technical limitations in mind, scientists are using SNP data more frequently.
Why use SNPs rather than whole-genome DNA sequencing?
The terms genotyping and sequencing have slightly different meanings. Genotyping involves identifying
genetic variations in individuals, whereas sequencing involves finding the exact nucleotide sequence (in
terms of A,T, G and C) of a certain length of DNA (Fig. 5.30). A whole genome, parts of the genome or a
short piece of DNA can be sequenced.
FIGURE 5.30 DNA
sequencing
SNP SNP SNP
information showing
SNP changes in DNA AACACGCCA TTCGGGGTC AGTCGACCG
DNA sample with AACACGCCA TTCGAGGTC AGTCAACCG
SNPs identified AACATGCCA TTCGGGGTC AGTCAACCG
AACACGCCA TTCGGGGTC AGTCGACCG
CTCAAAGTACGGTTCAGGCA
Haplotypes: adjacent
T T G A T T G C G C A A C AG T A A T A
SNPs that are
C C C G A TC T G T G A T A C T G G T G
inherited together
TCGATTCCGCGGTTCAGACA
Tag SNPs: specific SNPs that are
unique enough to identify the
whole haplotype
186 MODULE FIVE » HEREDITY 9780170408851
05_bio_InFocus12_2e_sb_08851_txt.indd 186 08/08/18 6:57 pm
INVESTIGATION 5.6
A secondary source investigation of how genetic similarities
and differences can be compared
PART A: ANSWERING THE INQUIRY QUESTION AT THE START OF THIS CHAPTER
Answer the inquiry question at the start of this chapter, recording your information in the form of a concept
map.
How can genetic similarities and differences within and between species be compared?
Put this question in the centre of your concept map.
Review the variety of methods studied in this chapter, from investigations using genetic crosses, through
studies of allele frequency data, to using SNPs, to explain how genetic similarities and differences within and
between populations can be compared.
As a starting point, consider which methods are useful for finding genetic similarities and differences:
• between individuals
• within populations
• between species.
Leave space on your concept map, as you might want to add details after you have completed chapters 8
and 9.
PART B: EX TENSION – INVESTIGATING SNPS AND THEIR APPLICATIONS
WS
1 See the worksheet ‘Extension: Understanding SNP data’.
2 Investigate what a SNP is and what SNP data is. Find out how SNP data differs from DNA sequencing data, Extension:
Understanding
what the applications (uses) of SNP data are, and any limitations of this type of data. SNP data
3 Look up PheGenI (Phenotype-Genotype Integrator) or other software programs and find a YouTube clip
less than four minutes long that explains and demonstrates how SNP data software works.
KEY CONCEPTS
● SNPs are loci on chromosomes where alleles differ at a single base. The rarer allele must
have a frequency of at least 1% in a random set of individuals in a population to be termed
a SNP.
● SNPS are valuable as genetic markers for identifying individuals and can be associated with
certain disorders and traits.
● A haplotype is a cluster of marker alleles on the same chromosome and can be used for
association studies in disease and to track the inheritance of different regions of the genome.
CHECK YOUR
1 Explain what a SNP is. UNDERSTANDING
2 Give two advantages of using SNP techniques rather than whole-genome sequencing.
3 Describe three applications of SNP data. 5.4b
4 How can the genetic similarities and differences within and between species be compared?
5 Go back to the concept map you created in Investigation 5.6 and fill in what you have learned.
9780170408851 CHAPTER 5 » GENETIC VARIATION 187
05_bio_InFocus12_2e_sb_08851_txt.indd 187 08/08/18 6:57 pm
5 CHAPTER SUMMARY
How can the genetic similarities and differences within and between species
be compared?
HOW GENETIC VARIATION IS INTRODUCED
Meiosis
Crossing over Independent assortment Halving of chromosome Four gametes, all
number genetically different
Half of the gametes will contain T and half will contain t.
T One
chromosome
t pair
Other
chromosome
pair Four haploid cells
Crossing over
Metaphase I Pairs of Cytokinesis I Cytokinesis II
Early prophase I
Chromosomes align independently – various The genes in each haploid cell are a combination of the
combinations of paternal and maternal genes are possible. parental genes = variation is introduced.
Mutation Fertilisation
Tt Tt
a b
Segregation
Gametes T t T t
Fertilisation
F2 TT Tt Tt tt
3 tall offspring : 1 short offspring
A mutation is a change in the DNA of a cell and may give Two haploid gametes fuse. Chromosomes in the
rise to new alleles (different forms of the same gene) that zygote have a combination of the genes contributed by
produce different phenotypes (variation). the parents.
POPULATION GENETICS
Allele frequency Single nucleotide polymorphisms (SNPs)
Population genetics studies how the ratios of alleles SNPs are genetic markers
in the gene pool of a population change over used to compare genetic
time. It is a way of comparing genetic similarities and similarities and differences C G
SNP
C G
differences within and between species. without sequencing the T A C G
G C G C
whole genome.
Using the formula one can calculate allele frequency:
In genome-wide association studies, computers are used to analyse SNPs
Number of copies of allele (G)in the population across genomes, to compare individuals, establish family lineages, study
Total number of copies of the gene (G + g)in the population evolutionary relatedness and indicate disease susceptibility.
188 MODULE FIVE » HEREDITY 9780170408851
05_bio_InFocus12_2e_sb_08851_txt.indd 188 08/08/18 6:59 pm
INHERITANCE PATTERNS
Autosomal recessive inheritance Sex-linked inheritance
Parental phenotypes: Haemophiliac male 3 Carrier female (hybrid)
Parental genotypes: Xh Y 3 XH Xh
Meiosis
Gametes:
Xh Y 3 XH Xh
Fertilisation
I Punnett square
1 2
Gametes XH Xh
II
1 2
Xh XH Xh Xh Xh
III
Y XH Y Xh Y
1
F1 genotypic ratio: 1 XH Xh : 1 Xh Xh : 1 XH Y : 1 Xh Y
F1 phenotypic ratio: 1 normal female : 1 haemophiliac female (lethal) : 1 normal male : 1 haemophiliac male
Heterozygotes do not express the trait (recessive).
Inheritance is not related to gender (autosomal). The trait Genes carried on sex chromosomes (X and Y) code for traits
may ‘skip’ a generation. Two parents who don’t show the other than gender. The inheritance pattern differs in male and
trait produce offspring with the trait. female offspring.
Incomplete dominant inheritance Co-dominant inheritance
P
Red bull White cow
3
When When purebreds
CRCR CrCr
purebreds mate, mate, both
F1
a blending of alleles are
the trait is Pure-bred CRCR Pure-bred CWCW expressed in the
expressed in Roan calf
offspring.
the offspring.
CRCr CRCr CRCr CRCr
Hybrid CRCW
INTERPRETING INHERITANCE PATTERNS
Punnett squares Pedigree charts
Let T = tall and t = short
Sample pedigree
F1: Hybrid tall Hybrid tall
I
Tt Tt
Segregation 1 2
Gametes T t T t
II
Gametes T t 1 2 3 4 5 6
Arabic numerals
T TT Tt represent individuals
III in pedigree.
1 2 3 4 5
t Tt tt
Method of
TT : Tt : Tt : tt Roman numerals identifying
represent generation this individual
3 tall : 1 short
number. in a pedigree: II-2
Punnett squares are a problem-solving technique
used to calculate the probability of a genetic trait Pedigree charts are used to trace the inheritance of particular
being passed on in a population. It takes into traits through several generations of a family. They use an
account all possible allele combinations that may accepted format of symbols and numbering to compare
arise during fertilisation. genetic similarities and differences.
9780170408851 CHAPTER 5 » GENETIC VARIATION 189
05_bio_InFocus12_2e_sb_08851_txt.indd 189 08/08/18 6:59 pm
5 CHAPTER REVIEW QUESTIONS Qz
Review quiz
1 Copy and complete the table below to compare mitosis 8 Answer the following questions about SNPs.
and meiosis. Note: If any of the processes occurs in one type a What is meant by ‘single nucleotide polymorphism’?
of division and not the other, state ‘does not occur’ under
b Explain how SNPs arise.
the relevant heading and describe the process (and when it
occurs) under the heading of the other type of cell division. c What is the difference between a SNP and a mutation
in a population?
MITOSIS MEIOSIS d Why are SNPs useful in genetic studies?
Cells in which it occurs 9 Explain what a GWAS is, how it is conducted and the
Purpose applications of these studies.
Number of cell divisions 10 The ABO blood groups in humans are determined by
to complete the process three alleles at one locus: IA, IB and Ii.
Replication of a Is it possible for one person to have all three alleles?
chromosomes Explain your answer.
Formation of bivalents b Which alleles are codominant? Explain what this means.
Crossing over c Explain why it is not possible to know the genotype of a
person who belongs to the blood group A or B unless you
Alignment at equator
investigate the genotypes of their parents and/or offspring.
Halving of chromosome d What possible gametes will a person with the blood
number
group AB produce? Explain your answer.
Number of resulting cells
e Use a Punnett square to show the phenotypic and
Genetic content of genotypic ratios that result for the offspring of a couple
resulting cells with blood groups AB and AO.
2 Explain how meiosis introduces genetic variation into a 11 Draw the standard symbols used in a pedigree to represent:
population.
a parents (both unaffected)
3 Use labelled diagrams to represent metaphase and b twins, one unaffected male and one affected female
anaphase of meiosis I and meiosis II.
c the Roman numeral indicating the generation of
4 Draw a diagram to show crossing over of genetic material grandchildren.
between a pair of chromosomes. Label two pairs of genes
12 Look at the following pairs of alleles and identify which
on each chromosome, depicting the alleles as being
genotypes would have a similar phenotype, if the alleles
heterozygous for each gene.
presented by the capital letters are dominant over the
5 Distinguish between the following terms. You may include alleles presented by the small letters.
diagrams and/or examples in your explanation. AA Aa aa Bb BB bb
a chromosome and chromatid
13 A breeder of guinea pigs needs to find out whether one of
b autosomal dominant and recessive alleles
her brown guinea pigs is heterozygous or homozygous for
c recessive sex-linked allele and recessive autosomal alleles hair colour. Albino (white) guinea pigs have the genotype
d codominant alleles and incomplete dominant alleles aa. Guinea pigs that are not albinos have the genotype
e a trait determined by multiple alleles and one AA or Aa. Explain how the breeder might do a test cross
determined by multiple genes to determine the genotype of her brown guinea pig. (See
page 165 for test crosses.)
6 Explain what is meant by the following terms:
14 If you were carrying out breeding experiments with a
a F1 hybrid
group of organisms that are heterozygous for a particular
b pure-breeding homozygote. gene that has one dominant and one recessive allele:
7 A black mouse mates with a white mouse and all the a How many different phenotypes of offspring would
offspring are black. there be? Identify them and give their expected ratios.
a Explain why there are no brown offspring. b How many different genotypes of offspring would there
b If the black offspring are interbred, what are the be? Identify them and give their expected ratios.
expected genotypic and phenotypic ratios for their 15 Explain why it is the male parent in humans who
offspring? Use a Punnett square to illustrate your answer. determines the gender of offspring. Use a Punnett square
to support your explanation.
190 MODULE FIVE » HEREDITY 9780170408851
05_bio_InFocus12_2e_sb_08851_txt.indd 190 08/08/18 6:59 pm
16 A homozygous pea plant with purple flowers is crossed 19 Refer to the pedigree in Figure 5.34 to answer the
with a homozygous pea plant with white flowers. All the questions below.
offspring are purple. a Name the trait being investigated in the pedigree.
a Which colour is dominant? Justify your answer. b What was the phenotypic ratio of offspring born in the
b Use a Punnett square to show the possible second generation to the grandparents I1 and I2?
genotypes that would result from this cross. c Write a test cross that could be carried out to show
c Calculate the ratios of phenotypes and genotypes of whether the trait inherited by the sister with a widow’s
the offspring. peak is dominant or recessive. Explain your reasoning.
17 Explain why each of the following statements is false. 20 Explain how population geneticists measure allele
a Offspring resulting from self-fertilisation are frequency in a population. Include the formula that they
genetically identical. use.
b In a monohybrid cross Bb × Bb, there is a 25% chance 21 What are the advantages of using SNPs rather than
of a child being bb. If the first child is bb, there is less whole-genome DNA sequencing to identify variations in
of a chance that the second child will be bb. individuals?
18 What type of inheritance pattern is shown in Figure 5.33? 22 Discuss the limitations of SNP frequency data.
Justify your answer. Use a Punnett square to show the
23 Select a human genetic disease for which a GWAS has
genetic cross with genotypes of each flower.
been conducted and explain why, despite being able to
White camellia Red camellia
Getty Images/Milton Wordley identify disease susceptibility in particular individuals, the
Shutterstock.com/atiger
challenge to establish causality still remains.
Red and white camellia
Shutterstock.com/LukeLuke
FIGURE 5.33 Genetic cross with camellia flowers
FIGURE 5.34
Source: Adapted from pbworks.com
Pedigree for
1st generation Question 19
(grandparents) Ww ww ww Ww
2nd generation
(parents, aunts
and uncles)
Ww ww ww Ww Ww ww
Dominant Recessive
3rd generation
(two sisters)
Getty Images/Liquidlibrary
Shutterstock.com/benedix
WW ww
or
Ww
Widow’s peak No widow’s peak
9780170408851 CHAPTER 5 » GENETIC VARIATION 191
05_bio_InFocus12_2e_sb_08851_txt.indd 191 08/08/18 6:59 pm
6 Inheritance patterns in a population
Students:
INQUIRY QUESTION • investigate the use of technologies to determine inheritance patterns in a population using, for example:
(ACSBL064), (ACSBL085) ICT
Can population genetic
– DNA sequencing and profiling (ACSBL086) EU
patterns be predicted
• investigate the use of data analysis from a large-scale collaborative project to identify trends, patterns and
with any accuracy?
relationships, for example: (ACSBL064, ACSBL073) AAEA, CCT, IU, N
– the use of population genetics data in conservation management S
– population genetics studies used to determine the inheritance of a disease or disorder CCT, ICT, N
– population genetics relating to human evolution IU
Biology Stage 6 Syllabus © NSW Education Standards Authority for and on behalf of the Crown in right of the State of New South Wales, 2017
Shutterstock.com/science photo
192 9780170408851
06_bio_InFocus12_2e_sb_08851_txt.indd 192 08/08/18 6:53 pm
In 2003, an international group of scientists led by the codiscoverer of the structure of DNA, James Watson,
sequenced the first human genome. The publicly funded Human Genome Project (HGP) sequenced DNA
obtained from a number of individuals, with the resulting genome representing a mosaic rather than the
genome of one person. The final genome was published online, enabling free redistribution and scientific
use of the data.
In an almost parallel commercial venture, a corporation known as Celera Genomics sequenced the
second human genome in 2008.
The results of both projects have given scientists an improved understanding of many aspects of
genetics, including genetic disorders, disease diagnosis and predisposition to disease. This knowledge
provides scientists with the potential to individualise diagnosis and treatment of diseases. However, it
also gives employers and health insurers information that could be used to discriminate against people
on the basis of their future health.
The ramifications of gaining such knowledge are huge. Would you want to know about possible
health issues? How do you think this knowledge could be used in the hands of employers and insurance
companies?
Getty Images/alanphilips
FIGURE 6.1 The Human Genome Project has provided scientists with information about the approximately 3 billion bases
that make up approximately 21 000 genes on chromosomes. It has also provided information about approximately 4000
genetic disorders and the locations of potentially faulty genes.
6.1 DNA technologies
Once the structure of DNA had been unraveled by Watson and Crick, scientists were able to gain more
information about how DNA influences the normal functioning of every living thing. They were able WS
to determine the sequence of genes along DNA using techniques such as DNA sequencing and DNA
Inheritance
profiling. patterns in
a population
In DNA sequencing, the precise order of nucleotides in a sample of DNA is determined. In DNA crossword
profiling, an organism’s unique DNA profile is determined and represented as a distinct series of bands.
Both techniques are described on the following pages.
9780170408851 CHAPTER 6 » INHERITANCE PATTERNS IN A POPULATION 193
06_bio_InFocus12_2e_sb_08851_txt.indd 193 08/08/18 6:53 pm
DNA sequencing
In DNA sequencing, the exact nucleotide sequence (the order of the bases A, T, G and C) of a gene on a
chromosome is determined. There are several methods of sequencing DNA, including manual methods
such as the Sanger chain termination method or the Maxam-Gilbert method, or automatically using a
DNA sequencer.
The Sanger method
British biochemist Fred Sanger and his team in the HGP first used the Sanger method to determine DNA
sequences. The method is also known as dideoxy DNA (ddDNA) sequencing, and when fully automated
allows the sequencing of approximately 1000 bases per second.
The first step in this method is to isolate the DNA from the cells of the organism. This is followed by
the sequencing reactions (Fig. 6.2). The fragments of DNA produced are then sorted by length using a
process called capillary electrophoresis, and the results are analysed by a computer.
Wikipedia/Estevezj - (CC BY-SA 3.0) Creative Commons Attribution-Share Alike 3.0 Unported license.
1 Reaction mixture:
primer and DNA template DNA polymerase
ddNTPs with fluorochromes dNTPs (dATP, dCTP, dGTP and dTTP) ddNTPs: dideoxynucleotide
triphosphates
Primer (chain-terminating nucelotides)
59 39 fluorochromes: fluorescent
dyes (attached to ddNTPs)
39 59 that absorb light of particular
Template ddNTPs wavelengths
ddTTP
ddCTP
ddATP 3 Capillary gel electrophoresis
ddGTP separation of DNA fragments
2 Primer elongation Capillary gel
and chain termination
59 39 Laser Detector
59 39
59 39
59 39
59 39
59 39
4 Laser detection of fluorochromes
59 39 and computation sequence analysis
59 39
59 39
Chromatograph
FIGURE 6.2 Steps in the Sanger method of sequencing DNA
Once the DNA has been isolated and replicated, usually by the polymerase chain reaction (PCR)
method (page 197), the sequencing reactions are begun. These are done in a series of steps.
1 The double-stranded DNA is separated into single strands by heating.
2 A small piece of DNA called a primer binds to the start of the single strand of DNA.
3 DNA polymerase uses this single DNA strand as a template to build the complementary strand of
DNA using free nucleotides.
194 MODULE FIVE » HEREDITY 9780170408851
06_bio_InFocus12_2e_sb_08851_txt.indd 194 08/08/18 6:54 pm
4 Within the reaction mixture are chain-terminating nucleotides known as dideoxy nucleotides. They
are called ‘chain terminating’ because, after they have attached to their complementary base on the
template strand, they prevent any further nucleotides from attaching. There are four types of dideoxy Sanger method
nucleotides, one for each of the bases A, T, C and G: ddATP, ddTTP, ddCTP, ddGTP. Watch the video DNA
Sequencing.
5 Each of the four types of terminator nucleotides is labelled with a different fluorescent dye and will
randomly combine with the complementary base on the strands of template DNA. As soon as they
become part of the chain, no further nucleotides can attach and the chain is terminated. Chain
termination occurs at different positions along the DNA, leading to many different lengths of dye-
labelled DNA. The colour of the fluorescent dye is determined by which nucleotide is at the end of the
Sanger process
chain. All fragments ending with a particular base have the same colour. of DNA
sequencing
6 This process continues until every position on the template strand has been identified with a chain-
View this interactive
terminating nucleotide. animation and
answer the
7 The dye-labelled DNA strands are placed into a tiny capillary tube containing a gel, and an electric questions.
current is used to pull the strands through the gel in the capillary tube. Shorter strands move through
the gel quickly and emerge before the longer strands, which make slower progress through the gel.
8 When the strands emerge, they pass through a laser beam, which causes them to glow at a particular
wavelength detected by a photocell and fed to a computer. The wavelength at which they fluoresce
depends on the particular base nucleotide. The order in which the complementary nucleotides pass Gel electrophoresis
through the laser beam allows the sequence of the bases on the template strand of DNA to be determined.
9 The computer analyses the colours and displays a chromatogram of the sequence of ACGTACGTACTCAGATGCT
bases in the original DNA sample. In the example shown in Figure 6.3, the sequence ACGTACGTACTCAGATGC
ACGTACGTACTCAGATG
of bases on the original DNA strand would be TGAGTCTACGA (complementary to ACGTACGTACTCAGAT
the sequence obtained by reading, in Figure 6.3, the last base on each row, from the ACGTACGTACTCAGA
bottom to the top). ACGTACGTACTCAG
ACGTACGTACTCA
ACGTACGTACTC
The Maxam-Gilbert method ACGTACGTACT
The Maxam-Gilbert method of DNA sequencing involves chemical sequencing of the ACGTACGTAC
ACGTACGTA
DNA strand, and was developed at about the same time as the Sanger method. It is
no longer widely used for DNA sequencing, because of its complex nature and its use FIGURE 6.3 Strands of DNA
of hazardous chemicals. It does still have important applications in the further study of of different lengths, each
beginning with a primer (pink).
DNA, including the structure of nucleotides and modifications made to DNA. Nucleotides (black) are added until
This method involves chemical reactions that are specific to the two groups of bases: a fluorescent chain-terminating
nucleotide (coloured) is added. The
pyrimidines (C and T) and purines (A and G). order of the complementary bases
The first step in the process is to radioactively label one end of the DNA by adding a on the different lengths of dye-
labelled strands of DNA allows the
radioactive phosphorus atom to the phosphate molecule (Fig. 6.4, page 196). sequence of bases on the template
Chemicals and conditions are then modified to suit a specific base, which results in DNA to be determined.
the base being removed from the ribose sugar it is attached to. The DNA strand is cleaved
(cut) at this site. This occurs at each position of that specific base in the DNA strand being
sequenced.
The DNA fragments formed then undergo gel electrophoresis, with the shorter strands moving
further through the gel than the longer strands.
The DNA strand is then exposed to chemicals and conditions that are specific to each of the other
bases and the same procedure is followed. When all patterns from the gel electrophoresis are compared,
the sequence of the bases on the DNA strand can then be determined.
For example, a strand of DNA is radioactively labelled at one end and the chemicals and conditions for
cytosine (C) are applied to the mixture. This causes the removal of the C base from the ribose sugar it was
attached to and the cleavage of the strand where it was removed. The same thing occurs at each of the
positions of the cytosine, creating fragments of different lengths. The next reaction is to add chemicals
and conditions that remove both the C and T bases and then compare the resultant gel electrophoresis
to determine the position of the T bases.
9780170408851 CHAPTER 6 » INHERITANCE PATTERNS IN A POPULATION 195
06_bio_InFocus12_2e_sb_08851_txt.indd 195 08/08/18 6:54 pm
1 Obtain single-stranded DNA
AC TG AC TGAA
32 AC TGAC TGAA 2 Add a 32P to 59 end
G A1 G T1 C C 3 Cleave at specific nucleotides
32ACT
32ACTGACT
32ACTGACTGAA
32ACTG
32ACTGACTG
32ACTGACTGA
32ACTGACTGAA
32AC
32ACTGAC
32ACTGACTGAA
32A
32ACTGA
1 occasional G’s 1 occasional T’s 32ACTGACTGAA 4 Differently sized DNA strands
5 Electrophoresis through
$ high-resolution acrylamide gels
5
(
"
$
5
(
"
"
6 Deduce DNA sequence
FIGURE 6.4 Steps in the Maxam-Gilbert method of sequencing DNA
Science Photo Library/Patrice Latron/
Eurelios/Look At Sciences
FIGURE 6.5 Example of a DNA sequencing device: the portable
MinION (produced by Oxford Nanopore) sequences both DNA
and RNA and plugs into a computer via a USB.
196 MODULE FIVE » HEREDITY 9780170408851
06_bio_InFocus12_2e_sb_08851_txt.indd 196 08/08/18 6:54 pm
Similar reactions are carried out to identify the positions of the G and A bases so that the whole
sequence can be determined.
Next-generation technologies
A range of next-generation sequencing technologies are faster, cheaper, use shorter DNA lengths and can
sequence many fragments at the same time.
One example is nanopore sequencing. This process involves propelling a DNA molecule with the use
of a motor protein through a protein nanopore, a nanometre-sized pore in a membrane that separates
two compartments, both containing a buffered potassium chloride solution (Fig. 6.5). The difference in
current generated by the aqueous solutions from both chambers when passing through the nanopore
depends on the identity of the DNA sequence. This technology allows parallel readings on an individual
device, and can control up to 2048 individual nanopores capable of processing 450 base pairs per second.
The Human Genome Project cost almost $100 million dollars; in 2018 using this technology it would
have cost significantly less.
DNA profiling
DNA profiling, also known as DNA fingerprint analysis, is a scientific technique used to identify and
compare individuals by characteristics in their DNA. The process was developed by Sir Alec Jeffreys, and
has become a useful tool in forensic investigations, paternity testing and other biological applications.
The more closely two individuals are related, the more similar their DNA profiles are. The chance of two
people who are not identical twins having the same DNA profile is less than one in one billion.
While 99.9% of DNA is common to all humans, there are sections in our DNA called STRs that are
unique to each individual. STRs (short tandem repeats) are sections of non-coding DNA that are repeated
many times over (for example, TATATATATA). The number of repeats at any given location in the non-
coding regions of DNA varies between individuals and gives rise
to the different DNA profiles. As each individual has two alleles Mother Child Male 1 Male 2
Source: Adapted from bloodanddna.weebly.com
for each STR (one from each parent), the length of a large number
of STRs can be used as a basis for identification.
The process of DNA profiling involves isolating the DNA to
be profiled. This can come from a variety of nucleated somatic
cells such as saliva, blood or cheek cells. The polymerase chain
reaction (PCR) is used to increase, or amplify, the amount of
DNA of the sequence under study. Gel electrophoresis is used to
separate the segments according to length. Smaller fragments
will have fewer repeats than larger fragments, and so will migrate
further on the gel. In Figure 6.6, the mother’s DNA is on the left.
The child whose paternity is under question is next, and the two
potential fathers are on the right (Male 1 and Male 2). Notice that
the blue banding of the child matches the blue banding of the
mother. The orange banding of the child matches more closely
with the orange banding of Male 1 than Male 2. FIGURE 6.6 Paternity can be established using DNA profiling.
Ethical considerations
Once a person’s DNA has been analysed, questions must be asked, such as: Who owns the information Ethical
obtained? Does it belong to the person who supplied the DNA, the company that performed the profile, understanding
or another party? Who can access that information?
Consider a situation where the person profiled is carrying the DNA for a disease such as Huntington’s
chorea. This disease is a progressive brain disorder that causes uncontrolled movements, emotional
problems and loss of cognition. It develops as a result of a mutated HTT dominant gene inherited from a
9780170408851 CHAPTER 6 » INHERITANCE PATTERNS IN A POPULATION 197
06_bio_InFocus12_2e_sb_08851_txt.indd 197 08/08/18 6:54 pm
parent. The symptoms of this disease do not become apparent until an individual is aged in their thirties
or forties. Individuals might not wish to know that they will develop this condition within the next twenty
years or so, and children of a known sufferer are faced with the dilemma of whether to be tested. This is
Can your genes
be patented in in addition to all the other issues faced by people with any inherited condition.
Australia?
Life insurance companies could access DNA profiling results to determine the risk of insuring a person.
If that person is shown to have a higher than normal risk for heart disease or cancer, or will develop a disease
such as Huntington’s chorea, is it right to charge that person a higher premium? Under existing Australian
law, life insurance applicants must disclose the results of any genetic testing if asked to by the insurer. The
Can your genes
be patented in insurer is then allowed to use these results to discriminate against applicants for life, permanent disability
the US? and income protection insurance. This can deter people from undergoing genetic testing or becoming
involved in medical research where genetic testing may be involved. Many other countries have protected
consumers by restricting or banning the use of genetic testing for insurance purposes.
In order to recoup the immense cost of medical research, some companies have applied to patent
gene mutations such as those responsible for BRCA1 and BRCA2. A patent would prohibit all future
research and development by another company, and would in effect stifle research. In 2013, a US court
ruled that genes cannot be patented; the ruling overturned thousands of US patents on genes.
INVESTIGATION 6.1
A secondary-source investigation using DNA technology
to study guira cuckoo families
Cuckoos are medium-sized birds, and there are many different types. The guira cuckoo lays its eggs in
communal nests, which have been built by all members of the group, who also share the incubation of the
eggs. Female guira cuckoos incubate and raise chicks from eggs that they did not lay.
Shutterstock.com/Ondrej Prosicky
FIGURE 6.7 The guira cuckoo
One way to determine whether a female guira cuckoo is the biological mother of the chicks she raises is to
create a DNA profile of mother and chicks.
AIM
To determine, using DNA profiling, whether guira cuckoo mothers raise their own chicks
198 MODULE FIVE » HEREDITY 9780170408851
06_bio_InFocus12_2e_sb_08851_txt.indd 198 08/08/18 6:54 pm
MATERIAL
Ruler
METHOD
1 Consider the DNA profile in Figure 6.8. DNA was obtained by capturing cuckoos, collecting a small blood
sample from each, and extracting the DNA. Five STRs have been identified in cuckoos: Cam1, Cam2, Cam3,
Cam4 and Cam5. Using PCR, these five regions were amplified in all adults and chicks of eight families. The
PCR products were then separated using gel electrophoresis.
Figure 6.8 shows the resulting gel. Each individual has two alleles for each STR. Each line (band) represents
one of the alleles for the STR. Sometimes only one thicker band is observed, if the individual has two
identical alleles.
Family 1 Family 2 Family 3 Family 4
C1 C2 C1 C2 C3 C4 C5 C1 C2 C3 C4 C5 C6 C1 C2
Cam 1
Cam 2
Cam 3
Cam 4
Cam 5
Family 5 Family 6 Family 7 Family 8
C1 C2 C3 C1 C2 C3 C1 C2 C3 C4 C5 C6 C7 C1 C2
Cam 1
Cam 2
Cam 3
Cam 4
Cam 5
FIGURE 6.8 DNA profiling for the eight cuckoo families that include a social mother ( ), social father ( ) and chicks (C)
2 Compare the profile of the mother of each family and the profile of each chick to determine whether the
female could have been the biological mother of the chick or is the social mother. The social mother of
the chick is the mother that raises and feeds the chick and does not share genetic similarities.
3 Each chick will have one allele for each STR from its biological mother and one from its biological father.
To compare the profile of the mother of each family with the profile of each chick, look at the first STR
(Cam1) for Family 1. It can be seen that one of the bands for Chick 1 (C1) matches at least one of the
bands in the mother. This means that C1 has the same allele for the STR, Cam1, as the mother. The same
can be seen for C2.
9780170408851 CHAPTER 6 » INHERITANCE PATTERNS IN A POPULATION 199
06_bio_InFocus12_2e_sb_08851_txt.indd 199 08/08/18 6:54 pm
Continuing for Family 1, when the bands for C1 and C2 are compared with the mother in all of the
other STRs (Cam 2 – Cam 5), it can be seen that both chicks have at least one of their alleles in common with
the mother. Therefore, the mother is very likely to be the biological mother of both Chick 1 and Chick 2.
4 Copy Table 6.1 and record in the second column which chicks in each family are the biological chicks.
5 Calculate the proportion of non-family chicks in each family and include these in the third column.
6 Determine whether there is any difference in the proportion of non-family chicks between small and
large families.
RESULTS
TABLE 6.1
FAMILY BIOLOGICAL CHICKS NON-FAMILY CHICKS
1
2
3
4
5
6
7
8
ANALYSIS OF RESULTS
1 Analyse your results to identify (using family numbers and chick numbers) any ‘non-family’ chicks that have
been raised by a social mother cuckoo. Justify your answer, referring to your data.
2 Calculate the maximum proportion of non-family chicks in total over the eight families.
DISCUSSION
1 Explain whether the results show a relationship between family size (large or small cuckoo families) and the
likelihood of raising non-family chicks. Use data to justify your answer.
2 How could this practice of social parenting among cuckoos ensure the survival of the species?
3 Discuss the benefits of using DNA profiling in studying populations.
CONCLUSION
Write a conclusion related to the aim of this investigation, to outline your findings.
KEY CONCEPTS
● DNA sequencing determines the exact nucleotide sequence (the order of the bases A, T, G and C)
of a gene on a chromosome. DNA sequencing may be conducted using the Sanger method, the
Maxam-Gilbert method or next-generation technologies.
● DNA profiling (DNA fingerprint analysis) is a scientific technique used to identify individuals by
characteristics such as STRs (short tandem repeats) in their DNA.
● STRs are sections of non-coding DNA that are in the same position on chromosomes for each
individual and are repeated many times.
● STRs are unique to each individual because they repeat by different amounts.
● 99.9% of DNA is common to all humans.
● The PCR (polymerase chain reaction) is used to increase the amount of DNA of the sequence.
● Gel electrophoresis is a technique used to separate strands of DNA based on their molecular
weight and therefore size. Shorter (lower molecular weight) molecules travel further through
the gel than longer (higher molecular weight) molecules.
● Numerous ethical considerations need to be taken into account when using these DNA
technologies.
200 MODULE FIVE » HEREDITY 9780170408851
06_bio_InFocus12_2e_sb_08851_txt.indd 200 08/08/18 6:54 pm
CHECK YOUR
1 a Define ‘DNA sequencing’. UNDERSTANDING
b List three methods of sequencing DNA.
2 Explain how gel electrophoresis separates strands of DNA.
6.1
3 Describe how DNA profiling can be used Crime scene
to identify individuals on the basis of their sample Victim Suspect 1 Suspect 2
Shutterstock.com/Alila Medical Media
DNA.
4 Give the full name of each of the following
abbreviations and explain what each term
means.
a STR
b PCR
5 A blood-stained sample found at the scene
of a jewellery shop break-in was analysed
using gel electrophoresis. The police
arrested two suspects and also analysed
their blood using the same technique. The
results are shown in Figure 6.9.
a The jewellery shop owner also had
their blood tested (labelled ‘Victim’).
Explain why this was necessary.
b According to the results, which suspect
committed the burglary? Explain your
choice.
FIGURE 6.9 Analysis of blood from crime scene using gel electrophoresis
6 Outline three ethical issues associated with
use of DNA technologies.
Using large-scale data to study
6.2 population genetics
With the automation of DNA technologies, scientists have been able to produce large amounts of data
that can be saved and analysed by software programs (bioinformatics). This has created many new
opportunities for collaboration.
The use of large-scale data sets that are analysed computationally has enabled the scientific
community to embark on exciting new research that will have a significant impact on how science is
conducted in the future.
Population genetics
Population genetics is the study of genetic variation within a population (Chapter 5), including changes
in the frequency of genes and alleles within a population and among populations over time. The alleles
of all the genes in a particular population are known as the gene pool of the population. Population
geneticists study variations in these alleles within the gene pool and how these variations change from
one generation to the next. Factors that affect this variation within the gene pool are the size of the
population, mutation, natural selection, genetic drift, the diversity of the environment and migration
patterns. Genetic differences between species can be used to determine the evolutionary history of
populations – those with the most similar gene pools are most closely related.
9780170408851 CHAPTER 6 » INHERITANCE PATTERNS IN A POPULATION 201
06_bio_InFocus12_2e_sb_08851_txt.indd 201 08/08/18 6:54 pm
Refer to Chapter 5 to
The processes of DNA sequencing and DNA profiling (discussed earlier) and an understanding of
find out more about heredity allow us to study the frequency of alleles in a population over several generations.
Mendel’s findings.
Population genetics depends on the findings of two of the great names in biology. Gregor Mendel
showed that each parent provides one copy of each allele to the offspring. The expression of these alleles
Review your depends on their pattern of inheritance.
understanding of Charles Darwin proposed natural selection as the driving force for evolution. Taking Mendel’s and
evolution by natural
selection from Biology Darwin’s work together, we can see that some alleles are selected for as they confer greater survival
in Focus Year 11 advantage than others. These advantageous alleles are passed on to the next generation and so increase
Chapter 9.
in number.
Population genetics and conservation management
Conservation genetics is a subfield of population genetics. It incorporates an understanding of how genes
are inherited in a population. The principal aim is to avoid extinction of species by applying conservation
methods that ensure the maintenance of biodiversity. It combines the principals of applied ecology with
an understanding of evolutionary biology.
Traditional methods used by conservation biologists to gather information about endangered species
include field observation, sampling and statistical analysis, focusing on the distribution and abundance of
specific organisms. (See Biology in Focus Year 11, Chapter 7.)
Conservation genetics relies on gathering genetic data, for biodiversity conservation and to make
informed decisions about protecting populations that are endangered or nearing extinction. It is a
useful tool for scientists to use when determining current and future strategies for the conservation of
Refer to Chapter 5,
populations. The numerous types of DNA analysis, including next-generation analysis methods, use many
page 185 types of genetic tools including SNPs, GWAS and haplotypes, and have been instrumental in determining
for information
about SNPs,
not only kinship lineages but also in improving our understanding of microevolution, including selection
haplotypes and and mutation. These methods also enable scientists to identify segments of the genome that are essential
GWAS.
for the organism’s adaptation to the environment. They can determine relationships and identify
individuals that could be reintroduced into a population for recovery. Any deleterious alleles for brain
function, immunity, metabolism and other necessary functions can be detected, as can any mutations
that may enhance these functions. These types of information are essential in identifying conservation
strategies to increase the chance of saving endangered species and maintaining biodiversity.
Woolly mammoth extinction
Getty Images/SVF2/Universal Images Group
One aim of studying population genetics and conservation
genetics is to use the past to make accurate predictions about
possible future extinction events. Conservation geneticists
are hoping that by studying past events they can use the
data to develop models that can assist in the conservation of
endangered species.
It is possible to study the effects of inbreeding in extinct
species. In 2015, scientists conducted a complete DNA
sequence to compare two historical samples of the woolly
mammoth (Fig. 6.10), to determine whether there was
a reduction in genetic diversity due to inbreeding in the
FIGURE 6.10 A complete baby mammoth preserved. Researchers have
been able to sequence the genome of two mammoths. population that had been isolated (on Wrangel island). One
sample was from a 45 000-year-old specimen that had lived
on the Siberian mainland and the other was from a 4300-year-old mammoth bone found on Wrangel
Island, in the Arctic Ocean (Fig. 6.11).
202 MODULE FIVE » HEREDITY 9780170408851
06_bio_InFocus12_2e_sb_08851_txt.indd 202 08/08/18 6:55 pm
FIGURE 6.11
Alamy Stock Photo/Rainer Lesniewski
Wrangel Island,
location of the
mammoths that
outlived Siberian
mammoths by
1500 years. Siberian
mammoths died off
due to climate change
and human hunters.
Genetic sequencing indicated that the island mammoths had a series of major detrimental
mutations, including those that affected olfactory processes and some that reduced the number and
variety of the mammoths’ urinary proteins. These would have greatly reduced their ability to mark and
recognise territory, hunt and mate. Another two mutations were found in the gene known as FOXQ1,
which affects the mammoths’ hair structure. Mutations to this gene would have given the Wrangel
Island mammoths a translucent, cream-coloured, satiny coat, which would have reduced its insulating
properties, an important feature in ice age climates, where insulation is of paramount importance for
survival. It appears that isolation on Wrangel Island and the resultant inbreeding and loss of genetic
diversity made these mammoths more susceptible to disease and reduced their ability to survive in their
environment. They were said to have suffered a ‘genomic meltdown’. Their numbers fell from tens of
thousands to around 1000.
The information gained in the mammoth study, about the effects of isolation leading to a
reduction in genetic diversity and ultimately extinction, is an example of how population genetics Extinction of
Tasmanian tigers
and conservation genetics can be useful tools in trying to conserve modern-day populations that are
dwindling in numbers.
Using population genetics to study modern koala populations
The koala (Phascolarctos cinereus) is a tree-dwelling, medium-sized marsupial with a sturdy body,
large rounded ears, grey-coloured fur and sharp claws. Koalas are found throughout eastern
Australia, from north Queensland to South Australia. Males are larger than females and a gradient
exists for size, where southern koalas are bigger and heavier than those living in Queensland. Their
general numbers in the north are declining due to habitat destruction and fragmentation, while the
southern numbers are healthy. During the last ice age (about 20 000 years ago), two biogeographic
barriers, the Brisbane River Valley and the Clarence River Valley, separated the koala populations.
9780170408851 CHAPTER 6 » INHERITANCE PATTERNS IN A POPULATION 203
06_bio_InFocus12_2e_sb_08851_txt.indd 203 08/08/18 6:55 pm
This impediment to movement disappeared at the end of the ice age, although habitat fragmentation
has now restricted the gene flow between populations to some extent.
Koalas are one species, even though historically there has been discussion about a subspecies due to
phenotypic differences between geographically distant groups. The results of a very recent large study
confirmed that they are one species.
Threats to the koala population include the fur trade in the past (late 19th and early 20th centuries),
as well as current habitat clearance. Deaths due to predation, vehicles, diseases such as chlamydia (which
affects fertility), bushfires and drought have also reduced their overall numbers.
Often the control of koala numbers is left to the government of the local area, but the results of a
recent major study indicate that the overall distribution, both past and present, needs to be taken into
account in the management of koala numbers.
The historical and current distribution of koalas is shown in Figure 6.12.
A number of studies have been conducted to investigate the population genetics of koalas
(Fig. 6.13), but most of these have been focused at a local level. The recent study referred to above
has gathered the largest amount of genetic data ever collected and covers all koala habitats. It also
includes information from a range of time periods (1870s to 2015). This study has generated large-scale
data sets, which can be analysed. (See Investigation 6.2.)
© Australian Museum
Key
Current distribution
Historical distribution
Introduced populations
St Lawrence Gap
Brisbane Valley
Clarence River
Hunter Valley
FIGURE 6.12 The current and past distribution of koalas, with four perceived
biogeographical barriers labelled. These barriers are thought to have separated koala
populations.
204 MODULE FIVE » HEREDITY 9780170408851
06_bio_InFocus12_2e_sb_08851_txt.indd 204 08/08/18 6:55 pm
Tissue samples were obtained from 662 wild koalas in collaboration with researchers, consultants, Port
Macquarie Koala Hospital and Australia Zoo Wildlife Hospital, and from the Australian Museum Tissue
Collection. These samples for DNA analysis were collected from ear punches, to investigate genetic
variation in koala populations.
Newspix/Patrick Hamilton
FIGURE 6.13
Testing koalas in
order to determine
genetic variation in
populations
INVESTIGATION 6.2
Secondary source investigation of population genetics data WS
and conservation of koala (Phascolarctos cinereus) Mitochondrial
DNA - an
BACKGROUND introduction
Tissue samples were obtained from 662 wild koalas in collaboration with researchers, consultants, Port
Sustainability
Macquarie Koala Hospital and Australia Zoo Wildlife Hospital, and from the Australian Museum Tissue
Collection. The mitochondrial DNA control region (mtDNA CR ) of each tissue sample was analysed by next-
Critical and
generation methods (page 197) to determine the base sequence in this non-coding section of mtDNA. creative thinking
This was used to identify the different haplotypes in the koala tissues being tested. Existing published koala
haplotypes that were available in the GenBank databank were also accessed. A haplotype is a group of SNP
Numeracy
markers, also described as a group of genes that are inherited together on a particular chromosome from the
one parent. In the koala study, the genes are inherited down the mother’s lineage as mtDNA. Two or more
organisms that have the same haplotype will have the same genetic information in that particular position of
Haplotypes are
the chromosome being tested (in this case the CR of the mtDNA), indicating that they are closely related to groups of genes
each other. The haplotypes can be used to compare individuals of different populations in order to determine inherited together
which populations are most closely related each other, and as a result to determine their recent evolutionary on a chromosome
from the same
history. parent.
A haplotype network is a two-dimensional summary of genetic diversity within a group and may be
A haplotype
interpreted together with a map of evolutionary and geographical history. network is
Sometimes these networks look very complicated, so when interpreting a haplotype network you need to a summary
remember that: diagram showing
genetic diversity
• Each circle represents a unique haplotype. within a group of
organisms.
• The size of the circle is proportional to the number of individuals sampled that belong to that haplotype.
9780170408851 CHAPTER 6 » INHERITANCE PATTERNS IN A POPULATION 205
06_bio_InFocus12_2e_sb_08851_txt.indd 205 08/08/18 6:55 pm
• The lines connect each haplotype to its most similar relative.
• The number of bars on the lines represents the mutational 4 2
steps between the haplotypes. The more bars, the greater the
difference in the sequence of bases between the haplotypes.
A simplified haplotype network is shown in Figure 6.14.
This diagram shows three haplotypes in the species being 8
tested, ranging in size from the largest, with 8 individuals sharing a
haplotype, to the smallest, with 2 individuals sharing a haplotype.
The circle with 8 and the circle with 4 are the most closely related.
The bars on the line between 2 and 4 indicate that there are two FIGURE 6.14 A simple haplotype
mutational steps between groups 2 and 4 and, therefore, genetic network diagram
divergence.
AIMS
• To investigate the degree of diversity in koala populations
• To interpret genetic data and diagrams and infer trends and patterns
HYPOTHESIS
Propose a hypothesis regarding the genetic diversity of koala populations.
DATA
When the mtDNA CR was analysed, 53 unique haplotypes were found across the four regions indicated on the
map in Figure 6.15. In Figure 6.16, the four lineages are indicated by the coloured circles:
• orange circles = northern group 1 lineage
• pink circles = northern group 2 lineage
• purple circles = central lineage
• blue circles = southern lineage.
Source: adapted from Neaves LE, Frankham GJ, Dennison S et al.,
‘Phylogeography of the koala, (Phascolarctos cinereus, and harmonising data to
inform conservation’. PLoS One. 2016; 11(9): e0162207, Fig. 3
Brisbane Valley
St.Lawrence Gap
Brisbane Valley
Clarence River
Clarence River
Hunter Valley
N
0 km 200 km
Note: Triangles indicate sites sampled only in previous studies.
0 km N 1000 km
FIGURE 6.15 Geographical distribution of the koala, showing the locations of the sampling of mtDNA CR and the four lineages
206 MODULE FIVE » HEREDITY 9780170408851
06_bio_InFocus12_2e_sb_08851_txt.indd 206 08/08/18 6:55 pm
In the haplotype network shown in Figure 6.16, each haplotype is identified by the letters Pc and a number.
The size of each circle is proportional to the number of individuals in the group.
Source: adapted from Neaves LE, Frankham GJ, Dennison S et al.,
‘Phylogeography of the koala, (Phascolarctos cinereus, and harmonising data to
inform conservation’. PLoS One. 2016; 11(9): e016220,. Fig. 4
Pc33*
Pc42 Pc15
Pc32*
Pc36*
Pc40*
Pc53* Pc12*
Pc7
Pc37* Pc31
Pc14
Pc29*
Pc49
Pc47 Pc41*
Pc13
Pc39*
Pc38* Pc34* Pc22 Pc26*
Pc20
Pc30*
Pc45 Pc21
Pc52 Pc25
Pc51 Pc44
Pc46 Pc27
Pc28 Pc17
Pc4
Pc18*
Pc43 Pc48
Pc50 Pc35*
Pc19 Pc3
Pc1
Pc11
Pc16
Pc5
Pc8 Pc10
Pc2
Pc9
Pc24*
10 samples
Pc23* 1 sample
Pc6
FIGURE 6.16 Haplotype network diagram for koala mitochondrial DNA CR. * means that an individual koala makes up the
haplotype (and was recorded from GenBank and not detected in this study).
The data in Table 6.4 reflects diversity in mitochondrial DNA of koalas that were sampled across a range of
koala habitats, numbered as locations 1–20 in both Table 6.4 and on the map in Figure 6.17. The table shows
the location, sample size, number of unique haplotypes at each location and the haplotype diversity at each
Koala
location. The higher the value, the greater the haplotype diversity. phylogeography
TABLE 6.4 Mitochondrial DNA CR diversity
HAPLOTYPE DIVERSITY
LOCATION KEY LOCATION SAMPLE SIZE HAPLOTYPES (n) BASED ON mtDNA
1 Whitsunday Qld 8 4 0.75
2 Blair Athol Qld 10 2 0.20
3 Clermont Qld 38 5 0.37
4 Maryborough Qld 11 1 –
5 Redlands Qld 7 2 0.46
6 Coomera Qld 21 1 –
7 Tyagarah NSW 17 1 –
8 Ballina NSW 37 2 0.074
9 Iluka NSW 7 1 –
9780170408851 CHAPTER 6 » INHERITANCE PATTERNS IN A POPULATION 207
06_bio_InFocus12_2e_sb_08851_txt.indd 207 08/08/18 6:55 pm
HAPLOTYPE DIVERSITY
LOCATION KEY LOCATION SAMPLE SIZE HAPLOTYPES (n) BASED ON mtDNA
10 Pine Creek NSW 50 1 –
11 Port Macquarie NSW 142 3 0.45
12 Maitland NSW 7 1 –
13 Campbelltown NSW 24 4 0.663
14 East Gippsland Vic 19 3 0.119
15 French Island Vic 33 1 –
16 Cape Otway Vic 19 1 –
17 Bessiebelle Vic 14 2 –
18 Mt Lofty Ranges SA 33 6 0.662
19 Eyre Peninsula SA 19 1 0.61
20 Kangaroo Island SA 26 3 0.227
Overall 662 36 0.84
(Source: adapted from Neaves LE, Frankham GJ, Dennison S et al., ‘Phylogeography of the koala, (Phascolarctos cinereus), and harmonising data to inform conservation’,
PLoS One 2016; 11(9): e0162207, Table 1)
Table 6.5 compares the sequences of DNA in the mtDNA CR of koalas distributed across localities 1–20.
Numbers 1–20 in Table 6.4, Figure 6.17 and Table 6.5 all denote the same localities. In Table 6.5, koalas from
different localities are compared on a pairwise basis. That is, koalas from two regions in different localities are
compared to demonstrate genetic diversity. The measurement range is 0–1, where zero indicates that there is
no significant diffference, while 1 suggests that koalas are the most different in terms of that haplotype..
Geographically close areas – for example, Coomera (location 6 across the top horizontal row) and Ballina
(location 8 down the vertical row) – have a score of 0 (shaded yellow in Table 6.5) indicating no significant
genetic difference. Areas with a score of 1 – for example, Pine Creek (site 10) and Iluka (Site 9) – are genetically
divergent.
FIGURE 6.17
(Phascolarctos cinereus, and harmonising data to inform conservation’. PLoS One 2016; 11(9):
Source: adapted from Neaves LE, Frankham GJ, Dennison S et al., ‘Phylogeography of the koala,
e0162207, Fig. 1
Map showing
sampling sites 1–20 as
detailed in Table 6.4
NT 1
Qld 2
3
St Lawrence Gap
4
WA 5 Brisbane Valley
6
7
SA 8 Clarence River
9
10
11
NSW Hunter Valley
12
20 13
18
19
Vic
17 14
16 15
Tas
0 km N 1000 km
208 MODULE FIVE » HEREDITY 9780170408851
06_bio_InFocus12_2e_sb_08851_txt.indd 208 08/08/18 6:55 pm
TABLE 6.5 Pairwise comparison of the sequence of mtDNA CR between different localities. Numbers range from 0 (no
significant difference) to 1 (most different).
LOCATION 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
1
2 .09
3 .21 0
4 .57 .78 .75
5 .72 .84 .87 .94
6 .87 .94 .91 1.0 .66
7 .84 .93 .90 1.0 .62 0
8 .81 .89 .88 .93 .39 0 0
9 .75 .88 .88 1.0 .44 0 0 0
10 .92 .96 .94 1.0 .98 1.0 1.0 .97 1.0
11 .89 .92 .91 .92 .93 .94 .94 .93 .93 .20
12 .74 .88 .88 1.0 .94 1.0 1.0 .93 1.0 1.0 .63
13 .80 .88 .88 .92 .91 .95 .95 .92 .93 .75 .58 .55
14 .89 .94 .92 .98 .97 .99 .99 .96 .99 .92 .60 .87 .19
15 .86 .94 .91 1.0 .97 1.0 1.0 .96 1.0 1.0 1.0 .59 1.0 0
16 .85 .93 .91 1.0 .97 1.0 1.0 .96 1.0 0 .16 1.0 .65 .09 1.0
17 .90 .95 .93 .99 .98 1.0 1.0 .96 1.0 .97 .61 .95 .25 0 0 .96
18 .78 .85 .86 .89 .88 .92 .90 .90 .65 .58 .46 0 .19 .18 .55 .50 .22
19 .86 .94 .91 1.0 .97 1.0 1.0 .96 1.0 1.0 .59 1.0 .20 0 0 .10 0 .18
20 .83 .90 .89 .94 .93 .96 .96 .93 .95 .76 .56 .57 .09 .01 .02 .67 .04 .09 .02
(Source: adapted from Neaves LE, Frankham GJ, Dennison S et al., ‘Phylogeography of the koala, (Phascolarctos cinereus),
and harmonising data to inform conservation’, PLoS One 2016; 11(9): e0162207, Table 2)
METHOD
State a hypothesis regarding genetic diversity in koala populations across a range of localities.
Use the data sets provided to answer the questions below.
QUESTIONS
1 a Which section of the koala mtDNA was being tested?
b Was the same section of mtDNA tested in all koalas?
2 Is this region coding or non-coding?
3 Research and briefly describe the purpose of this region of mtDNA.
4 Refer to Figure 6.16.
a Determine which lineage has the greatest number of haplotypes.
b Of the haplotypes Pc2, Pc7 and Pc46, which haplotype:
i has the highest number of individuals with that haplotype
ii is part of the central lineage
iii has the lowest number of individuals with that haplotype?
c Determine the total number of mutational steps between:
i Pc19 and Pc27
ii Pc47 and Pc51.
d Which of these pairs is more closely related: Pc19 and Pc27, or Pc47 and Pc51?
9780170408851 CHAPTER 6 » INHERITANCE PATTERNS IN A POPULATION 209
06_bio_InFocus12_2e_sb_08851_txt.indd 209 08/08/18 6:55 pm
3 Is there is only one mutational step between:
a Pc3 and Pc10
b Pc3 and Pc11?
4 Why are Pc10 and Pc11 different haplotypes?
5 Is there greater genetic variation within or between lineages?
6 Refer to Figure 6.17.
a How many lineages are predominant in the majority of NSW, Victoria and SA (Region 1)?
b How many lineages are present in the area between far north of NSW up to just above the midpoint of
the Queensland coast (Region 2)?
c Where is most of the central lineage located?
d In which of the two regions (1 or 2) referred to in questions a and b would you consider there to be the
most genetic diversity? Provide reasons for your answer.
7 Refer to Table 6.4.
a Which location had the greatest number of haplotypes?
b Which location has the greatest haplotype diversity?
c What is the value of the haplotypic diversity for location 20, Kangaroo Island?
d Identify the lineages for each of the locations you identified in questions a, b and c.
8 Refer to Table 6.5 and Figure 6.17. In each of the following pairs of locations, determine whether the koalas
are closely related or genetically divergent. Also state whether or not the locations are close to each other.
a Region 1: far north NSW – Queensland
i 1 and 5
ii 1 and 3
iii 7 and 4
iv 10 and 6
b Region 2: the rest of NSW, Victoria and South Australia
i 13 and 12
ii 14 and 13
iii 17 and 13
iv 20 and 14
8 In which region, 1 or 2, is the greatest genetic diversity shown within the koala populations? Use the data
you have studied to justify your choice.
9 The koala population in locations 19 (Eyre Peninsula) and 20 (Kangaroo Island) were formed by
introducing koalas from other locations.
Use the data in Table 6.5 to predict the likely source(s) of koalas for each of these locations. Justify your
answer.
10 Does the data provided support your hypothesis? Explain your answer.
DISCUSSION
1 The greater the genetic diversity in a population, the greater the chance of survival of that population.
Which of the lineages in this study shows the least genetic diversity and how would you increase this
diversity? Use data that you have studied to support your answer.
2 The data that has been studied here is from one study. How would you improve the validity of the
inferences made from this data?
CONCLUSION
Summarise your findings regarding koala genetic diversity in eastern Australia.
210 MODULE FIVE » HEREDITY 9780170408851
06_bio_InFocus12_2e_sb_08851_txt.indd 210 08/08/18 6:55 pm
KEY CONCEPTS
● Population genetics is the study of genetic variation within a population, and the changes in the
frequency of genes and alleles within a population and among populations over time.
● Mendel’s and Darwin’s work forms the basis of population genetics, in showing that some
alleles are selected as they confer greater survival advantage than others.
● Conservation genetics looks at how genes are inherited in a population, in order to avoid
extinction of species by applying conservation methods that ensure the maintenance of
biodiversity.
● Genetic analysis using large-scale data including GWAS, SNPs and haplotypes provides detailed
information about genetic diversity in a population.
● Haplotype networks map the different haplotypes in populations.
● The extinction of the woolly mammoth on Wrangel Island can in part be attributed to a severe
decrease in genetic diversity due to small population numbers.
● The control region of mitochondrial DNA in koalas was analysed to determine the different
lineages and genetic diversity in koalas in eastern Australia.
● The southern lineage of koalas demonstrates the lowest genetic diversity compared with the
lineages from north-eastern NSW and Queensland, which demonstrate high levels of genetic
diversity.
CHECK YOUR
1 Define ‘population genetics’ and ‘conservation genetics’. UNDERSTANDING
2 How do the findings of Mendel and Darwin influence the study of population genetics?
3 How can DNA analysis be used in population genetics and conservation management? Provide
6.2
an example.
4 Distinguish between SNPs and haplotypes.
5 State the aim of conservation genetics.
Using large-scale data to study
6.3 population genetics and disease
Alkaptonuria (black urine disease) is a disease in which the body cannot process the amino acids
phenylalanine and tyrosine, which occur in protein. This disease causes many problems but the first WS
symptom is urine with an unusually dark colour, which turns black if left exposed to air.
In the early part of the 20th century, Archibald Garrod demonstrated that this disease is an inherited Identification of
the remains of
recessive disease. He made this deduction by surveying the families of his patients and developing a King Richard III
using mtDNA
pedigree of each family history. analysis
With the expansion of technologies such as DNA sequencing, it was subsequently found that
alkaptonuria is caused by a mutation in the HGD gene for the enzyme homogentisate 1,2-dioxygenase,
located on chromosome 3. Alkaptonuria is an example of a disease that results from a mutation in a
single gene in all cells of the body, and is known as a monogenic disease.
Scientists currently estimate that there are more than 10 000 monogenic human diseases. Although
relatively rare, they affect millions of people worldwide. The global prevalence of all monogenic diseases
at birth is approximately 10 in every 1000 births.
With the advent of genetic testing, the diagnosis of these diseases and the probability of any future
offspring inheriting these conditions can be determined quickly and accurately.
In humans, the most common genetic differences (polymorphisms) in the genome are single base
pair differences called single nucleotide polymorphisms (SNPs), pronounced ‘snips’. Genetic testing
for the presence of the SNPs that are unique to a particular disease can be carried out quickly and
relatively easily.
9780170408851 CHAPTER 6 » INHERITANCE PATTERNS IN A POPULATION 211
06_bio_InFocus12_2e_sb_08851_txt.indd 211 08/08/18 6:55 pm
In New South Wales, the newborn
Alamy Stock Photo/David Gee 4
screening program provides free
genetic tests for all newborns for the
SNPs associated with phenylketonuria,
congenital hypothyroidism, cystic fibrosis,
galactosaemia, fatty acid oxidation, urea
cycle disorders and many more congenital
(present at birth) diseases. Most of these
conditions are genetic.
The data collected provides the
potential for large-scale genomic
FIGURE 6.18 A newborn screening test called the heel prick test analysis of newborns. Such screenings
provides genetic testing for 25 congenital conditions. have a significant impact on individuals,
through early detection and improved
treatment options. They also assist in generating data about the occurrence of specific genetic conditions
in the population.
There have been many efforts to create a gene–disease specific mutation database with the increasing
amounts of data provided by next-generation gene sequencing technologies. The Human Gene Mutation
Database (HGMD) stores comprehensive information about germline mutations associated with human
inherited diseases. HGMD does not store information about somatic and mitochondrial mutations,
as this is stored in COSMIC (Catalogue of Somatic Mutations in Cancer) and MITOMAP (human
mitochondrial genome) databases, respectively.
INVESTIGATION 6.3
Secondary-source investigation to determine the inheritance
patterns of breast and ovarian cancer genes in a population
BACKGROUND INFORMATION
Ethical
understanding Breast screens involving a mammogram are used to identify abnormalities in breast tissue. One particular type
of breast cancer is a ‘basal-like’ cancer that is particularly aggressive, more difficult to control and harder to treat
Information and
communication than most forms of this disease.
technology Mutations of the BRCA1 and BRCA2 genes put women at a much higher risk of developing this form
capability
of breast cancer. The BRCA1 and BRCA2 mutations are inherited and are carried by one woman in 600. The
presence of these mutated genes increases the risk of developing this cancer by 85%.
Numeracy BRCA1 and BRCA 2 are tumour suppressor genes found on chromosome 17 and chromosome 13
respectively (Fig. 6.19). They are believed to be responsible for coding for proteins that repair genes involved
Critical and in regulating the process of cell division. Mutations of the BRCA1 and BRCA2 genes mean that the genes that
creative control cell division are not repaired, which ultimately results in the uncontrolled cell division associated with
thinking
cancer.
In an American longitudinal study involving 46 276 women, the genes were sequenced to identify the
prevalence of BRCA1 and BRCA2 mutations. Deleterious mutations to the BRCA1 or BRCA2 gene were identified
in 12.5% of subjects. The study also looked at the ancestry of the subjects to see if there was a relationship
between ethnicity and the prevalence of the mutated genes.
212 MODULE FIVE » HEREDITY 9780170408851
06_bio_InFocus12_2e_sb_08851_txt.indd 212 08/08/18 6:56 pm
AIM
To use data to interpret trends, patterns and
relationships in the inheritance of genes that
BRCA2
increase an individual’s chance of developing gene
breast or ovarian cancer
METHOD
Complete the following activities and answer the BRCA1
questions regarding the prevalence of BRCA1 and BRCA2 gene
genes in different populations and the risk of developing
breast or ovarian cancer.
Go to the weblink to view the study.
Chromosome 17 Chromosome 13
PART A BRAC1 and
BRAC 2
Table 6.6 shows the prevalence of BCRA1/2 mutations in FIGURE 6.19 Chromosome 17 and chromosome 13 mutations
showing the location of the BRCA1 and BRCA 2 gene information
women of different ethnicities, obtained from a large-
scale population genetics study.
TABLE 6.6 Prevalence of the BCRA1/2 genes in the study
DELETERIOUS MUTATIONS
(% OF WOMEN IN STUDY)
NUMBER OF
ETHNICITY SUBJECTS BRCA1 BRCA2 TOTAL
Western European 36 235 6.9 5.2 12.1
Central European 4 066 8.3 5.3 13.5
Latin American 1 936 9.6 5.4 14.8
African 1 767 10.2 5.7 15.6
Asian 1 183 6.3 6.3 12.7
Native American 597 7.4 5.9 13.2
Middle Eastern 492 6.1 3.3 9.4
Total 46 276 7.2 5.3 12.5
(Source: adapted from Hall MJ, Reid JE, Burbidge LA et al. 2009, ‘BRCA1 and BRCA2 mutations in women of different ethnicities undergoing testing for hereditary
breast-ovarian cancer’, Cancer 115(10): 2222–33, 15 May 2009, Table 2, see http://onlinelibrary.wiley.com/doi/10.1002/cncr.24200/full)
1 Draw an appropriate graph of the data in Table 6.6, indicating the percentage of women in each ethnic
group who have the BRCA1 and BRCA2 genes. The y-axis should have a suitable scale. The x-axis should
have two divisions per ethnic group, one for each type of mutation. Include a key for identification of
BRCA1 and BRCA2.
2 Using both the graph you have drawn and the information in Table 6.6, answer the following questions.
QUESTIONS
1 Which ethnic group had the highest incidence of:
a the BRCA1 gene
b the BRCA2 gene?
2 Outline the general trend exhibited in the relationship between percentages of the BRCA1 gene and the
BRCA2 gene for most ethnic groups.
3 Compare the BRCA1 and BRCA2 percentages for women of Western European ethnicities with those of
Latin American and African ethnicities.
4 Suggest how the reliability of the results for Native American and Middle Eastern ethnicities could be
improved.
9780170408851 CHAPTER 6 » INHERITANCE PATTERNS IN A POPULATION 213
06_bio_InFocus12_2e_sb_08851_txt.indd 213 08/08/18 6:56 pm
PART B
Refer to Figure 6.20 to answer the questions that follow.
Source: adapted from Hall MJ, Reid JE, Burbidge LA et al. 2009,
‘BRCA1 and BRCA2 mutations in women of different ethnicities
undergoing testing for hereditary breast-ovarian cancer’, Cancer
115(10): 2222–33, 15 May 2009, Table 2
a b
100 100
Ovarian cancer risk (%)
Breast cancer risk (%)
80 80
60 60
40 BRCA2 carriers 40
BRCA1 carriers BRCA1 carriers
20 20
BRCA2 carriers
0 0
20 30 40 50 60 70 80 20 30 40 50 60 70 80
Age (years) Age (years)
FIGURE 6.20 Cumulative risk of developing a breast cancer and b ovarian cancer in carriers of the BRCA1 and BRCA2 gene mutations
QUESTIONS
1 What is the cumulative risk of developing breast cancer at:
a age 40, in:
i BRCA1 carriers
ii BRCA2 carriers
b age 74, in:
i BRCA1 carriers
ii BRCA2 carriers?
2 Outline the general trend shown in the graph for the cumulative risk of developing breast cancer as age
increases for BRCA1 carriers.
3 Determine the cumulative risk of developing ovarian cancer at:
a age 48, in:
i BRCA1 carriers
ii BRCA2 carriers
b age 70, in:
i BRCA1 carriers
ii BRCA2 carriers.
4 Outline the general trend exhibited on the graph for the cumulative risk of developing ovarian cancer in
BRCA1 carriers and compare this to the trend for BRCA2 carriers.
5 Compare the trends shown for the cumulative risk of developing breast cancer with the cumulative risk of
developing ovarian cancer in BRCA1 carriers.
6 Using data from all sources presented in this investigation, determine whether it is possible to predict the
chances of developing breast or ovarian cancer.
CONCLUSION
Based on the data studied in this investigation, is it possible to predict the chance of developing breast or
ovarian cancer based on the inheritance of the BRCA1 or BRCA2 gene mutation? Justify your answer using data
from both sources.
214 MODULE FIVE » HEREDITY 9780170408851
06_bio_InFocus12_2e_sb_08851_txt.indd 214 08/08/18 6:56 pm
KEY CONCEPTS
● The prediction of genetic susceptibility to a disease has traditionally been based on family
background and pedigree analysis.
● Large-scale screening and DNA analysis can have a significant impact on individuals through
early detection and improved treatment options.
● The Human Gene Mutation Database (HGMD) stores comprehensive information about
germline mutations associated with human inherited diseases.
● Analysis of large-scale genetic information can be used to predict the inheritance of a disease
or disorder.
CHECK YOUR
1 Before the development of genetic technologies, how was an inherited disease traced within a family? UNDERSTANDING
2 Define these terms: monogenic, polymorphism, single nucleotide polymorphism.
3 What type of data can be obtained from newborn screening tests?
6.3
4 Distinguish between the normal and mutated BRCA1 gene.
Using large-scale data to study
6.4 population genetics and human
evolution
Anthropological genetics is an emerging branch of science that combines components of population
Genetic drift
genetics, such as DNA analysis, with historical, archaeological and linguistic evidence to determine the and gene flow
pathways of human evolution. It aims to explain the causes of human diversity in our past and present. are discussed in
Chapter 7.
The evolutionary forces of mutation, natural selection, genetic drift and gene flow are responsible for the
patterns of diversity in human populations today. The number of alleles and the frequency of alleles in a
population are measures of this diversity. Mathematical population models allow scientists to interpret
Intercultural
genetic diversity and predict the genetic patterns associated with human evolution. understanding
Anthropologists have grappled with the question of when modern humans arose as a species.
Did they arise in Africa 200 000 years ago, or did they come from a subgroup once they were out of
Africa? Studying the human genome rather than fossils alone (Fig. 6.21) has significantly changed our
understanding of human evolution.
Science Photo Library/Pascal Goetgheluck
FIGURE 6.21
Traditional methods
of analysis used
to study human
evolution are based
on comparing fossil
evidence such as
archaic (left) and
modern (right) Homo
sapiens skulls.
9780170408851 CHAPTER 6 » INHERITANCE PATTERNS IN A POPULATION 215
06_bio_InFocus12_2e_sb_08851_txt.indd 215 08/08/18 6:56 pm
Human migration theories
There are two main contesting theories regarding human migration out of Africa: the Multiregional
hypothesis and the Replacement hypothesis.
The Multiregional hypothesis (MRE) relies mostly on fossil evidence and suggests that all human
populations can be traced back to when Homo erectus first left Africa, about 2 million years ago. It is
suggested that there was gene flow between neighbouring populations and that once they dispersed into
other portions of the old world, they slowly evolved into modern humans (Fig. 6.22).
The Replacement hypothesis, also called the Out of Africa or Eve hypothesis, suggests that archaic
Homo sapiens left Africa. It proposes that a second migration out of Africa happened about 100 000
years ago and that modern humans of African origin conquered archaic groups and replaced them by
interbreeding with and out-competing them.
FIGURE 6.22
Multiregional Years ago Replacement (Out of Africa)
(http://creativecommons.org/licenses/by-sa/3.0/)
The Citizens’ Compendium CZ: Creative Commons CC-BY-SA 3.0
Comparison of
the Multiregional
and Replacement Modern
hypotheses of human Africans Europeans Asians Australians
migration out of
humans Africans Europeans Asians Australians
Africa
50 000
100 000
150 000
Homo
erectus
1 000 000
Spread of Homo erectus Spread of Homo erectus
through the world through the world
Homo
habilis
2 000 000
African origin for Homo erectus African origin for Homo erectus
Genetic evidence
Modern genetic studies have shown that if the MRE were correct, modern populations would contain
ancient alleles scattered in different regions of the world. Researchers sequenced over 18 000 whole
human mtDNA genomes from people all over the world.
Mitochondrial DNA was chosen because its pattern of maternal inheritance (hence, named the Eve
hypothesis) provided a relatively uninterrupted lineage of descent from ancestral populations. Global
human populations were grouped according to the specific mutations in their mtDNA: members of a
group that share the same mutations must be descendants of a common ancestor (haplogroups). Using
molecular homology, phylogenetic trees were produced from the mtDNA haplogroups.
It was discovered that, among modern humans, most of the variation in mtDNA sequences occurs
in African populations (L haplogroups, Fig. 6.23). The mtDNA of Europeans, Asians and the Indigenous
peoples of Australia, the Americas and Pacific islands represent just a subset of total human mtDNA
diversity (M and N haplogroups, Fig. 6.23). This provides evidence for the Replacement (Out of Africa)
hypothesis.
216 MODULE FIVE » HEREDITY 9780170408851
06_bio_InFocus12_2e_sb_08851_txt.indd 216 08/08/18 6:56 pm
Molecular clock estimates suggest that diverse populations of modern humans evolved over 200 000
years in Africa, with the haplogroups that migrated out of Africa diverging 70 000 years ago. Superimposing
the phylogenetic tree on a map of Africa (Fig. 6.23) strengthens the case for migration. The two surviving
mtDNA groups (M and N) that colonised the other continents are most closely related to the African L3
group located north-east of Africa and nearest the Middle East.
a b
N 45–60 kya
M
70 kya
M N
L3
L3
L2 57–87 kya
L2
~90 kya
~110 kya
L1
L0a,f L1
MRCA
L0d L5
L0
L0k ~140 kya
L0k
L0d
L0a
FIGURE 6.23 a Phylogenetic tree generated from mtDNA sequences of global human populations. The labels at the tips of
the tree represent the haplogroups into which human mtDNA mutations can be classified. b Map showing the location of each
haplogroup and inferred migration patterns thousands of years ago (kya). All haplogroups originate in Africa and the Middle
East. Only the M and N haplogroups are found in indigenous populations throughout the rest of the world. MRCA = most recent
common ancestor.
Out of Africa
The evidence suggests that, when our human ancestors first migrated out of Africa, they were not alone.
At least two other species of humans (Neanderthal and Denisovans) occupied what is now the Eurasian
land mass. Neanderthal (Homo neanderthalensis) remains (Fig. 6.24) are found in western, central,
eastern and Mediterranean Europe, as well as south-west, central and northern Asia up to the Altai
Mountains in Siberia.
Denisovans (Fig. 6.24) were a subspecies of humans. A 41 000-year-old finger bone found in a cave in
the Altai Mountains in Siberia is genetically different from both Neanderthals and humans. These caves
had been inhabited by both Neanderthals and Denisovans, possibly even overlapping at times.
As our human ancestors migrated through Eurasia, they would have encountered Neanderthals
and Denisovans. Genetic evidence suggests that they interbred with Neanderthals. In doing so, a
small amount of Neanderthal DNA was introduced into the human genome, and persists today.
Scientists have concluded that most Europeans and Asians have 2% Neanderthal DNA. In fact,
genetic analysis of the oldest European mummy (‘Otzi the iceman’, who lived around 3400 BCE)
shows it to contain an even higher percentage.
9780170408851 CHAPTER 6 » INHERITANCE PATTERNS IN A POPULATION 217
06_bio_InFocus12_2e_sb_08851_txt.indd 217 08/08/18 6:56 pm
FIGURE 6.24
Getty Images/Ted
Thai/The LIFE Picture
Collection
Neanderthals and
Alamy Stock Photo/
E. R. Degginger
Denisovans were
closely related.
DNA comparisons ?
suggest that
the ancestors of
modern humans
diverged 500 000 Modern humans
years ago. Neanderthals Denisovans Today
100 000
years ago
200 000
300 000
400 000
500 000
Alamy Stock Photo/
Cro Magnon
Homo
heidelbergensis
INVESTIGATION 6.4
A secondary-source investigation into using genetic evidence
to map the trail of our ancestors out of Africa
Mitochondrial DNA (mtDNA) is ideal for tracing human evolution because it is inherited only through the
maternal line and is not subject to recombination, as nuclear DNA is. There are also 1016 molecules of mtDNA
within every human, and each mtDNA molecule is usually identical to all the others. The mean rate of mtDNA
divergence within humans is 2–4% per million years.
A worldwide survey of mtDNA drawn from 147 people from five geographic regions was conducted and
partial results are presented below.
AIM
To use data from secondary-source investigations to determine the route taken by our ancestors when they
migrated out of Africa
BACKGROUND
The five geographic regions sampled are:
1 Sub-Saharan Africa (n = 20)
2 Asian from China, Vietnam, Laos, the Philippines, Indonesia and Tonga (n = 34)
3 Australian Aborigines (n = 21)
4 Caucasians from Europe, North Africa and the Middle East (n = 46)
5 Aboriginal New Guineans (n = 26).
Table 6.7 shows the mtDNA divergence (difference) within and between the five human populations. The
shaded diagonal shows divergence between individuals within the population, the cells below the diagonal
show the divergence between the two different populations, and the cells above the diagonal have been
removed for the purpose of this investigation.
218 MODULE FIVE » HEREDITY 9780170408851
06_bio_InFocus12_2e_sb_08851_txt.indd 218 08/08/18 6:56 pm
TABLE 6.7 MtDNA divergence within and between five human populations
SEQUENCE DIVERSION (%)
POPULATION 1 AFRICAN 2 ASIAN 3 AUSTRALIAN 4 CAUCASIAN 5 NEW GUINEAN
1 African 0.47
2 Asian 0.45 0.35
3 Australian 0.40 0.31 0.25
4 Caucasian 0.40 0.31 0.27 0.23
5 New Guinean 0.42 0.34 0.29 0.29 0.25
(Source: Adapted from Cann RL, Stoneking M & Wilson AC 1987, ‘Mitochondrial DNA and human evolution’, Nature 325: 321-36, Table 1)
QUESTIONS
1 a Which population shows the greatest sequence divergence in mtDNA sequences within the
population?
b What does this mean in terms of the age of this population?
2 a Which population shows the least divergence in mtDNA sequences within the population?
b What does this mean in terms of the age of this population?
3 Formulate a hypothesis to explain the observations in Questions 1 and 2.
4 Explain why sub-Saharan Africans do not have any Neanderthal DNA in their genome.
5 Use evidence from Table 6.7,
Figure 6.25 and pages 216–18 to Eurasians and North
complete this question. Download the and South Americans Indigenous Australians
2.5% 2.5% 5%
worksheet Human evolution map. On
the map, indicate the most likely path
taken by our ancestors when they
moved out of Africa. Show where they
may have interbred with Neanderthals WS
and Denisovans. Make sure you are Neanderthal
able to support each decision that Denisovan Human
you make with evidence. Write this FIGURE 6.25 Percentage of archaic DNA in different human populations
evolution
evidence on the map.
KEY CONCEPTS
● Anthropological genetics is the science of using genetic data to understand human evolution.
● Humans have more genetic diversity within a population than between populations.
● Until recently, our understanding of human evolution was based on fossil evidence, which is
both incomplete and subject to interpretation.
● The two models used to explain human migration are the Multiregional hypothesis (MRE) and
the Replacement hypothesis.
● Genetic data favours the Replacement hypothesis that modern humans evolved out of Africa
and spread across the other continents.
CHECK YOUR
UNDERSTANDING 1 What does anthropological genetics aim to explain?
2 a State the two theories that attempt to explain human migration.
6.4 b Compare these two theories.
3 Which of the two theories in Question 2 does the genetic evidence support? List that evidence and
explain how it supports the theory.
4 List the two other human species that were alive at the same time as our ancestors. State the evidence
that supports this.
9780170408851 CHAPTER 6 » INHERITANCE PATTERNS IN A POPULATION 219
06_bio_InFocus12_2e_sb_08851_txt.indd 219 08/08/18 6:56 pm
6 CHAPTER SUMMARY
Inheritance patterns in a population: Can population genetic patterns be predicted with any accuracy?
Inheritance patterns can be studied and predicted using genetic technologies that determine the sequence of
genes along a section of DNA.
Ethical issues arising from gathering
of genetic information
DNA sequencing DNA profiling
Determines the exact order of bases Also known as DNA fingerprint analysis
of a gene, e.g. ACGTACGTACTTGGA Mother Child Male 1 Male 2
Several methods can be used, including:
Sanger method New-generation technologies
DNA is isolated and (e.g. Oxford nanopore) DNA is propelled
replicated using with a motor protein through a protein
PCR. nanopore.
Maxim Gilbert
method
Chemicals are used to STR’s (short tandem repeats) are sections
identify a specific base. of non-coding DNA that are unique
Ectrophoresis is then used to individuals and can be used for the
to compare the patterns of identification of individuals.
bases.
The process:
Population genetics
• DNA is isolated.
Gene pool The study of genetic variation in a
• PCR is used to amplify the amount of DNA.
The alleles found in population and changes to the frequency
of alleles within a population. Data • Sections are separated according to
a population length using gel electrophoresis.
analysis from large-scale collaborative
projects is used for:
Human evolution studies
See next page.
Conservation management
How to avoid extinction by maintaining Disease and genetics data
genetic biodiversity, e.g. the koala. Enables scientists to study patterns of genetic disease
inheritance as well as focusing in improved treatment options
Traditionally field observations were used.
Now genetic data is gathered to make For example:
informed decisions on biodiversity.
BRCA1 and BRCA2 genes code BRCA2
gene
for proteins that repair genes.
Mutations of these genes are BRCA1
linked to breast cancer. gene
Chromosome 17 Chromosome 13
Modern genetic tools See next page.
220 MODULE FIVE » HEREDITY 9780170408851
06_bio_InFocus12_2e_sb_08851_txt.indd 220 08/08/18 6:57 pm
Modern genetic tools
Include SNPs GWAS and haplotypes
SNP Haplotype GWAS
Single nucleotide A group of genes that are Genome-wide
polymorphism inherited together association study
4 2
Human evolution studies:
Anthropological genetics Modern humans of
African origin conquered
archaic groups and
replaced them by
Human migration theories interbreeding.
Multiregional hypothesis (MRE) Once dispersed, Out of Africa hypothesis
Relies mostly on fossil evidence. evolved into Replacement hypothesis – relies mostly
modern humans on mtDNA evidence.
Suggests gene
flow between
neighbouring Archaic Homo
All human A second migration
populations. sapiens left Africa.
populations can happened about
be traced back 100 000 years ago.
to Homo erectus
leaving Africa about
2 million years ago.
Multiregional Years ago Replacement (Out of Africa)
Modern
Africans Europeans Asians Australians humans Africans Europeans Asians Australians
50 000
100 000
150 000
Homo
erectus
1 000 000
Spread of Homo erectus Spread of Homo erectus
through the world through the world
Homo
habilis
2 000 000
African origin for Homo erectus African origin for Homo erectus
9780170408851 CHAPTER 6 » INHERITANCE PATTERNS IN A POPULATION 221
06_bio_InFocus12_2e_sb_08851_txt.indd 221 08/08/18 6:58 pm
6 CHAPTER REVIEW QUESTIONS Qz
Review quiz
1 a Outline two theories used to explain how humans 13 Describe variation in the human species.
evolved.
14 Explain how the frequency of an allele can change in a
b Outline the evidence used to support each theory. population.
2 Distinguish between Neanderthals and Denosovans. 15 Use an example to describe a genetic disease that can
Comment on their relationship to modern humans. occur more frequently in a particular ethnic group.
3 Outline the evidence used to explain human evolution. 16 Outline the function of the following genes:
4 Outline how research into population genetics has a tumour suppressor gene
changed over time. b BRCA1 and BRCA2.
5 How did scientists study genes and their location before 17 How has anthropological genetics changed our
the Human Genome Project (HGP)? understanding of human evolution?
6 How has our understanding of human evolution changed 18 Why did scientists in the past think that humans belonged
because of large-scale data analysis? to distinct racial groups?
7 Describe how DNA sequencing can assist in identifying 19 Describe one phenotypic difference that is evident
mutations that cause diseases. between human groups.
8 Explain why the HGP provided an important stimulus for 20 Explain the significance of gene flow between human
the automation of DNA sequencing. populations.
9 Outline one use of DNA profiling. 21 Explain why mitochondrial DNA is used to compare the
10 Describe a technology used to improve our genetic relatedness of modern human populations.
understanding of inheritance patterns. 22 According to the Replacement (Out of Africa) hypothesis,
11 How does inbreeding affect genetic diversity? modern humans moved out of Africa to populate the rest
of the world. Outline what may have happened to the
12 a Justify why scientists have researched the genetic populations that already lived there.
diversity of koalas.
23 Evaluate the use of genetic techniques in aiding our
b Outline two genetic techniques used to investigate the
understanding of human evolution.
diversity of koala populations.
c Why might there be a difference in genetic diversity 24 Can population genetic patterns be predicted with
between koala populations? accuracy?
222 MODULE FIVE » HEREDITY 9780170408851
06_bio_InFocus12_2e_sb_08851_txt.indd 222 08/08/18 6:58 pm
» END-OF-MODULE REVIEW MODULE 5 : HEREDITY
Answer the following questions.
1 Explain why the genetic code needs to be universal in 5 In 1940, a blood cell protein was discovered in humans
order for bacteria to produce human growth hormone. that had first been discovered in rhesus monkeys. The
Use a flow chart to provide an example that illustrates allele of the gene that produces the protein is called Rh
your answer. positive (Rh+) and is dominant over the allele for the
absence of the protein, termed Rh negative (Rh–). The
2 The diploid number of chromosomes in humans (Homo allele for Rh+ shows complete dominance. Draw one
sapiens) is 46 and the diploid number of chromosomes in Punnett square to show all of the following, and explain
rice (Ozyra sativa) is 24. Decide whether each of the following each using examples from the Punnett square.
statements is true or false, and provide evidence from your a An Rh– child is born from parents who have at least
understanding of genetics to support your answer. one Rh– allele.
a Simpler organisms have fewer chromosomes than b Two Rh+ parents could have a Rh– child.
complex organisms.
c Siblings in the same family are a mixture of Rh+ and Rh–.
b Plant species have fewer chromosomes than animal
species. 6 Familial hypercholesterolaemia is a disorder in which
c The number of chromosomes in a human gamete is receptors on liver cells that normally take up
less than the diploid number of chromosomes in rice. cholesterol from the bloodstream do not work. This
d The number of chromosomes in a rice gamete is the results in very high levels of cholesterol in the blood.
same as the number of chromosomes in a human Individuals who are heterozygous have half of the
gamete. receptors functioning; homozygous individuals have no
receptors functioning.
3 The giant panda is native to China. Due to habitat loss a Name the type of inheritance pattern shown in
it is on the brink of extinction. Luckily there are many hypercholesterolaemia, giving reasons for your answer.
giant pandas in zoos across the world where they are b Describe the expected effect of the gene for
bred in an effort to increase the wild population. One of hypercholesterolaemia on cholesterol levels in the
the problems in breeding from a small population is the blood of a person who is:
reduction in genetic variation, so it is important to keep
i homozygous for the normal allele
track of breeding partners and offspring.
ii heterozygous
Pandas are very difficult to breed in captivity, so most
fertilisation is achieved through artificial insemination iii homozygous for the hypercholesterolaemia allele.
(mixing eggs and sperm in a test tube) using semen from c Draw a Punnett square to determine the genotypes of
several males. Once fertilisation occurs, it is essential that offspring of two parents who are heterozygous for the
the father be identified. hypercholesterolaemia gene. Give the phenotypic and
One way to do this is to collect the pandas’ faeces. This genotypic ratios of offspring.
faeces contains DNA not only from the panda, but from
7 A male guinea pig that is pure breeding for black fur is
the bamboo on which they feed, and from bacteria.
crossed with a guinea pig that is pure breeding for white
a What techniques would be used to determine the fur. The offspring have parts of their body that are black
source of DNA in the panda faeces? Describe the and parts that are white.
purpose of each technique.
a What type of inheritance does this suggest for coat
b What other benefit would occur from these colour in these guinea pigs? Give a reason for your
procedures? answer.
c Zoo keepers could also use blood samples from the b Discuss what the expected offspring would be in
panda to gain DNA. Suggest one reason why they terms of genotypes and phenotypes (and their ratios)
choose to use faeces instead. if, in guinea pigs,
d Outline how scientists could keep track of breeding i black was dominant over white
partners and offspring to prevent reduced genetic
ii black and white showed incomplete dominance
variation in the population.
iii black was X-linked and dominant
4 Compare the physical and chemical structure of DNA and iv black was codominant and sex-linked.
proteins, including differences in chemical composition,
monomers, bonding, physical shape, primary structure
and overall structure.
9780170408851 CHAPTER 6 » INHERITANCE PATTERNS IN A POPULATION 223
06_bio_InFocus12_2e_sb_08851_txt.indd 223 08/08/18 6:58 pm
8 Discuss four natural mechanisms of reproduction in living a Write out the letters in the order in which these stages
organisms that ensure the continuity of the species. occur.
Include in your discussion examples of mechanisms seen b How many chromosomes are there in the cell?
in both asexual and sexual reproduction and unicellular c What would the haploid number of chromosomes be
and multicellular organisms. for these cells?
9 Use the diagram below to answer the questions that follow. d Draw the cells that would result if the above cell was
to divide by meiosis. You may use colour to help you
C illustrate this process.
D
B 11 A species of mosquito that causes yellow fever has
three pairs of chromosomes in its cells. Calculate how
many different combinations of maternal and paternal
chromosomes would be possible in the gametes. Show
your working.
E
12 An inherited condition known as ichthyosis results in scaly
A skin. The disorder is found in 1 in 6000 males, but the
F disease is almost unknown in females.
a What type of inheritance may account for the
a Give the letter(s) of the label that points to the part(s) difference in the occurrence of ichthyosis in males
of the flower where each of the following occurs: and females?
i meiosis b From which parent would an affected male inherit the
defective allele? Explain why.
ii pollen lands during pollination
c What is the probability that a male could pass the
iii fertilisation.
defective gene to his sons? Explain your answer.
b Explain how artificial pollination is carried out, referring
d What may account for the fact that there are no
to letters of parts of the diagram to help you explain.
known cases of the disease in females?
c In terms of the diagram, explain the difference between
an ovary, an ovule and an ovum. You may redraw part 13 A dingo is a carnivorous placental mammal with high-
of the diagram and label it to aid your explanation. quality parental care. The Tasmanian devil is a carnivorous
d If a harmful mutation occurred in a cell at position A, marsupial mammal. It is not known exactly how many
explain the consequences, if any, for this plant and chromosomes a thylacine tiger had, but scientists expect
future generations. it to be fourteen, like related marsupials.
e If a mutation occurred in the cells inside C, explain Scientists believe that by placing synthetic chromosomes
the possible consequences for this plant and future created from DNA fragments from a preserved Tasmanian
generations. tiger genome into a treated egg cell of a related species,
f Explain how a flower such as this one could ensure it may be possible to create a viable egg that can be
cross pollination rather than self-pollination, and the implanted into a surrogate mother, to recreate the extinct
resulting advantages to future offspring. Tasmanian tiger.
g If the inheritance pattern of this flower’s colour is Which host animal, dingo or Tasmanian devil, would be
incomplete dominance, and it reproduces by self- best to use to act as an egg donor? Which would be best
fertilisation, predict the genotypic and phenotypic as a surrogate mother? Justify your answer.
ratios of offspring in the first filial generation.
10 The sequence of diagrams below represents the stages of
a cell dividing by mitosis.
A B C D E
224 MODULE FIVE » HEREDITY 9780170408851
06_bio_InFocus12_2e_sb_08851_txt.indd 224 08/08/18 6:58 pm
▻ Investigate the structure and physiology of a variety of flowering plants, with an emphasis on
reproductive mechanisms that are adaptations that ensure continuity of the species.
▻ Research the claim that sexual reproduction helps speed up evolution and may allow some algae to
adapt quickly enough to tolerate the rise in sea surface temperature. Evaluate the possibility that this
adaptation will allow some corals to survive a bleaching event.
▻ Investigate gametogenesis and compare and model differences in meiosis during the production
of egg cells and sperm cells in mammals.
▻ Look into the Red Queen hypothesis and find out whether it promotes natural selection for or
against sexual reproduction.
▻ Find out about current research into links between:
– oestrogen and cognitive functioning, sex drive, mood lowering (depression), binge eating, bone
growth and maturation, maintenance of the cardiovascular system, immune system and other
metabolic functions
– androgens and muscle mass, the brain and behaviour, and the female body.
▻ Find out about the effects of alcohol consumption on hormonal secretions in pregnancy and the
development of the foetus.
▻ Find out about babies conceived using DNA from three people to bypass mitochondrial disease. Use
the weblink to help you.
▻ Find out about the research that has led to our understanding of how fertilisation occurs, including
the research of scientists such as Oscar Hertwig, Walter Sutton and Theodore Boveri, Frank Lillie,
Three parents Benjamin Kaupp, K. Miki and D.E. Clapham.
▻ Conduct secondary source research into the first baby born by in vitro fertilisation (Edward and
Steptoe technique) in 1978 and compare this technique to the techniques used today.
9780170408851 CHAPTER 6 » INHERITANCE PATTERNS IN A POPULATION 225
06_bio_InFocus12_2e_sb_08851_txt.indd 225 08/08/18 6:58 pm
» MODULE SIX
GENETIC CHANGE
7 Mutation
8 Biotechnology
9 Genetic technologies
Science Photo Library/Alfred Pasieka
226 9780170408851
07_bio_InFocus12_2e_sb_08851_txt.indd 226 09/08/18 9:22 am
7 Mutation
Students:
INQUIRY QUESTION • explain how a range of mutagens operate, including but not limited to: ICT
- electromagnetic radiation sources
How does mutation
- chemicals
introduce new alleles into - naturally occurring mutagens
a population?
• compare the causes, processes and effects of different types of mutation, including but not limited to: ICT N
- point mutation
- chromosomal mutation
• distinguish between somatic mutations and germ-line mutations and their effect on an organism (ACSBL082,
ACSBL083) ICT
• assess the significance of ‘coding’ and ‘non-coding’ DNA segments in the process of mutation (ACSBL078) ICT N
• investigate the causes of genetic variation relating to the processes of fertilisation, meiosis and mutation
(ACSBL078) N
• evaluate the effect of mutation, gene flow and genetic drift on the gene pool of populations (ACSBL091,
ACSBL092) N
Biology Stage 6 Syllabus © NSW Education Standards Authority for and on behalf of the Crown in right of the State of New South Wales, 2017
Shutterstock.com/koya979
9780170408851 227
07_bio_InFocus12_2e_sb_08851_txt.indd 227 09/08/18 9:22 am
Our genes play a big part in determining how we look and behave, and even whether or not we are likely
to get sick. No two individuals are alike – even identical twins have their differences. These differences are
termed ‘variations’. The combined impact of genetics and the environment is being explored to find out
what makes us different. Mutations, or changes in DNA, play a large role in introducing new alleles into
the population. Scientists are using knowledge about variations due to mutation in exciting new ways,
such as predicting and treating health problems.
At the molecular level, a mutation is a change in the genetic material of a cell – the sequence of
nucleotides in DNA is altered. This may be the result of spontaneous mistakes that arise and are not
corrected when DNA is replicated, or of mistakes induced by environmental factors such as UV light
or cigarette smoke. In either case, this alteration of DNA changes the information coded in the gene
and may alter the protein or RNA end product.
Mutations range in size, from a change in a single DNA base pair to a change in the structure of a large
segment of DNA in one or more chromosomes, where multiple genes are affected. Variations of genes
that arise as a result of mutations are said to be alleles of that gene. Some genes have markers that may
be associated with mutations, and data about these markers is being used more frequently to identify
potential health problems.
Shutterstock.com/Catalin Rusnac
FIGURE 7.1
Mutations at the
molecular level alter
the sequence of
nucleotides in DNA.
7.1 Mutagens
What is a mutagen and what are its effects? Answers to these questions were discovered just over a
hundred years ago. During the late 1800s and early 1900s, many scientists were involved in studying
radiation. Because the harmful effects of radiation were unknown then, scientists who were exposed
to large amounts of radiation over prolonged periods of time, such as Marie Curie, developed various
illnesses. Marie Curie worked with ionising radiation for most of her career and died in 1934 from
leukaemia due to overexposure to radioactive emissions. Rosalind Franklin, who worked with X-rays
in her crystallography studies, died of ovarian cancer in 1958.
Survivors of the 1945 bombing of Hiroshima suffered physical mutations as a result of radioactive
output from the nuclear explosion. The link between exposure to ionising radiation and an increase
in the occurrence of certain illnesses such as leukaemia and other cancers was identified, but
further evidence was needed to show that radiation was causing these cancers.
228 MODULE SIX » GENETIC CHANGE 9780170408851
07_bio_InFocus12_2e_sb_08851_txt.indd 228 08/08/18 7:03 pm
By the 1970s, it was known that certain chemicals as well as radiation can change the structure
of DNA and lead to cancer. Victims of the 1986 nuclear meltdown in Chernobyl showed immediate
damage to their DNA and the damage was passed to their descendants. As early as the 1950s, some
viruses were found to be carcinogenic. So how do chemicals, radiation and biological agents change
DNA in a way that leads to cancer?
Mutagenic agents
Maintaining the integrity of DNA is essential for the functioning of cells. Environmental agents that
alter DNA and cause mutations are termed mutagens. The process of inducing a mutation is termed
mutagenesis and the resulting mutations are termed induced mutations.
Many mutagens are carcinogenic (cancer-causing). This is because some mutations occur in genes
that regulate the cell cycle or promote or suppress cell division. These mutations cause changes in the
cell cycle that may result in increased cell division with no differentiation, resulting in masses of cells
known as tumours. There are two types of genes in which mutations commonly lead to cancer: proto-
oncogenes and tumour suppressor genes. You will learn more about these in Chapter 15.
Mutagens can be grouped into categories, based on their source (Fig. 7.2). To explore different
mutagenic agents, you need to understand their basic features, how they act and the specific damage to
DNA that commonly results from each type of mutagen.
Cellular UV light Ionising Chemical Replication
metabolism exposure radiation exposure errors
DNA damage
DNA repair mechanisms
Cell cycle checkpoint DNA repair:
activation Base excision repair
Nucleotide excision repair
Mismatch repair
Double-strand break repair
FIGURE 7.2 Causes of DNA damage and types of repair mechanisms activated
Chemical mutagens
Chemical mutagens are chemicals that cause mutations if cells are exposed to them at high frequencies
or for prolonged periods of time. A large number of ingested and everyday chemicals have been found
to be mutagenic over time, and many of these are no longer as widely used as they were in the past.
Chemical mutagens cause a change in DNA that alters the function of proteins and, as a result, cellular
processes are impaired.
9780170408851 CHAPTER 7 » MUTATION 229
07_bio_InFocus12_2e_sb_08851_txt.indd 229 08/08/18 7:03 pm
Examples of chemical mutagens:
◗ ingested chemicals including alcohol, tar in tobacco smoke, some medications and chemicals in
food – especially charred and fatty foods, and food additives and preservatives (such as nitrites)
◗ environmental irritants and poisons such as organic solvents ( for example, benzene), cleaning
products, asbestos, coal tars, pesticides and some hair dyes.
Chemicals that are mutagenic are usually structurally
similar to normal bases in DNA (purines and pyrimidines)
org/wiki/File:DNA_methylation.jpg)
Christopher Bock/Creative Commons
(CC BY-SA 3.0) (https://commons.wikimedia.
and so they may mistakenly become incorporated into
DNA during replication. This results in the insertion of
incorrect nucleotides opposite them during replication –
termed mispairing (Fig. 7.3). Their insertion often results
in the production of a non-functional protein end product.
Some common examples of molecules that are chemical
mutagens include alkylating agents, de-aminating agents
and intercalating agents (chemicals that interact directly
with DNA and change its structure). You will research this in
more detail in Investigation 7.1.
Naturally occurring mutagens
It is believed that some mutations, thought in the past to
FIGURE 7.3 DNA undergoes structural change in base pairing as a
have arisen spontaneously, may be the result of exposure to
result of mutagenesis. naturally occurring mutagens in the environment. We know
that spontaneous mutations, such as DNA replication errors,
arise during DNA replication and are retained because the
normal mechanism of DNA repair does not correct them. Other types of mutations, perhaps thought
to be ‘spontaneous’ in the past, are now associated with mutagenic agents that are present naturally in
the environment.
Naturally occurring mutagens are mutagenic agents that are present at normal levels within natural
environments, and may cause mutations. The likelihood of mutation is thought to increase with increased
frequency and length of exposure.
Naturally occurring mutagens can be divided into two groups: biological mutagens and non-biological
naturally occurring mutagens.
Non-biological naturally occurring mutagens include metals, such as mercury and cadmium, that
occur naturally in the environment. Biological naturally occurring mutagens include viruses, bacteria,
fungi and their products.
Biological mutagens and their actions
◗ End-products of metabolism: many naturally occurring biological mutagens may be produced by fungi,
or plant or animal cells during metabolism. These mutagens tend to be discovered when sudden
outbreaks of particular types of cancers occur in organisms that live in particular areas or soils and/
or eat particular foods.
One example of a biological mutagen that is currently being researched is an end-product of
cellular metabolism, called nitrosamine. Nitrosamines are chemicals that form in the stomach
when certain foods or food ingredients are eaten in combination – for example, when ingredients
that contain nitrous acid or nitrites are eaten together with amines, naturally present in meat and
fish. Examples are some processed and smoked meats and sausages that have this combination of
chemicals. Cooking these foods at high temperatures causes the nitrites and amines to combine,
forming carcinogenic (cancer forming) nitrosamines, particularly if the cooking methods involve
230 MODULE SIX » GENETIC CHANGE 9780170408851
07_bio_InFocus12_2e_sb_08851_txt.indd 230 08/08/18 7:04 pm
direct heat, such as frying or grilling. (It is interesting to note that nitrosamines are a component
of cigarette smoke, an unnatural mutagen that is known to be highly carcinogenic.)
◗ Transposons are sections of DNA that spontaneously fragment and relocate or multiply within the
genome. When these transposable elements insert into chromosomal DNA, they disrupt DNA
functioning.
◗ Microbes are naturally occurring biological mutagens. These include viruses (such as hepatitis B virus,
HIV, Epstein-Barr virus, Rubella virus) and bacteria (such as Helicobacter). Mutagenic microbes may
also directly alter the genetic material in cells.
Effects of biological mutagens
Many mutagenic microbes are able to insert their own base sequences into DNA and in this way change
the functioning of genes and trigger cancers (similar to transposons).
Some bacteria and/or their products cause inflammation, during which free radicals (reactive oxygen
species) are produced, causing DNA damage and reducing the efficiency of DNA repair systems, thereby
increasing mutation. Examples are the bacteria Helicobacter pylori and some mycotoxins (chemicals
produced by some fungi). The release of free radicals in the body may also lead to a condition known
as oxidative stress, where the individual’s immune response is altered and the immune system does not
function properly to fight off viral infections.
Some products made by microbes are mutagenic due to their instability at cellular pH. They
decompose to form an intermediate that can bind to cellular DNA and alter it.
Physical mutagens
Physical mutagens include heat and ionising radiation. Direct heat often has a combined action with
chemical and naturally occurring mutagens, as discussed in the previous section.
Radiation is any transfer of energy through space from a source, such as electromagnetic radiation
from the sun. Not all radiation is harmful to our health. The harmful type, called ionising radiation, has
enough energy to break chemical bonds in molecules, including DNA.
Electromagnetic radiation
Electromagnetic radiation comes from the sun and is a form of energy that is all around us, such as
radio waves, microwaves and gamma rays. This energy is transmitted in waves or particles in a range of
wavelengths and frequencies.
The overall range of wavelengths is known as the electromagnetic (EM) spectrum. There are seven
regions in the spectrum, in order of decreasing wavelength (and increasing energy and frequency): radio
waves, microwaves, infrared (IR), visible light, ultraviolet (UV), X-rays and gamma-rays (Fig. 7.4).
Ionising radiation includes the shorter wavelengths of UV radiation as well as X-rays and gamma
rays. The shorter wavelength and high energy of ionising radiation make it dangerous, as it can split
off electrons, which cause damage in cells. Radio waves and infrared radiation are long-wavelength,
low-energy forms of radiation and are not harmful; ultraviolet radiation is somewhat harmful; gamma
radiation is extremely harmful, even in small doses.
Ultraviolet (UV) radiation
Near-ultraviolet radiation or UVA (315–400 nm) is non-ionising and the DNA damage that it does may be
related to ageing, but its mutagenic and carcinogenic impact is still uncertain.
Artificial UV lights in tanning salons use UVA, and prolonged exposure is a risk to health. For this
reason, commercial tanning salons are banned in Australia.
UVB or middle UV (280–315 nm) and UVC or far UV (180–280 nm), which have shorter wavelengths,
are a form of ionising radiation that is high in energy and the chemical damage it causes to DNA by
breaking bonds is known to be mutagenic and carcinogenic.
9780170408851 CHAPTER 7 » MUTATION 231
07_bio_InFocus12_2e_sb_08851_txt.indd 231 08/08/18 7:04 pm
Non-ionising radiation Ionising radiation
700 nm 600 nm 500 nm 400 nm
Visible spectrum
Frequency (Hz) Decreasing frequency Increasing frequency
104 106 1012 1015 1016 1018 1021
Longer
Shorter
wavelength
wavelength
Radio waves Microwaves Infrared Visible Ultraviolet X-rays Gamma rays
Wavelength
(metres) 102 11 1 1021 1022 1023 1024 1025 1026 1027 1028 1029 10210 10211 10212 10213
FIGURE 7.4 Ionising and non-ionising radiation
Naturally occurring UV radiation from sunlight has
been shown to be a contributing factor to skin cancer. The
Ultraviolet
light most common effect of UV radiation on DNA is to produce
pyrimidine dimers (cross-linked nucleotides). This occurs
when an adjacent pair of bases (either two thymine or two
Thymine dimer cytosine bases) on the same strand become attached to
each other (Fig. 7.5). This prevents them from pairing with
T T bases on the complementary strand, causing the strand
to end prematurely. This prevents normal replication
C A G G and transcription, affecting both the cell cycle and gene
G A
T
G T A A C C
C products.
C T
A
G
Other forms of ionising radiation
Ionising radiation is high-energy radiation that is able to
free electrons from atoms or molecules, turning them into
FIGURE 7.5 Thymine dimer mutation caused by exposure to UV light
ions (charged particles). These high-energy electrons that
are released can damage DNA.
Sources of ionising radiation are cosmic rays from the sun and outer space, as well as radioactive
elements in soil, the atmosphere and even stone and wood. Artificial sources of radiation that have been
created by humans include radioactive materials from nuclear reactions. These emit radiation such as
alpha, beta and gamma rays. Radiation from atomic bombs, toxic spills (such as occurred at Chernobyl in
1986), nuclear testing and power plants, and even radiation used in medicine (such as X-rays and gamma
radiation) are all forms of mutagenic ionising radiation that can be harmful to human health, even in
232 MODULE SIX » GENETIC CHANGE 9780170408851
07_bio_InFocus12_2e_sb_08851_txt.indd 232 08/08/18 7:04 pm
small doses. As mentioned before, high-energy UV radiation may also be considered ionising radiation, if
it has enough energy to ionise (remove an electron from) an atom or a molecule.
Ionising radiation has many effects on DNA. When electrons pass through cells, they interact with
water, and particles called free radicals are released (Fig. 7.6) . These are highly reactive and may act on
proteins and lipids in cell membranes and other parts of cells, in addition to DNA. Breaks in one or both
strands of DNA occur, leading to deletions, partial chromosome loss, rearrangements of sequences in How radiation
DNA and cross-linking of DNA with itself. This interferes with cell division, gene products and cell changes your
DNA
metabolism. Watch the video
clip.
CC BY 4.0 International Licence.
Direct effect b Indirect effect
The BCcampus Open Education Adaptation
Guide by Lauri M. Aesoph is used under a
2 2
H2O 1 radiation H2O1 + e2
H2O1 1 H2O H3O1 1 OH2
See Chapter 3,
FIGURE 7.6 The effects of ionising radiation on DNA: a release of an electron from a DNA molecule; and b formation of free page 104, for
radicals, which can affect DNA structure further details on
DNA repair.
Today there is strict regulation of the quantity of mutagens that may be present in products or to
which people may be exposed. Some chemicals are banned and others may be added in only very small
amounts. Radiation doses are also regulated.
Because the integrity of DNA replication is so important, DNA repair mechanisms operate in cells, DNA damage
whereby enzymes that are involved in replication also play a role in removing damaged parts of DNA and Watch the video
clip to see how
repairing DNA. These mechanisms include: DNA exposed to
ionising radiation
◗ base excision repair – a damaged or incorrectly paired base is removed (by a nuclease enzyme) from is damaged and
repaired.
its sugar linkage and replaced; an example is the removal of a pyrimidine dimer (Fig. 7.7).
◗ mismatch repair – once DNA has replicated, the enzyme DNA polymerase carries out a ‘spell check’
for accuracy of replication.
FIGURE 7.7 Repair
of a pyrimidine dimer
DNA with dimer in DNA
Dimer recognised by
DNA polymerase and
DNA cut
Dimer excised by
a nuclease
Gap filled by DNA
polymerase
Gap sealed by
DNA ligase
9780170408851 CHAPTER 7 » MUTATION 233
07_bio_InFocus12_2e_sb_08851_txt.indd 233 08/08/18 7:04 pm
INVESTIGATION 7.1
Secondary-source investigation into mutagens
WS
and how they operate
Mutagens and
their effects How do different agents alter the structure of DNA and affect gene expression? What increases the harmful
effects of mutagens on DNA? Is it the intensity or dosage of the agent, the length of time the cells are exposed
to the agent, or the frequency at which cells are exposed? It is important to find out such information, so that
lifestyle changes can be made to reduce the rate of mutagenesis.
There are two parts to this investigation. Part A is undertaken in a group of no more than four members and is
Information and mandatory. Part B is an optional extension.
communication
technology AIM
capability
To investigate mutagens and how they operate
Literacy
PART A: T YPES OF MUTATIONS CAUSED BY SPECIFIC MUTAGENS
Critical and METHOD
creative thinking
1 Investigate the specific chemical changes that are induced in DNA by each type of mutagen: radiation,
chemicals and naturally occurring mutagens such as biological agents. Use specific examples to support
your answer.
2 Working in groups, each member might choose to investigate one type of mutagen and its effects on DNA
and then share results.
3 Decide as a group exactly what information you will need to gather (develop a set of research questions)
Review how to and how you will present your results. You should include illustrations or images (correctly referenced) of
develop research
questions and the type of DNA damage caused by each mutagen. Refer to tables in the online resource to assist you with
assessing the your research. You may also wish to include information on safe exposure levels and/or levels at which the
reliability of agent becomes mutagenic.
resources in
Chapter 1 4 Some suggestions for presentation of results are: in the form of a table, as a multimedia presentation, or in
a poster. Select the presentation style that will best enable you and your group to understand and revise
mutations.
5 Find a video clip of not more than 5 minutes that shows how mutations arise. Ensure you use a reliable
source. Save the URL and record it with your results. Write a paragraph to justify the reliability of your source.
6 Pair and share with a partner and view each other’s selected video clips. Review them and rate them on a
scale of 1 to 5. You and your partner should develop criteria on which you will rate the videos.
RESULTS
1 Present your information in the format chosen by your group. Make sure all research questions are
addressed, examples are used and an illustration of the type of DNA damage is included.
2 Create a document in which you record:
A synopsis is a
short description of • the URL for your video clip
what happens in a
film. It includes the • the title of the video
most important or • a brief synopsis of the video (See margin note.)
interesting parts, to
attract a potential • a paragraph justifying the reliability of the source
target audience.
• a place for your partner to write a paragraph as a review of your video clip.
DISCUSSION
Do a peer review: evaluate the relevance and reliability of your partner’s video clip.
CONCLUSION
Write a conclusion about mutagens and how they operate.
234 MODULE SIX » GENETIC CHANGE 9780170408851
07_bio_InFocus12_2e_sb_08851_txt.indd 234 08/08/18 7:04 pm
PART B (OPTIONAL EX TENSION): WHAT INCREASES THE RATE OF MUTAGENESIS?
Numeracy
METHOD
1 Using a range of reliable sources, research whether it is the length of time that cells are exposed to
mutagens, the frequency of exposure (how often they are exposed), the intensity (dosage) of the exposure Review how to
to the mutagen, or any combination of these factors, that leads to an increase in the harmful effects of write a literature
review in
mutagens on DNA. Chapter 1
2 Write a literature review with an investigation question and three to four paragraphs summarising your
findings. Include graphs to support your viewpoint.
3 Propose a hypothesis and design a practical investigation, based on your secondary-source research, that
you could carry out to test your hypothesis.
Note: For safety reasons, it is not recommended that a practical investigation of this kind be conducted,
as the use of mutagens poses risks. If you are going to conduct a practical investigation, use common
household products that do not have highly mutagenic effects, and do so only with the approval of your
teacher once you have considered all safety aspects with them.
RESULTS
1 Your literature review, with graphs, should summarise what factors increase the rate of mutagenesis.
2 Your experiment design should be written as a procedure with the headings Aim, Hypothesis, Materials,
Risk assessment and safety, Method and Results (even though you will not have any results to record at this
stage). In the section on results, draw up a scaffold for recording your results – for example, a table with
headings and/or a graph with axes labelled.
DISCUSSION
Do a peer review of a classmate’s experiment design, and provide feedback on how they could improve their
investigation plan.
KEY CONCEPTS
● A mutation is a change in the nucleotide sequence in DNA.
● Mutations may arise spontaneously during cell division or they may be induced by mutagens.
● Physical mutagens include various types of radiation that cause DNA damage.
– UV light causes dimers (cross-linked nucleotides).
– X-rays cause chromosomal aberrations.
– Nuclear radiation causes breaks in DNA strands.
● Chemical mutagens include ingested chemicals (such as tar in tobacco smoke) and irritants or
poisons (such as benzene). Chemical mutagens may disrupt DNA by replacing bases or being
inserted between them.
● Naturally occurring mutagens include biological and non-biological naturally occurring
elements in the environment.
● Biological mutagens include some bacteria that insert plasmids into DNA and some viruses that
insert their nucleic acid sequences into DNA.
CHECK YOUR
1 Distinguish between ‘mutation’ and ‘mutagen’. UNDERSTANDING
2 Name the three types of mutagenic agents and give two examples of each.
3 Define ‘naturally occurring mutagen’ and give an example.
7.1
4 Explain how DNA replication is disrupted by:
a dimer formation
b free radical interference
c single-stranded breaks
d double-stranded breaks.
5 Discuss the importance of DNA repair enzymes during replication.
9780170408851 CHAPTER 7 » MUTATION 235
07_bio_InFocus12_2e_sb_08851_txt.indd 235 08/08/18 7:04 pm
7.2 Types of mutations
Genes owe their specificity to the order in which their base pairs are arranged (in much the same way as
words derive their meaning from a specific sequence of letters in the alphabet).
Mutation is a collective term for a change in DNA, but the different types of mutation can be
distinguished according to five criteria:
See Chapter 4 for
1 The origin (cause) of the mutation: spontaneous mutations arise randomly as a result of an error in
discussion of introns a natural process such as DNA replication in cells, whereas induced mutations arise as a result of
and exons.
an environmental agent such as a chemical or radiation, which increases the chance of nucleotide
sequences being changed.
2 The amount of genetic material changed: point mutations are changes to a single base pair of DNA and
affect only a single gene (gene mutations). In contrast, chromosomal mutations move whole blocks
of genes to different parts of a chromosome or to another chromosome entirely (Fig. 7.8). Frameshift
mutations may affect a single gene or a sequence of genes and arise as a result of a point mutation or
a chromosomal mutation (Fig. 7.11, page 239).
3 The effect of the mutation on DNA: a nucleotide base may
Chromosomal
mutation
be substituted, inserted or deleted. This in turn may lead
to a change in one amino acid (or no change in amino
Point mutation acids if the new base forms a triplet that codes for the
same amino acid as the original codon).
4 The effect of the mutation on phenotype: there may be no
change in the phenotype (silent mutation), or a small or
large change (or variation) in the phenotype, depending
Single gene mutations are Chromosome structure mutations on the type of amino acid substituted. If a phenotypic
the result of a change to are the result of alterations to
a single DNA nucleotide. the structure of one or change occurs, this is most often harmful, but it may
more whole chromosomes. sometimes be neutral or, very rarely, beneficial in its effect
on the individual and its chances of survival.
FIGURE 7.8 Mutations range in size from single gene mutations to Mutations that occur in genes that code for proteins are
chromosomal mutations.
usually extremely severe, with many being potentially lethal
for the organism that bears them.
5 Heritability of mutations: the possibility that a mutation will be passed down through generations
depends on whether the mutation occurs in a non-reproductive (somatic) cell or a reproductive
(germline) cell. Mutations that occur in non-coding DNA may or may not have severe effects,
depending on whether the DNA sequence is involved in gene regulation.
Point mutation
A point mutation is a single nucleotide variation. Although small, these mutations can have a significant
effect on phenotype if they occur within the exon of a gene, or in an intron where they affect gene
expression.
GIF animation
of a substitute
mutation
Effects of point mutations on DNA
Watch the animation, Point mutations may be named according to how they change the nucleotide sequence of DNA. This in
take notes and
draw diagrams to turn affects the expression of the mutated genes. Most point mutations result in a base substitution, but
consolidate your
understanding.
some result in a frameshift mutation. (See next section.)
A base substitution occurs when one nucleotide base is replaced by a different base – for example,
C is replaced by T, G or A (Fig. 7.9). This may result in a different amino acid being inserted into the
polypeptide.
236 MODULE SIX » GENETIC CHANGE 9780170408851
07_bio_InFocus12_2e_sb_08851_txt.indd 236 08/08/18 7:04 pm
As an analogy, think of the bases on DNA as being a
media/point_mutation.png)
Adapted from Rosalind (http://rosalind.info/
like letters in words. If the word TAG becomes GAG,
A AC C C T A C A C
changing this word in a sentence will give the sentence a C
T T G G G A T G G T G
different meaning. In the same way, changing an amino
acid in a protein can change the function of the protein.
An example of a point mutation is the sickle cell gene Point
mutation
point mutation that occurs in human red blood cells,
resulting in the disease sickle cell anaemia. The triplet
C
CTC is changed to CAC (and the complementary strand A AC C T T A C C A
T T G G A A T G G T G
changes from GAG to GTG). In terms of its phenotypic
effect, it is termed a ‘missense mutation’. The base
substitution causes the amino acid glutamate to be b
swapped for valine, alters the shape of the haemoglobin
AGG GCA ACG UAC ACU CA... Normal mRNA code
molecule and results in the sickle cell shape of the red
blood cells. (See Fig. 7.10b for a visual representation of a Arg Ala Thr Tyr Thr Amino acid sequence
with normal translation
missense mutation.)
A GGG CAA CGU ACA CUC A... 1 1 Frameshift mutation
Frameshift mutation Gly Gln Gly Thr Leu Different amino acid sequence
AG GGC AAC GUA CAC UCA
A point mutation that involves the insertion or deletion of 2 1 Frameshift mutation
a single nucleotide pair can lead to a frameshift mutation Gly Asn Val His Ser Different amino acid sequence
(Fig. 7.9). This is where the insertion or deletion of one
base shifts the entire ‘reading frame’ of RNA, leading to FIGURE 7.9 a Point mutation due to a base substitution in DNA, showing
the creation of a whole sequence of incorrect amino acids replacement of CG pair with TA; b frameshift mutation (shift in reading
frame highlighted in pink)
and the production of a non-functional protein. Because
mRNA bases are read in threes (triplets of bases called codons), when a base pair is added or removed
from DNA, it shifts the reading frame and every triplet beyond that point will be different (Fig. 7.10d and e).
As an analogy, think of triplets in mRNA as being like three-letter words in a sentence. A base insertion
into ‘THE DOG SAW THE CAT’ leads to ‘TTH EDO GSA WTH ECA T’.
Frameshift mutations may arise not only from point mutations, but also when more than one base is
inserted – see insertions and deletions, in the next section – particularly if the bases inserted are not in
multiples of three, as this will shift the reading frame (Fig. 7.10d and e).
Changes in proteins (phenotype) due to point mutations
Mutations may also be classified according to their effect on proteins and/or phenotype.
◗ Nonsense mutations (Fig. 7.10a) change an amino acid to a stop codon. This has a very noticeable
effect on a protein, as it cuts it short. The resulting protein is usually non-functional and this has a
major phenotypic effect.
◗ Missense mutations (Fig. 7.10b) are point mutations that result in an amino acid change. The
functionality of the resulting protein is determined by whether or not the replacement amino acid is
the same type as the original. The sickle cell anaemia example given earlier is a missense mutation
because the protein end product is changed and is less functional (the ‘sense’ or ‘meaning’ of the
protein is changed).
◗ Silent mutations (Fig. 7.10c) are changes in the DNA sequence that do not cause a change in amino
acid, because of the redundancy of the genetic code, and therefore have no effect on proteins. For
example, GCC and GCA on mRNA both code for the amino acid valine, and so a change between
GCC and GCA in the third base of mRNA will have no effect on the amino acid sequence of a protein.
Silent mutations therefore do not have any noticeable effect on the protein (or phenotype).
◗ Neutral mutations are changes in DNA that result in an amino acid of the same type as the original,
and so the change does not significantly affect the structure of the protein.
9780170408851 CHAPTER 7 » MUTATION 237
07_bio_InFocus12_2e_sb_08851_txt.indd 237 08/08/18 7:04 pm
a
Normal Nonsense mutation
Original DNA Normal Mutated DNA mRNA translates
strand mRNA polypeptide strand mutation
A U A U
A U Phe A U
A U A U Phe
A U A U
T A Tyr T A STOP
A U T A
CODON
C G C G
G C Ala G C Short
T A T A polypeptide –
G C G C synthesis
C G Arg C G
ends too soon.
A U A U
b c
Missense mutation Silent mutation
Changed Change in sequence
Mutated mRNA amino acid Mutated mRNA gives same
DNA translates in polypeptide DNA translates amino acid in
strand mutation chain strand mutation polypeptide chain
A U A U
A U Phe A U Phe
A U G C
A U A U
T A Tyr T A Tyr
A U A U
C G C G
C G Gly G C Ala
T A T A
G C G C
C G Arg C G Arg
A U A U
d e
Frameshift insertion Frameshift deletion
Mutated mRNA Major change Mutated mRNA Major change in
DNA translates in amino DNA translates amino acid
strand mutation acid sequence strand mutation sequence
A U A U
A U Phe A U Phe
Insertion A U A U
T
T A A U
A U Ile
T A A U Leu
A U C G
C G Cys G C
G C T A His
T A G C
G C Thr C G
C G A U
Val
A U
FIGURE 7.10 Types of point mutations
Chromosomal mutations
Some mutations are larger than point mutations and involve changes to a series of bases within a
chromosome. Chromosomal mutations (sometimes referred to as chromosomal aberrations) are large-
scale changes where either the overall structure of a chromosome is changed or the entire number of
238 MODULE SIX » GENETIC CHANGE 9780170408851
07_bio_InFocus12_2e_sb_08851_txt.indd 238 08/08/18 7:04 pm
chromosomes in a cell is altered. Gene mutations, by contrast, are any changes to the DNA sequence within
one gene, ranging from point mutations to chromosomal mutations that involve insertions and deletions of a
number of bases.
Changes in chromosome structure
There are four main types of chromosomal mutation that alter the structure of chromosomes: deletions,
insertions, inversions and translocations. These are outlined below and shown in Figure 7.11.
A C D E F A B B C D E F
Deletion Duplication
Part of a chromosome An extra piece of
A C D E F is lost. chromosome is added.
B 1 A B C D E F
A B C D E F
Original chromosome Chromosome 1
A B C D L
A piece of A piece of chromosome 1 J K
A E D C B F
chromosome drops breaks off and joins G H I E F
out, rotates 1808 chromosome 2. A piece Chromosome 2
and is rejoined. of chromosome 2 breaks
A E D C B F off and joins chromosome 1.
Inversion The chromosomes are no A B C J K L
longer homologous. G H I D E F
Translocation
FIGURE 7.11 Types of chromosomal mutation (changes to structure of chromosomes)
Chromosomal deletion
A chromosomal deletion occurs when a section of DNA is removed and not replaced. This leads to a
reduction in the number of genes in a chromosome. Deletions are often the result of exposure to high
heat, viruses or radiation.
Chromosomal insertion (duplication)
Chromosomal insertion (duplication) occurs when a portion of DNA is duplicated (or doubled) and
inserted, increasing the number of genes on the chromosome. Its effect depends on the size, location
and number of repeats.
The position of the duplication in DNA (whether in an intron or an exon), as well as the number of
repeats of the sequence, determine whether the mutation has any phenotypic effect and the extent of this
effect. The size of the insertion or duplication also plays a role, determining whether the insertion affects
the individual in the same way as altering the chromosome number does. (Changes in chromosome
number are discussed later.)
Changes in the number of repeats may also determine the phenotypic effect. When a section of DNA
is copied and repeated two or more times, the extra copies of the DNA sequence may or may not have
a phenotypic effect, depending on whether the number of repeat copies is above a certain threshold
number. These types of duplications lead to variations known as copy number variations. Diseases such
as Huntington’s chorea and fragile X syndrome seem to be linked to the number of duplications within
a chromosome.
9780170408851 CHAPTER 7 » MUTATION 239
07_bio_InFocus12_2e_sb_08851_txt.indd 239 08/08/18 7:04 pm
Chromosomal inversion
A chromosomal inversion occurs when a section of DNA is removed, turned around through
180 degrees (the sequence is turned back to front or inverted) and then reinserted into the chromosome,
so that the bases are in reverse order. Inversions may range in size from a few hundred bases to five
megabases in size (1 megabase is 1 million base pairs long). One of the most commonly known diseases
that arises from an inversion mutation is haemophilia A, caused by an inversion mutation in the factor
VII gene on the X chromosome. This mutation was an example used in Chapter 5 in the discussion of
X-linked inheritance.
Chromosomal translocation
A chromosomal translocation occurs when a section of DNA is moved from one chromosome to a non-
homologous chromosome. This rearrangement may lead to gene fusion, when the translocated region
joins two normally separate genes. Some scientists think that transposable elements (transposons
or ‘jumping genes’) inserted into DNA millions of years ago may be responsible for making up a large
proportion of non-coding DNA.
Aneuploidy: changes in chromosome number
Aneuploidy occurs when one or more extra copies of an entire chromosome are made or an entire
The gaining of
one or more chromosome is missing, leading to an abnormal number of chromosomes in the cell. For example,
complete sets of the result of aneuploidy in a human cell may be 45 or 47 chromosomes instead of the normal number,
chromosomes is
termed ‘euploidy’. 46 chromosomes. Down syndrome is an example of a disorder that arises as a result of a change in
This differs from ploidy (chromosome number). The individual has an extra copy of chromosome 21. (Down syndrome is
aneuploidy.
discussed in more detail in Chapter 15.)
KEY CONCEPTS
● Mutations may be classified according to:
– the amount of DNA affected (gene mutations or chromosomal mutations)
– how they arise (spontaneous or induced mutations)
– how they change the DNA structure (point mutations, frameshift mutations, deletions,
insertions, translocations, duplications)
– how they affect DNA functioning and resulting proteins (nonsense, missense, neutral, silent)
– whether or not they can be inherited (somatic or germline mutations).
● A point mutation is a change in a single nucleotide base pair in DNA and is an example of a
small-scale gene mutation.
● A chromosomal mutation is a large-scale alteration, being a structural and/or numerical change in
the entire DNA strand. Some chromosomal mutations involve a change in chromosome number
(aneuploidy).
CHECK YOUR
UNDERSTANDING 1 Refer to Figures 7.10 and 7.11 (on pages 238 and 239) to answer the following questions.
a Describe, in your own words, the changes in DNA that occur in each type of mutation.
7.2 b Using the relevant letters of the alphabet shown in the diagrams, give a reason why each mutation has
its particular name.
c Draw a diagram similar to those in Figure 7.11 to represent a chromosomal insertion of six base pairs.
2 Draw a sequence of diagrams, using colour and showing the base pairing in part of a double-stranded
DNA molecule, to represent the following types of point mutations within a gene:
a base substitution
b frameshift mutation due to an insertion
c deletion mutation that does not lead to a frameshift mutation.
3 Outline what the effect on the protein will be for each mutation in parts a–c of Question 2.
240 MODULE SIX » GENETIC CHANGE 9780170408851
07_bio_InFocus12_2e_sb_08851_txt.indd 240 08/08/18 7:04 pm
Mutations and how they
7.3 affect organisms
A mutation is often defined in molecular terms as a change in DNA nucleotide sequence, but mutations
WS
exert their effects at cellular, individual and population levels.
At a cellular level, the type of cell affected by a mutation determines the extent of its influence. A How the term
mutation that affects a germline cell will be passed on to every cell in the offspring of the gamete, whereas ‘mutation’ was
introduced into
a somatic mutation (mutation in a non-reproductive body cell) may lead to a localised effect, such as the Biology
development of a tumour in a part of the organism, but it will not be passed on to the next generation.
Mutations within individuals differ in their phenotypic effect. To understand mutations at the level
of the individual, we need to understand how genes translate into physical, behavioural, physiological
or biochemical changes in features (Chapter 4). Some mutations lead to significant phenotypic change,
whereas others have little or no phenotypic effect, and these effects may be beneficial, harmful or neutral. Genetic
variation: the
At the population level, mutations are the direct source of all new alleles and introduce genetic outcome of
mutation
variation into a population. Mutations that are heritable can be passed on to future generations. If these Learn more by
new alleles are expressed as differences in phenotype, natural selection can act on these differences, so exploring mutations
such as those in
that undesirable mutations are removed from a population and desirable traits flourish. This in turn helps Shar-Pei dogs, red
hair, cystic fibrosis
ensure the continuity of alleles that increase the chances of survival of organisms within the population – and extra-toed cats.
this is the basis of evolution by natural selection and speciation.
Somatic and germline mutations – are all mutations inherited?
The type of cell in which a mutation occurs determines whether or not it will be inherited and, therefore,
the impact of its effect. Most mutations arise in somatic cells (non-reproductive body cells) and are not
inherited by descendants of that individual. However, some mutations occur in germline cells in the
gonads (which produce gametes – egg and sperm cells). These mutations may be inherited by successive
generations (Fig. 7.12).
Somatic mutations
Somatic mutations occur in somatic cells, often due to replication errors prior to mitosis. Spontaneous
mutations may occur in the S phase of the cell cycle (when DNA is vulnerable during replication) and, if
not repaired during ‘proofreading’ in the G2 phase, will be passed on to daughter cells. When a mutated
cell continues to divide by mitosis, the error is replicated each time and passed on to cells in successive
divisions, amplifying the error within that tissue. This may result in an observable phenotypic difference
in the tissue, such as pigmented cells in a carcinoma, a tumour or some other form of disease that is
observable in an organ. Cancer is a common result of mutation in somatic cells – skin cancer, liver cancer
and brain tumours are all examples of somatic mutations.
Somatic mutations do not always result in visible phenotypic changes in cells. Many occur as
physiological changes, such as the mutations for cystic fibrosis, thalassaemia and Tay-Sachs disease.
(Some of these diseases are discussed in more detail in Chapter 15.) The earlier in development the
mutation occurs, the greater its effect will be, as the mutation will be replicated in a greater number of
cells as the organism grows.
Germline mutations
Germline mutations (sometimes called gametic mutations) occur in the sexual reproductive cells that give
rise to gametes (germline cells) and these mutations are passed to offspring. When a gamete carrying the
mutation fuses with another gamete and an embryo forms, the mutation is replicated in every cell of the
embryo as it divides and grows, affecting all cells in the resulting child.
9780170408851 CHAPTER 7 » MUTATION 241
07_bio_InFocus12_2e_sb_08851_txt.indd 241 08/08/18 7:04 pm
FIGURE 7.12
Germline and somatic Somatic mutation Germline mutation
mutations
Mutated
sector
Mutated
Skin cells have cells Germline cell has
mutated DNA mutated DNA
No gametes Half of gametes
carry mutation carry mutation
Normal children Normal Mutated
children child
Coding and non-coding DNA
As you read in Chapter 4, some DNA codes for proteins (coding DNA) and some does not (non-coding
Review non-coding
DNA in Chapter 4. DNA). The phenotype of an individual depends on the presence of particular proteins and the activity
of those proteins. Mutations in coding genes therefore have a direct effect on these protein products.
Mutations in non-coding DNA were originally thought to have no phenotypic effect, but it has been
found that many affect gene expression, while some have no effect.
Mutations in coding DNA
Medical Images/Nucleus Medical Media
and their significance
In general, mutations in coding genes usually affect
the type or sequence of amino acids in a protein
end-product. In eukaryotes, mutations may also
affect gene splicing and in this way modify the
function or levels of the protein product. For
example, whether a mouse’s coat is white or grey
depends on the presence of proteins, including
enzymes that make the pigment. Because proteins
are the product of genes in the coding region of
DNA, if a mutation occurs in this region, it directly FIGURE 7.13 DNA repair enzymes wrap around a DNA
affects the protein and therefore the phenotype of molecule to repair it. Mutations in DNA repair enzymes
can cause cells to malfunction, become cancerous or die.
the individual.
Most DNA in prokaryotes is coding DNA;
they do not have much non-coding DNA compared with eukaryotes. Studies of coding DNA in simple
organisms such as bacteria and yeast reveal that it is, to a large extent, made of genes for DNA repair
enzymes (Fig. 7.13). Maintaining the integrity of DNA is essential for the survival of these species. Microbes
are exposed to constantly changing environments, but characteristics for DNA repair enzymes are not
tolerant of genetic variation and change. In experiments where genes in coding DNA of prokaryotes
were purposely inactivated, organisms showed an increase in the rate of mutation – both spontaneous
and induced.
242 MODULE SIX » GENETIC CHANGE 9780170408851
07_bio_InFocus12_2e_sb_08851_txt.indd 242 08/08/18 7:04 pm
Errors in the genes of eukaryotes whose products are involved in DNA repair are also serious,
as the result is a general increase in mutations arising from errors in replication. An example of a
mutation in a gene for DNA repair is a mutated gene that causes the disease Xeroderma pigmentosum.
People who suffer from this disease are extremely susceptible to cell damage if exposed to UV light,
and are a thousand times more susceptible to skin cancer than people who do not have the XP
mutation.
Mutations in tumour suppressor genes can result in cancer, as can mutations in genes that activate
proto-oncogenes (which normally promote cell division or reduce cell death).
Mutations in non-coding DNA and their significance
Mutations in the protein-coding regions of genes have commonly been associated with human genetic
disease, but for many years molecular biologists were unsure of the function of non-coding DNA. In
the 1950s, scientists discovered that some parts of non-coding DNA in eukaryotes have important
functions, despite the fact that no protein end-product is made. They discovered regulatory sequences
that promote (‘switch on’) genes or shut down (‘switch off ’) genes. Many of these parts of non-coding
DNA code for end-products other than DNA, such as rRNA and small nuclear RNA. These both have
important functions in gene expression – small nuclear RNA plays a role in determining which introns
are spliced out of DNA before it leaves the nucleus and rRNA is the machinery used by the cell for
translation. Mutations in these non-coding regions have been shown to affect gene expression and cell
functioning.
Research also showed that if segments of non-coding DNA were removed from an egg cell, it
could not develop properly. There is growing evidence that mutations in non-coding genes are
linked to developmental and congenital abnormalities (birth defects), supporting the idea that
non-coding DNA is important during embryonic development. Mutations that occur in non-coding
DNA in germline cells may lead to developmental abnormalities that cause the embryo or foetus
to be aborted or, if less severe, may lead to congenital abnormalities. For example, an isolated
(non-syndrome) congenital heart defect results from a mutation of the TBX5 enhancer gene in a
non-coding area of DNA.
Studies involving genetic markers show that mutations in non-coding DNA have also been associated
with a predisposition to specific diseases in adults. Mutations in the regulatory part of DNA, such as
enhancer sequences, have been shown to genetically predispose people to non-infectious disease such as
heart disease, diabetes, cancer and obesity, among other disorders. Some mutations in non-coding DNA
are even associated with a predisposition to infectious disease such as hepatitis C. Scientists suggest that
mutations in gene-regulatory DNA sequences may disrupt gene expression, leading to abnormalities in
phenotype.
Evolutionists have suggested that non-coding DNA may hold an evolutionary advantage for the
organisms in which it occurs. It may act as a buffer area dividing one gene from the next, so that if a
frameshift mutation arises, the introns (gaps) will minimise the changes caused by the mutation. It may
also play a role in giving some leeway when genes break during crossing over, so the recombination does
not have to have pinpoint accuracy.
Junk DNA
Parts of non-coding DNA that seemed to have neither a protein-coding nor a regulatory function were
given the name ‘junk DNA’ in 1972 by scientist Susumu Ohno. This term does not include regulating
sequences in non-coding DNA (promoters, silencers and enhancers). Molecular biologists have also
excluded from the ‘junk DNA’ category other non-coding DNA where specific functions have been More information
on non-coding
identified ( for example, DNA associated with the formation of centromeres and telomeres). DNA is provided
Only DNA that is highly repetitive is accepted by some molecular biologists as being of unknown in Chapter 4,
page 124.
function and termed ‘junk DNA’, because its nature and function remain a mystery.
9780170408851 CHAPTER 7 » MUTATION 243
07_bio_InFocus12_2e_sb_08851_txt.indd 243 08/08/18 7:04 pm
This portion of non-coding DNA contains hundreds and thousands of repeats of DNA sequences that
WS are just a few hundred base pairs long. The origins of these repeat sequences are believed to be viruses that
inserted copies of a segment of their genetic material into a host cell’s DNA. Inserted DNA elements are
The biochemical
nature of called ‘transposable’ elements and may be transposons (transposed DNA) or retrotransposons (inserted
mutations
viral RNA that has been reverse-transcribed back into DNA). Transposons and retrotransposons are
considered mutations if they occur near genes or in their promoter regions, where they change gene
expression or functioning.
The large numbers of repeat DNA sequences are believed to have arisen when these elements made
numerous copies of themselves within the DNA of the cell. Some geneticists call these repeats ‘selfish
DNA’, as it uses host cell material and gives nothing back. This raises the question of why they have not
been removed from the genome if they serve no function. Some scientists argue that, from an evolutionary
perspective, transposable elements introduce variation and keep the genome diverse, providing increased
opportunity for adaptation by natural selection. The debate among scientists continues.
INVESTIGATION 7.2
Analysing data to investigate mutations in coding
and non-coding DNA
Current projects like ENCODE and the Epigenomics Roadmap are researching the 98% of the genome that
comprises non-coding DNA, to determine whether it is as essential to gene function as coding regions.
In this investigation, you will investigate the relationship (if any) between quantity of DNA and how
complex an organism is, and you will analyse data to assess the significance of ‘coding’ and ‘non-coding’ DNA
segments of DNA in the process of mutation.
Information and
communication PART A
technology
capability
Early geneticists thought that the amount of DNA in the genome of an organism would be an indication of its complexity.
METHOD
Numeracy
Investigate the validity of the hypothesis DNA transposons
Alglascock/Creative Commons CC BY SA 3.0 (https://commons.
wikimedia.org/wiki/File:Components_of_the_Human_Genome.jpg)
proposed: that the amount of DNA in a 3% LTR retro-transposons
Critical and 8%
creative
genome correlates with the complexity Simple sequence
thinking of the organism. Find data in the form of repeats
tables and graphs to support your answer. 3%
Write a conclusion for your findings and Segmental SINEs 13%
write a discussion paragraph, explaining duplications
the science behind your conclusion. 5%
RESULTS LINEs 20%
1 Write a conclusion about the validity of Misc. unique
the hypothesis. Misc. sequences
heterochromatin 12%
2 Provide evidence to support your 8% Introns 26%
conclusion (text, tables and graphs).
Protein-coding
PART B genes 2%
LTR = long terminal repeat
METHOD SINEs and LINEs are types of retrotransposons.
Heterochromatin is known to play a role in gene expression.
1 Analyse the pie graph in Figure 7.14
and answer the questions that follow. FIGURE 7.14 Components of the human genome
244 MODULE SIX » GENETIC CHANGE 9780170408851
07_bio_InFocus12_2e_sb_08851_txt.indd 244 08/08/18 7:04 pm
2 What proportion of the human genome is made up of:
a protein-coding genes
b non-protein-coding genes
c transposable elements
d retrotransposons
e unique sequences with no known function
f duplications and repeats?
3 From the pie chart, calculate the proportion of non-coding DNA that you would consider to:
a be junk DNA. Justify your answer.
b play a role in gene expression.
4 Write a research-based answer to the syllabus outcome: Assess the significance of ‘coding’ and ‘non-coding’
DNA segments in the process of mutation. Your answer should be approximately 200–300 words.
Before tackling this question, use information from this section of the textbook, as well as from your
answers to Questions 1 and 2, to write some research questions that outline the information you need to
find out. Use secondary sources to gather information to address your research questions.
DISCUSSION AND CONCLUSION
Use information from both your research and from the graph in Figure 7.14 to support your answer to the
inquiry question at the start of this chapter: How does mutation introduce new alleles into a population?
Investigating causes of genetic variation: fertilisation,
meiosis and mutation
Mechanisms of sexual reproduction such as gamete formation (meiosis) and fertilisation increase
gene recombination and therefore variation in individuals (new gene combinations) and variability
in a population (the amount by which individuals in a population vary from each other genetically).
Evolutionary studies show that greater variability improves the ability of a population to adapt to changes
in the environment, resulting in an increased chance of survival. If there is little or no variability within a
population, the result is a static or unchanging population that is less likely to be able to adapt to sudden
changes in the environment, and more likely to be wiped out.
As a very simple example to illustrate variability in a population, consider humans. One parent may
have blue eyes and fair hair, the other dark eyes and dark hair. If the traits for hair colour and eye colour
assort independently of each other – that is, they occur on separate chromosomes – their gametes may
combine to produce offspring that have blue eyes and dark hair, or brown eyes and fair hair. In these
cases, the offspring have a different combination of genes than their parents, increasing variability.
Variability in a population may be further increased if there are a greater number of alleles present for
each gene. If, within the human population under discussion, there are also individuals with red hair and
green eyes, there is greater variability and an even greater opportunity for more gene combinations to
arise in gametes produced by individuals.
Therefore variability may be increased as a result of:
◗ recombination of genetic material
◗ an increased number of alleles for a particular gene.
Mutation plays a part in increasing the number of alleles for a trait, whereas meiosis and fertilisation
(gamete formation and gamete fusion) play a significant role in recombining genetic material.
Remember, although the basis of inherited variation is mutation, not all variation – and therefore
variability – is genetic in origin. The effect of the environment on variation (phenotype) of organisms was
discussed in Chapter 4.
9780170408851 CHAPTER 7 » MUTATION 245
07_bio_InFocus12_2e_sb_08851_txt.indd 245 08/08/18 7:04 pm
Meiosis and genetic variation
When gametes form, crossing over and random segregation in meiosis result in genetic recombination
of paternal and maternal genes within each gamete. When two different gametes unite during sexual
reproduction (fertilisation), a further mixing of genetic material occurs and this results in offspring with
many new combinations of genes. The importance of this variability is described below.
Variation during meiosis and gamete formation may also be caused by mutations – either during
replication of DNA (leading to replication errors) or during the separation (disjunction) of chromosomes
(leading to chromosomal mutations). Replication errors in meiosis may arise in a similar manner to
those in mitosis, commonly leading to point mutations. Chromosomal mutations may arise due to errors
in crossing over or non-disjunction of chromosomes or chromatids during anaphase I or II.
Chromosomal errors
When crossing over goes wrong, chromosomal aberrations may be introduced. For example:
◗ the DNA to be exchanged during synapsis may be inverted before it is inserted onto the arm of a
corresponding chromatid
◗ a chromosome may break and, if this is followed by a duplication of the chromosome, the two
chromatids that fuse may now have two centromeres. When they pull apart in anaphase, one
chromatid will have a duplication and one will have a deletion.
These chromosomal changes may be brought about by exposure to mutagens during meiosis.
Remember that gametes may remain in meiosis I for a prolonged period of time in females (many years,
because the gametes are formed in embryonic life) and so exposure of female ovaries to mutagens at
any stage during reproductive life may be detrimental. This is why females are given an X-ray-deflecting
apron to wear when having X-rays.
Changes in chromosomal numbers (non-disjunction)
What happens
when mitosis
When one or more pairs of homologous chromosomes or sister chromatids do not separate as they should
goes wrong? during nuclear division, an abnormal distribution of daughter chromosomes in the resulting daughter
Changes in
chromosome number
cells occurs, and this may lead to a change in chromosome number (Fig. 7.15). An example of this is
and structure, mitotic Down syndrome, caused by an extra copy of chromosome 21. The age of the parents, as well as some
errors and cancer.
environmental factors, may increase the risk of errors in meiosis leading to chromosomal mutations.
FIGURE 7.15 Non-
disjunction of
chromosomes during
meiosis Parent cell
Meiosis I
Homologous
chromosomes
fail to segregate
Meiosis II
Gametes Gametes
246 MODULE SIX » GENETIC CHANGE 9780170408851
07_bio_InFocus12_2e_sb_08851_txt.indd 246 08/08/18 7:04 pm
INVESTIGATION 7.3
A secondary-source investigation of the causes of mutation
related to meiosis and fertilisation
See Chapter 15
In non-disjunction, a pair of chromosomes fails to segregate during meiosis. Therefore one resulting cell for examples of
(gamete) may inherit the pair of chromosomes, while the other inherits neither chromosome from that disorders arising
bivalent. Each of the resulting gametes will have an incorrect chromosome number. as a result of
non-disjunction.
METHOD
Use a range of secondary sources to investigate the effect of the age of parents (mother and/or father) and
the impact of one environmental factor (such as alcohol or smoking) on the rate of mutation during gamete
Numeracy
formation and fertilisation.
Support your findings with quantitative data.
RESULTS
Present your information in the form of a brochure to educate the public.
CONCLUSION
Write a statement on your brochure, beneath the data, summarising your findings.
KEY CONCEPTS
● Mutations cause diversity in populations by introducing genetic variation.
● In multicellular organisms, mutations can be classified according to the type of cell in which
they occur.
– Somatic mutations arise in a single body cell and cannot be inherited. They affect only
patches of tissue derived from the mutated cell and are more severe if they occur early in
development.
– Germline mutations arise in gametes and can be inherited, affecting all cells in the
individual that the gamete gives rise to.
● Variation is introduced during meiosis when genetic recombination occurs during crossing over
and random segregation.
● When two different gametes fuse during fertilisation, a further mixing of genetic material
results in offspring with many new combinations of genes.
● Another cause of variation during meiosis and gamete formation may be mutations arising
during replication of DNA or during the separation (disjunction) of chromosomes.
● Mutations and sexual reproduction are the reason that organisms are not genetically identical,
even if they have the same ancestors.
CHECK YOUR
1 Define ‘mutation’, ‘variation’ and ‘variability’. UNDERSTANDING
2 Compare germline mutations and somatic mutations.
3 Distinguish between coding and non-coding DNA. 7.3
4 What is the function of coding DNA?
5 List three known functions of non-coding DNA.
6 Outline the effects of mutations that occur in coding DNA and explain how these are different from the
effects of mutations that occur in non-coding DNA.
7 Give one example of a disease that arises as a result of non-disjunction of chromosomes in meiosis.
8 Compare how chromosomal aberrations and changes in chromosome numbers arise during meiosis.
9 Explain three ways in which genetic variation may be introduced during meiosis and fertilisation.
9780170408851 CHAPTER 7 » MUTATION 247
07_bio_InFocus12_2e_sb_08851_txt.indd 247 08/08/18 7:04 pm
Population genetics – mutation,
7.4 gene flow and genetic drift
The genetic diversity in plant and animal populations today is the result of global spread and each
population adapting to its local environment. New alleles may be introduced into a population by
mutation, or through the movement of individuals between populations (emigration and immigration).
Genetic diversity is the result of a large number of variants (different alleles) that may be present for each
gene and a large number of genes that may be present for each trait (polygenic traits).
For example, in the human population, the gene for height is not like Mendel’s pea plants where there
are only two alleles – tall or short. In humans, height is a polygenic trait and each gene for the trait has
two or more alleles. As a result, there are a large number of variants – one polygenic trait (height) has
many possible genotypes and phenotypes.
In a graph showing the height of individuals against how many in the population have each height
( frequency of phenotype), the curve has a continuous distribution. If you measure the height of all
students in your class and calculate an average, you will find that many students are a little taller or
shorter than the average, with a few students much taller or much shorter if the sample size of your
class is large enough. On a graph, this distribution appears as a bell-shaped curve, termed a ‘normal
distribution curve’, typical of polygenic traits (Fig. 7.16).
As you know, one of the main sources of genetic variations is mutation. This affects phenotype,
the basis for natural selection. The graph in Figure 7.17 shows the effect of mutations on the fitness of
individuals in a population. Very few mutations overall are advantageous and selected to increase in
frequency. Detrimental or deleterious mutations (highest frequency) are eliminated, neutral mutations
remain and those few that are beneficial are selected. Neutral mutations that are maintained in the
population can be considered an evolutionary ‘back-up’ – they provide variations that have no immediate
effect, but may provide an advantage in the future if the environment changes suddenly.
Phytopathology, Federal Institute of Technology, Zurich, Switzerland,
PHI-A-2004-0524-01. Copyright © The American Phytopathological Society.
Reproduced, by permission, from Institute of Plant Sciences/
McDonald, B. A. 2004. Population Genetics of Plant Pathogens: Natural
Selection in Plant Pathosystems. The Plant Health Instructor. doi:10.1094/
Most mutations have a negative effect on fitness and
are quickly eliminated
Frequency of mutated allele
But mutations that do not affect
fitness can persist in populations
Neutral and
Frequency of phenotype
Lethal
nearly neutral
mutations
mutations Advantageous
mutations
Phenotype (height) 0 W
Relative evolutionary fitness
FIGURE 7.16 The distribution of FIGURE 7.17 A hypothetical distribution curve showing the relationship between new
phenotypes that would be expected for mutant alleles and natural selection. Relative evolutionary fitness is a measure of the
a polygenic trait such as height, where survival and/or reproductive rate of a genotype or phenotype. W is the average range of
many genes contribute to the trait fitness for an allele in the population.
Population genetics and factors causing changes in allele frequency
Population genetics is the study of how a population changes over time, leading to species evolving.
Population genetics involves quantitative study (looking at quantitative data – numbers) in which
248 MODULE SIX » GENETIC CHANGE 9780170408851
07_bio_InFocus12_2e_sb_08851_txt.indd 248 08/08/18 7:04 pm
scientists analyse the distribution of genetic variation in a population. To do this, population geneticists
A population
study factors that cause increases or decreases in allele frequency within a population. is a group of
Natural selection is not the only factor that causes changes in the distribution of genetic variation in individuals of a
species that live
a population, resulting in it changing over time. Sometimes individuals in a population are not selected in a common
by natural selection, but instead survive and reproduce by chance. For example, a natural disaster may area and are
interbreeding.
strike in a particular place and wipe out some organisms, while others have a lucky escape. The allele Allele frequency
frequency of the survivors will increase as they reproduce. This change in allele frequency due to chance is a measure of
how often an
is known as genetic drift. Another way in which allele frequency may change is due to new individuals allele occurs in a
entering a population, or existing individuals leaving (gene flow). population.
Sometimes an allele may become ‘fixed’ in a population. This means that it becomes the only
remaining allele in that population, having outcompeted all other less successful alleles. This is very
unusual, because most variants or alleles only give a small benefit or no benefit at all.
Therefore, although the likelihood that a variation (mutation) will be passed on to subsequent Gene flow and
generations is often due to choice (natural selection), it may also be a result of chance (genetic drift) or genetic drift – a
simulation
immigration and emigration (gene flow). Work through
the simulation
to increase your
Scientists who paved the way for population genetics understanding of
gene flow.
To study population genetics, you need to use your knowledge and understanding of the laws of genetic
inheritance to predict how the genetic composition of a population will change when subjected to
evolutionary selective pressures.
Progress in the field of population genetics depends on the work of many scientists. Mendel and
Darwin paved the way, and other biologists have worked on developing mathematical models that can
be used to make predictions for current populations. These mathematical models take Mendel’s and
Darwin’s findings into account.
◗ Mendel’s findings:
– Each parent donates one allele for every gene to their offspring; therefore, offspring have two
alleles for every gene.
– Some alleles are dominant and expressed, whether they are present in a single copy or two copies
in an individual.
– Other alleles are recessive and only expressed when they are not paired with a dominant gene.
◗ Darwin’s findings:
– Natural selection is the primary driving force for evolution; if a gene confers an advantage, it is
more likely to be passed on to the next generation.
Factors that cause changes in allele frequency within a population
1 Selective pressure causes changes in allele frequency due to variations – alleles that make individuals
well suited to the environment increase.
2 Sexual selection (or non-random mating) changes allele frequency because mating is not random; the
most successful maters’ genes remain in the gene pool.
3 Mutation leads to the formation of new alleles, due to changes or ‘errors’ in DNA that arise during
gametogenesis (meiosis). During fertilisation, ‘good’ (useful) and/or ‘bad’ (deleterious) errors are
passed on to the next generation.
4 Genetic drift causes changes in allele frequency due to random chance. This causes individuals to be
different, not necessarily more successful. Genetic drift may occur as a result of a natural disaster
(bottleneck effect) or due to a few individuals in a population (founding individuals) becoming
geographically isolated from the original population (founder effect). The remaining individuals may
not be an accurate representation of the allele distribution and genotype frequencies of the original
population. The change in allele frequency due to genetic drift is greater if the population is small.
9780170408851 CHAPTER 7 » MUTATION 249
07_bio_InFocus12_2e_sb_08851_txt.indd 249 08/08/18 7:04 pm
5 Gene flow changes allele frequency due to mixing of new individuals in a population. As a result,
different alleles find their way into the population (for example, through immigration) and these
genes spread. Alleles may be lost from the population through emigration. This effect is also more
Virtual biology
lab noticeable in smaller populations.
Population genetics
simulations Today, technology and genetic testing, together with an understanding of heredity, allow us to study
populations over several generations and observe evolution happening (rather than having to observe
them over millions of years). Population geneticists are able to use this data to describe how genetics and
evolution influence each other, using mathematical models they have created.
Although all humans are genetically very similar, no humans (other than identical twins at birth)
are genetically identical. In terms of DNA sequences, all humans are 99.9% similar to each other in
genetic composition. Our differences are an indication of our genetic variation. We share 99% of
our genes with chimpanzees and 60% with chickens. However, even a 0.1% difference in the DNA of
individual people still amounts to hundreds of thousands of base pairs. The human genome consists
of approximately 3 × 109 (3 billion) base pairs, of which 6 × 106 (6 million) are different. As you learned
in the previous chapter, analysis of SNPs (single nucleotide polymorphisms) may be used, rather than
looking at actual DNA base sequences, to take into account these differences in human DNA. SNP
studies are important in enabling scientists to search for variations in DNA associated with particular
human traits, including susceptibility to disease and response to certain medical drugs, which in turn
may affect their treatment.
We know that genetic stability occurs if all individuals have the same reproductive capacity and fitness.
Any change that causes some individuals to produce more offspring than others, such as an increase in
an individual’s ability to survive, mate and reproduce, will result in a change in allele frequencies. In a
similar way, if an allele makes an individual more vulnerable to disease or predation, it is likely to decrease
in frequency, until it is either very rare or eliminated from the population.
All of this must be taken into account when developing models to predict changes that may occur in
allele frequency in populations and identify causes of these changes.
INVESTIGATION 7.4
Secondary-source investigation to evaluate the effect of mutation,
gene flow and genetic drift on the gene pool of populations
BACKGROUND
Some diseases that have arisen as a result of mutation occur in different frequencies in the gene pools of
various populations in the world today. Exploring the reasons for the changes in the frequency of these
diseases is interesting. For some diseases, the effects of the mutation may be twofold – detrimental in one
respect, but conferring an advantage to certain populations in another. The frequency of some diseases is not
affected by geographical distribution, but may be affected by the age of individuals within the population.
Alleles of other diseases are not reduced because their disadvantageous symptoms only appear once an
individual is past reproductive age.
In this investigation, you will look at the average frequency of a given disease in the human race and
compare this with the frequency in different population groups, investigating a possible cause for this change
in frequency. At the end of the investigation, you will evaluate the effect of mutation, gene flow and genetic
drift on the gene pool of these populations.
The parts of this investigation differ in complexity. All students should be able to complete parts A and B.
Part C is for advanced students or those who wish to extend their knowledge further.
250 MODULE SIX » GENETIC CHANGE 9780170408851
07_bio_InFocus12_2e_sb_08851_txt.indd 250 08/08/18 7:04 pm
Part A (Basic investigation – all students)
AIM
To investigate the impact of mutation, genetic drift, gene flow and natural selection on a hypothetical
population of stickleback fish
METHOD
Work through the interactive video simulation on the weblink and identify, in the evolution story of these Population
sticklebacks, when and how genetic drift, gene flow and natural selection occurred. genetics –
sticklebacks
RESULTS
Write a hypothesis, method and results for the experiment described in the simulation. Copy and paste the
graph showing % frequency of sticklebacks over time. Calculate the percentage change in frequency of the
Numeracy
two genotypes of sticklebacks within the population in 1983, 1993 and 2003.
CONCLUSION
1 Write a statement summarising the findings of the experiment.
2 Evaluate the effect of mutation, gene flow and genetic drift on the gene pool of the stickleback population.
Part B (Intermediate level)
AIMS
To carry out a case study of a genetic disease caused by different types of mutations and investigate:
1 the cause of the genetic variation (mutation, mutagen, process – meiosis/fertilisation)
2 the frequency of the disease in populations around the world
3 the effect of gene flow and genetic drift on the distribution of the disease
4 the correlation (if any), in big data sets, between the incidence of the disease and the number of Internet
Information and
searches for information about the disease, around the world communication
technology
METHOD capability
1 Conduct a case study of three diseases, each caused by one of the following types of mutation:
A point mutation – for example, sickle cell anaemia
B chromosomal mutation – for example, Huntington’s chorea or fragile X syndrome
C change in chromosome number – for example, Down syndrome.
2 Recommended procedure: work in general groups of six, carrying out a jigsaw activity, two researching
disease A, two researching B and two researching C. Genetic
diseases
These expert pairs from each general group may join up to form an expert group to investigate the disease
Sickle cell anaemia
they have been allocated. Each expert pair will report back to their original general group. Huntington’s
3 In expert groups or pairs, begin your research using the weblinks provided and then go on to use a variety chorea
Down syndrome
of sources. Research the information required for your particular case study, to meet the requirements
Fragile X syndrome
outlined in the Results section.
4 The general group re-forms, with all six students coming together to collate their information on the three
different types of disease, reading each other’s information and answering the three to five questions
posed by each expert pair. (See Results.)
Refer back to
RESULTS your findings in
Investigation 7.1
Present your results (in a collaborative way, such as Google Docs), including the following information and data to help you with
for each disease that has been investigated: point 3 of the
results.
1 Type of mutation (and draw a diagram to illustrate)
2 Number of variants (one or more mutations) responsible for causing the disease in populations
3 Possible mutagens (and reasons why you think these may be the cause of the mutation)
9780170408851 CHAPTER 7 » MUTATION 251
07_bio_InFocus12_2e_sb_08851_txt.indd 251 08/08/18 7:04 pm
4 Process by which the mutation arose – when, how and where. For example:
• when – during replication/in mitosis/non-disjunction in meiosis, and so on
• how – describe the process
• where – whether you think this occurred in a germline or somatic cell mutation (and reasons for your choice).
5 Average frequency of the disease in all humans in the world, compared with frequencies in different
populations on continents/in countries around the globe. Include a map to illustrate the frequency of the
disease in different parts of the world, as well as a graph showing relevant data. Investigate possible reasons
for this distribution (include the impacts of gene flow, genetic drift and natural selection).
Information and
communication 6 Use the ‘Google explore data’ weblink and prevalence data to find out whether there is a correlation
technology
capability
between the number of Google searches for this type of information and the part of the world where
alleles for the disease occur in the highest frequency (that is, where the disease is most prevalent). Write a
paragraph to outline your findings. Use data to justify your conclusion.
CONCLUSION
Google explore
data Evaluate the effect of mutation, gene flow and genetic drift on the gene pool of the population with the
Do a correlation study highest incidence of this disease.
of the number of
Google searches for DISCUSSION
this type of information
and compare it with Write 3–5 questions based on your findings, for your peers to answer. Each question should be of a different
your findings on
frequency of disease in level of complexity, ranging from 1–5 on a scale, where:
Question 5. 1 = Recall of a small amount of knowledge and understanding is required to answer the question.
5 = A large amount of knowledge and understanding is required, and skills in analysing and synthesising
information are necessary to answer the question.
WS
Part C (Intermediate/Advanced – extension)
Read the information about the Hardy-Weinberg principle and work through the simulations on the weblinks
Introducing the that follow.
Hardy-Weinberg The Hardy–Weinberg principle (also known as the Hardy-Weinberg equilibrium) is based on the idea
equation
that the frequency of alleles in a population remains constant from one generation to the next if none of the
evolutionary influences (such as mutation, sexual selection, genetic drift or gene flow) are acting. That is, it
assumes that a population is in a hypothetical state of equilibrium.
G.H. Hardy and William Weinberg introduced their mathematical model in 1908 and developed an
equation that shows how Mendelian genetics work at the level of the whole population and gives the
Basic/ expected frequency of different alleles in a hypothetical population that is not evolving.
intermediate/
advanced: It makes certain assumptions about the hypothetical population:
Population
genetics • alleles are equally beneficial (no natural selection)
Use different • mating is completely random (no sexual selection)
models to explore
evolutionary • no random modification of the gene pool occurs (no mutation)
influences on the
frequency of alleles • the population is large (no effect from genetic drift)
and genotypes in
virtual populations. • no immigration or emigration occurs (no gene flow).
The Hardy-Weinberg principle enables scientists to find a relationship between the phenotype and
the actual frequency of the genes in a population. If we know the frequency of homozygous recessive
individuals in a population (for example, the percentage of the population that is ww), we can conclude that
the remaining individuals must be either WW or Ww. We can then use simple mathematics to work out what
proportion of the remaining population is WW and what proportion is Ww.
We can then look at actual allele frequencies and try to find reasons for the difference between this and the
expected ratios.
The change in allele frequencies in a gene pool of a population over generations is known as
microevolution. Populations may undergo microevolutionary change and still interbreed, but at times isolation
Intermediate/ occurs and this may lead to the development of new species (speciation). This means that if the original
advanced
extension:
populations were brought together again, they would have enough variation that they could no longer
Deriving the interbreed, indicating that, over many generations, microevolutionary changes can lead to new species.
Hardy-Weinberg Therefore the Hardy-Weinberg equation can be a useful way to describe the degree of microevolution that is
equation
taking place over successive generations.
252 MODULE SIX » GENETIC CHANGE 9780170408851
07_bio_InFocus12_2e_sb_08851_txt.indd 252 08/08/18 7:04 pm
KEY CONCEPTS
CHANGE IN ALLELES
FACTOR WHAT IS IT IS DUE TO … EFFECT ON THE NEXT GENERATION
Selective pressure The main selective pressure is variations that are passed Alleles that make individuals ‘fitter’
natural selection (Darwin) on because they make – more likely to survive and live to
individuals more likely to reproductive age – become most
survive (and more virile) frequent
Sexual selection Certain individuals are more non-random mating Alleles of individuals who are most
attractive to mates and therefore (mating is not random; successful at mating are more
more likely to breed some individuals mate common in the gene pool
more than others)
Mutation New genes arise due to ‘errors’ in new alleles arising New alleles that are beneficial
DNA replication during meiosis during gametogenesis become more frequent in the
(gametogenesis); they may be being introduced into a population
beneficial, neutral or harmful population
Genetic drift Random events (e.g. a tornado) random chance (non- Causes individuals within a
(more obvious in lead to a change in gene selective; does not depend population to be different (not
smaller populations) frequency because some on genetic make-up) necessarily more successful) due to
individuals are wiped out random chance
Gene flow Individuals with different genes mixing with new Allele frequency in the population
(more obvious in come into a population and genetically different changes
smaller populations) spread their alleles individuals (e.g.
immigration, emigration)
CHECK YOUR
1 Match the following terms with the statements below. UNDERSTANDING
genetic drift, gene pool, genome, gene flow
a Individuals survive and reproduce due to chance, resulting in a change in allele frequency. 7.4
b New individuals enter or leave a population.
c The range of genes and all their alleles in a population.
d All the genetic material in an individual or in a cell.
2 Explain the role of selective pressure in microevolution.
3 How do sexual selection, genetic drift and gene flow affect allele frequencies within a population?
4 Explain why genetic drift and gene flow show a greater effect on allele frequencies in smaller populations.
9780170408851 CHAPTER 7 » MUTATION 253
07_bio_InFocus12_2e_sb_08851_txt.indd 253 08/08/18 7:04 pm
7 CHAPTER SUMMARY
Mutation: What is a mutation?
DNA CHANGE
At the molecular level
a
A change in nucleotide sequence Types of point Normal Nonsense mutation
mutations Original DNA Normal Mutated DNA mRNA translates
• point mutation strand mRNA polypeptide strand mutation
• Nonsense A U A U
Phe A
• Missense A
A
U
U A
U
U Phe
Point mutation • Silent A U A U
T A Tyr T A STOP
A U T A
• Frameshift C G C G
CODON
insertion G
T
C
A
Ala G
T
C
A
Short
polypeptide –
• Frameshift G
C
C
G Arg
G
C
C
G
synthesis
ends too soon.
deletion A U A U
At the chromosomal level
(change in chromosome structure/number) A B B C D E
A C D E F F
• Chromosomal Deletion Duplication
Chromosomal
mutation mutations
Part of a chromosome An extra piece of
• insertion A C D E F is lost. chromosome is added.
B 1 A B C D E F
• deletion
• inversion
A B C D E F
• duplication Original chromosome Chromosome 1
Chromosome structure mutations A B C L
D J K
are the result of alterations to A E D C B F A piece of A piece of chromosome 1
the structure of one or chromosome drops breaks off and joins G H I E F
more whole chromosomes. out, rotates 1808 chromosome 2. A piece Chromosome 2
and is rejoined. of chromosome 2 breaks
A E D C B F off and joins chromosome 1.
Inversion The chromosomes are no A B C J K L
longer homologous. G H I D E F
Translocation
At the cellular level At organism level
Somatic mutation Germline mutation
Mutated
sector
Mutated
Skin cells have cells Germline cell has
mutated DNA mutated DNA
No gametes Half of gametes
carry mutation carry mutation
Normal children Normal Mutated
children child
254 MODULE SIX » GENETIC CHANGE 9780170408851
07_bio_InFocus12_2e_sb_08851_txt.indd 254 08/08/18 7:05 pm
HOW ARE NEW ALLELES INTRODUCED?
Mutagens Mutation and genetic variation
• Physical e.g. EM radiation Physical
• Chemical e.g. tobacco smoke Mutagen Mutation change new allele
in DNA
• Naturally occurring e.g. viruses
Ultraviolet
Cellular UV light Ionising Chemical Replication light
metabolism exposure radiation exposure errors
Thymine dimer
DNA damage
T T
C A G G
G A
T
G T A A C C
DNA repair mechanisms C
C T
A
Cell cycle checkpoint DNA repair: G
activation Base excision repair
Nucleotide excision repair
Mismatch repair
Double-strand break repair
DNA repair MEIOSIS CODING/NON-CODING DNA
• Mutations can affect DNA repair • non-disjunction
DNA transposons
3% LTR retro-transposons
Parent cell 8%
Simple sequence
repeats
3%
Meiosis I SINEs 13%
Segmental
duplications
5%
Homologous
chromosomes LINEs 20%
fail to segregate
Misc. unique
Misc. sequences
Meiosis II heterochromatin 12%
8% Introns 26%
Gametes Gametes
Protein-coding
genes 2%
LTR = long terminal repeat
SINEs and LINEs are types of retrotransposons.
Heterochromatin is known to play a role in gene expression.
Mutations can lead to Changes in alleles at population level
Most mutations have a negative effect on fitness and
are quickly eliminated
Frequency of mutated allele
But mutations that do not affect
fitness can persist in populations
Neutral and
Lethal
nearly neutral
mutations
mutations Advantageous
mutations
0 W
Relative evolutionary fitness
9780170408851 CHAPTER 7 » MUTATION 255
07_bio_InFocus12_2e_sb_08851_txt.indd 255 08/08/18 7:05 pm
7 CHAPTER REVIEW QUESTIONS Qz
Review quiz
1 Distinguish between the following terms: 9 Explain, using diagrams where necessary, the following
a mutation and mutagen types of chromosomal mutations:
b spontaneous mutations and induced mutations a deletion
c deletion and duplication b duplication
d inversion and translocation c inversion
e somatic mutation and germline mutation d translocation.
f missense mutation and nonsense mutation 10 Explain how non-disjunction in meiosis can lead to
g aneuploidy and polyploidy trisomy. Use a diagram to help you explain.
h coding DNA and non-coding DNA 11 Discuss the advantages and disadvantages of DNA having
i gene flow and genetic drift the ability to repair itself.
j point mutation and chromosomal mutation 12 Describe the way transposable genetic elements operate,
k polygenic traits and multi-allelic traits. and discuss their impact on the genome.
2 Explain what is meant by the following categories 13 Why do germline mutations exert a greater phenotypic
of mutagenic agents, and give two examples effect than somatic mutations?
of each: 14 Why are somatic mutations not passed on to offspring?
a electromagnetic radiation
15 Explain how fertilisation, meiosis and mutation lead to
b chemical mutagens genetic variation.
c naturally occurring mutagens.
3 Copy and complete the table to summarise how
mutagens operate in cells.
MUTAGEN TYPE EFFECT ON DNA EXAMPLES
Chemical Ingested chemicals
Environmental irritants and poisons
Naturally occurring Biological
mutagens
Non-biological
Electromagnetic Ultraviolet radiation
radiation
Ionising radiation
4 Outline the processes during which mutations can arise. 16 Name five factors that cause changes in allele frequency
within a population, and explain how each brings about
5 Using words and arrows, construct a flow chart to show
this change.
how a change in DNA can lead to a change in phenotype.
17 Explain why the sickle cell mutation is described as a
6 What is a point mutation? Give examples.
missense point mutation.
7 What is the difference between a chromosomal mutation
18 Draw a flow chart to illustrate a silent mutation and the
and a gene mutation?
resulting polypeptide chain that would be produced. (See
8 Explain, using letters to represent bases, each of the Fig. 7.10 for ideas.)
following types of gene mutations:
19 Explain how mutations in DNA may lead to a generation
a base substitution of new alleles.
b frameshift.
20 Explain, using examples, how DNA mutations may lead to
cancer.
256 MODULE SIX » GENETIC CHANGE 9780170408851
07_bio_InFocus12_2e_sb_08851_txt.indd 256 08/08/18 7:05 pm
21 Construct a table to summarise the types of point and 24 Using Figure 7.18, explain the difference between somatic
chromosomal mutations, their causes, the changes in and germline mutations when gametes are produced
DNA structure (process of mutation) and the effects of during meiosis.
each mutation. Draw a diagram to show an original base
25 Is it true to say that mutations in coding DNA have a
sequence and the resulting changed base sequence for
phenotypic effect, but mutations in non-coding DNA
each type of mutation. Use the following headings: Type
have no phenotypic effect? Justify your answer.
of mutation, Causes, Change to DNA, Effect of mutation,
Example of disorder, Diagram. 26 In nature, mutation occurs spontaneously at a very low
rate. As a result, geneticists at first found it difficult to
22 Using examples, evaluate the effect of each of the
investigate mutations and their effects. In 1927, American
following on the gene pool of populations:
biologist H.J. Muller discovered that irradiating fruit
a mutation flies (Drosophila melanogaster) with X-rays could greatly
b gene flow increase the mutation rate. Explain how this discovery
c genetic drift. could be applied to study the cause and inheritance of
mutations.
23 The change in allele frequencies in the gene pool of a
population over generations is known as microevolution.
Explain how mutation can lead to microevolution and
speciation over time.
Germline mutations Somatic mutations
BioNinja.com.au
Parental
Germline gametes
mutation
Embryo
Somatic
mutation
Patch of
Organism affected
Entire area
organism
carries the
mutation
Half of gametes Gametes of No gametes
carry the mutation offspring carry mutation
FIGURE 7.18 Results of germline and somatic mutation
9780170408851 CHAPTER 7 » MUTATION 257
07_bio_InFocus12_2e_sb_08851_txt.indd 257 08/08/18 7:05 pm
8 Biotechnology
Students:
INQUIRY QUESTION • Investigate the uses and applications of biotechnology (past, present and future), including: (ACSBL087)
– analysing the social implications and ethical uses of biotechnology, including plant and animal examples
How do genetic
S EU ICT CC
techniques affect – researching future directions of the use of biotechnology CCT ICT
Earth’s biodiversity? – evaluating the potential benefits for society of research using genetic technologies S EU PS
– evaluating the changes to the Earth’s biodiversity due to genetic techniques S EU PS
Biology Stage 6 Syllabus © NSW Education Standards Authority for and on behalf of the Crown in right of the State of New South Wales, 2017
Shutterstock.com/Jason Benz Bennee
258 9780170408851
08_bio_InFocus12_2e_sb_08851_txt.indd 258 08/08/18 7:07 pm
The term ‘biotechnology’ is used in all spheres of life today – from areas such as the food industry,
agriculture and conservation, to the health industry, medical circles and business. This topic of interest
surfaces not only at global conferences, but in all forms of media, social networking, business meetings
and even around dinner tables and in coffee shops. Discussion
of biotechnology can evoke strong emotional responses, based
a
on differing opinions. So what, exactly, is biotechnology?
Getty Images/Science Source
Biotechnology literally means the use of biological
materials (bio) as tools (technology). Simply put, it is the use
of living organisms or their products to fulfill human needs.
Common to the many formal definitions of biotechnology is
the idea that living materials, biological processes or biological
products are used to make new products that are useful to
humans, in fields such as industry, agriculture and medicine.
Examples of biological materials from living things include cell
products (such as enzymes or antibiotics), living cells, tissues
and whole organisms (micro-organisms, plants and animals).
Although biotechnology has many beneficial applications,
biotechnology used by humans may be detrimental to the
environment or other humans, plants or animals. Taken to
the extreme, some biotechnologies may be used for destructive
purposes, such as in ‘bioterrorism’. As a counter-measure, the
field of bioethics has grown, so that people can put in place
boundaries by looking at the social and ethical impacts of
biotechnology, its uses and its potential further applications.
Biotechnology includes ancient and traditional biotech-
b
Shutterstock.com/anyaivanova
nologies used to make beverages such as wine and beer, and
foods such as bread, yoghurt and cheese. It encompasses pro-
cesses in agriculture to manipulate plant and animal breeding
to produce higher milk-yielding animals and disease-resistant
crops, as well as modern genetic technologies involving gene
manipulation. It also has ground-breaking applications in
medicine and in the production of transgenic organisms.
In this chapter, you will explore how biotechnology,
including specific genetic techniques, is used and how it can
affect biodiversity. It is also important to assess the benefits
and risks to make valid social and ethical decisions about using
biotechnology, in order to limit its impact on living things and
FIGURE 8.1 Biotechnology – past and present: a discovering
ensure that the benefits outweigh the harm. penicillin; b producing a DNA micro-array
Biotechnology – past, present
8.1 and future
Biotechnology has been in use for many thousands of years, despite the fact that it was only named
relatively recently. We call the practices from thousands of years ago ancient biotechnology. Those in use
from the late 1800s to the mid-1900s are called classical biotechnology, and those implemented since the
discovery of DNA (1950s to the present) are known as modern biotechnology. The term ‘biotechnology’
was introduced in 1919 by a Hungarian scientist, Karl Ereky, to refer in general to processes where raw
materials were converted into useful products, such as on industrial farms.
9780170408851 CHAPTER 8 » BIOTECHNOLOGY 259
08_bio_InFocus12_2e_sb_08851_txt.indd 259 08/08/18 7:07 pm
Most biotechnological developments in early times were based on using products available in nature
to improve living conditions and survival, targeting the basic human need for food, shelter and clothing.
Today’s biotechnology has similar improvements in mind, but the techniques are implemented at a more
precise molecular level, some with far-reaching consequences.
Past biotechnology
WS
Ancient biotechnology was in practice for thousands of years without a full understanding of the biological
Ancient
and biochemical processes involved. Practices included the use of yeast to make bread, as well as beer
technologies and wine fermentation. Foods such as yoghurt and cheese were produced using bacterial cultures.
Classical biotechnology emerged with the contributions of scientists such as Louis Pasteur and Gregor
Mendel. Pasteur discovered that fermentation was not a chemical process but a biological one. Mendel
introduced the idea of genetic information being transferred from one generation to the next, a concept
central to biotechnology today. By the end of the 19th century, cell products such as enzymes were in
use. The first antibiotic was discovered in 1928 and antibiotics were used for the first time as medicine in
1941. Biotechnology was moving from the farmyard and the garden into the laboratory.
Present biotechnology
Modern biotechnology took a huge step forward with the discovery of DNA and its subsequent
manipulation at a molecular level. This has been likened to the biological equivalent of humans landing
on the moon. Manipulation of DNA to create products for human use is known as gene technology. This
is a branch of biotechnology where the end products are very precisely obtained, because people now
understand how DNA makes proteins, such as enzymes, which control all aspects of cell metabolism.
Modern biotechnology uses the tools of genetic engineering not only to make specific proteins, but also
to regulate cell processes so that specific outcomes can be achieved and precise needs can be met.
The applications of biotechnology have varied over time, with specific uses in agriculture,
medicine and environmental remediation. Some scientists have tried to classify the various branches
of biotechnology using colours – green biotechnology focuses on developments in agriculture, red
biotechnology on medical and pharmaceutical applications, white biotechnology on industrial purposes,
and yellow biotechnology on food production. However, the branches tend to overlap – for example,
genetically modified crops are developed in agriculture but are used to increase food production – and
so the classification system still requires some refining.
Traditional applications of biotechnology were mainly in plant and animal breeding. The growing of
crops was the beginning of agriculture, with humans attempting to create a stable supply of nutritious
food for their clans. The domestication of animals provided humans with help in doing physical work, and
had the added benefit of protection. As far back as 15 000 BCE, as seen in evidence of the oldest dog fossils
from Siberia, humans were using dogs for these purposes.
Modern applications of biotechnology still encompass
Shutterstock.com/Martin Muzik
food production and industry, for example the production
of genetically modified (GM) food and the production of
industrial products, such as paper. While animal breeding still
plays a large role, there has been a shift in breeding techniques
from selective breeding to genetic modification of animals.
A further broad application of modern biotechnology is in
medicine and pharmaceuticals to improve human health.
Environmental conservation is another global focus of
biotechnology today.
Future biotechnology
In future applications, advances in genomics as well as our
FIGURE 8.2 Canis lupis, the Eurasian grey wolf, is believed to be the understanding of how proteins are expressed in cells will
ancestor of the modern dog, domesticated 15 000–16 500 years ago.
be used for improving the treatment of infectious diseases,
260 MODULE SIX » GENETIC CHANGE 9780170408851
08_bio_InFocus12_2e_sb_08851_txt.indd 260 08/08/18 7:08 pm
cancer and other genetic disorders. Green chemistry, where proteins can be modified to produce
environmentally friendly products, is being explored. Cellular metabolic pathways are being manipulated
to enable a range of outcomes, including the production of edible vaccines using micro-organisms, the
manufacture of synthetic cells and organs, and the transplantation of organs from animals into humans.
Ancient biotechnology
Early humans obtained their food by hunting and gathering. Later, they began raising their own animals
and growing their own crops.
Agriculture
Farming began in the Middle East, known as the ‘fertile crescent’, approximately 10 000 years ago.
By 7000 years ago, farming was established in China, and by 5000 years ago in Mesoamerica (central
America and the southern tip of North America). Over hundreds of years, humans worked to improve
the quality and yield of their food, realising the advantage of selecting seeds from the best crops and
breeding the best-quality animals. This was the start of selective breeding or artificial selection, involving
the human ‘manipulation’ of living organisms. People selected organisms that they wished to cross-breed,
ensuring that selected individuals possessed desirable characteristics that could be passed on to future
generations. Cross-breeding different varieties of organisms resulted in stronger, healthier offspring than
inbreeding – a phenomenon known today as hybrid vigour.
The shift away from hunting–gathering towards farming resulted in food surpluses, which meant an
increase in population density and, for the first time, a significant change in biodiversity.
Aboriginal people and aquaculture
Archaeologists have found stones and foundations, up to 6000 years old, that are evidence of a canal
system built by Aboriginal people. The traces show that canals meandered from the ocean to inland
areas in the Lake Condah district of western Victoria. There is also evidence of eel traps (known
as Budj Bim eel traps) being used in the district. There is similar evidence in Mount William and
Tolondo, where canals were built to connect naturally occurring swamps, and in the Barwon–Darling
river system in western NSW. Aquaculture has continued among the Aboriginal people (Fig. 8.3), and Aboriginal and
Torres Strait
elders still recount stories of their grandparents’ days about eel traps – how they were used, and the Islander histories
preservation of eels by smoking them in the hollows of trees, to sustain people when food was scarce and cultures
and for trade with other groups.
(see State Library of NSW (IE1676894), Photo by Thomas Dick
FIGURE 8.3 Aboriginal man collecting oysters, an example of early aquaculture
9780170408851 CHAPTER 8 » BIOTECHNOLOGY 261
08_bio_InFocus12_2e_sb_08851_txt.indd 261 08/08/18 7:08 pm
Food production: bread and cheese making
After domestication of food crops and wild animals, humans began to
implement other biotechnologies, such as cheese making and bread making.
Some of the earliest evidence of changes in plants due to domestic breeding
comes from ancient evidence of the use of wild grains in caves in the Middle
East, inhabited approximately 10 000 years ago. The layers of fossilised grain
reflect a change in the characteristics of the grain, with the older wild grains of
Einkorn wheat in the bottom layers having to be pounded to release the seeds,
whereas the younger Emmer wheat grain in the top layers could naturally
release the seeds (Fig. 8.4).
Einkorn Emmer Durum Bread making
Ancient wheats Modern wheat Images carved in the walls of tombs in ancient Egypt depict the process of
Fewer chromosomes, More chromosomes, bread making (Fig. 8.5). This explains the need for wheat from which seeds
lower gluten content higher gluten content
could be naturally extracted. Evidence of the use of yeast to make bread is
FIGURE 8.4 Comparison of ancient wheats and
seen in Egyptian tombs from around 2000 BC. It is assumed that wild yeast
modern wheat made its way into dough by accident around 10 000 years ago and was later
intentionally introduced when the benefits of its actions were noted. Yeast
ferments sugars to produce carbon dioxide, which in turn makes the bread rise. Yeast was extracted
from malt-wort and added to the dough. Baker’s yeast has been used since the 1920s and today the
Saccharomyces cerevisiae strain is used to ferment bread dough.
Caves containing fossilised wheat were also rich in animal remains, indicting a change in the types of
animals eaten. As humans moved from being a migratory species to settled groups, they learned how to use
the plants and animals around them. Maize, beans and potatoes in Central America, rice, millet and buffalo
in Asia, and wheat, sheep and goats in the Middle East were bred and farmed.
Alamy Stock Photo/ART Collection
Alamy Stock Photo/Heritage Image Partnership Ltd.
FIGURE 8.6 A meal with cheese, from an 11th century
FIGURE 8.5 Bread making in ancient Egypt medieval handbook on health and wellbeing
Cheese making
Cheese making involves the action of bacteria on milk and dates back as far as 10 000 years ago.
The process was improved over the years, and by the time classical cheese making was in progress,
people understood that enzymes could be purposely added, and when the enzymes combined with
bacteria naturally present in the air, curds and whey were produced. Pressing of the curds removes
262 MODULE SIX » GENETIC CHANGE 9780170408851
08_bio_InFocus12_2e_sb_08851_txt.indd 262 08/08/18 7:08 pm
excess water, and storage in a dry environment allows ripening, which often includes the action of
other surface bacteria that give the cheese a distinct flavour.
Evidence of yoghurt making dates back to approximately 4000 BC. The Chinese used Lactobacillus to
ferment milk into a semi-liquid consistency, extending the time over which the milk could be stored and
used. This same genus is still used to make yoghurt today.
Classical biotechnology (1800s to mid-20th century)
At particular points in time, key findings have led to remarkable advances in the field of biotechnology.
One example of this is the discovery by Louis Pasteur in 1857 that fermentation results from the action
of micro-organisms.
Fermentation
The word fermentation is derived from the Latin word fervere – ‘to boil’. The use of fermentation began
over 6000 years ago. It is believed to have started in ancient Egypt, when bread or milled grain left in a
damp place began to ferment due to yeasts present in the air. The wheat would have provided sugars
produced from starch, and the yeast from spores in the environment would have used the sugars to
ferment the bread and produce alcohol.
The discovery that the process of fermentation resulted from use of the biological organism
yeast is attributed to the work of Joseph Louis Gay-Lussac and Louis Pasteur. Although people had
been using these processes for thousands of years, it was not until the 1600s that it was recognised
that the froth on beer was due to gas accumulation. Gay-Lussac proposed the chemistry behind Reread Chapter 3
of Biology in
this, but the discovery that microbes were responsible for the gas production is attributed to Focus Year 11
Pasteur (Fig. 8.7). In the 1860s, Pasteur used experimentation to show that the fermentation process on alcoholic
and lactic acid
is biological, not chemical. fermentation
Classical biotechnology therefore uses known biological material such as cells (for example, yeast (anaerobic
respiration).
and other microbes), as well as known cell products (such as enzymes and
antibiotics) to achieve a particular goal.
Brewers used barley and other grains to make beer. Hops were added to
the process in the Middle Ages, and the process relied on yeast from the air.
A sugar-rich solution that contains either grain or fruit naturally contains
yeasts and, if allowed to stand, the yeast ferments the sugars to produce
alcohol and carbon dioxide. In wine making, the skin of grapes contains
natural sugars and yeasts that facilitate the process of fermentation.
Medicine and antibiotic production
The use of plants to heal the sick predates modern medicine. Many
conventional drugs and medicines used today are derivatives of ancient
remedies. Willow bark, which contains salicin, was used to treat
inflammation and for pain relief. Turmeric was used to improve circulation,
and its anti-inflammatory properties are recognised today. The Persians
and Egyptians eased pain by using the milk of the opium poppy (Fig. 8.8).
Poppy seed cakes and poppy pods have been found in Neolithic Swiss
dwellings from 4000 years ago. Bark from the Cinchona plant, also known
as Jesuit bark, was used by indigenous people in South America to ease
fever. The plant contains quinine, which has antimalarial properties.
A growing awareness of medicinal plants from ancient times to
today has led to contemporary scientists creating medicine from plants
and fungi, used in modern pharmacological drug development. One FIGURE 8.7 Pasteur’s findings on fermentation
of the most famous natural products discovered was an antibacterial were published in 1879.
9780170408851 CHAPTER 8 » BIOTECHNOLOGY 263
08_bio_InFocus12_2e_sb_08851_txt.indd 263 08/08/18 7:08 pm
product made by the fungus Penicillium. The product was discovered in 1928 by
Alamy Stock Photo/Nigel Cattlin
English bacteriologist Alexander Fleming. It was later stabilised by Australian
pharmacologist and pathologist, Howard Florey, to form the antibiotic known
today as penicillin. This application revolutionised the treatment of infectious
diseases caused by bacteria, and penicillin is still used today.
Plant selective breeding techniques
Hybridisation and artificial pollination were, and still are, commonly used in
horticulture and agriculture to improve the quality of plants being grown or
raised. Hybridisation produces hybrid offspring with combined traits that make
them better suited to their environment or for their end use (such as bigger
flowers, higher nutrient value, increased crop yield, shorter breeding time,
greater resistance to drought, disease or salinity, or higher stamina), termed
‘hybrid vigour’.
At times, traits that are beneficial to breeders and consumers may be
FIGURE 8.8 The milky sap of Papaver
somniferum, the opium poppy, is used to detrimental to the plant. For example, making fruit sweeter may attract more
make opium, and its seeds are used for feeding by insects and other pests. Some traits that increase a plant’s resistance
culinary purposes.
to disease may be lost when the plant is bred to enhance other traits.
KEY CONCEPTS
● Biotechnology is the use of living organisms or their products for human benefit.
● Ancient biotechnology began thousands of years ago, with the domestication of crops and
animals and the use of living cells to make food products such as bread, cheese and wine.
● Classical biotechnology came about with advances in scientific understanding of the role of
living organisms in fermentation (Pasteur), antibiotics (Fleming) and genetics (Mendel).
CHECK YOUR 1 Define ‘biotechnology’.
UNDERSTANDING
2 Identify the biological materials that may be used in biotechnology.
8.1a 3 Name three fields of biotechnology, classified according to ‘colour’.
Modern biotechnology (1950s – present)
Modern biotechnology to a large extent involves genetic engineering – techniques that are used to
WS manipulate DNA to meet the needs of society, the environment and science in a very precise way.
Genetic engineering involves humans manipulating the pattern of bases in the DNA (genotype) of an
Technologies to
manipulate DNA organism to change its phenotype, making the individual appear or act differently. The most common
steps in genetic engineering involve ‘cutting, copying and pasting’ DNA sequences, a different version
of what you may do on a computer to a word processing document. An example of genetic engineering
is where scientists have modified bacteria by using enzymes to snip out (cut) a human gene and insert
(paste) it into bacteria, enabling the bacteria to produce human proteins such as insulin and human
You will learn growth hormone. The new DNA, made up of DNA from more than one species (bacterial DNA with
more about
transgenic a human gene inserted), is known as recombinant DNA (rDNA) (Fig. 8.9). These organisms are called
species in genetically modified organisms (GMOs) or, if they are able to pass on their newly constructed genome to
Chapter 9.
the next generation, transgenic species.
264 MODULE SIX » GENETIC CHANGE 9780170408851
08_bio_InFocus12_2e_sb_08851_txt.indd 264 08/08/18 7:08 pm
Foreign DNA A T
(e.g. human) T A A
Cut Sticky A
T A
C G end G
G C C
Cut
A T
A T DNA
T A segment T
T A Cut cut by T Sticky A
C G C end T A
restriction G T G
Cut G C C
enzyme C
A T G
Foreign DNA
segment T
inserted into T A
T Cut T C A
A A plasmid and
T A G G
Plasmid cut T joined by
T A T C
C by restriction DNA ligase
C
Cut G G enzyme G
A G
T
C A A
G
A A
G G Recombinant plasmid
C A C
T
Bacterial plasmid
FIGURE 8.9 Formation of recombinant DNA in the bacterium E. coli
DNA technology is a generic term for the use of specialised biological tools to modify, measure,
manipulate and manufacture DNA. All these ‘tools’ (many of which are enzymes) come from other living
organisms, such as bacteria and viruses.
Some of these genetic engineering techniques are dealt with in other chapters, so only a brief outline
is provided below, to clarify how they are used sequentially and applied to achieve specific outcomes in
modern biotechnology.
Technology to manipulate DNA
DNA splicing
DNA splicing means cutting out genes. The required gene or sequence of bases in a DNA molecule is
See Chapter 9 for
spliced out, using restriction enzymes that cut DNA at specific base sequences (Fig. 8.9). Restriction more detail on
enzymes occur naturally in bacteria. Their purpose in nature is to ‘chop up’ foreign DNA from invading this technique.
viruses. Scientists use them like ‘molecular scissors’, snipping DNA into smaller pieces at specific base
sequences (Fig. 8.10).
9780170408851 CHAPTER 8 » BIOTECHNOLOGY 265
08_bio_InFocus12_2e_sb_08851_txt.indd 265 08/08/18 7:08 pm
a b
… T C C A G G A C T G G TA C C G A A T T C C C G G ATATAT T T C C ACGTCACT A G C T TA C C G A
TGCTGTGA T C G A AT G G C T
A G G T C C T G A C C G AT G G C T T A A G G G G C C TATATA A A G G …
Alu I
Eco Rl
ACGTCACT A G C T TA C C G A
… G G A C T G G C TA C C G A A T T C C C G G ATATAT TGCAGTGA T C G A AT G G C T
C C T G A C C G AT G G C T T A A G G G C C TATATA …
Sticky ends Blunt ends
FIGURE 8.10 a Sticky ends produced by cutting DNA with the restriction enzyme ECoR1; b blunt ends produced by cutting DNA with the
restriction enzyme Alu1
DNA amplification
DNA amplification
is dealt with in
DNA amplification means copying genes. This is done through a process known as the polymerase chain
Chapter 9. reaction (PCR), in which the DNA polymerase enzyme is used to replicate DNA fragments many times
before they are inserted into the new genome.
Recombining DNA
Recombining DNA means ‘pasting’ genes. A DNA ligase enzyme is used to join pieces of DNA together,
forming bonds in the sugar-phosphate backbone of DNA.
Technology to analyse and visualise DNA
DNA molecules are too small to be seen, even with a microscope, so special techniques must be used to
enable scientists to analyse and visualise them. DNA is usually cut into small fragments that can then be
identified and built into a picture of a whole DNA molecule or genome. DNA analysis and visualisation
techniques include gel electrophoresis and gene probes.
Agarose gel electrophoresis
Gel electrophoresis (Fig. 8.11) is used to analyse DNA and then identify the ‘DNA fingerprint’ of an
individual (described in Chapter 6, page 197). DNA is fragmented and passed through a gel. The
distribution pattern of the fragments can be seen as bands on the gel, each band representing a DNA
fragment of a particular size (Fig. 6.6). This information can be used in a manner similar to a bar code, to
identify an individual or a species.
Gene probes
Science Photo Library/Simon Fraser
A gene probe is a specific length of single-stranded DNA
(20–1000 nucleotides in length) that is complementary to a
known DNA sequence from a specific gene. Gene probes can be
manufactured artificially and tagged with a fluorescent dye or
radioactive atom so that the probe and the DNA that it binds to
can be seen. This allows the DNA to be ‘visualised’. Thousands
of genes can be tested at a time, using a micro-array.
DNA sequencing
DNA sequencing is used to determine the exact nucleotide
FIGURE 8.11 A researcher injecting genetic material into an sequence of DNA or a gene, to find (visualise) the genetic
agarose gel code for a particular phenotype. This may be done using
gel electrophoresis or using ‘next-generation’ automated
266 MODULE SIX » GENETIC CHANGE 9780170408851
08_bio_InFocus12_2e_sb_08851_txt.indd 266 08/08/18 7:08 pm
sequencing technologies, such as nanopores (Chapter 6).
Shutterstock.com/science photo
All sequence data that is published is saved in a database called
GenBank for use by the public.
DNA profiling
DNA profiling involves DNA amplification of short tandem
repeats (STRs) by PCR, followed by gel electrophoresis. Its
purpose is to compare the base sequences of two or more
individuals to determine relatedness based on differences in the
length of DNA repeats.
Applications of modern biotechnology
FIGURE 8.12 In DNA profiling, DNA sequences are analysed
and social implications
Human needs drive biotechnology, which today still includes the creation of food, medical and
agricultural products, and has also extended to applications in industrial biotechnology and gene WS
technology, resulting in new varieties of living organisms. This has impacts on Earth’s biodiversity.
Modern technologies
Industrial biotechnology applications
Industrial biotechnology includes fields such as enzyme engineering, bio-nanotechnology and synthetic See Chapter 9 for
more information
biology, as well as biochemical and bio-material engineering. on applications of
Applications of industrial biotechnology include: biotechnology in
industry, resource
◗ pollution prevention, for example the use of microorganisms to clean up and reduce waste; the use of conservation and
agriculture.
enzymes in washing powders to remove stains, replacing phosphates that were previously used and
built up in water systems, contributing to eutrophication (overgrowth of plant life in waterways);
the production of environmentally friendly products such as fertilisers, biopesticides, biofuels and
biodegradable materials made from plants
◗ biomaterial production, which involves any natural or synthetic substance being made to interact Industrial
biotechnology
with biological systems for a medical, therapeutic or diagnostic purpose. Examples include joint Analyse the table
replacements, artificial heart valves, stents and breast implants. of products and
summarise the
Future applications include: benefits to society and
the environment of at
◗ biofabrication – the automated production of tissues and organs, using the principles of 3D printing least three of these
and materials such as cells, fibres and gels, to replace diseased or injured tissue products.
◗ synthetic biology – using computer technology to construct synthetic genomes that can function
in a living cell. In 2010, American scientists J. Craig Venter and his team created the first synthetic
cell – a microbe. They used a computer to create a digital genetic code of 1.1 million base pairs.
The genome, a replica of the full genome of the bacterium
Mycosplasma mycoides, was made in the laboratory from Shutterstock.com/GiroScience
synthetic nucleotides. When implanted into an enucleated
cell of another related bacterium, the genome directed
the bacterium to produce new proteins. The synthetic
cell divided under the instruction of the synthetic code
to become a colony of M. mycoides cells. The cell was
nicknamed ‘Synthia’ and is acknowledged as the first
synthetic cell. This new biotechnology opens up a world of
possibilities. The application of making large-scale changes
to codons in genetic systems using computers will enable
different and/or novel amino acids to be incorporated into
proteins, to improve gene expression and exclude genetic FIGURE 8.13 Synthetic cells are built entirely through genetic
engineering.
diseases.
9780170408851 CHAPTER 8 » BIOTECHNOLOGY 267
08_bio_InFocus12_2e_sb_08851_txt.indd 267 08/08/18 7:08 pm
Agricultural biotechnology applications
Applications of agricultural biotechnology include improving plant and animal production by increasing
yield, nutritional value and resistance to disease. Agricultural biotechnology aims to enhance the quality
Sustainability of, and economic returns from, commercial crops by using reproductive technology and gene technology
(Chapter 9).
Ethical
understanding
Reproductive technologies and genetic diversity
Asia and
Australia’s Modern-day reproductive technologies include artificial insemination (animals) and pollination (plants),
engagement in vitro fertilisation, embryo transfer and cloning. This advanced technology uses DNA manipulation
with Asia
techniques to insert desired genes into organisms by genetic engineering, creating transgenic species
(Chapter 9).
Advantages of selective breeding in agriculture currently include increased:
The latest ◗ milk yield in female cattle
defence against ◗ quality of beef in cattle
animal extinction
◗ size of eggs from chickens (and more frequent laying)
◗ grain yield from wheat
◗ protein in food
◗ vitamin content in food ( for example, golden rice).
Agricultural applications of biotechnology include the use of
Shutterstock.com/marekuliasz; Shutterstock.com/Marius C; Shutterstock.com/A G Baxter
genetically engineered crops, such as golden rice, to address hunger
in poor and developing countries and work towards eradicating
starvation. Golden rice was created by the insertion of two genes,
one from the daffodil (replaced by corn in a later version) and one
from a bacterium, into a rice genome. Golden rice differs from other
rice in that it contains a vitamin A pre-cursor, beta carotene. This
rice, with its much higher nutritional (vitamin A) content, was then
developed and its creators formed a deal with a company to produce
it in large quantities for humanitarian purposes, to help to combat
vitamin A deficiency (which can cause blindness and other serious
health problems) in the developing world.
However, worldwide concern has grown about loss of genetic
diversity and biological resources, due to farming generally and,
in particular, farming in developing countries. At a convention on
biological diversity in Japan in 2010, a new protocol (the Nagoya
Protocol) was adopted. This addressed the issue of access to
FIGURE 8.14 Biodiversity is one of the concerns of
agricultural biotechnology. genetic resources by various countries and the ‘fair and equitable
sharing of benefits’ from the use of these resources. As a result, a
legal framework was set up for the biotechnology industry to implement a common goal of sustaining
biological diversity.
Conservation biology applications
Progress has also been made in using plant biotechnology for biodiversity conservation. Advances in
genomics and proteomics have enabled researchers to identify desirable traits in crops and plants using
molecular markers, and to bank (save) favourable germplasm. Germplasm is any living tissue from which
new plants can form, and includes whole plant plant parts (such as leaves or stems), pollen and clusters
of cells. Germplasm can be incorporated into crop varieties, either through selective breeding or using
genetic manipulation techniques, to increase biodiversity.
Applications of animal biotechnology include researchers mapping relatedness between animals
(in the wild and in captivity) and then designing breeding programs to maximise hybrid vigour and
genetic biodiversity (Fig. 8.14).
268 MODULE SIX » GENETIC CHANGE 9780170408851
08_bio_InFocus12_2e_sb_08851_txt.indd 268 08/08/18 7:08 pm
Artificial insemination is being used for
Imagefolk/Naturepl/Mark Carwardine
animal conservation in the wild and in zoos, to
maintain biodiversity. For example, researchers
at the Smithsonian National Zoo in the USA
have used artificial insemination in animals at
risk of extinction, producing one hundred black-
footed ferrets that could then be released into
their natural former habitat.
Veterinarians at the Zoological Society
of London’s conservation centre have been
conducting habitat surveys in Niger and Chad
FIGURE 8.15 The Sumatran rhino, almost extinct in the wild,
in Africa to try to reintroduce a herd of antelope is part of a captive breeding program.
(scimitar-horned oryx) that are extinct in the
wild. The zoo has appealed to other zoos around
the world to provide either female oryxes or oryx sperm so that the resulting offspring have the broadest
possible genetic variation.
Some species that are close to extinction, such as the Sumatran rhino (Fig. 8.15), cannot be saved in the
wild. Captive breeding technologies are critical in saving these species.
The southern white rhino has been brought back from the brink of extinction by captive-breeding
programs. At the start of the 20th century, there were approximately 50 southern white rhino left. As
a result of captive breeding with close mapping of relatedness, there are now over 20 400 white rhinos, Saving the rhino
with no apparent birth defects despite inbreeding from a small parent population. The rhinos remain
in captive populations in conservation centres, to reduce the risk of them being eliminated in one
place by disease, natural disaster or poaching.
Banks for animal genetic material have also been established, and oocytes and gametes are being
cryogenically preserved at zoos around the world, to conserve animal genes for biodiversity purposes. Biotechnology for
biodiversity
Genetic engineering can also produce plants and animals that are more fertile and resistant to disease Read about DNA
and drought, and plants that can grow in nutrient-poor soils. This is crucial in maintaining biodiversity. banks for plants and
the use of molecular
markers.
Medical technology applications
Gene therapy is a technique based on delivering normal genes that function correctly, to individuals
who are lacking a functional copy and as a result suffer from a genetic disorder. For example, scientists See Chapter 9 for
have had success with the disorder called severe combined immunodeficiency (SCID). Sufferers are very more information
on gene therapy
susceptible to infection, as the mutant gene and Chapter 12
disrupts the functioning of the B and T cells in for more
Shutterstock.com/Mopic
information on
their immune systems. B and T cells.
In vitro fertilisation has been in use in
humans for about 40 years. Over this time
it has become more sophisticated and
now has a greater success rate, thanks to
Three-parent
improvements in scientists’ understanding technique
of endocrinology and reproduction in various Read about babies
conceived using DNA
species, and advances in biotechnology. It is from three people, to
prevent mitochondrial
not only successful in allowing couples who disease.
have fertility issues to reproduce, but it is also
being used to prevent children being born with
inherited genetic diseases – one technique uses
gamete material from three parents to avoid a
child being born with mitochondrial disease. FIGURE 8.16 Gene therapy involves the manipulation of DNA
to overcome genetic disorders.
(See the weblink.)
9780170408851 CHAPTER 8 » BIOTECHNOLOGY 269
08_bio_InFocus12_2e_sb_08851_txt.indd 269 08/08/18 7:08 pm
INVESTIGATION 8.1
Secondary-source investigation into the uses of biotechnology:
Critical and past, present and future
creative thinking
In the past, people developed biotechnologies to improve the availability and quality of food, from growing
Information and crops to making products such as bread, cheese, beer and wine. Traditional biotechnology progressed as
communication scientific understanding of these processes improved and knowledge and understanding of cell and molecular
technology
capability biology increased. Biotechnology has made major advances, enabling scientists to manipulate genes and
their products more precisely than ever before and applications have moved into the realm of gene therapy in
medicine.
AIMS
To gather data about the development of biotechnologies from past to present
To analyse trends in biotechnology developments and identify the scientific knowledge and understanding
needed for each breakthrough
METHOD
1 Working in groups of three, you are to create timelines of biotechnological developments in particular
fields. You will then compare your different timelines within the group, to identify trends and patterns
common in major breakthroughs.
2 Individual work: select two applications of biotechnology (examples below) and conduct research,
gathering relevant information from a variety of sources, to follow the development of biotechnologies
from ancient times to the present. You must select at least one biotechnology that is not being researched
by another member of your group. Extrapolate at least one future direction that research in this field is
taking.
3 Create a timeline to record your information, placing the two biotechnologies on each side of the line for
comparison.
Some examples of applications of biotechnology that you may wish to research are those used for:
• food production – from ancient agriculture/aquaculture to current genetically modified food
• fermentation – from ancient practices to applications of modern fermentation
• selective breeding – from domestication to genetically engineered organisms
• medical /pharmaceutical applications – from the ancient practice of using bark to gene therapy today
• environmental applications – from early agriculture to harnessing nitrogen, phosphorous and
biofuels today
• biodiversity conservation – from agricultural beginnings to plant DNA banks to reintroducing genes of
extinct animals into the gene pool to increase biodiversity.
RESULTS
Record your results in the form of a timeline, including dates (or a range of dates where applicable) and events
in the development of the applications of biotechnology that you are researching, arranged in chronological
order. The timeline may be drawn from the bottom to the top of the page (earliest date at the bottom), or from
left to right on a landscape-oriented page (earliest dates on the left).
DISCUSSION
As a group, analyse your timelines to find common trends in the development of biotechnologies throughout
history and identify the scientific knowledge and understanding needed for each breakthrough.
CONCLUSION
Based on your research, sum up the advances in biotechnology in your selected field and outline the scientific
knowledge and understanding required for breakthroughs in these fields.
270 MODULE SIX » GENETIC CHANGE 9780170408851
08_bio_InFocus12_2e_sb_08851_txt.indd 270 08/08/18 7:08 pm
KEY CONCEPTS
● Modern biotechnologies have been developed to manipulate, analyse and visualise DNA in
genomes.
● Applications of modern biotechnologies include:
– industrial uses: the production of biopesticides, the use of enzymes in pollution reduction,
using cell products to make fertilisers
– agricultural uses: reproductive technologies for selective breeding and genetic modification
of foods
– medical uses: gene therapy and human IVF.
1 Distinguish between ancient, classical and modern biotechnologies, giving an example of each.
CHECK YOUR
UNDERSTANDING
2 Create a table to outline two uses and applications of biotechnology, one past and one present, in each of
the following areas: 8.1b
a agriculture b food production c medicine or pharmaceuticals.
8.2 Ethics and social implications
The manipulation of DNA by humans is a contentious issue, as it raises ethical questions – people need Ethical
to make wise decisions when important values are at stake. Selective breeding may benefit society understanding
by making agricultural practices more productive, but when the principles of selective breeding are
applied to humans there is the potential for breaches of ethics – attempts to create a race of humans
with ‘superior’ genetic qualities, for example, as was seen during World War II. In the late 20th century,
some drug trials breached the principles of research ethics by using volunteers who were vulnerable or
terminally ill, subjecting them to harm. DNA manipulation techniques in use today have potential for Civics and
citizenship
misuse in biological warfare and terrorism. New biotechnologies are powerful and have great potential
to change the genomes of organisms, with global impact. Sustainability
Technologies such as cloning and the CRISPR technique (page 275) allow very precise introduction
of genes into cells, making it easier for scientists to alter the human genome and combine the
genes of different species. This raises issues of human and animal rights and freedoms, including
the question of how ‘tampering with nature’ may alter the path of evolution. We need to consider our
responsibilities carefully, to ensure that these technologies maximise benefits, preserve privacy, and
support dignity and informed consent, while minimising harm. For example, positive inroads are being
made in using biotechnology in conservation, increasing the biodiversity of animals in farming and in the
wild and to further research, but what are the costs to society and the environment?.
Case study: Global need for increase in agricultural products
The United Nations, Department of Economic and Social Affairs, Population Division (UNESCO) has
estimated that, by the year 2050, there will be an additional 2.41 billion people in the world to feed
(UN-DESA-PD 2011). The demand for food and other resources to sustain the population will grow
exponentially and this puts new demands on the agricultural industry (Fig. 8.17).
This demand for food is not spread evenly across all nations. It is predicted that there will be very little
increase in human populations in the more developed regions of the world (Europe, Northern America,
Australia/New Zealand and Japan), but very high increases in population are likely in less developed countries
(Asia, South-East Asia, Africa).
Reproductive and genetic technologies in livestock and crop production can make a positive
contribution in developing countries, alleviating poverty and hunger, reducing the threat of disease and
ensuring environmental sustainability.
9780170408851 CHAPTER 8 » BIOTECHNOLOGY 271
08_bio_InFocus12_2e_sb_08851_txt.indd 271 08/08/18 7:08 pm
1 2 3 4 5 6
en/c/1a001c07-6567-4c0a-b5ca-b5b86bc0e881/). Reproduced with permission.
Source: Food and Agriculture Organization of the United Nations,’ FOA Hunger Map 2015’, Millennium
Development Goal 1 and World Food Summit Hunger Targets’. (http://www.fao.org/publications/card/
About 793 million people in the world still Yet progress has been made, even in the The year 2015 marks the end of the In developing regions the target was almost Some regions, such as Latin America, the In many countries that have failed to reach
lack sufficient food for conducting an active presence of significant population growth. monitoring period for the Millennium achieved, with the share of undernourished east and southeastern regions of Asia, the the international hunger targets, natural
and healthy life. Approximately 218 million fewer people Development Goal targets. Seventy-three out having decreased during the monitoring Caucasus and Central Asia, and the northern and human-induced disasters or political
suffer from undernourishment than 25 years of 129 developing countries – more than half period from 23.3 to 12.9 percent. and western regions of Africa, have made instability have resulted in protracted crises,
ago and 169 million fewer than a decade ago. the countries monitored – have reached the fast progress. Progress was also recorded in with increased vulnerability and food
MDG 1C hunger target of halving the southern Asia, Oceania, the Caribbean and insecurity among large segments of the
proportion of the chronically undernourished. southern and eastern Africa, but at too slow population.
a pace to reach the MDG 1C target.
120°0'0"W 60°0'0"W 0°0'0" 60°0'0"E 120°0'0"E
Millennium Development Goal 1 Undernourishment data: FAO Statistics Division (ESS)
SOURCES
and World Food Summit Political boundaries: FAO Global Administrative Unit Layers (GAUL)
Global relief: ETOPO1 (National Geophysical Data Center - NOAA)
Inland water bodies: FAO Land and Water Division (NRL)
Hunger Targets Iceland
Sweden
Russian Federation
Finland
Norway
Produced by the FAO Statistics Division Estonia
Canada Latvia
Denmark
For additional information: Lithuania
Belarus
http://www.fao.org/economic/ess Ireland United Kingdom
Netherlands Poland
Belgium Germany
Czech Republic
Luxembourg Ukraine
Slovakia
Liechtenstein Austria
Hungary
Kazakhstan
France Switzerland Republic of Moldova
Slovenia
Romania Mongolia
Croatia
Monaco Bosnia and Herzegovina
Serbia
Italy Montenegro Bulgaria
Georgia
The Former Yugoslav Republic of Macedonia
Uzbekistan Kyrgyzstan
Albania Armenia
Spain Azerbaijan Turkmenistan Democratic People's Republic of Korea
United States of America Portugal Greece Turkey Tajikistan
Malta
Syrian Arab Republic
China Republic of Korea
Japan
Cyprus
Afghanistan
Tunisia Lebanon Iraq
Iran (Islamic Republic of)
West Bank and Gaza Strip
Morocco
Israel
Jordan
Kuwait
Algeria Nepal
Pakistan Bhutan
Libya Egypt Bahrain
Qatar
Mexico Bangladesh
Saudi Arabia United Arab Emirates
Cuba
India
Mauritania Myanmar Lao People's
HaitiDominican Republic
Oman
Anguilla Mali Democratic Republic
Jamaica
Belize Saint Kitts and Nevis Antigua and Barbuda Niger
Montserrat
Guatemala Sudan Yemen
Cabo Verde Senegal Chad Eritrea Thailand
Honduras Martinique
Saint Lucia
El Salvador Gambia Philippines
Saint Vincent and the Grenadines Barbados
Nicaragua Burkina Faso Cambodia
Grenada Guinea-Bissau Viet Nam
GOALS Guinea Djibouti
Trinidad and Tobago
Costa Rica
Ghana Benin Nigeria Ethiopia
Millennium Development Goal 1, target 1C: halve, between 1990-92 and 2015, the proportion Panama
Venezuela (Bolivarian Republic of)
Sierra Leone
Côte d'Ivoire Sri Lanka Palau
of people suffering from undernourishment, or reduce this proportion below 5 percent. Togo Central African Republic South Sudan Micronesia (Federated States of) Marshall Islands
Liberia
The indicator measures the proportion of the population below the minimum level of dietary energy Suriname
Guyana Cameroon Somalia Brunei Darussalam
French Guiana
consumption (undernourishment). The assessment is not conducted for developed regions. Colombia
Malaysia
Kiribati Equatorial Guinea Uganda Singapore
Sao Tome and Principe
0°0'0" Congo Kenya 0°0'0"
Maldives Nauru
Gabon
Prevalence of undernourishment: measures the probability that a randomly selected individual Ecuador
Democratic Republic Rwanda Indonesia
in the population is consuming an amount of dietary energy, which is insufficient to cover her/his of the Congo Burundi
requirements to lead an active and healthy life. Seychelles
United Republic of Tanzania Papua New Guinea
Peru Tuvalu
Timor-Leste
World Food Summit (WFS) goal: halve, between 1990-92 and 2015, the number of people Solomon Islands
undernourished. Brazil Comoros
Samoa Angola
500 250 0 500 1 000 1 500 2 000 2 500 3 000
American Samoa Kilometers Zambia Malawi Vanuatu
Bolivia (Plurinational State of) Fiji
Niue The designations employed and the presentation of the material in the maps do not imply the Zimbabwe
expression of any opinion whatsoever on the part of FAO concerning the legal or constitutional status Madagascar Mauritius
Tonga Namibia
of any country, territory or sea area, or concerning the delimitation of frontiers. Paraguay Botswana Mozambique
Australia
Swaziland
Lesotho
Chile
South Africa
Uruguay
Argentina
New Zealand
LEGEND
Target 1C not achieved, Target 1C not achieved, with lack
Target 1C achieved Missing or insufficient data Not assessed
with slow progress of progress or deterioration
LEGEND LEGEND
<5% Very low Target achieved
5% 14.9% - Moderately low Target not achieved,
with slow progress
15% 24.9% - Moderately high
Target not achieved, with
lack of progress or deterioration
25% 34.9% - High
Missing or
35% and over - Very high insufficient data
NOTES
Missing or insufficient data Not assessed
The latest global undernourishment estimates published in SOFI 2015 have been slightly revised of the national per capita availability of calories. Based on the updated data, new estimates of the
due to a change in the underlying data of two countries. In particular: Prevalence of Undernourishment and the Number of Undernourished people were obtained for
Oman.
1. New information on agricultural production in Senegal, provided by the Agence Nationale de
Statistique et de la Démographie, has led to a revision of the national per capita availability of As a result of these revisions, estimates for the relevant regional and global aggregates, as well as
I4674E/1/05.15
calories. Based on the updated data, new estimates of the Prevalence of Undernourishment and special country groups, have also been updated.
Number of Undernourished people for the periods from 2010-12 to 2014-16 were calculated.
These revisions do not change the overall assessment of the state of global food insecurity
2. Estimates on food losses at the retail level for Oman were modified, leading to a minor revision described in SOFI 2015.
FIGURE 8.17 United Nations world food hunger map. Green areas in the large map indicate that Millennium Development
Goal Hunger Target 1C (to halve the proportion of people suffering from undernourishment or reduce this proportion to
below 5 per cent) has been achieved; yellow areas indicate target not achieved and slow progress; red areas indicate target
not achieved and no progress or worsening.
Part of the solution to food shortages is to improve agricultural productivity by increasing the:
◗ amount of food – larger numbers of plants and animals farmed for consumption
◗ quality of food – greater amount of edible protein in foods (crops and livestock).
◗ resistance of some crops and livestock to disease, drought and floods.
As knowledge and technological power in the biological sciences grow, the need arises for careful
consideration of the values that are at stake. An International Bioethics Committee has been formed by
UNESCO to ensure that progress in genetics is accompanied by reflection on ethical and legal issues.
They also aim to take action to heighten awareness of human dignity and freedom of choice and to
Ethical
understanding ensure respect for all living organisms and the environment. They encourage countries to work together
to reach international agreement on legal and ethical issues in molecular biology.
Critical and
creative thinking When analysing the social and ethical implications of new biotechnologies, the following should be
considered:
◗ medical and health benefits
◗ financial and social justice issues
Personal and
◗ animal and human rights
social capability ◗ effects on the environment.
Making an ethical decision
Regulation of Bioethics refers to the study and investigation of how decisions in medicine and science affect society
gene technology
in Australia and the environment. We need to take into account the benefit or harm to the lives and health of
individuals and society as a whole. We also need to consider justice and equity – fair and equitable
treatment for all. When faced with a controversial issue, people can differ in their opinion of what is right
or wrong, which may lead to a moral dilemma, where trying to decide what is right or wrong challenges
a person’s basic beliefs.
272 MODULE SIX » GENETIC CHANGE 9780170408851
08_bio_InFocus12_2e_sb_08851_txt.indd 272 08/08/18 7:09 pm
Imagefolk/Nigel Pavitt
Shutterstock.com/Boris15
FIGURE 8.18 Women carrying farming
produce in a developing country FIGURE 8.19 Aspects of bioethics
TABLE 8.1 Basic principles of ethics
PRINCIPLE QUESTIONS AIM
1 Benefit In whose best interests is the action – does it benefit individuals/groups/society in general/future generations? Wellbeing
and non- How reliable and useful is the procedure?
harm
Do the advantages outweigh the risks?
2 Individual Is the person properly informed of the advantages and harms or risks? Choice
rights and Does the person have freedom of choice?
autonomy
Are the rights of others protected or breached?
3 Privacy Will the person’s genetic information remain private? Respect
and What is the right thing to do if a breach of privacy could save another person’s life?
societal
How might the release of this information affect the way in which society or another individual perceives that person?
perception
4 Equity and Is there equal access for all members of society (no bias in terms of gender, socioeconomic status or ethnicity)? Fairness
justice Is there fair sharing of resources that can be justified?
How can discrimination be avoided?
To become informed, reflective and responsible citizens, we need to develop our skills in critical
thinking. The media, politicians and religious institutions often give wide exposure to controversial
issues, and we do not always want them to make decisions on our behalf. Ethics are the principles that
help us decide what is the right thing to do.
Scientists use evidence and reasoning, rather than emotion, to understand and respond to
technological advancement and scientific developments. We need to weigh up the risks and benefits
of using certain technologies or procedures, and compare these with the potential consequences of
not using the procedures. This process of reasoning should help us gain an informed ethical standpoint
that we can justify. However, we also need to take into account our own beliefs, values and cultural
experiences. As a result, bioethicists often use frameworks that have been created to guide thinking
and decision making. The frameworks that are selected for use may differ, but they serve a common
purpose – to assist the users to evaluate conflicting points of view and reach a judgement based on
logic and reasoning.
Today many people develop careers as bioethicists. They work towards developing guidelines to
assist individuals, healthcare providers, conservationists and global communities to make decisions
about biological issues that pose moral dilemmas. Bioethicists come from a variety of backgrounds,
including lawyers, scientists, doctors, nurses, philosophers, social workers, theologians and educators.
They may be employed by governments, hospitals and universities. Although bioethicists may disagree
on certain points of view among themselves, they generally agree on a basic set of guidelines, referred to
as the basic principles of ethics. These principles are summarised in Table 8.1, along with questions to help
users decide whether a procedure is ethical.
9780170408851 CHAPTER 8 » BIOTECHNOLOGY 273
08_bio_InFocus12_2e_sb_08851_txt.indd 273 08/08/18 7:09 pm
INVESTIGATION 8.2
Secondary-source investigation to research an ethical issue
BACKGROUND INFORMATION
Critical and Many people regard golden rice as an example of how biotechnology can be used to help developing
creative thinking
nations, while others think it is a risk to humans and the environment. Questions of whether resources such
Information and as golden rice should be privatised by companies with intellectual property rights have further fuelled the
communication debate. Are there other ways to address this issue that would promote the use of genetic engineering to
technology
capability alleviate hunger in developing nations? Traditional technologies worked for some nations – for example, the
large-scale use of fertilisers and pesticides, as well as improved seeds and livestock, increased agricultural
production in the USA and Europe to a level where there is more than enough to feed people. Are there new
Sustainability
unexplored technologies that may be better?
Ethical AIM
understanding
To conduct research to answer the question: Can genetic engineering biotechnology solve the problem of
Civics and world hunger?
citizenship
METHOD
Personal and
social capability
1 As a group, begin by researching genetically modified organisms such as golden rice (and other genetically
modified foods produced using biotechnology). Use this researched information and the information
provided in Table 8.1 to assist you in making a decision. You may wish to start by using the search phrase,
‘the politics of golden rice’.
2 Investigate issues such as:
• Does this biotechnology pose risks to humans and the environment?
• Should resources such as this be privatised, with intellectual property rights?
• Should a small number of companies control much of the seed?
• Are there other technologies that may be better used to combat poverty and hunger and bring a
balance of power and economy?
3 Discuss the issue as a group. Listen with focus as each student expresses his or her own opinion as an
evidence-based argument. There is no need for the group to reach consensus.
4 Individual work: Use the results of your research and group discussion to write your own one-page answer to the
question posed in the aim of this investigation.
Using examples, evaluate the potential benefits of researching genetic technologies.
In your answer:
a Identify the issue and the decision to be made.
Ethics matrix
b Describe the technology that is causing the issue, advantages, disadvantages and why it raises moral
Students compare
three systems of dilemmas.
livestock production
with organic farming,
c Present the facts – what information is needed to make an informed decision about this issue?
which is more d Present your opinion, explaining whether your opinion changed over the course of the investigation
humane but also
more expensive. (and, if so, why). What are the opinions of others in your group?
They evaluate each,
answering questions e What other options (alternative outcomes) are there for this issue? Identify both positive outcomes and
based on an ethics unacceptable outcomes for this issue.
matrix.
f Make your decision, and close with a statement justifying it.
EX TENSION
Complete the interactive exercise found in the weblink.
274 MODULE SIX » GENETIC CHANGE 9780170408851
08_bio_InFocus12_2e_sb_08851_txt.indd 274 08/08/18 7:09 pm
KEY CONCEPTS
● Biotechnologies have social, financial, environmental, legal and ethical impacts.
● Bioethics is the application of ethics to the science and practice of biology.
● The world’s population is growing and food shortages may be addressed by using GM food.
● A framework of ethical principles may be applied when making ethical decisions in biology.
CHECK YOUR
1 Define the following terms: UNDERSTANDING
a bioethics
b bioethicist
8.2
c contentious issue.
2 Outline the four basic principles that are used to guide ethical decision making.
3 Outline the advantage of golden rice over normal rice.
4 Explain how golden rice has been genetically engineered.
5 List three contentious issues surrounding the use of golden rice for humanitarian purposes.
Future directions and benefits
8.3 of research
Biotechnology is constantly evolving. The techniques and applications used today are far more
complex and precise that those used just ten years ago. As new discoveries advance scientific
CRISPR
knowledge and understanding, we can predict the impact of future biotechnology on individuals,
society and the environment. These new discoveries include advances in biotechnology that
have been developed for agriculture, medicine and industry.
Shutterstock.com/ibreakstock
One of the most recent developments in biotechnology that has enormous implications for
the future is a new genome editing technique called CRISPR (Clustered Regularly Interspaced
Short Palindromic Repeats). The CRISPR enzymes were discovered in bacteria, where their
role was to ‘chop up’ the DNA of invading viruses. CRISPR-Cas 9 is an enzyme that can be used
to snip DNA at a particular base, so it can then be attached to a ‘guide’ RNA (Fig. 8.20) that
targets a specific complementary nucleotide sequence in the genome to which it will be added.
As a result, genes can now be spliced and inserted with pinpoint accuracy, opening up a host of
possibilities, such as uncovering genes that are instrumental in causing neurological disorders FIGURE 8.20 Graphical
such as Alzheimer’s disease and schizophrenia. However, the easy use and accuracy of CRISPR representation of CRISPR-Cas9
protein with guide RNA
also raises concerns about germline gene editing and the creation of ‘designer babies’.
INVESTIGATION 8.3
Secondary-source investigation of the future direction
of biotechnology
Boosting wheat
fibre
BACKGROUND INFORMATION
Hybridisation
The rapid evolution of biotechnological applications is exciting, but also potentially threatening. Genetic techniques to protect
against bowel cancer
technologies may be used for the benefit of humankind, but there is also the possibility of misuse, to the detriment and autoimmune
of humans and the environment. Does the threat of abuse of a technology mean we should not explore it further? disease such as type II
diabetes
What are the difficulties in trying to establish and enforce international laws to regulate the use of biotechnologies?
9780170408851 CHAPTER 8 » BIOTECHNOLOGY 275
08_bio_InFocus12_2e_sb_08851_txt.indd 275 08/08/18 7:09 pm
AIMS
To research future directions in the use of biotechnology
To evaluate the potential benefits of researching these technologies
Use of urine
Explore the possibility METHOD
of extracting nitrogen
and phosphorus from
urine, for potential use
1 Use secondary sources to research in detail three examples of future directions of the use of biotechnology.
in fertilisers. Select examples from different fields – agriculture, conservation, medicine and industry.
2 Summarise your findings in a table. Use Table 8.2 as a guide.
Sea-quence TABLE 8.2
Sea-quence is a TECHNOLOGY FUTURE DIRECTION FOR USE POTENTIAL BENEFIT OF RESEARCHING THIS TECHNOLOGY
project to sequence
the genomes of 1
nine reef-building
corals, together with 2
symbiotic microbes.
The information may 3
be used to stop coral
loss on the Great
Barrier Reef.
3 Use an appropriate referencing style to acknowledge your sources.
CONCLUSIONS
Based on the information you have gathered, write a statement in which you evaluate the potential benefits of
researching biotechnologies.
You are encouraged to find your own resources, but some are given here in weblinks as a starting point or
to generate ideas.
8.4 Changes to Earth’s biodiversity
Biodiversity is critical in maintaining healthy ecosystems and thereby sustaining plant and animal life on
Fighting animal Earth, including human life. Biologists and breeders in agriculture realise they need to conserve diversity
extinction
in living organisms for the long-term survival of species and to feed the growing human population.
Animal parents ‘from
the grave’ may have Modern biotechnology gives humans the potential to alter the path of evolution by artificially
their DNA introduced
once again into the combining the qualities of organisms that were once separate species (for example, by creating transgenic
gene pool. species). This could increase biodiversity in the short term, by introducing new gene combinations in the
population and new genes in individuals. In the long term, however, biodiversity will be reduced if these
organisms with desirable characteristics are reproduced and bred, using reproductive technologies such
Sustainability
as cloning and selective breeding.
Another concern is that wild varieties of plants and animals may cross-breed with genetically
Ethical
understanding engineered ones, which has the potential to affect Earth’s biodiversity.
You have seen in this chapter that biotechnology can be applied to save species that are on the brink
Personal and of extinction, improve biodiversity in farming practices and alleviate hunger in resource-poor areas of the
social capability world, at the same time putting into place biodiversity conservation measures to ensure future resilience
in these species.
A major disadvantage of biotechnologies such as selective breeding, cloning and genetic engineering
WS
is the potential to reduce genetic diversity in the long term and therefore increase the risk of populations
Use of modern
being wiped out in response to disease or a sudden environmental change.
biotechnology in If humans influence the path of evolution to the extent that species become extinct, human
conservation: White
rhinos survival may also be compromised. A balanced ecosystem with a wide diversity of species is needed.
276 MODULE SIX » GENETIC CHANGE 9780170408851
08_bio_InFocus12_2e_sb_08851_txt.indd 276 08/08/18 7:09 pm
The survival of genetically engineered organisms depends
AAP Image/Joe Castro
on how well they compete with wild-type species in nature. If
their genes are advantageous to the population, the frequency
of these genes in the gene pool will increase, but the downside
of this is that they may out-compete natural species and result
in the extinction of those species.
Our ability to apply biotechnology to prepare genetically
modified organisms for epidemics by further genetically
transforming them with genes for resistance to diseases may
prove too costly and time-consuming.
To overcome the threat of reduced diversity, stocks of varied
cattle are being maintained, and germplasm of plants and FIGURE 8.21 Australia’s first genetically modified Holstein calves,
gamete material of animals is being banked, so that a variety of Holly, Molly, Lolly and Jolly, cloned for their high-protein milk, with
Dr Ian Lewis, who collaborated in the project.
genomes is available if needed in future – for example, in case of
unprecedented events.
INVESTIGATION 8.4
How do genetic techniques affect Earth’s biodiversity?
Using information you researched throughout this chapter, produce a multimedia presentation to answer the Genetic
technologies
inquiry question at the start of this chapter: How do genetic techniques affect Earth’s biodiversity? Use a range Use this link to work
of well-selected images to illustrate your answer. through interactive
activities and learn
Work though at least one of the weblinks provided here to further broaden your understanding before more about genetic
completing this task. technologies, including
conservation genetics.
KEY CONCEPTS
● CRISPR is a new gene editing tool that is very precise, and also contentious because it can be
used in human gene editing.
● Using CRISPR, genes can be spliced and inserted with pinpoint accuracy.
A bigger toolbox:
● Future directions for research include the use of: Biotechnology
– gene therapy to treat human disease in biodiversity
conservation
– GMOs to alleviate hunger
– plant banks and animal cryopreservation to maintain biodiversity in agriculture and for
wildlife conservation
– plant- and algae-based resources to develop next-generation biofuels.
● Loss of biodiversity is a major concern, and biotechnology can be used in breeding programs to
counteract this.
1 Outline how the technology known as CRISPR Cas-9 works.
CHECK YOUR
UNDERSTANDING
2 List three future directions and benefits of biotechnology.
3 Describe a case study where biotechnology has been used for conservation purposes. 8.4
9780170408851 CHAPTER 8 » BIOTECHNOLOGY 277
08_bio_InFocus12_2e_sb_08851_txt.indd 277 08/08/18 7:09 pm
8 CHAPTER SUMMARY
Biotechnology: How do genetic techniques affect Earth’s biodiversity?
BIOTECHNOLOGY: USES AND APPLICATIONS
Past (ancient) Past (classical)
• Food production – use • Fermentation
of living cells to make • Plant and animal
bread, cheese and wine selective breeding
• Medicine • Agriculture
• Crop and animal • Medicine and
domestication antibiotic
• Aboriginal people and production
aquaculture
Foreign DNA A T
(e.g. human) A
Present (modern) T
T
A
A
Cut Sticky A
C G end G
G C C
Cut
A T
Technology to manipulate
DNA
• DNA splicing A
T
T
A
DNA
segment T
T A Cut cut by T Sticky A
• DNA amplification C G restriction
C
G
end T
T
A
G
Cut G C C
enzyme C
• Recombining DNA A T G
Technology to analyse and visualise Foreign DNA
segment T
DNA A
T Cut T
inserted into
plasmid and C
T A
A
A A G G
T
• Gel electrophoresis and gene probes T
C A
Plasmid cut
by restriction
T
T
joined by
DNA ligase
C
C
G G
• DNA sequencing Cut
A G
enzyme G
T
• DNA profiling G
C
A
A A
A
G G Recombinant plasmid
C A C
T
Bacterial plasmid
Applications of modern biotechnology
Conservation Industrial Agricultural Medical
278 MODULE SIX » GENETIC CHANGE 9780170408851
08_bio_InFocus12_2e_sb_08851_txt.indd 278 08/08/18 7:10 pm
Future directions and potential benefits
Potential benefits to Using CRISPR,
society of research genes can
using genetic be spliced
technologies and inserted
with pinpoint
accuracy.
Potential benefits
• Gene therapy to treat human disease
• Genetically modified food to alleviate hunger
• Plant banks and animal cryopreservation to maintain
biodiversity and for wildlife conservation
• Plant and algae-based resources to develop next-generation
biofuels
Changes to Earth’s biodiversity due to genetic techniques
Short term changes:
• Increase biodiversity by introducing new gene combinations.
Long term changes:
• Decrease biodiversity by selectively breeding desired gene
combinations. Breeding programs, plant banks are being
developed.
FUTURE BIOTECHNOLOGY
Ethics and social implications (plant and animal uses)
Making an ethical decision
Benefit and non-harm Individual rights and
autonomy
Privacy and societal
perception Equity and justice
9780170408851 CHAPTER 8 » BIOTECHNOLOGY 279
08_bio_InFocus12_2e_sb_08851_txt.indd 279 08/08/18 7:10 pm
8 CHAPTER REVIEW QUESTIONS Qz
Review quiz
1 Define ‘biotechnology’. 12 Outline two ways in which genetic engineering helps
conserve endangered animals.
2 Outline one ancient Aboriginal use of biotechnology.
13 Create a flow chart to outline the production of
3 Explain how agriculture began and why breeding of
recombinant DNA.
animals with desired characteristics can be described as
biotechnology. 14 Predict whether the following cuts made by restriction
enzymes will produce sticky or blunt ends. The arrows
4 Outline three biotechnology practices carried out
show where the cuts occur in the double-stranded DNA.
thousands of years ago (other than selective breeding).
5 Why are antibiotics considered to be biotechnology? a TCCGCGGA b AGGGCCT c GCGGCCGC
6 Discuss how the use of fermentation has evolved as a AGGCGCCT TCCCGGA CGCCGGCG
form of biotechnology.
7 Describe three ways in which genes can be manipulated. 15 Explain how you could use biotechnology to design and
implement a breeding program that minimises inbreeding
8 Explain the purpose of gel electrophoresis and PCR in
of an endangered species.
gene manipulation.
16 Evaluate whether the use of genetically modified food
9 Outline two techniques that can be used to visualise DNA.
is ethical from a consumer’s point of view and from the
10 Distinguish between the use of selective breeding and perspective of alleviating hunger in the world.
genetic engineering in creating crops or livestock with
17 Answer the inquiry question: How do genetic techniques
greater yields.
affect Earth’s biodiversity?
11 Explain why seed banks have been established in different
places in the world.
280 MODULE SIX » GENETIC CHANGE 9780170408851
08_bio_InFocus12_2e_sb_08851_txt.indd 280 08/08/18 7:10 pm
9 Genetic technologies
INQUIRY Students:
QUESTION
• investigate the uses and advantages of current genetic technologies that induce genetic change
Does artificial • compare the processes and outcomes of reproductive technologies, including but not limited to: S
manipulation of DNA – artificial insemination
have the potential to – artificial pollination
change populations • investigate and assess the effectiveness of cloning, including, but not limited to: EU ICT
forever? – whole organism cloning
– gene cloning
• describe techniques and applications used in recombinant DNA technology, for example: EU CCT
– the development of transgenic organisms in agricultural and medical applications (ACSBL087)
• evaluate the benefits of using genetic technologies in agricultural, medical and industrial applications
(ACSBL086) S EU
• evaluate the effect on biodiversity of using biotechnology in agriculture S
• interpret a range of secondary sources to assess the influence of social, economic and cultural contexts on a
range of biotechnologies EU ICT IU DD
Biology Stage 6 Syllabus © NSW Education Standards Authority for and on behalf of the Crown in right of the State of New South Wales, 2017
Shutterstock.com/koya979
9780170408851 281
09_bio_InFocus12_2e_sb_08851_txt.indd 281 08/08/18 7:10 pm
For centuries, humans have been able to alter the gene pool through selective breeding, hybridisation,
artificial pollination and artificial insemination. With an increased understanding of DNA and gene
expression, cloning and recombinant technologies are now possible and scientists can induce desirable
genetic changes for the benefit of the human population. This chapter explores some of the processes and
techniques used with these technologies and investigates their impacts on society and the environment.
FIGURE 9.1
Getty Images/iStock/xubingruo
WS Scientists are now
able to artificially
Genetic manipulate DNA
technologies
Processes and outcomes of
9.1 reproductive technologies
Humans have been trying to breed improved animals and plants for agricultural purposes for thousands
of years.
Selective breeding
Selective breeding in animals, in its most basic form, involves mating a male that displays at least one
desirable characteristic with a female that displays at least one other desirable characteristic, in the
hope that some offspring will inherit the desired favourable genetic
traits from both parents. For example, crossing a Friesian bull
Getty Images/UniversalImagesGroup
(female Friesians are known for their production of large quantities
of milk) with a Jersey cow (which produces creamy milk) will result
in some offspring that produce large amounts of creamy milk.
Offspring that have both these desirable traits are then selected for
further breeding. In selective breeding, both parent individuals are
different varieties of the same species, so the offspring produced
are fertile. Selective breeding may have the advantages of hybrid
vigour (Chapter 8), but may also introduce some disadvantages. For
example, if undesirable genes are inherited together with desirable
traits, it is possible that some hybrid cows from a Friesian × Jersey
might grow large udders that make walking difficult and cause
FIGURE 9.2 Selectively bred cow with very large udder
ulcers where the udder and legs make contact (Fig. 9.2).
282 MODULE SIX » GENETIC CHANGE 9780170408851
09_bio_InFocus12_2e_sb_08851_txt.indd 282 08/08/18 7:10 pm
Another disadvantage of using whole
Shutterstock.com/Flaxphotos
animals for selective breeding is that it is time-
consuming and costly. It involves transporting
large animals over long distances. There is
always the chance that they will injure each
other or that they may not mate, or that it will
take a long time for the cow to become pregnant.
To overcome these problems, the technologies of
artificial insemination, in vitro fertilisation (IVF)
and multiple ovulation embryo transfer (MOET)
have been introduced.
Artificial insemination
Artificial insemination in animals involves
collecting sperm from a chosen male and
artificially introducing it into several selected
females. There are records of attempting artificial FIGURE 9.3 A liquid nitrogen bank filled with semen from a chosen bull, to be used to
impregnate cows
insemination in dogs in the early 1700s but it was
only from the 1980s onwards that it became a
commercial enterprise and became more widespread. This was due to research into, and discovery of,
the effective storage and transport of sperm. Semen containing the sperm is removed from the male Sustainability
(using mechanical stimulation or an artificial vagina), and the collected semen is divided into semen
straws, chilled and then frozen in liquid nitrogen for long-term storage and transportation (Fig. 9.3).
When it is time to transfer the semen to the female, the semen straw is thawed and placed in a sterile
artificial insemination ‘gun’. The gun is carefully inserted into the vagina to the cervix, where the semen
is deposited.
The outcomes
Transporting frozen sperm overcomes the problem of transporting large animals over long distances, is
cost-effective and reduces the danger to animals of injury in transit or during mating. Many females can
be inseminated and so one male can sire offspring with several females. Because the semen can be frozen
indefinitely, a male can still produce offspring many years after the animal has died. For example, Dutch bull
Sunny Boy produced 1.7 million units of semen in the 1990s and offspring were produced for many years
after his death. An American stud bull, Toystory, holds the current record. He produced 2.4 million units
of semen and has sired 500 000 daughters in 50 countries to date. There
are only 50 bulls worldwide who have produced more than a million units of
Newspix/John Casamento
semen. These statistics lead to questions about changing biodiversity.
Artificial insemination is also being used in conservation, to increase
the numbers of endangered species. Monash University PhD student
Jonathan Daly conducted the first artificial insemination of a shark (using
a broad-nosed seven-gill shark as a model species) in trying to develop a
technique to apply to grey nurse sharks, whose numbers are dwindling
on the east coast of Australia. Mzuri, a male gorilla, was the first gorilla
born (in June 1984) using this reproductive technology, which was carried
out at Melbourne Zoo by Professor David Galloway of the University of
Melbourne (Fig. 9.4).
Artificial insemination can be costly, due to the requirement for
specialised equipment, and it is time consuming and has the potential to FIGURE 9.4 Baby gorilla Mzuri was born as the result
cause injury to the female if carried out incorrectly. The disadvantage with of artificial insemination at Melbourne Zoo.
9780170408851 CHAPTER 9 » GENETIC TECHNOLOGIES 283
09_bio_InFocus12_2e_sb_08851_txt.indd 283 08/08/18 7:11 pm
the greatest consequences, however, is the reduction in genetic diversity within populations throughout
the world.
The advantages of artificial insemination far outweigh the disadvantages. It has become the
principal method of assisted reproductive technology for many types of cattle, sheep and pigs, as well as
performance and sport horses around the world.
With the use of selective breeding techniques such as artificial insemination, humans alter the
genetic composition of the breeding population, by selecting individuals with traits considered by
the breeder to be advantageous, and carrying out controlled breeding of these individuals. As a result,
individuals with the desired phenotypes have new combinations of alleles that are introduced into the
population and these offspring are in turn selectively bred. The alleles that increase in frequency in
the gene pool of the population are therefore those that have been selected by the breeder rather than
by nature. An individual’s survival and reproduction within the population depend on the presence of
alleles that enable them to increase the output of a product that is useful to humans, rather than alleles
that increase their fitness in terms of suitability to the environment or reproductive success. Because the
selected offspring are fertile, these new combinations of alleles can be passed on to future generations.
In vitro fertilisation
In vitro fertilisation (IVF) differs from artificial insemination in that an egg is fertilised by a sperm outside
the mother’s body (in an artificially created environment, such as a Petri dish). The resulting zygotes
are cultured until they have progressed to an early stage of development. They are then transferred
into the biological mother, a surrogate mother or frozen in liquid nitrogen for later transplantation or
MOET is multiple for use in scientific research. IVF is often carried out in conjunction with MOET to maximise the high
ovulation embryo
transfer.
genetic merit of female cattle. MOET allows cows, which normally give birth once a year, to become stud
breeders when surrogate mothers are used. Direct embryo transfer is the final stage of IVF, where the
fresh or frozen cultured embryo is transferred into the uterus. Insertion of the embryo is done using a
thin tube called a catheter, which deposits the embryo into the uterine lining.
This method is often used in cases where there is decreased fertility in one or both of the parents.
In vitro fertilisation has the following effects:
1 Genetic diversity of populations is reduced due to the production of large numbers of viable embryos
from a small selection of parent animals with desirable traits. (See page 291 for more detail.)
2 Genes for infertility, which would not naturally have been passed on, are now inherited by offspring.
It is important to consider whether humans are breeding infertility into a population by assisting
reproduction with reproductive technologies such as in vitro fertilisation. This is the opposite of
natural selection, where the frequency of genes that enhance fertility tend to increase.
3 Sperm banks have the potential to alter the genetic composition of a population, in animals and in
humans. People can choose the sperm donor they prefer, based on a list of his traits. This may increase
the frequency of certain donor genes within the population (for example, in humans, academic
ability or physically attractive features) and reduce the frequency of those seen as unfavourable.
Elimination of certain genes means other important alleles may be lost (such as those associated
with creativity or disease resistance).
Artificial pollination
Records show that selective breeding in plants, or artificial pollination, was used in ancient times –
an Assyrian carving that dates back to 870 BCE shows the artificial pollination of date palms. Artificial
pollination was used by Mendel in his experiments with pea plants in the 19th century and was used by
scientists, such as William Farrer, who were involved in hybridisation studies; and it is still used today.
In the past century, thousands of new breeds of plants have been created using artificial pollination.
284 MODULE SIX » GENETIC CHANGE 9780170408851
09_bio_InFocus12_2e_sb_08851_txt.indd 284 08/08/18 7:11 pm
The process
Alamy Stock Photo/Edward Parker
The process of artificial pollination involves removing
the stamens of a flower and dusting the pollen onto
the stigma of the same flower or another flower on the
same plant (self-pollination) or a flower on a different
plant (cross-pollination). As with the other selective
breeding processes discussed in this chapter, this
gives the breeder a greater degree of control over the
breeding process.
Artificial hand pollination (Fig. 9.5) is an
important horticultural technique that enables the
production of offspring with specific favourable
characteristics, such as disease-resistant fruit. In
order to ensure a greater yield of crop and seeds,
FIGURE 9.5 Artificial pollination by hand
humans have artificially pollinated almond crops
and date crops for thousands of years.
The process enables the creation of new varieties
©Anna Haldewang/SCAD
of plants, but its overuse can lead to crops that are
too similar, thus reducing biodiversity. The corn
blight that occurred in the USA in 1970 is an example
of the impact of a reduction in genetic diversity and
increased susceptibility to disease in a crop species.
The outcome
Many crop plants worldwide depend on insect
pollination. Insufficient pollination will reduce
fruit and seed yield, and can affect the quality of
the offspring in both growth rate and resistance
to herbivores. Researchers compared artificially
pollinated gooseberries with those pollinated
by insects. Compared to the hand-pollinated
plants, the insect-pollinated plants had larger
fruit and greater seed germination rates. As bee
populations around the world decline, scientists
are currently looking at drone pollinators (Fig. 9.6),
which have a sticky surface to take pollen to the
flower to ensure direct pollination.
Artificial pollination is often used to produce
hybrid plants. The development of maize (corn) has
produced a hybrid with an increased growth rate, FIGURE 9.6 Drone pollination of flowers is being explored by scientists.
greater uniformity and increased yield.
Evidence shows that artificial pollination increases
genetic variability within populations due to the creation of hybrid species. The use of artificial pollination
to create hybrids is an area where genetic diversity increases – new combinations of alleles are introduced
into the gene pool of a population. For example, wheat hybrids were created by crossing Purple Straw
variety 14A and a Fife–Indian wheat variety, Yandilla, to create a new variety called Federation. New gene WS
combinations can be passed on to future generations if the hybrids are fertile, increasing their frequency
Selective breeding
in the gene pool and thereby altering the genetic composition of the population. (Remember that in in wheat
hybridisation within a species, the resulting hybrids are fertile, as opposed to hybridisation across species,
where the offspring are usually infertile.)
9780170408851 CHAPTER 9 » GENETIC TECHNOLOGIES 285
09_bio_InFocus12_2e_sb_08851_txt.indd 285 08/08/18 7:11 pm
INVESTIGATION 9.1
Modelling and comparing the processes and outcomes of artificial
pollination and artificial insemination
In this investigation, you will use a model to illustrate the differences in the processes used and the outcomes
of reproductive techniques. A model is a visual or physical representation (Chapter 1, page 5) and can include
illustrations and diagrams, a three-dimensional model or a digital model.
Artificial METHOD
pollination
Select or create a model to illustrate the processes used for each reproductive technique example and the
outcome of the process.
Ensure that the model is labelled so that it clearly compares the processes and outcomes of each of the
reproductive techniques.
See the weblinks as a resource for this activity.
Artificial
insemination RESULTS
Ensure that your model is appropriately labelled or coded and that the similarities and differences between the
processes and outcomes are clearly shown.
Models in biology PEER REVIEW OF THE MODEL
and their purpose Use the following template to evaluate another student’s work by indicating positive aspects as ‘warm’
are dealt with in
more detail in feedback and aspects that don’t match the criteria as ‘cool’ feedback. Use the feedback to design
Chapter 1, page 5. improvements to your own model.
PEER FEEDBACK
Warm feedback
Cool feedback
CONCLUSION
Evaluate your model. Consider the feedback from the peer review exercise: are there any improvements to the
model that should be made?
KEY CONCEPTS
● Artificial insemination involves the process of inserting semen into the vagina of an animal. It
allows for animals with desired characteristics to produce offspring.
● Artificial selection is a process that has enabled the selection of specific characteristics in
animals for the benefit of humans.
● Artificial pollination involves the dusting of pollen by hand, from the anthers to the stigma
of the same flower or a different flower. This enables the plant breeder to control the
characteristics of the plants being bred.
● Artificial pollination has been used to produce plants with specific traits that are beneficial for
humans.
● The aim of reproductive technologies is to pass on desirable characteristics to the next
generation.
286 MODULE SIX » GENETIC CHANGE 9780170408851
09_bio_InFocus12_2e_sb_08851_txt.indd 286 08/08/18 7:11 pm
1 Define the following reproductive technologies and provide an example of each.
CHECK YOUR
UNDERSTANDING
a selective breeding
b artificial insemination 9.1
c in vitro fertilisation
d artificial pollination
2 List three outcomes of the reproductive technologies named in Question 1.
3 State the main difference between within-species hybridisation and between-species hybridisation.
9.2 Cloning
Selective breeding as described in the previous section relies to some extent on trial and error – hoping
that the desired combination of favourable genes ends up in some individuals. A modern-day technology
that overcomes the trial-and-error nature of selective breeding is cloning. Cloning is the production of an
exact copy.
Two forms of cloning are discussed in this chapter.
◗ Gene cloning occurs at a cellular level and involves producing identical copies of one gene. Multiple
copies of a gene are needed for genetic engineering and biotechnological research.
◗ Whole-organism cloning, also known as reproductive cloning, involves creating a genetically identical
(whole) organism, using a somatic cell (or a few somatic cells) from another mature organism. Whole-
organism cloning is a form of asexual reproduction and so it is considered a reproductive technology.
Other forms of cloning include cell cloning, which is used for unicellular organisms, and molecular
cloning, which is used in recombinant DNA technologies.
Gene cloning
In gene cloning, scientists select a gene, remove it from the source DNA and insert it into the DNA of
another organism, to make identical copies of that gene. This technique is used in the production of
insulin on a large scale.
The simplified steps involved in the process of gene cloning are outlined below and in Figure 9.7.
1 The gene (section of DNA) is cut from the source organism using restriction enzymes (enzymes
produced by bacteria).
2 The gene is pasted into a vector DNA or plasmid by a process known as ligation (ligase enzymes are
used to join fragments of DNA).
3 The plasmid containing the gene is introduced to a host cell by a process called transformation.
4 The host cell can now make copies of the vector DNA when it makes copies of its own DNA.
Polymerase chain reaction (PCR) is a form of in vitro DNA cloning (carried out in a test tube rather
than a living organism). PCR is used widely in research and has many genetic applications. It amplifies
a particular DNA sequence and makes multiple copies that can then be used in various research and
analysis techniques. PCR involves a process of thermal cycling to denature the DNA strand and the use of
complementary primers that locate and duplicate the required section of DNA. The three processes are
denaturing, annealing and extension (Fig. 9.8) to make multiple copies of the segment of DNA.
9780170408851 CHAPTER 9 » GENETIC TECHNOLOGIES 287
09_bio_InFocus12_2e_sb_08851_txt.indd 287 08/08/18 7:11 pm
FIGURE 9.7 The
process of gene
cloning Cell of source organism,
with desired gene
Chromosome with DNA
1 Desired gene is cut from
source cell.
Bacterium
2 Gene is inserted into plasmid.
Recombinant DNA
Bacterial Plasmid (plasmid)
Desired gene
chromosome
3 Plasmid is inserted
into host (bacterial)
cell (transformation).
4 Host cell replicates,
making copies of
desired gene.
BioNinja.com.au
FIGURE 9.8 PCR components PCR process
Polymerase chain
reaction C G
A T 95!C
DNA sample Primers Nucelotides
1. Denaturing
55!C Strands separate
Taq polymerase Mix buffer PCR tube
2. Annealing
72!C Primers bind template
Thermal cycler
3. Extension
New strand synthesised
288 MODULE SIX » GENETIC CHANGE 9780170408851
09_bio_InFocus12_2e_sb_08851_txt.indd 288 08/08/18 7:11 pm
Whole-organism cloning
The first mammal to be artificially cloned from an adult cell was a sheep named Dolly, born on 5 July 1996
at the Roslin Institute in Edinburgh, Scotland. Dolly was cloned from mature cells taken from the udder
of a 6-year-old sheep. It is the age of the parent animal from which modern-day clones are produced that
makes this process so remarkable. Embryo-splitting leading to multiple births occurs naturally and can
be fairly easily replicated in a laboratory. However, cloning from adult cells (of living or even deceased
organisms) does not occur in nature. The main difficulty faced by scientists who produce clones from
adult cells is that certain genes, especially those needed for development, have been ‘switched off ’ or
shut down in differentiated cells and so they need to be ‘switched on’ or reprogrammed for development.
Cloning techniques
The methodology for cloning was tested, proven and patented in 1996. It took about 276 attempts
before the success of Dolly the sheep. The rate of success, although improving, is still low. This makes
cloning a very expensive technology. Since the
start of the 21st century, many mammals have
AAP Image/AP/Oregon Primate Research Center
been cloned, including Tetra, a rhesus macaque
born in 2000 and the first primate cloned
(Fig. 9.9). The first cloned horse, Prometea, was
born in Italy in 2003. The international rules of
horse racing do not permit artificial insemination
or fertility treatment for the breeding of horses,
so it is unlikely that cloning will be acceptable in
horse racing in the near future.
Cloning is most commonly used in
agriculture. For example, beef from cloned
cattle is available in supermarkets in Japan, and
seedless grapes, consumed worldwide, are a FIGURE 9.9 Tetra, the first cloned primate, was cloned via
product of plant cloning. embryo splitting.
Somatic cell nuclear transfer
Whole-organism cloning (reproductive cloning) is also known as somatic cell nuclear transfer (SCNT).
Each time a mammal is cloned, the SCNT process involves three animals: one that donates the nucleus,
one that acts as an egg donor and one that plays the role of surrogate mother. Modelling
whole-organism
Ian Wilmut and his team used the method of SCNT described below to create Dolly the sheep cloning
(Fig. 9.10).
1 Cells were taken from the udder (mammary glands) of a six-year-old ewe (sheep number 1). These
cells were starved of nutrients to stop them dividing.
2 The nucleus was removed from a healthy unfertilised egg from another sheep (sheep number 2), a
process called enucleation.
3 The udder cell with a nucleus, taken from sheep 1 was injected into the enucleated egg of sheep 2. The
two cells were then treated with electricity, which caused the cells to fuse or blend together to form
a ‘fertilised’ egg cell. This cell underwent normal growth and development, dividing by the process
of mitosis. As the cells continued to divide, the resulting ‘embryo’ was implanted into the uterus of a
third sheep (sheep number 3), who was the surrogate mother. The embryo developed and was born as
a genetically identical twin to sheep 1, the original sheep that donated the cell from its udder.
9780170408851 CHAPTER 9 » GENETIC TECHNOLOGIES 289
09_bio_InFocus12_2e_sb_08851_txt.indd 289 08/08/18 7:11 pm
Nucleus containing
source DNA
4
1
Mammary cell is inserted
Mammary cell is extracted into the enucleated egg cell.
and grown in a laboratory.
5
Electric shock opens cell
membranes and triggers
cell division.
3
Egg cell is extracted. Nucleus is removed
2
from egg cell with a
micropipette.
Preparation Cell fusion Cell division
Embryo
8
After a five-month
pregnancy, a lamb
genetically identical
to the sheep from
which the mammary
cell was extracted is
born.
6 Embryo begins to Embryo is implanted
7
develop in vitro. into surrogate mother.
Development Implantation Birth of clone Growth to adulthood
FIGURE 9.10 The process of somatic cell nuclear transfer in sheep
A second technique used in whole-organism cloning is artificial embryo twinning. This is a relatively
inexpensive technique: a short time after fertilisation, the embryo is split into two before the cells become
specialised. Splitting is done in the laboratory and the embryos are then implanted into a surrogate to
develop. The embryos that develop are genetically identical. This technique is used extensively in cattle
production.
In horticulture, the cloning of plants is common practice and plant propagation has a long history.
Plant propagation involves using a cutting of an existing plant and growing it to form a new plant. Both
plants are genetically identical. The propagation of grape vines is a practice that dates back to early
European civilisation. The technique conserves the variety and is often faster than growing another
plant from seed.
290 MODULE SIX » GENETIC CHANGE 9780170408851
09_bio_InFocus12_2e_sb_08851_txt.indd 290 08/08/18 7:11 pm
Tissue culture is another cloning technique used in horticulture. Small portions of plant tissue
are grown in solid growth medium or nutrient agar broth until they are ready to be transplanted. The
technique is called micropropagation.
Cloning: a contentious issue
Cloning is not a new phenomenon – identical twins are naturally produced genetic clones and occur in
every animal species studied for this phenomenon. Cloning is also common in plants – botanists have
been using cuttings, the splitting of bulbs and other forms of asexual reproduction to propagate plants
for many centuries. Bananas are also clones of each other and vastly different from their ancestral stock.
They have a very limited gene pool. Animals were first cloned a century ago, when two-celled embryos of
sea urchins and salamanders were split.
When assessing ethical issues in cloning, you need to consider which type of cloning is being assessed,
as the processes vary. Ethical issues are often centred around whole-organism and human cloning rather
than gene or cell cloning.
Some of the ethical issues involved in cloning include the following:
◗ Concern for animal welfare – there are already concerns about the treatment of animals in large-scale Ethical
understanding
farming, which many feel would be exacerbated by cloning animals for food production.
◗ The same techniques used to clone animals could be used to clone humans. This raises moral
concerns as well as religious and legal concerns.
◗ There is the religious argument that, in cloning animals, humans are ‘acting as God’.
◗ There are unforeseen health risks for cloned animals that are yet to be considered.
◗ Reproductive cloning is an expensive procedure, which limits access to this technique.
Cloning alters the genetic composition of a population
In agriculture, cloning is used as a form of selective breeding once an ‘ideal’ hybrid has been obtained.
The advantage of cloning is that it reduces the ‘unknown’ element in selective breeding – the
characteristics being bred can be precisely controlled. It also allows the desired characteristic to be
reproduced in a short space of time, making it an efficient method of obtaining desired characteristics
in organisms.
However, cloning reduces genetic diversity in populations, as organisms produced by
reproductive cloning are derived from only one parent (an artificial form of asexual reproduction)
and are genetically identical to the parent. Only a few parent animals may be cloned, so if many
clones are produced from only a few parent organisms, genetic diversity is reduced, as all the
organisms have identical DNA. After continued selective breeding, the cloned organism becomes
the predominant organism. Cloning ensures that identical combinations of genes (that is, entire
genomes) are conserved within a population. It therefore increases the frequency of these genotypes
within the population and, as a result of artificial selection, natural gene combinations that are not
selected will gradually disappear.
In nature, genes are conserved by evolution only if they serve an essential function for the organism.
For example, the genes for cytochromes (proteins essential for chemical respiration) are conserved
because, if they are altered by mutation, the individual cannot survive. Therefore, a mutation in these
genes that altered the proteins would not be passed on to future generations. The disadvantage of
cloning is that, if all members of a species are identical, the population is less likely to survive any sudden
environmental changes and is vulnerable to foreign pathogens.
9780170408851 CHAPTER 9 » GENETIC TECHNOLOGIES 291
09_bio_InFocus12_2e_sb_08851_txt.indd 291 08/08/18 7:11 pm
INVESTIGATION 9.2
Secondary-source investigation to assess the effectiveness of cloning
Information and
communication In this secondary-source investigation, you will assess the effectiveness of different cloning techniques and
technology consider the ethical impacts of the development of cloning techniques.
capability
AIM
Ethical
understanding Write an aim for this investigation. What is the main purpose of this investigation?
METHOD
Use key terms to complete an Internet search and locate current examples of gene cloning and whole-
organism cloning. The examples in this chapter can be used as a guide.
Develop a set of criteria and construct a table similar to the one below to collect the data.
WHOLE DOES IT
ORGANISM ACHIEVE THE WHAT ARE
OR GENE DESIRED ARE THERE ANY IS IT COST THE ETHICAL
CLONING? EXAMPLE OUTCOME? LIMITATIONS? EFFECTIVE? CONSIDERATIONS? SOURCE
Learn genetics:
cloning, and click
and clone Use the weblinks as a starting point.
DISCUSSION
Discuss these questions as a class before writing your answers.
1 Of the examples investigated, which is the most effective? Justify your answer.
2 Which techniques are affected by ethical considerations? Give specific examples.
3 What factors did you consider when you were deciding on the effectiveness of each technique?
CONCLUSION
Write a conclusion that assesses the effectiveness of cloning.
KEY CONCEPTS
● Cloning involves the production of an individual that is genetically identical to one that already
exists.
● Two types of cloning are: whole-organism cloning and gene cloning.
● Whole-organism cloning (reproductive cloning) is used to create a genetically identical whole
organism.
● Gene cloning is used to produce identical copies of a specific gene.
● Cloning can be used as a form of selective breeding to produce organisms with specific desired
characteristics.
● A disadvantage of cloning is that all members of the cloned population are genetically identical
and therefore the population is susceptible to specific selecting agents.
CHECK YOUR
1 Distinguish between whole-organism cloning and gene cloning.
UNDERSTANDING
2 Outline a process used to clone whole organisms.
9.2 3 Explain the purpose of whole-organism cloning.
4 Explain why Dolly the sheep was a genetically identical twin, not the daughter, of sheep 1.
5 Describe a process used to clone genes.
292 MODULE SIX » GENETIC CHANGE 9780170408851
09_bio_InFocus12_2e_sb_08851_txt.indd 292 08/08/18 7:11 pm
9.3 Recombinant DNA technologies
The aim of recombinant DNA technology is to insert a gene from one species into the genome of another.
The process involves isolating DNA fragments from one genome using restriction enzymes, which can cut
DNA at a precise sequence of bases. These can be reassembled using a process known as ligation. DNA
pieces are joined using an enzyme called DNA ligase. The resulting DNA fragment is called recombinant
DNA, as it has been recombined with DNA from other sources.
The process of recombinant DNA technology is shown in Figure 9.11. The steps are as follows:
1 The required gene is isolated from a
cell. A A T T
G Plasmid DNA is cut open by restriction
2 A piece of circular DNA known as a
C
AA
TT enzyme, producing sticky ends.
Circular
plasmid is removed from bacteria.
G
C
plasmid A A
3 Two pieces of DNA are cut using the DNA
TT
G
AA
same restriction enzyme. TT
C
C
G
4 The fragments produced have
matching sticky ends (sections of
single-stranded DNA with exposed A AT T C G
nucleotide bases at the end of a G CTTAA DNA ligase joins DNA
Gene fragment is cut from fragment and plasmid DNA.
double-stranded molecule; Fig 9.12).
source by same restriction GA
5 The bacterial plasmid is cut at two enzyme so has matching TC A
T
G CT T
TT
points using the same restriction sticky ends. A
GA A
C
AAG
CT TA
enzymes.
6 As the sticky ends of the human Recombinant DNA
gene and the plasmid come
together, they can join up via base Plasmid is taken up by bacterial cell
via transformation.
pairing. This process is called
annealing.
Plasmid with Bacterial
7 DNA fragments are joined by foreign gene chromosome
the enzyme DNA ligase. Joined
fragments can form a circular Bacterial colonies
plasmid or a linear molecule. grown on agar
8 The plasmid is inserted back into a
bacterial cell, where multiple copies
of the gene can be produced.
Once multiple copies of the gene
have been produced, the gene can be
inserted into an egg cell of another
species and, after fertilisation, becomes Multiple copies
part of the newly formed organism’s of desired gene
DNA.
FIGURE 9.11 Recombinant DNA technology
9780170408851 CHAPTER 9 » GENETIC TECHNOLOGIES 293
09_bio_InFocus12_2e_sb_08851_txt.indd 293 08/08/18 7:11 pm
FIGURE 9.12 Sticky
ends of a piece of
DNA after being
cut by a restriction A A T T G C T
enzyme
C G A
Sticky ends
A G C
T C G T T A A
Delivering the gene
There are four main ways of inserting the desired gene into the genome of a species to be genetically
transformed:
1 micro-injection of DNA directly into the nucleus of a single cell – this is usually done under an optical
microscope to introduce DNA into egg cells when creating transgenic species (Fig. 9.13a)
2 biolistics – mechanically delivering DNA on microscopic particles into target tissues and cells by
‘firing’ them from a gene ‘gun’; for example, tiny gold particles are used to coat the DNA, which is then
fired at the target cells under high pressure or voltage
3 electroporation – increasing the membrane permeability by applying an electrical current
4 transduction by a vector – DNA is carried into cells by a viral vector such as an adenovirus, liposome
or bacterial plasmid. These vectors may be injected directly into the bloodstream or may be delivered
by aerosol delivery (nasal spray or oral aerosol for example, used in trials of gene therapy for cystic
fibrosis) (Fig. 9.13b).
Science Photo Library/Zephyr
Dreamstime.com/Peter Elvidge
a b
FIGURE 9.13 Two methods of inserting genes into the cells of a different species: a micro-injection of DNA directly into the
nucleus of a cell; b inhaling viral vectors in an aerosol
In gene therapy, a healthy copy of a gene is inserted into defective non-germline tissue in a developed
or mature plant or animal. Because the gene is inserted into non-germline tissue only, it will not be
passed on to the next generation. Gene therapy is a new form of medicine, with the potential to replace
conventional treatments for diseases.
294 MODULE SIX » GENETIC CHANGE 9780170408851
09_bio_InFocus12_2e_sb_08851_txt.indd 294 08/08/18 7:11 pm
Transgenic species
Gene manipulation, known as genetic engineering, can be used to create transgenic species. A transgenic
species (trans = across) is one that has been created by moving a gene ‘across’ species – taking a gene WS
from one species and inserting it into the DNA of another species. This gene must become part of
Transgenic
that organism’s germline genome (DNA) if it is to be inherited by subsequent generations. The gene is mammalian
animals
therefore inserted either directly into a germline cell or into a fertilised egg cell. The creation of transgenic
species is only considered to be a reproductive technology if it increases the reproductive capacity of an
animal. Most transgenic species are created for reasons other than increasing reproduction.
Transgenic Bt cotton plants
Over the years, traditional pesticides used on cotton plants had to be made stronger and be applied more
frequently to eradicate insect pests. One such insect pest was the caterpillar of the Helicoverpa zea moth,
which destroys hundreds of millions of dollars’ worth of cotton plants each year. With increased spraying,
these caterpillars were developing resistance to the pesticides due to the process of natural selection.
In the 1990s, CSIRO scientists in collaboration with the US company Monsanto extensively trialled
the use of its Ingard GM cotton, also known as Bt cotton, which is a transgenic species.
Bt cotton plants were genetically modified (this means to add or remove genes) – they contain a gene
that codes for the production of a protein that kills the caterpillar of the Helicoverpa zea moth. The insertion
of the Bt gene into the cotton plant has reduced the need to use pesticides to kill these caterpillars. This
is better for the environment and reduces the development of pesticide resistance in the caterpillars. The
gene is called Bt because it was originally taken from the soil bacterium, Bacillus thuringiensis.
Cotton growers in New South Wales and Queensland would normally spray their crops numerous
times in one growing season. They now only spray occasionally using a narrow-spectrum pesticide to
eliminate sucking insects and mites. This spray does not kill beneficial insects (such as ladybirds and
wasps), unlike broad-spectrum sprays.
The Bt gene codes for the production of the toxic protein in an inactive form that is harmless to
humans and most animals, and even to most insects. However, when the protein is eaten by a caterpillar,
it is converted by the caterpillar’s digestive system into an active form that kills the caterpillar.
The process used to produce transgenic cotton is as follows:
1 Scientists cut normal cotton seedlings into small pieces and place them on a solid growth medium,
where they grow into calluses (Fig. 9.14). After about six weeks the callus cells are transferred to a
liquid medium, where they are given hormones to induce them to grow into cotton plant embryos.
2 By genetic engineering, the Bt gene is cut from the genome of the bacterium, Bacillus thuringiensis,
using restriction enzymes.
3 The Bt gene is transferred to the cotton plant embryos. This is done using a second bacterium as
a carrier or vector. This bacterium, called Agrobacterium tumefaciens, causes crown gall disease in
plants, and is used as a vector because it is able to inject genes into other cells.
4 The cotton plant embryos are dipped in a solution that contains a mixture of the vector,
Agrobacterium, and the extracted Bt genes (which have recombined with the Agrobacterium
genome), and the vector bacteria inject the Bt genes into the cotton cells.
5 Once the gene is inserted, the embryos containing the Bt genes are grown in tissue culture and are
then placed on another solid medium and germinated into small plants, which are planted in pots
and grown in glasshouses. These plants are now a transgenic species, containing a gene from another
species in their genome.
9780170408851 CHAPTER 9 » GENETIC TECHNOLOGIES 295
09_bio_InFocus12_2e_sb_08851_txt.indd 295 08/08/18 7:11 pm
FIGURE 9.14 The
process of producing Fragment grows
Bt cotton plants by Fragmented into a callus
tissue culturing seedling
Callus in liquid medium
with hormones becomes
Normal cotton an embryo; embryo is
seedling Transgenic mature plant infected with Bt genes
Bt cotton seedling
develops from embryo
Cotton is a very difficult plant to culture, but CSIRO scientists have developed workable techniques
for growing three varieties of cotton. In order to increase the success of the project, the scientists have
developed four different insecticidal genes to use in cotton. However, the project has been controversial,
with critics claiming that it is harming the surrounding ecosystems.
Ingard, a cotton containing the product of a single gene, has been replaced by Bollgard II cotton, which
contains two inserted genes and produces two proteins that are lethal to the caterpillar. It is highly unlikely
that the caterpillar will become resistant to both proteins. In addition, cotton farmers plant a ‘refuge crop’
of pea plants in a field nearby, so that moths that may have one recessive allele for resistance to Bollgard II
continue to interbreed with moths who feed on the ‘refuge crop’. This reduces the chances of inbreeding
caterpillars with double-recessive alleles, which could confer resistance.
Another example of a transgenic species is the alfalfa plant in Australia, which has been genetically
modified to produce high levels of cysteine. Sheep that graze on this alfalfa have higher-quality wool.
Researchers are trying to develop a method to insert this gene directly into sheep.
In the short term, creating transgenic species increases genetic diversity – genes are moved from one
species to another and this can be used to confer resistance on species that previously were susceptible
to particular diseases, allowing them to survive and pass on their favourable genes. However, in the long
term, it may reduce genetic diversity, because the original genetic material of some organisms may be
reduced or lost forever – that is, there may be loss of biodiversity.
Medical uses of transgenic organisms
Although there are many ethical issues concerning the use of transgenic organisms in medical
applications, their use can expand our understanding of the role genes play in the development of
diseases. Transgenic organisms also provide us with opportunities to safely test and develop new
treatments. While transgenic animals are not commonly used on the open market as a food source,
there are several examples of transgenic animals being used in medical applications. Transgenic sheep
in Australia have been given a gene for the blood-clotting factor that is lacking in people who suffer
from haemophilia. The factor can be extracted from the sheep’s milk and used for human treatment.
296 MODULE SIX » GENETIC CHANGE 9780170408851
09_bio_InFocus12_2e_sb_08851_txt.indd 296 08/08/18 7:11 pm
Transgenic animals can be used to study how genes regulate
Genetically engineered
specific body functions. Mario R. Capecchi, at the University of mouse embryonic stem
Utah, won the 2007 Nobel Prize in Physiology or Medicine for his cells
work on transgenic mice, in particular, the ‘knock-out’ mouse. A
Stem cells are injected
knock-out mouse is one in which researchers have inactivated, or into blastocyst.
‘knocked out’, an existing gene. This knocked-out gene has been
replaced with an artificial piece of DNA at the blastocyst stage of Blastocyst
Inner cell mass
development (Fig. 9.15). Transgenic mice with gonads that have
knock-out stem cells are cross-bred, producing some offspring Blastocyst is implanted
into uterus of host
that are pure breeding for the knockout gene. These are used female.
for research. By making a specific gene inactive, and observing
differences from normal behaviour or functioning, researchers
can infer the function of that gene. Mouse gives birth.
Transgenic mice are often used to study a range of diseases
including cancer, obesity, heart disease, diabetes, Alzheimer’s
disease and Parkinson’s disease. Mice are a useful model in medical
research because their tissues and organs are similar to those of Transgenic mouse is a mix
of blastocyst cells and
humans and therefore many of their genes are also similar. Knock- genetically engineered cells.
out mice that lack the tumour suppression gene are useful in human
cancer research, enabling cancer treatments such as potential
FIGURE 9.15 Producing knock-out mice
drugs, as well as symptoms of the disease, to be studied.
In vaccine research, the production of recombinant DNA
vaccines involves selecting a gene that codes for a particular antigen, rather than using the whole genome
of the antigen. In the case of the recombined vaccine against the hepatitis B virus, the target DNA is
inserted into a plasmid that is recombined with a yeast cell (Fig. 9.16). This is incubated to allow the yeast
cells to multiply. The antigen is extracted and purified as a vaccine. Vaccine research using recombined
Transgenic mice
DNA is currently being used to develop vaccines against malaria and cattle tick. The advantages of
recombinant vaccines are that they have a low risk of side effects and are relatively cheap to produce,
making them a good option for use in developing countries.
FIGURE 9.16
Hepatitis B virus Isolated Production of
Shutterstock.com/Blamb
surface hepatitis B vaccine
antigen Recombinant
gene DNA
Inserted into
Bacterium yeast cell
Plasmid
DNA cut Modified yeast
cells produce
HB vaccine HBsAg
Bacterial Plasmid
chromosome
9780170408851 CHAPTER 9 » GENETIC TECHNOLOGIES 297
09_bio_InFocus12_2e_sb_08851_txt.indd 297 08/08/18 7:11 pm
As the demand for human organ transplants grows, there is a need to develop non-human
organs for transplantation, as the waiting lists for viable organs that match can be very long.
Xenotransplantation (using organs from other animals) provides the opportunity for patients
with failing organs to have transplants. Organs from transgenic swine that have human
complementary surface markers (proteins on the cell surface that identify the cell lineage and
stage of differentiation) on their cells would inhibit the activation of organ rejection. This would
enable people on long waiting lists to access viable organs (Fig. 9.17).
Source: Adapted from www.nature.com, vol 527, iss. 7577,
10 Nov 2015, 'New life for pig-to-human transplants', by Sara
Reardon
FIGURE 9.17 Cornea Lung Kidney
Potential transplant
organs from
genetically
modified pigs
Heart
Pancreas
Liver
KEY CONCEPTS
● Recombinant DNA technology makes it possible to insert a gene from one species into the
genome of another species.
● Restriction enzymes are used to cut DNA at a precise sequence of bases, leaving a sticky end.
● Sticky ends can join up to the sticky ends of a bacterial plasmid DNA cut with the same
restriction enzyme and joined using an enzyme called DNA ligase.
● The four main ways of inserting the desired gene into the genome of a species to be genetically
transformed are: micro-injection, biolistics, electroporation and transduction.
● A transgenic species is one that has been created by moving a gene ‘across’ species.
● Transgenic species are useful in agriculture and medical research.
CHECK YOUR
1 Define the following terms: recombinant DNA, sticky end, transgenic organism, vector, plasmid, genetic
UNDERSTANDING
engineering.
9.3 2 Use an example to outline how gene therapy can be used to treat a medical condition.
3 Use a diagram to explain how a transgenic organism can be created.
4 Outline a recombinant DNA procedure used to produce a transgenic organism in medicine
and in agriculture.
Current genetic technologies that
9.4
induce genetic change
A range of current genetic technologies have been discussed in this and the previous chapter, including
hybridisation, selective breeding, artificial pollination, artificial insemination, transgenic species, gene
cloning, whole-organism cloning and recombinant DNA techniques. All these techniques produce
genetic change, and each has a particular purpose and application.
298 MODULE SIX » GENETIC CHANGE 9780170408851
09_bio_InFocus12_2e_sb_08851_txt.indd 298 08/08/18 7:11 pm
INVESTIGATION 9.3
Secondary-source investigation to research technologies that
induce genetic change
Mechanisms of
recombination
AIM
To investigate the uses and advantages of current technologies that induce genetic change
METHOD
DNA cutting
1 Choose one of the following technologies to study in depth: and pasting
• Hybridisation
• Selective breeding
• Artificial pollination
• Artificial insemination
• Transgenic species Gene therapy
• Gene cloning
• Whole-organism cloning.
2 Use secondary sources to find a range of applications for the chosen technology. Assess the reliability of
each source you use. Gene splicing
RESULTS
1 List the advantages of using this technology. Advantages could include financial benefits, health benefits
or sustainability of food supplies.
2 Choose a suitable medium to construct an advertisement that promotes the use of your chosen technology Knock-out mice
to the general population. Your advertisement should show the technology process in a way that can be fact sheet
readily understood and highlight the positive aspects of the technology for a particular application.
9.5 Benefits of using genetic
technologies
The benefits of genetic technologies to society include improved food quality, cost-effective production
and improved food supply. The ability to supply sustainable and nutritional food sources for a growing
world population is essential. Improved access to pharmaceuticals and improved techniques in medical
research are certainly beneficial to the human population.
Agricultural benefits
Proponents of transgenic organisms suggest that, with gene technology, it is possible to produce crop
and animal varieties that are better suited to specific environments, such as high salinity or drought.
Plants can be made pest resistant (for example, Bt cotton). For producers, the use of transgenic
organisms provides an opportunity to increase the productivity of marginalised land and reduce post-
harvest losses.
9780170408851 CHAPTER 9 » GENETIC TECHNOLOGIES 299
09_bio_InFocus12_2e_sb_08851_txt.indd 299 08/08/18 7:11 pm
There have been significant advances in the production of genetically modified plants that have
enhanced nutrient levels. For example, rice can be produced with a higher protein or iron content.
Increasing the lipid content of starch-rich plants can improve the nutritional value or energy density of
crops. A higher lipid content in plants can also be useful in the production of animal feed, fuel and oil,
and in industrial applications.
A range of GM animals have the potential to be used as food sources. One of the first GM animals
to be approved for human consumption is the GM Atlantic salmon, which is available on the open
market and approved in the USA. It has been modified to grow faster and larger than the natural stock by
incorporating DNA from Chinook salmon.
Medical benefits
The study of human genomics involves the analysis of all the DNA in a living cell, as well as gene
functioning. In medicine, genomics has the potential to influence medical care and could help
individualise treatments. It is currently being used in oncology and pharmacology, and in the treatment
of rare and undiagnosed diseases, as well as diagnosed infectious diseases.
Genetic engineering provides the opportunity to produce valuable products of medical importance
through recombinant DNA technology. Pharmaceutical products can be developed artificially and
more efficiently than with traditional methods of production. For example, Humulin (human insulin) is
produced for people with diabetes to regulate insulin levels (Fig. 9.18). Before it was developed (in 1982),
diabetics were treated with insulin extracted from pigs and cows. The recombinant form of insulin is
better tolerated by diabetics and can be produced quickly and efficiently.
Insulin-producing
gene is cut
DNA
Human cell
Plasmid is Insulin extracted
Recombinant inserted into Bacteria divide
plasmid bacteria and begin
producing insulin
Bacterium
Plasmid
Plasmid DNA
is cut
FIGURE 9.18 Recombinant DNA technology used to produce insulin
The role of Monoclonal antibodies (MABs) are used in medicine, particularly cancer research. MABs incorporate
antibodies in
recognising specific
the use of genetic technology to artificially clone antibody-producing cells that target specific antigens.
protein markers is MABs are used in cancer treatment to assist the natural immune system to produce specific antibodies
discussed in more
detail in Chapter 12.
that target cancer cells (Fig. 9.19). MABs are grown either in vitro or in the stomach lining of mice. Their
Cancer is discussed role is to recognise specific types of protein markers on cancer cells. Some MABs are produced to activate
in more detail in
Chapter 15.
the immune system, some block the immune system, some stop cancer cells from dividing and others
assist in the delivery of drugs and radiation therapy. They are produced for specific forms of cancer and
are therefore antigen specific. Cancer patients can be given MABs intravenously in combination with
other therapies.
300 MODULE SIX » GENETIC CHANGE 9780170408851
09_bio_InFocus12_2e_sb_08851_txt.indd 300 08/08/18 7:11 pm
Industrial benefits Monoclonal
Source: Cancer Research UK
antibody
Current research projects are aimed at exploring the
potential of plants to make compounds for industrial
uses. For example, GM plants could be used to produce
Proteins on
environmentally friendly chemicals that can replace the the cell
Cancer
non-renewable products that are currently used (such as cell
fuels, plastics and paints). CSIRO has been working on
potato plants that produce a type of starch that can be Monoclonal
used to produce a range of products such as paper and antibody
locked onto
textiles (Fig. 9.20). protein
Enzymes, which are biological catalysts, have been
used extensively in food production and brewing for FIGURE 9.19 Action of a monoclonal antibody
at least 6000 years. More recently, recombinant DNA on a cancer cell
techniques have been used to manufacture enzymes
that are used widely in the food industry, particularly in
dairy production and brewing. The advantage of using
Copyright by BASF (CC BY-NC-ND 2.0) https://
creativecommons.org/licenses/by-nc-nd/2.0
recombinant DNA is that it can be quickly cloned to
produce large quantities of an enzyme that is targeted
specifically at a particular substrate – an enzyme
produced in this way is purer than enzymes produced by
more traditional methods, which can contain a range of
additional chemical substances.
Researchers have been working on developing
genetically engineered plants and bacteria (E. coli)
that can absorb heavy metals, such as mercury from
FIGURE 9.20 Microscopic image of the surface
contaminated sites. This could aid in the remediation of a potato plant genetically modified to produce
of mine sites and other heavily polluted areas, reducing starch for paper, textile and adhesive production
harm to local ecosystems.
INVESTIGATION 9.4
Benefits and limitations of genetic technologies: A class debate
When evaluating the potential benefits of genetic technologies, you will make a judgement based on certain Ethical
criteria. The criteria must include reasons for and against. In this investigation you will need to access a variety understanding
of sources, including current information from the Internet, scientific journals, videos and other sources.
AIMS
Sustainability
1 To gather and process information on examples of genetic technologies in agriculture, medicine and
industrial uses
2 To assess the benefits of these technologies and identify some arguments against the use of these
biotechnologies
3 To summarise your research in a table
4 To debate some of the benefits and limitations of researching genetic technologies
9780170408851 CHAPTER 9 » GENETIC TECHNOLOGIES 301
09_bio_InFocus12_2e_sb_08851_txt.indd 301 08/08/18 7:11 pm
METHOD
1 Use secondary sources to research in detail at least two examples of genetic technologies in use in
agriculture, medicine or industry – for each, make notes on:
• the details of the two species whose genes have been recombined
• the advantages and/or disadvantages of this transformation
• applications in agriculture, medicine and industry
• the benefits and limitations of the technology.
2 Remember to use sources that are accurate, reliable and valid. Refer to the CRAAP test (pages 10–11). Keep
a record of your sources in an appropriate format. Your school library website may be able to provide a
suitable template for references gathered. (Acknowledgments and references are also discussed in Chapter 1,
page 27.)
3 Prepare to debate the benefits and limitations of genetic technologies. You should be able to argue
on the affirmative or the negative team – you will be assigned to a team at the start of the lesson
and given a specific topic for debate. Identify three advantages and limitations and prepare a written
discussion on each.
(Note: Points for and against must link back to the issue, otherwise they will be considered irrelevant.) The
table below may be used as a starting point.
FOR AGAINST
Agricultural example:
Medical example:
Industrial example:
KEY CONCEPTS
● Evaluating an issue requires you to make a judgement based on certain criteria.
● Potential benefits of using genetic technologies in agriculture include producing crops that are
drought resistant and/or pest resistant and produce a higher yield.
● Medical benefits include producing food that has better nutritional value (e.g. golden rice) and
the production of pharmaceuticals and vaccines.
● Industrial applications include the potential to produce new polymers, new energy sources and
products that are more environmentally friendly.
● Limitations of genetic technologies include their impact on human health and the environment.
CHECK YOUR
1 Name a technology that induces genetic change, and list two advantages of that technology.
UNDERSTANDING
2 Use an example to explain the potential benefit of using genetically modified organisms in the production
9.5 of food.
3 Use an example to describe the use of a genetically modified organism in medicine.
4 Identify some limitations of using genetic technologies.
5 Discuss the use of genetically modified organisms in industry.
302 MODULE SIX » GENETIC CHANGE 9780170408851
09_bio_InFocus12_2e_sb_08851_txt.indd 302 08/08/18 7:11 pm
The effect of biotechnology
9.6
in agriculture
Biotechnologies may increase or decrease the genetic diversity of species, depending on how they are
used. For example, selective breeding has the potential to both increase and decrease genetic diversity. Sustainability
In the short term, introduced genes broaden the gene pool in a population. In the long term, if selected
desirable genes constantly replace other varieties of genes, the gene pool, and therefore genetic diversity,
will decrease.
Charles Darwin was aware of the effects of selective breeding – he bred pigeons and used the results
of his artificial selection to demonstrate the principles of natural selection. Darwin explained that
the process of selection (natural or artificial) determines the success of an individual in reproducing
and passing on its variations. In genetic terms, selection acts on the phenotype and determines which
genotypes are passed on, directly affecting the gene pool.
Selective breeding often leads to a reduction in genetic variation – when ‘pure-bred’ species and
animals that are highly ‘pedigreed’ have been selectively bred for certain ‘desirable’ traits.
INVESTIGATION 9.5
Secondary-source investigation: Effect of biotechnology
on biodiversity
AIM
To evaluate the effect on biodiversity of using biotechnology in agriculture
BACKGROUND
The provision of nutritional food in large quantities is essential to sustain the food demands of the growing
global population. GM plant species are often used, with the aim of providing faster-growing and nutritionally WS
superior foods than natural plant species. GM soybeans are generally produced to be resistant to the herbicide
Comparing plant
glyphosate, the chemical constituent of the herbicide RoundUp. This enables farmers to spray for weeds in the modification
soy plantations without harming the plants. Soybeans are a good source of protein, minerals and fatty acids, methods
and are used in the manufacture of a range of food products including milk, flour, protein and tofu. They are
also used in animal feed, and in the manufacture of particle board, adhesives, oils, waxes, lubricants and foam.
Soybeans are an important legume worldwide, and an economically important crop in Brazil, the USA and Argentina.
GM soy was originally produced as ‘RoundUp Ready’ soy by the chemical company Monsanto in 1994. It
was made using recombinant DNA techniques. In developing the GM soy plant, researchers extracted the
desired genes from the bacterium Agrobacterium tumefaciens. The genes are inserted into a bacterial plasmid
and a gene gun is used to insert the plasmids into
Shutterstock.com/sima
the nuclei of soy plant cells. Other companies are
now producing similar products using recombinant
technologies. The recombinant technique used is
similar to that used to produce Bt cotton.
In Brazil, large areas of rainforest have been
cleared for soy bean plantations. There is also
concern over the effect of glyphosate on the
sensitive rainforest ecosystem, due to the extensive
use of glyphosate as a herbicide. Glyphosate is safe
for human consumption in small amounts and it
would be expected that GM soy would include FIGURE 9.21 Genetically modified soybeans
9780170408851 CHAPTER 9 » GENETIC TECHNOLOGIES 303
09_bio_InFocus12_2e_sb_08851_txt.indd 303 08/08/18 7:11 pm
traces of the herbicide due to spraying of glyphosate on GM soy plantations. Studies in the USA have shown that
residual amounts of glyphosate in GM soy products can be quite high, depending on the farming practices, and
this is now being monitored.
Some weeds are resistant to glyphosate, and plantations affected by resistant weed growth may require
spraying with an additional herbicide, adding to the residual amount of herbicide in the soy product and in
the environment. The potential for GM seed dispersal beyond the boundaries of a plantation is possible and is
tightly controlled, to prevent resistant strains from affecting ecologically sensitive areas. Run-off of glyphosate
into neighbouring rainforest and aquatic environments is possible and could affect sensitive organisms even at
low concentrations.
METHOD
Either use the information on GM soy above or select another example of a GM food used in agriculture, to
evaluate the effect on biodiversity. In considering biodiversity, consider the biodiversity of the crop as well as
the surrounding natural ecosystems. Also consider both long-term and short-term effects.
1 Use reliable sources (Chapter 1, page 10) for this research activity and justify the reliability of each source
in an annotated bibliography. A template such as the one below may be used to collect information from
each source.
Biotechnology in agriculture: annotated bibliography
Reference:
Why is the source relevant?
What makes this source reliable?
Short summary of the relevant information (no more than two paragraphs):
2 Use secondary sources to research in detail at least two examples of genetic technologies used in agriculture.
Remember to use sources that provide information that is accurate, reliable and valid (Chapter 1,
pages 16–17).
RESULTS
1 Summarise your research in a table of arguments for and against the use of your selected GM food in
agriculture, based on its impact on biodiversity.
2 Choose a suitable method for representing the information you have collected.
For example, a mind map might be an effective way of completing your evaluation. To make a mind map,
see the weblink.
Mind map
DISCUSSION
What impact has your selected GM food had on biodiversity in both the short term and the long term?
KEY CONCEPTS
● When reviewing the impact of genetic techniques on biodiversity, it is important to consider
both long-term and short-term effects.
● In the short term, introducing a new genotype will increase the biodiversity in a population.
● In the long term, introducing a new genotype may reduce the biodiversity in a population, as
large numbers of identical organisms with particular (beneficial) characteristics are created.
CHECK YOUR 1 What is the long-term impact of using a genetic biotechnology on the biodiversity of a population?
UNDERSTANDING
2 Outline the possible effect of artificial pollination on genetic diversity.
9.6 3 How can the process of genetic modification affect genetic diversity in a population?
4 Describe a genetic technique used in agriculture and how it affects genetic diversity.
304 MODULE SIX » GENETIC CHANGE 9780170408851
09_bio_InFocus12_2e_sb_08851_txt.indd 304 08/08/18 7:11 pm
Social, economic and cultural
9.7
influences on biotechnologies
For the past 10 000 years, biotechnologies have been developed to assist humans. Current
biotechnologies are complex in their application and have the potential to change society and the
environment. In principle, biotechnologies are developed to improve human life. When people
make decisions about the influence of a specific biotechnology, they consider their needs, values
and priorities. This means that your point of view may differ from someone else’s, based on these
considerations.
Social context
Social context is the physical and social setting in which we live. In relation to biotechnology, the
biotechnological techniques that are available to a society are dictated by the specific needs of that
society, as well as the choices made by government, and the wealth of individuals and the economic
status of the country. For example, in many countries, DNA fingerprinting techniques are used
extensively in forensic science and in paternity testing. In these techniques, non-coding segments of
DNA are used to determine differences and similarities. The most
common technique is the use of short tandem repeat (STR) analysis More shared alleles 5 greater probability of being related
of DNA.
Short tandem repeats (STR) are a type of sequence marker on a
Related
chromosome. Repeats are often 2–10 bases long and vary in number
Source: The American Society of Human Genetics
in the population. Primers are used to locate these repeats and are
designed to match areas of interest on the chromosome. Primers
Probability
include a short segment of complementary bases that target the
complementary sequence of DNA. The STRs in alleles are counted, to
determine the number of shared alleles between samples (Fig. 9.22).
DNA analysis techniques such as STR enable investigators to match
samples and solve problems with a high degree of accuracy. However, Not related
the process is time consuming and costly, and may not be available in
all parts of the world. In addition, ethical issues arising from the use
Number of shared alleles
of this technology include the potential for discrimination, as well as
ownership and privacy issues in relation to the genetic information FIGURE 9.22 Determining relatedness between DNA
obtained, and the possibility of inappropriate applications of the samples: the probability of finding many shared alleles is
high in related individuals and low in unrelated individuals.
technology.
Economic context
The amount of research and development required to bring genetically modified foods to the consumer
is huge. While farmers want to make a profit, there is also a need for consumers to buy food at reasonable
prices. Genetically modified products are often patented, which means that the biotechnology company
owns the rights to a particular technology. Some argue that this gives large multinational corporations
a monopoly. There are growing concerns, for example, that small-scale farmers in developing countries
cannot afford to buy the seeds for genetically modified crops, and that this perpetuates the unequal
distribution of wealth between developed and developing nations. In some cases, however, GM food can
be produced in greater volumes for the same or less cost, so the farmer receives greater financial returns
and the consumer pays less. For example, the potential to produce GM Atlantic salmon in greater volumes
than are possible in the natural species means the cost of salmon can be reduced for the consumer, and
the income of Atlantic salmon farmers can be increased.
9780170408851 CHAPTER 9 » GENETIC TECHNOLOGIES 305
09_bio_InFocus12_2e_sb_08851_txt.indd 305 08/08/18 7:11 pm
Cultural context
AAP Image/The Environment Ministers office/Michael Amendolia/
Photographed with the permission of the traditional landowners
Cultural context is dependent on the shared meanings, ideas, beliefs
and characteristics of the people who make up a society. The values,
religious and moral beliefs and educational background of a group of
people may influence their opinions and whether they are open to
using biotechnologies.
DNA testing can be used to determine the lineage of fossilised
human remains. The results of mitochondrial DNA testing of the
fossil remains of Mungo Man, found at Lake Mungo in NSW were
first published in 2001 and raised the possibility that another lineage
of modern humans inhabited the continent before Aboriginal people.
The reliability of the study was recently disputed as the samples were
thought to have been contaminated in the original study. In 2016,
FIGURE 9.23 Fossil evidence: 20 000-year-old human footprint
at Mungo National Park DNA testing of the fossilised human remains revealed that Mungo
Man was in fact of Aboriginal lineage and proved that Aboriginal
peoples were the first inhabitants of the Australian continent. The 2016 study used improved DNA testing
Aboriginal
and Torres techniques and compared the DNA of the samples with that of the current inhabitants of the location.
Strait Islander The DNA testing and permission to retest the remains of Mungo Man were agreed to by the traditional
histories and
cultures custodians of Mungo Man, the Muthi Muthi people.
INVESTIGATION 9.6
Using secondary sources to assess social, economic and
cultural influences on the use of biotechnologies
Ethical Advances in biotechnology in areas such as stem cell research and cloning have created high expectations
understanding about the possibility of curing diseases such as cancer and repairing worn and damaged tissues, possibly
Information and
saving millions of human lives. However, not everyone is in favour of all new techniques. For example, for
communication religious or ethical reasons, some people are opposed to cloning that destroys embryos, or the termination of
technology pregnancies where the embryo has been diagnosed with a genetic abnormality. There are strong arguments
capability
about the sanctity of human life and humans meddling with nature. In some countries, religion is strongly tied
to public policy and public opinion, and has a powerful influence on the regulation of biotechnologies.
In 2010, a survey of people in 32 European countries reflected a strong relationship between strong belief
in God and strong opposition to synthetic biology, due to the perception that the creation of a new type of
organism was in direct conflict with the idea that creation is a divine activity.
Different religions hold slightly differing views on the development of biotechnology. For example, Islam
forbids the consumption of pork, and therefore scholars have raised concerns regarding the introduction of pig
genes into food sources or in the development of organs for transplants.
The use of biotechnologies can be an area of contention and controversy, and for this reason you will need
to consider the social and cultural factors that influence or bias people’s perspectives. For this investigation,
you will research the use of one biotechnology.
AIMS
Intercultural
1 To use a range of resources in gathering information to assess the social, economic and cultural impacts of
understanding the use of one biotechnology
2 To assess the accuracy, validity and reliability of the information gathered
Difference and
diversity 3 To peer review another student’s investigation
306 MODULE SIX » GENETIC CHANGE 9780170408851
09_bio_InFocus12_2e_sb_08851_txt.indd 306 08/08/18 7:12 pm
METHOD
1 Choose a biotechnology to investigate. Some examples that you may want to consider include:
• xenotransplantation
• using salmon genes to create a recombinant DNA strawberry
• the potential for human cloning
• IVF.
2 Use a range of resources including books, journals, videos and Internet sources to gather information about
the social, economic and cultural impacts on your chosen biotechnology:
• social impacts – include human rights, benefits to humans, sustainability of resources
• economic impacts – include financial costs, financial benefits
• cultural impacts – include religious opinion, difference of opinion due to location and customs.
3 Use a table like the one below to summarise your findings.
IMPACTS OF BIOTECHNOLOGY
SOCIAL
ECONOMIC
CULTURAL
4 Develop a reference list. (Chapter 1, page 27.)
5 Assess the validity, reliability and accuracy of the sources you used. Use the following as a guide.
ACCURACY Is the information substantiated? This means is it consistent (reliable) and valid, across
more than one source, including scientific literature?
RELIABILITY Is the information current?
Is the source reputable? Check the URL.
Does the article aim to create bias? (Look at the author’s credentials, date of
publication and the organisation(s) they are affiliated with.)
VALIDITY Does the information relate to the problem you are researching?
6 Working with another student, peer review each other’s investigation using agreed criteria (page 4).
CONCLUSION
Use the information you have gathered to assess the overall cultural, economic and social impacts of your
chosen biotechnology.
KEY CONCEPTS
● Social, economic and cultural contexts influence the development of biotechnologies.
● These influences vary depending on the biotechnology and the country in which it
is developed.
CHECK YOUR
1 Outline a social influence on the development of biotechnology.
UNDERSTANDING
2 Describe an economic influence on the development of a specific named biotechnology.
3 How do different religions view the development of genetic biotechnology? 9.7
9780170408851 CHAPTER 9 » GENETIC TECHNOLOGIES 307
09_bio_InFocus12_2e_sb_08851_txt.indd 307 08/08/18 7:12 pm
9 CHAPTER SUMMARY
Genetic technologies: Does artificial manipulation of DNA have the potential to
change populations forever?
Selective breeding Artificial insemination
Choosing desirable characteristics (e.g. GENETIC TECHNOLOGIES: Collecting sperm from a selected male and
crossing Friesian and Jersey cattle) ARTIFICIAL inseminating several selected females
MANIPULATION OF DNA
Artificial pollination Cloning
Selective breeding in plants by Producitoni of
controlling pollination an exact copy
Gene cloning – production of identical copies Whole organism cloning – cloning adult cells (e.g. somatic
of one gene (e.g. to produce insulin) nuclear transfer, which involves three animals)
Cell of source organism,
with desired gene
Chromosome with DNA Mammary cell is extracted
and grown in a laboratory.
1 Desired gene is cut from
source cell.
Bacterium
2 Gene is inserted into plasmid.
Recombinant DNA Egg cell is extracted.
Bacterial Plasmid (plasmid)
Desired gene
chromosome
3 Plasmid is inserted
into host (bacterial) After a five-month
cell (transformation). pregnancy, a lamb
genetically identical
to the sheep from
which the mammary
cell was extracted is
born.
Embryo is implanted
into surrogate mother.
4 Host cell replicates,
making copies of
desired gene.
Moral and
Animal welfare
religious issues
Concern for the treatment ETHICAL ISSUES AND CLONING
Same techniques could
of animals
be used to clone humans
Legal concerns Alters genetic composition Cost and access Health risks
Who owns the patents to Decreases genetic diversity To the technology Still to be determined
create living things? in a population
308 MODULE SIX » GENETIC CHANGE 9780170408851
09_bio_InFocus12_2e_sb_08851_txt.indd 308 08/08/18 7:12 pm
RECOMBINANT DNA TECHNOLOGIES
Methods used to Involve inserting G
A ATT
Plasmid DNA is cut open by restriction
C
insert the desired the gene of one Circular TTA A enzyme, producing sticky ends.
C
AA
G
plasmid
gene: organism into DNA
AA
TT
G
TT
the genome of
C
• microinjection
G
another
• biolistics A AT T C
G
G
CTTAA DNA ligase joins DNA
fragment and plasmid DNA.
• electroporation Gene fragment is cut from
source by same restriction TC
GA
A
enzyme so has matching T
• transduction
TT
CT T
GA A
sticky ends. AG
C
AAG
TA
CT
Recombinant DNA
Plasmid is taken up by bacterial cell
via transformation.
Transgenic species Plasmid with Bacterial
foreign gene chromosome
Created by moving a gene from one species into
Bacterial colonies
another (e.g. Bt Cotton) grown on agar
Production of Multiple copies
vaccines of desired gene
Medical uses
e.g. hepatitis B vaccine
Knock-out mice used to study Genetically engineered
mouse embryonic stem
diseases such as Alzheimer’s cells
Stem cells are injected
Transgenic sheep into blastocyst.
produce blood-clotting Inner cell mass Blastocyst
factor Blastocyst is implanted
into uterus of host
female.
Agricultural Mouse gives birth.
• Enhances nutrient
Transgenic mouse is a mix
levels in plants, e.g. of blastocyst cells and
genetically engineered cells.
golden rice and
GM soybean
• Potential to Medical
produce GM Monoclonal
• Opportunity to produce antibody
animals as food, e.g. salmon pharmaceuticals, e.g.
insulin for diabetics
Proteins on
Industrial • Production of Cancer the cell
cell
• Potential to produce BENEFITS OF monoclonal antibodies
environmentally friendly USING GENETIC for use in cancer Monoclonal
antibody
chemicals TECHNOLOGIES treatment locked onto
protein
• Replace non-renewable
resources Economic context
• GMO are often patented, making them more expensive.
• There can be unequal distribution of wealth.
EFFECTS OF GENETIC Cultural context
TECHNOLOGIES Values and beliefs
influences opinions
about biotechnologies.
Impact on genetic diversity Can increase Social context Specific
genetic diversity in the short term but replace needs of a society
varieties of genes in the long term, therefore determine which
reducing biotechnology. biotechnologies are used.
9780170408851 CHAPTER 9 » GENETIC TECHNOLOGIES 309
09_bio_InFocus12_2e_sb_08851_txt.indd 309 08/08/18 7:13 pm
9 CHAPTER REVIEW QUESTIONS Qz
Review quiz
1 Outline some examples of current genetic technologies 11 How is biotechnology used to monitor biodiversity in a
that can induce genetic change. population?
2 How is artificial insemination used in the conservation of 12 Why did scientists ensure that the nucleus was removed
endangered species? from an unfertilised egg that was used when making
Dolly the sheep?
3 Distinguish between artificial pollination and artificial
insemination. 13 Assess the benefits of using a named biotechnology in
the production of food for humans.
4 Explain how the genetic composition of a population can
be affected by in vitro fertilisation. 14 Why are some people opposed to the use of genetically
modified organisms in the production of food or medicine?
5 How is whole-organism cloning different from gene
cloning? 15 Explain how biodiversity can potentially be affected by
using techniques such as artificial selection and cloning.
6 Use an example to outline the process of gene cloning.
16 Genetic manipulation is used to create transgenic species
7 Describe one technique used in the application of
in agriculture. Discuss the ethical considerations of applying
recombinant DNA.
this technology to improve a named agricultural product.
8 Identify three applications of transgenic organisms.
17 Explain how the genetic diversity of a species may be
9 Draw a flow chart to describe how a transgenic organism increased using:
can be produced. a cloning b transgenic species.
10 Explain how transgenic organisms can be useful in a 18 Does artificial manipulation of DNA have the potential to
medical application. change populations forever? Explain.
MODULE 6 : GENETIC CHANGE
» END-OF-MODULE REVIEW
AND BIODIVERSITY
Answer the following questions.
1 Human insulin is made in a recombinant DNA process. 3 In Chile in 2003, the mummified skeleton of a six to eight
The processes involved are listed in A to E below. What year-old female was found, but the skeleton was only
is the correct sequence of these processes to make 15 cm long. Scientists named the skeleton Ata.
insulin? Write the letters in the order of the steps. Identify and outline the biotechnologies that could have
A The donor DNA fragment from the pancreas is pasted been used to enable scientists to arrive at each of the
into the plasmid by DNA ligase. conclusions a to b below.
B A piece of DNA is cut to remove the insulin-producing a Ata’s genome was compared to those of humans,
section of the gene from a human pancreas cell. chimpanzees and Rhesus macaques. The skeleton was
C The bacterial plasmid produces human insulin as confirmed as being human.
the gene spliced into it is expressed. The insulin is b X and Y chromosome analysis revealed that the
harvested for use in human diabetics. specimen was female.
D The plasmid with its new gene is returned to its c A comparison of the single nucleotide polymorphisms
bacterial cell, where it multiplies by binary fission. (SNPs) in Ata’s genome with those used as markers for
E A bacterial plasmid is removed from its cell and cut distinct geographical populations suggested that her
with a restriction enzyme. ancestry was Chilean.
d Ata was most likely a pre-term birth, with premature
2 Discuss the impact of mutations in DNA repair genes on bone development. DNA mutations linked to
the introduction of new alleles in a population. dwarfism were found in several genes associated with
bone formation and musculoskeletal development.
310 MODULE SIX » GENETIC CHANGE 9780170408851
09_bio_InFocus12_2e_sb_08851_txt.indd 310 08/08/18 7:13 pm
4 It was discovered that in African populations living very 9 Compare the process of PCR in a laboratory with DNA
close to the equator, there is a higher frequency in the replication in cells.
salt-saving version of the 3A5 gene. The mutant allele of
the 3A5 gene makes a protein that increases the efficiency 10 Explain how identifying end-product proteins produced
of an enzyme that breaks down cortisol, a hormone that by a cell can give insight into the genome of that cell.
raises salt levels in the kidneys and helps the body retain
water. Give a reason why this may be an advantage for people 11 Explain why, in DNA analysis techniques, a DNA probe
living in those geographical regions and explain how this needs to be labelled with a molecular tag (such as a
could have led to an increase in the frequency of this allele. radioactive atom or a fluorescent dye).
5 For the enzymes in the table compare their functions in 12 Biofuel can be produced by fermenting sugars from plants
replication with their application in gene technologies. such as sugar cane, corn, wheat, canola and sugar beet to
Name one gene technology in which each is used. ethanol. It uses a similar process to that used in beer and
wine-making. If these biofuels are blended with petrol
APPLICATION NAME or diesel, they reduce the amount of carbon emissions.
FUNCTION IN IN GENE OF GENE Propose reasons for and against furthering this type of
ENZYME REPLICATION TECHNOLOGY TECHNOLOGY research for the production of fuels for aviation.
DNA
polymerase 13 A DNA fragment with a total length of 3000 base pairs is
cut using restriction enzymes at the positions shown by
Ligase
the arrows. The numbers in brackets indicate the number
of bases in each fragment after cutting.
6 Some biotechnologies have been developed to
manipulate DNA, whereas other biotechnologies have (400 bp) (900 bp) (1700 bp)
been developed to analyse and visualise DNA. Explain the
difference between these processes and give an example DNA bands of known size were created by using the
of a gene technology for each. restriction enzyme EcoR1 and run through a gel by
electrophoresis. Copy the diagram and mark where bands
7 Explain the application and implications of each of the
from the sample DNA fragment would align on the gel.
following uses of biotechnology for conservation and
sustainability of biological diversity. You may use examples
to help your explanation. 6000 5000 4000 3000 2000 1000 800 600 500 400 200
a banking germ plasm from plants
b use of genetically modified crops as food
c mapping relatedness of animals in the wild and in
captivity for breeding programs
d artificial insemination for conservation in zoos and in 14 The table in the Key concepts box on page 253 (Chapter 7)
the wild lists factors such as selective pressure, sexual selection,
mutation, genetic drift and gene flow. Using this table,
8 Explain the importance of understanding endocrinology provide an example to illustrate each ‘change in allele’
(how hormones function) and the process of IVF to described. Use information from Chapters 1–7 to find
conduct gene therapy as a medical intervention to correct examples, and keep a record of which chapter you found
defective genes in offspring. the information in, for each.
▻ Investigate a specific genetic biotechnology and how it can be used to treat a particular human disease.
▻ Research the ethics of xenotransplantation and the laws that regulate it.
▻ How can cloning have the potential to bring back extinct organisms?
▻ Myth bust: Is Jurassic Park possible, with today’s biotechnologies?
▻ Create a survey to study a social, cultural or economic influence on biotechnology development.
9780170408851 CHAPTER 9 » GENETIC TECHNOLOGIES 311
09_bio_InFocus12_2e_sb_08851_txt.indd 311 08/08/18 7:13 pm
» MODULE SEVEN
INFECTIOUS DISEASE
10 Cause and transmission of infectious disease
11 Responses to pathogens
12 Immunity
13 Prevention, treatment and control of disease
Shutterstock.com/nobeastsofierce
312 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 312 08/08/18 7:18 pm
Cause and transmission
10 of infectious disease
Students:
• describe a variety of infectious diseases caused by pathogens, including micro-organisms, macroorganisms
INQUIRY QUESTION and non-cellular pathogens, and collect primary and secondary-sourced data and information relating to
How are diseases disease transmission, including: (ACSBL098, ACSBL097, ACSBL116, ACSBL117)
transmitted? – classifying different pathogens that cause disease in plants and animals (ACSBL117)
– investigating the transmission of a disease during an epidemic
– design and conduct a practical investigation relating to the microbial testing of water or food samples ICT
– investigate modes of transmission of infectious diseases, including direct contact, indirect contact and
vector transmission
• investigate of the work of Robert Koch and Louis Pasteur, to explain the causes and transmission of infectious
diseases, including: L, WE
– Koch’s postulates
– Pasteur’s experiments on microbial contamination
• assess the causes and effects of diseases on agricultural production, including but not limited to: S, WE
– plant diseases
– animal diseases
• compare the adaptations of different pathogens that facilitate their entry into and transmission between hosts
(ACSBL118)
Biology Stage 6 Syllabus © NSW Education Standards Authority for and on behalf of the Crown in right of the State of New South Wales, 2017
Science Photo Library
9780170408851 313
10_bio_InFocus12_2e_sb_08851_txt.indd 313 08/08/18 7:18 pm
For many years, the interaction between
Shutterstock.com/Azami Adiputera
humans and the organisms that seek
to inhabit them has been portrayed as
a constant and fierce battle between
deadly enemies, ending only with the
elimination of one side. This metaphor
fails to acknowledge the subtlety of the
immune response and the ability of an
organism’s combined defences to survey
newly recognised molecules and instigate
a measured and effective response. If
our immune system declared all-out war
every time, the result would be chronic,
unresolvable inflammation in all tissues
FIGURE 10.1 As in a game of chess, the body relies on many exposed to the outside world, and poor
strategies to deal with harmful microbes.
health. Worse still, the immune system
in this overactive state could direct its
defences against the organism itself, as occurs in autoimmune diseases such as lupus and type I
diabetes mellitus, or give rise to allergies such as asthma. Instead, the systems that protect multicellular
organisms from outside threats are less like a war, and more like a game of chess, where the players plan
ahead, and know when to advance and retreat.
The variety of infectious diseases
10.1
caused by pathogens
Prior to the work of scientists such as Louis Pasteur and Robert Koch, little was understood about
the nature of infectious disease. The ‘germ theory of disease’, that disease and decay are the product
of living organisms, was unknown to people, who still believed in spontaneous generation – that living
organisms could arise from inanimate material such as rotting meat. As with most scientific discoveries,
the mystery of infectious disease was unlocked progressively, as the science of microbiology emerged.
Critical to the development of this science was the concurrent development of technology such as the
light microscope, as well as techniques in staining and in sampling diseased tissue.
Disease is any process or condition that adversely affects the normal functioning of a living thing or
parts of a living thing. An infectious disease is caused by another organism or an infective agent known as
a pathogen (and is thought of as being 'caught' from somewhere or someone). Pathogens may be single-
celled microbes such as bacteria, protozoa and yeasts, multicellular parasites such as fungi and worms,
or non-cellular agents such as viruses and prions. Measles and influenza are examples of infectious
diseases of humans. Infectious diseases are distinguished from non-infectious diseases such as cancer
and diabetes, which do not involve the transfer of a pathogen between hosts and therefore cannot be
‘caught’. There are exceptions to this, however. For example, devil facial tumour disease is a cancer that
is also infectious, because cancer cells are transferred when one infected Tasmanian devil bites another.
The term communicable disease is often used to describe a disease that can be transmitted from plant
to plant, or from animal to animal. Pathogens have a range of strategies to achieve this transfer, based on
molecules known as virulence factors, which enable the pathogen to inhabit its host more effectively and
may even enable it to evade destruction by antibiotics. An example is bacteria that produce the enzyme
beta-lactamase and are resistant to penicillin-derived antibiotics.
314 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 314 08/08/18 7:18 pm
What is disease?
The word ‘disease’ derives from the old French terms des and aise, meaning a ‘lack of ease’. Disease
processes are typified by a series of signs and symptoms. Signs are objectively measurable factors, such
as increased body temperature (pyrexia or fever), the appearance of a rash, an increase in blood pressure
(hypertension) or a change in the colour of a tissue. When tissue is damaged, it forms a lesion (such as
a wound or an abscess). Signs are usually recorded during a physical examination of the body systems
and include the results of any histopathology that may be undertaken. Symptoms are factors reported
by the patient, such as pain, fatigue, nausea or headache, that cannot be directly observed by others. A
combination of signs and symptoms gives a complete picture of the effects of pathogens on the organism.
In low numbers, a pathogen may be incapable of initiating a disease.
Increases in pathogenic burden are often associated with infectious Defence
disease, as the body’s immune defences become overwhelmed. The
likelihood of an organism developing an infectious disease depends on
the balance between:
Attack (pathogenicity)
◗ the pathogenicity of the microbe, including the numbers of pathogens
(‘burden’)
◗ the defence capabilities of the host (Figure 10.2).
FIGURE 10.2 Disease is the
An example is the occurrence of a type of mange in dogs caused by result of a loss of balance
between defence and
the mite Demodex canis. This mite is a normal inhabitant of the hair attack.
follicles of canines and is usually present
in low numbers. The clinical expression
Alamy Stock Photo/imagegallery2
of demodectic mange (Fig. 10.3) is
most common in young puppies whose
immune systems are still developing,
or in older animals whose immune
systems are compromised. In these
cases, the mite acts as an opportunistic
pathogen – this can happen if there are
concurrent diseases, or if the animal has
been given a course of drugs that have
a suppressive effect on the immune
system, such as corticosteroids, which
are commonly prescribed for chronic FIGURE 10.3 The mange mite Demodex canis becomes pathogenic
only when immune suppression occurs.
skin inflammation.
KEY CONCEPTS
● The immune system is a complex network of responses to outside threats.
● Infectious diseases involve threats from infectious agents known as pathogens.
● There is a fine balance between an appropriate and useful response and one that may harm the
host organism.
● Disease results when there is a loss of balance between defence and attack.
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 315
10_bio_InFocus12_2e_sb_08851_txt.indd 315 08/08/18 7:18 pm
Classifying pathogens
Pathogens can be broadly classified as shown in figures 10.4 and 10.5.
FIGURE 10.4 Broad
classification of
pathogens
Proteins Prions
Non-cellular
Protein
Viruses
coat
Microscopic
organisms
Prokaryote Bacteria
Cellular
Eukaryote Fungi
Pathogens
Protozoans
Live outside
Ectoparasites
body
Macroscopic
organisms
Live inside
Endoparasites
body
BioNinja.com.au
FIGURE 10.5 Cellular
and non-cellular Cellular (living) Non-cellular (non-living)
pathogens, and
examples of diseases
they cause (CJD:
Creutzfeldt-Jacob
disease)
Protozoans Fungi Prokaryote Virus Prion
(e.g. malaria) (e.g. tinea) (bacteria, e.g. leprosy) (e.g. HIV/AIDS) (e.g. CJD)
Cellular pathogens: meningococcal meningitis
In 2017, the NSW Government implemented a school-based vaccination program for Year 11 and 12
students, to provide protection against a significant threat to their health. Meningococcal disease is a
serious bacterial disease that can cause acute illness and death due to bacterial meningitis (bacteria in
the brain) and septicaemia (bacteria in the blood). A new form of the bacteria, known as type W, had
resulted in a threefold increase in notifications of the disease during the school year and was causing
concern among health professionals. A decade of vaccination against other strains of the disease had
seen a decrease in the frequency of the disease. The most common symptoms of meningococcal disease
include fever, headache and stiffness of the neck, as well as pain in the joints. A red-purple rash (Fig. 10.6)
is common, as well as nausea and a dislike of bright lights (photophobia). Older teenagers and young
316 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 316 08/08/18 7:18 pm
adults are at increased risk of contracting the disease, due to social behaviours that increase the risk of
transmission. Rapid treatment is vital, to preserve life and minimise damage to organ systems.
A vaccine is now available that covers meningococcal types A, C, W and Y. The vaccine is particularly
recommended for young people living in close quarters, such as military establishments and boarding
schools.
Visuals Unlimited, Inc./Mediscan
FIGURE 10.6 A
severe rash that
does not blanch
(go pale) when
pressed is a sign
of meningococcal
disease.
Classification of bacteria
Bacteria are single-celled prokaryotic organisms. They have a cell wall but no membrane-bound nucleus
or organelles (Fig. 10.7). They are classified as one of the three domains of living things (eukaryotes,
bacteria and archaea).
Plasma membrane FIGURE 10.7 The
Cytoplasm
general structure of a
bacterium
DNA
Cell wall
Ribosomes
Flagellum
Bacteria reproduce by an asexual process known as binary fission (dividing in two). The time it takes
for the number of bacteria to double, known as the generation time, varies between species, but is between
10 minutes and 24 hours. This means that huge numbers of bacteria can be produced in a very short time.
Bacteria are larger than viruses but smaller than protozoans, varying in size from 0.2 to 10 µm
(micrometres) in length. Their genetic material is in two forms: as bacterial DNA in the form of a large
circular chromosome, and as smaller circular DNA fragments called plasmids. Their cell wall is composed
of peptidoglycan, a substance made of protein and carbohydrate molecules (unlike plant cell walls, which
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 317
10_bio_InFocus12_2e_sb_08851_txt.indd 317 08/08/18 7:18 pm
are composed of cellulose). Some bacteria, such as those in the genus Mycoplasma, lack a cell wall. The
mycoplasmas are obligate intracellular parasites – this means they cannot live and reproduce outside
a cell. M. pneumoniae causes pneumonia in humans, and M. gallisepticum causes chronic respiratory
disease in poultry and other wild birds. Some bacteria possess a polysaccharide capsule, which can act as
a virulence factor, making them more effective in causing disease.
Bacteria may also be classified according to their shape (Figs. 10.8, 10.9): spherical (coccus), rod-
shaped (bacillus), spiral (spirillum), comma-shaped (vibrio).
Science Photo Library/Dr. Gary Gaugler
Coccus
Bacillus
Spirillum
Vibrio
FIGURE 10.8 Different FIGURE 10.9 Example of a rod-shaped bacterium, Bacillus anthracis,
types of bacteria, based on which causes anthrax
their shape
Some bacteria (such as Rickettsia and Chlamydia species)
Courtesy of Dr. John Angelos
are obligate intracellular parasites. Others (such as E.coli and
Pseudomonas aeruginosa) are extracellular parasites – they live
in tissue fluid.
Different types of bacteria can be distinguished by their
staining properties (using Gram stain). Some bacteria are
Gram-positive, others are Gram-negative (Fig. 10.10). Bacteria
may be aerobes (survive in an oxygenated environment),
anaerobes or facultative anaerobes (survive by aerobic
respiration if oxygen is present, but can switch to anaerobic
respiration if oxygen is absent).
FIGURE 10.10 ‘Pink eye’ in cattle (infectious keratoconjunctivitis) is Transmission of bacterial disease
caused by the Gram-negative bacterium Moraxella bovis.
Bacteria are everywhere in nature, including water and soil,
and serve many vital roles in ecosystems. They are also used
Transmission by humans to create vaccines and antibiotics. They can inhabit multicellular organisms in a beneficial,
of pathogens is symbiotic relationship – there are an estimated 1000 trillion bacteria in the human body and most of
discussed in more
detail later in the these are beneficial.
chapter. Bacteria that cause disease do so by producing toxins or chemicals that are harmful to the host’s
body, or by damaging host tissue directly. This represents a parasitic relationship, as there is benefit to
the bacteria and harm to the host.
Transmission of bacterial diseases may occur directly through close contact with another infected
host organism, or indirectly through contact with an object contaminated with the bacterium.
Many bacteria are susceptible to chemical treatment with antibiotics, with concurrent management
such as surgical removal of dead tissue, wound cleansing and other supportive treatment.
318 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 318 08/08/18 7:19 pm
Some bacteria are capable of forming an endospore (a tough, waterproof external layer) and lying
dormant in the environment for years. Clostridial bacteria such as Clostridium tetani, the causal agent of
tetanus, can lie dormant in soil for decades, especially around horse properties. Endospores can resist
heat, chemicals and desiccation (drying out), which makes them extremely problematic, as normal
methods of sterilisation may be ineffective in eliminating them.
Bacteria may aggregate, forming a mucus-like structure called a biofilm. A biofilm can bind to living
tissue, and the carbohydrate matrix formed within it can also bind the bacteria to other surfaces, such
as implants and catheters. This strategy enhances their defences against antibiotics and can make their
detection and elimination very difficult.
TABLE 10.1 Examples of diseases caused by bacterial pathogens
BACTERIA NAME OF DISEASE FEATURES OF DISEASE
Bordetella pertussis Whooping cough • Runny nose, sneezing
(pertussis) • Characteristic ‘whoop’ during coughing bouts
• Gagging or vomiting
Salmonella enterica Salmonellosis • Vomiting and diarrhoea
(food poisoning) • Dehydration
• Fever and abdominal cramps
Mycobacterium Tuberculosis • Cough
tuberculosis • Fever
• Night sweats
• Blood-stained sputum
Clostridium tetani Tetanus • Fever, sweating, headache
(‘lockjaw’) • Dysphagia (difficulty swallowing)
• Tachycardia (rapid heartbeat)
• Muscle spasms that begin with jaw and spread to
rest of body
Chlamydia trachomatis Chlamydial disease • Burning sensation while urinating
(sexually transmitted) • Discharge
• May lead to infertility if untreated
Fungi: Tinea (athlete’s foot)
You may have been advised never to shower at
Shutterstock.com/Elena11
your gym or local pool without wearing ‘shower
shoes’ such as sandals or thongs. The warm and
moist environment of a public shower provides
ideal conditions for the growth and spread of
fungal pathogens. Tinea (Tinea pedis) or ‘athlete’s
foot’ is a common fungal disease in humans.
The symptoms are redness and itching of the
skin around the toes, scaling of the skin, and nail
deformities such as yellowing and hardening (Fig.
10.11). Treatment involves the use of antifungal FIGURE 10.11 Tinea can lead to hardening and yellowing
of nails.
creams for an extended period, even after the
symptoms are gone.
Classification of fungi
Fungi are eukaryotic organisms that have a cell wall composed of chitin (unlike the cellulose cell walls of
plants). Fungi are heterotrophic – they do not contain chlorophyll and are not capable of producing their
own nutrients. Most types of fungi are saprophytic – they live on dead plant and animal material, and
therefore play an important role as decomposers in an ecosystem.
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 319
10_bio_InFocus12_2e_sb_08851_txt.indd 319 08/08/18 7:19 pm
Fungi may be unicellular (such as yeasts, Fig. 10.12 and Fig. 2.25a) or multicellular (such as moulds,
Fig. 10.13). Moulds are composed of a system of microscopic tubular filaments or threads known as
hyphae, which branch and spread to form a structure known as a mycelium (Fig. 2.31).
Science Photo Library/Peggy Greb/US Department of Agriculture
Ribosomes
Cytoplasm
Mitochondrion
Nucleus
Cell wall
Cell membrane
FIGURE 10.13 Aspergillus flavus, a multicellular
FIGURE 10.12 Structure of a yeast cell as seen fungus that has a ‘fluffy’ appearance when grown
under the electron microscope on an agar plate, caused by the growth of hyphae
Fungi vary in size from microscopic to macroscopic. Some fungi (such as yeasts) reproduce asexually,
while others reproduce using both sexual and asexual reproduction. Some types (yeasts) are used by
humans to produce bread and alcohol.
Transmission of fungal disease
Fungal infections (mycoses) may be cutaneous (outer skin layer), subcutaneous (beneath the skin surface,
from penetrating wounds) or systemic (affecting internal organs). Most fungal infections are opportunistic,
affecting those with weakened immune systems or concurrent diseases. Many fungal pathogens are
dermatophytes, meaning they live on skin, nails and hair. Some fungi, such as Aspergillus, Blastomycosis,
Cryptococcosis and Coccidioides, can cause serious and life-threatening fungal diseases in humans and
other animals. Fungal pathogens may be transferred via close contact with a diseased person or animal, or
with contaminated objects. Thrush is a fungal disease caused by a yeast, Candida albicans (Fig. 10.14), and
can be associated with long-term use of asthma inhalants containing corticosteroids and the long-term
use of antibiotics.
In plants, fungi are one of the leading causes of infectious diseases, such as blights, mildews
and rusts.
Science Photo Library/Dr. M. A. Ansary
FIGURE 10.14 Oral thrush is a fungal disease caused by a yeast.
320 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 320 08/08/18 7:19 pm
TABLE 10.2 Examples of diseases caused by fungal pathogens (mycoses)
FUNGUS NAME OF DISEASE FEATURES OF DISEASE
• Epidermophyton • Tinea • Cutaneous mycoses
• Trychophyton • Tinea • Fungus secretes enzymes that break down keratin
• Microsporum • Ringworm • Exposure to pathogen combined with warm, moist
conditions necessary
• Redness, itching, scaliness of skin
• Ringworm may cause classic ring-shaped lesions on skin
• Yellowing and hardening of nails
• Sporothrix schenckii • Sporotrichosis • Subcutaneous mycosis
(rose gardener’s disease) • Small cut or scrape allows fungal entry
• Scratches from thorns combined with handling infected
plant matter
• Scratches and bites from cats
• Histoplasma capsulatum • Histoplasmosis • Systemic mycoses that cause severe lung disease
• Blastomyces dermatidis • Blastomycosis • Histoplasma grows in soil contaminated with bat
• Coccidioides spp. • Coccidiodomycosis droppings
• Blastomycosis is contracted by breathing in fungal spores
from moist soil and leaf material
Protozoa: giardiasis and cyptosporidiosis
Swimming is a favourite pastime of many Australians. In summer,
Shutterstock.com/Boris Sosnovyy
local pools and splash parks are filled with families trying to escape
the heat (Fig. 10.15). Unfortunately, when humans are crowded
into one place there is an increased risk of the transfer of protozoal
pathogens from infected people to others. (Protozoa, a sub-group
of unicelluar Protista, are microscopic animal-like unicellular
organisms.) Cryptosporidium parvum and Giardia lamblia (Fig. 10.16)
are protozoal organisms that live in the human gastrointestinal
tract and are possible sewage and pool contaminants. Infection
causes abdominal cramps, chronic diarrhoea, bloating and weight
loss. Both organisms are resistant to chlorine under normal pool
operating conditions. Infected infants and children are a particular
source of the pathogen, due to faecal contamination of pools.
Swallowing infected pool water is the main source of transmission. FIGURE 10.15 Splash parks are a potential source of protozoal
During the summer of 2016, an outbreak of cryptosporidiosis pathogens if not managed carefully.
prompted a warning from health authorities to councils regarding
the maintenance of splash parks and interactive water fountains.
They were suspected to be the source of the
outbreaks, leading to the media dubbing them
Science Photo Library/Dennis Kunkel Microscopy
a b
Science Photo Library/Dennis Kunkel Microscopy
‘poo parks’. Plans were made by the NSW State
Government to include splash parks under the
definition of ‘public swimming pools’ so that strict
water quality controls could be implemented
and monitored closely.
Transmission of protozoa
Diseases caused by protozoans include malaria
and trypanosomiasis (African sleeping sickness),
which are transmitted by insect bites. Amoebic
dysentery and giardiasis are transmitted in FIGURE 10.16 Giardia lamblia, a protozoan and potential pool contaminant:
a eggs; b adults
contaminated water (faeco-oral route).
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 321
10_bio_InFocus12_2e_sb_08851_txt.indd 321 08/08/18 7:19 pm
Classification of protozoa
Protozoa are single-celled eukaryotic organisms classified along with algae and
slime moulds in the Kingdom Protista (Chapter 2). They have a membrane-
Flagellum
bound nucleus, membrane-bound organelles and a cell membrane, but no cell
wall (Fig. 10.17). They usually reproduce by the process of binary fission. They
range in size from 1 to 300 µm, with the smallest the size of a bacterium. Most
Ribosomes protozoans are motile, and their type of locomotion forms the basis of their
classification (Fig. 10.18). Flagellates are propelled by a long whip-like tail called
a flagellum. Ciliates have many hair-like projections, called cilia, which propel the
Mitochondrion
protozoan by beating rapidly. Amoebae use projections of the cytoplasm, called
pseudopods, to move around. Sporozoa (such as Plasmodium) are protozoans
that do not have structures for motion and reproduce by releasing spores.
Nucleus Pseudopodium
Cytoplasm
Flagellum
Cilia
Cell membrane
Amoeba Trypanosoma Paramecium
length: 500–600 µm length: 15–30 µm length: 200–300 µm
FIGURE 10.17 A generalised protozoal cell
FIGURE 10.18 Types of protozoans, based on their mode of locomotion
Many protozoa are free-living and do not cause disease, but some are pathogenic (Fig. 10.19,
Table 10.3). Protozoal diseases are generally treated using antiprotozoal medications.
TABLE 10.3 Examples of diseases caused by protozoal pathogens
Science Photo Library/Eye of Science
PROTOZOAN NAME OF DISEASE FEATURES OF DISEASE
Plasmodium spp. Malaria • Fever
• Fatigue
• Headaches
• Jaundice
• Vomiting
Toxoplasma gondii Toxoplasmosis • May be asymptomatic
• Headache, fatigue
• Fever
• Muscle aches
• Tender lymph nodes
• Seizures
Entamoeba Amoebiasis • May be asymptomatic
FIGURE 10.19 Red blood cells and P. falciparum, one of the histolytica • Diarrhoea (often bloody)
species of Plasmodium that causes malaria • Fever and chills
Macro-organisms (macroparasites)
Macroparasites are larger than other pathogens – they are visible to the naked eye. They are multicellular
eukaryotic organisms, varying in size from the tiniest louse to very long tapeworms. Some macroparasites
cause disease directly, while others act as vectors in the transmission of disease. They can be classified
into two groups, according to where they live.
Endoparasites live inside the host’s body. Examples are flatworms (tapeworms and flukes)
and roundworms. They cause diseases such as taeniasis (tapeworm disease), hydatidosis (hydatid
disease), schistosomiasis (liver fluke disease) and elephantiasis (caused by a filarial worm).
322 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 322 08/08/18 7:19 pm
Ectoparasites live on the outside of the body, usually sucking blood. Examples are mosquitoes, fleas,
ticks, leeches, mites and lice. Some inject toxins while feeding; these can cause inflammation, allergic
reactions and sometimes partial paralysis. Ectoparasites can also act as vectors for the transmission
of other pathogens. The flea is a vector for the bacterium Yersinia pestis, which causes bubonic plague.
Parasitic helminths: heartworm
In the 1970s, vets in Sydney noticed an increase in the incidence of
Getty Images/Nnehring
heartworm in dogs. Heartworms are long, thin worms that live in
the right side of the heart as adults and block the flow of blood (Fig.
10.20). They cause damage to the lining of the heart, the valves and
the pulmonary veins that exit the right side of the heart. It had been
recognised as a problem in tropical north Queensland previously but
had not been seen so far south before. Symptoms include a cough,
and accumulation of fluid in the abdomen and lungs. The liver was
often swollen and affected dogs would suddenly collapse and die.
Diagnosis included radiographic detection of classic changes to the
lungs and heart, but reliable blood tests have since been developed.
Treatment is often as dangerous as the disease, as a mass of dying FIGURE 10.20 Adult heartworms in a dog’s heart
worms can dislodge from the heart and block major blood vessels.
Heartworm is spread by mosquitoes that bite an infected host and
transfer it to other dogs. Cats can also be infested with heartworm.
Classification of helminths
Helminths are worm-like organisms. They commonly inhabit the gastrointestinal systems of humans and
other animals, living on nutrients supplied by the host. They disrupt normal digestion and absorption of
gut contents. They adversely affect the host organism by the way they attach to the gut wall; the host’s
immune response is affected, as well as the way it feeds. Worms are generally treated using anthelmintics.
The following types of helminths are a significant cause of disease in humans and animals:
◗ nematodes (roundworms, whipworms, hookworms)
◗ cestodes (tapeworms)
◗ flatworms (platyhelminths, such as flukes).
Transmission of helminths
Most helminths have a complex life cycle that involves several stages and several hosts. Part of the life
cycle may be spent in the external environment. All helminths reproduce using eggs, which may be
deposited in the environment, to be picked up by another host
Adult worms lay eggs
through unsanitary drinking water or infected soil. Larvae hatch in the large intestine
from the eggs and mature in the host (Fig. 10.21).
Larvated eggs
The eggs of each species have a unique architecture, and are ingested
examination under a microscope can help to identify the species.
Faecal egg counts are performed on farm animals to estimate the Eggs are passed
in faeces
abundance and species of worm parasites in a herd. Helminth
infections place an economic burden on agricultural enterprises
through animal illness and reduced meat, milk and wool yields
in infected livestock. Overcrowding (high stocking rates) is a
prime contributing factor to problems with parasitic worms in Larvated eggs
agricultural enterprises as this facilitates the rapid spread of the develop
parasite eggs. Research suggests that low burdens of parasitic
worms may confer an advantage to the host, by stimulating the FIGURE 10.21 Intestinal parasites have a long and complex life
cycle involving multiple stages. The eggs can survive in the
immune system. environment for years.
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 323
10_bio_InFocus12_2e_sb_08851_txt.indd 323 08/08/18 7:19 pm
Domestic pets such as cats and dogs are routinely administered anthelmintic drugs, commonly
known as ‘deworming’. Large burdens of helminths such as hookworm can have dire consequences for
puppies and kittens as they cause intestinal bleeding and anaemia, while roundworms can contribute
to intestinal blockages and torsions. Sometimes worms will irritate an animal’s bottom and lead to the
behaviour known as ‘scooting’ as the animal drags its itchy bottom along the ground. Many worms (such
as strongyles or large redworms) affect horses and can even migrate through the blood vessels of the gut
to the liver and skin, causing catastrophic damage.
Plants are also susceptible to helminth infection. Larvae can cause serious disruption to leaves and
vascular system, compromising the plant’s ability to photosynthesise and transport water and nutrients.
TABLE 10.4 Examples of helminth diseases in animals
HELMINTH NAME OF DISEASE FEATURES OF DISEASE
Enterobius vermicularis Threadworm/pinworm • Red and itchy anus
(most common worm • Irritability and behaviour changes
infection in Australia) • Lack of appetite
• Restless sleep
Taenia solium (pigs) Tapeworm
• Worms may be visible in faeces
Taenia saginata (cattle)
• Weight loss
Toxocara canis (dogs) Roundworm • Abdominal pain
Toxascaris leonina (cats) • Diarrhoea
Ascaris lumbricoides (humans) • Blood in faeces
Ancylostoma duodenale (humans) Hookworm
Ancylostoma caninum (dogs)
Unicnaria stenocephala (dogs, cats, foxes)
Parasitic arthropods
Arthropods are invertebrates that have an exoskeleton and a segmented body; they include insects and
arachnids. Parasitic arthropods are ectoparasites, a leading cause of disease in humans, animals and
plants. They may cause skin irritation, act as vectors for other pathogens and contribute to blood loss and
concurrent infections. In some cases, ectoparasites have a devastating effect on organisms. Treatment
generally involves chemicals.
Fleas
Fleas infest a variety of animals, including humans. They can transmit tapeworms in dogs (Dipylidium caninum)
and cause allergic reactions to their saliva, which contains an antigenic protein. Flea allergy dermatitis is
caused by hypersensitivity to fleas and is a common
problem in dogs. It typically manifests as hair loss and
Shutterstock.com/Blamb
The flea life cycle
begins when the skin redness along the top of the back, or ‘hot spots’, near
Pupae develop adult flea lays eggs
before hatching in the pet’s coat
the tail and other areas on the belly. Fleas inhabit the soil,
as new adult cracks in floorboards and paving, and generally anywhere
fleas to complete
the life cycle a household pet frequents. The eggs are sensitive to
vibrations and carbon dioxide concentrations, and will
often hatch in the thousands when a house’s inhabitants
return from holidays (Fig. 10.22).
The eggs drop off
as the pet moves Ticks
around the home
Ticks are common ectoparasites of humans and
animals. The paralysis tick Ixodes holocyclus (Fig. 10.23)
Within a few days the is a problem in wet, densely vegetated areas, such
eggs hatch into larvae
as north-west Sydney. The tick injects a neurotoxin
during feeding that causes progressive paralysis. Ticks
FIGURE 10.22 The life cycle of the dog flea, Ctenocephalides canis
can be extremely difficult to locate on a pet and their
324 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 324 08/08/18 7:19 pm
effects may last several weeks, even after they have been
Shutterstock.com/IanRedding
removed. Bandicoots and possums are natural hosts but
are generally unaffected unless they carry large numbers
of ticks. One of the first signs of tick paralysis in dogs
is dysphonia (a strange bark) followed by dysphagia
(difficulty swallowing), a staggering gait (ataxia) and
potentially life-threatening paralysis.
FIGURE 10.23 The paralysis tick, Ixodes holocyclus
Lice
Lice may have biting or sucking mouthparts (Fig. 10.24a). They cause economic loss in the wool
industry as itchy sheep scratch themselves on fence posts and damage their fleece. Sucking by lice can
cause anaemia in infested animals. Head lice (Pediculus humanus capitis) are a common problem in
schools and childcare centres due to close contact between children.
Mites
Mites are arachnids (Fig. 10.24b). They live mostly on animals but can also infest humans. Infestation
with mites causes a condition known as mange (Fig. 10.3). Mites generally cause irritation, itchiness and
redness of the skin. House dust mites feed on shed human skin flakes. They are responsible for many
respiratory and skin problems in humans due to allergies.
Science Photo Library/George Bernard
Shutterstock.com/Bachkova Natalia
a
FIGURE 10.24 a Lice are insects; b mites are arachnids
TABLE 10.5 Examples of mites that infest animals and humans
MITE DISEASE FEATURES
Demodex canis (dogs) Demodectic mange • Overpopulation of the parasitic organism due to
immune compromise of the host
• Hair loss (alopecia)
• Itching
• Red skin
• Crusting of skin
Sarcoptes scabei Scabies • Hair loss (alopecia)
• Itching
• Red skin
• Crusting of skin
Ornithonyssus bursa Bird mites • Hair loss (alopecia) in humans
• Itching
• Red skin
• Crusting of skin
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 325
10_bio_InFocus12_2e_sb_08851_txt.indd 325 08/08/18 7:19 pm
Flies
Alamy Stock Photo/Jon Ongkiehong
The common housefly is found everywhere around the world.
It is a non-biting fly but is capable of transmitting pathogens
between hosts, including potentially dangerous gut bacteria
such as E. coli. Some flies lay eggs in the damaged skin of their
hosts. Fly strike in sheep is caused by the sheep blowfly (Lucilia
cuprina) and is a devastating condition where the eggs hatch
and the maggots burrow into the sheep’s flesh and feed from
it. Stable fly in horses (Stomoxys calcitrans) can lead to reduced
weight gain in the horse because of its continual agitation
caused by the flies biting. Large populations of flies around
cattle yards and paddocks can cause severe stress to animals
as they shake their heads and flap their ears in an attempt
FIGURE 10.25 Cattle bunch together when flies begin to bite them, to rid themselves of the flies, even developing heat stroke
in an attempt to avoid being bitten
in summer.
Mosquitoes
Mosquitoes can be considered biological parasites, because they benefit by having blood meals
from their hosts. Mosquitoes also act as vectors, transferring pathogens from one human or animal
WS
to another. These pathogens include those that cause malaria, Ross River fever, yellow fever and
Diversity of Dengue fever. Zika virus, transmitted by mosquitoes, is an emerging concern around the world and
pathogens
is especially dangerous because of its effects on the unborn foetus. It was first reported outside
Africa and Asia in 2007.
INVESTIGATION 10.1
A primary investigation of the comparative sizes
of pathogenic cells
Pathogens vary widely in shape and size. With advances in technology, we are now able to see objects of
astonishingly small sizes. The identification of pathogens is an important tool for a clinician who wishes to
Refer to Biology identify the causal agent of an infectious disease. One distinguishing feature that can be easily assessed under
in Focus Year 11, the light microscope is the comparative size of many cellular pathogens.
Chapter 2 to revise
how to use a AIM
microscope.
To use a light microscope to examine and compare the sizes of a variety of cellular pathogens
MATERIALS
• light microscope
• prepared slides of protozoa, bacteria, moulds, yeasts
• oil immersion lens
• immersion oil
326 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 326 08/08/18 7:20 pm
RISK ASSESSMENT
Complete a risk assessment for your investigation.
!
WHAT IS A HAZARD? WHAT RISK DOES THIS HAZARD POSE? HOW CAN YOU SAFELY MANAGE THIS RISK? RISK
ASSESSMENT
METHOD
1 Observe prepared slides of yeasts, moulds and protozoa under low power and then high power.
2 Draw a diagram of each of type of cell. Label the cell wall, cell membrane, nucleus, cytoplasm and other
structures you may see. Note the magnification.
3 Observe a prepared slide of bacterial cells.
4 Use an oil immersion objective lens to give a higher magnification (to observe the bacteria). Place a drop
of immersion oil on the coverslip above the specimen and centre the oil immersion objective lens over the
oil. Use the fine focus adjustment to obtain a clear image.
5 Draw a picture of one bacterial cell. Note the magnification.
RESULTS
Record your results in a table that includes:
• the cells recorded in order from smallest to largest
• a scientific diagram of each pathogen with a scale line to indicate size
• the magnification you used for each
• any similarities and differences noted between the different cellular pathogens.
DISCUSSION
1 Imagine that a doctor is in a remote village in a developing nation, investigating an outbreak of an
infectious disease. Discuss the usefulness of the above method in this situation.
2 What kinds of information about the pathogen or the disease would the doctor not get from this type of
investigation?
3 Evaluate the importance of keeping tissue samples free of contamination from the environment when
preparing slides for this kind of investigation in the field.
4 What extra precautions would need to be taken by a person who is preparing their own slides of
pathogens rather than using pre-prepared ones?
CONCLUSION
Write a summary statement on the usefulness of the light microscope in identifying pathogens by their
comparative size.
KEY CONCEPTS
● Cellular pathogens include bacteria, fungi, protozoa and macro-organisms.
● Bacteria are prokaryotic, unicellular organisms that are mostly harmless in nature. Some are
pathogenic to humans, animals and plants, and may directly destroy tissue or secrete toxins.
● Fungi may be unicellular or multicellular and are common causes of skin and lung diseases in
humans and animals.
● Protozoa are unicellular eukaryotes that inhabit a wide range of ecosystems; some are
pathogens.
● Macro-organisms such as worms (helminths) and arthropods (flies, mosquitoes, ticks, fleas, lice,
mites) can be pathogens or can act as vectors and carry other pathogens.
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 327
10_bio_InFocus12_2e_sb_08851_txt.indd 327 08/08/18 7:20 pm
Non-cellular pathogens
In Sydney during the winter of 2017, an increased
Getty Images/Hextor Retamal
number of people presented to hospital emergency
departments with severe vomiting and diarrhoea.
Particularly hard hit were aged care facilities and
childcare centres. The culprits were Norovirus and
Rotavirus, which are spread by direct contact with
an infected person. NSW Health advised people to
wash their hands after visiting the toilet and before
eating, to stop the spread of the virus. A rotavirus
vaccine is available for children (Fig. 10.26).
FIGURE 10.26 A rotavirus vaccine is available for
infants. Viruses
The word ‘virus’ is derived from a Latin word meaning
‘slimy liquid or poison’. Viruses were first recognised as pathogens in the 1890s after the study of the
tobacco mosaic virus. Viruses are non-cellular and have both living and non-living characteristics: they
contain genetic material in the form of nucleic acids and are able to pass on hereditary information
(a characteristic of living organisms), they are not composed of cells and they can be crystallised (a
characteristic of non-living things). Viruses are not free living – they can only reproduce and metabolise in
a host cell. A single viral particle is known as a virion.
Classification of viruses
Viruses are so small that they can only be viewed using an electron microscope. They consist of a
protective protein coat (called a capsid) that encloses the genetic material, which may be DNA or RNA –
this is the infectious part of the virus. Viruses that contain RNA are known as retroviruses. Some viruses
also have a lipid membrane (envelope) that surrounds the capsid (Fig. 10.27).
Each virus has a particular type of
structure. Some common structures are
shown in Figure 10.28.
Phospholipid
envelope The viral protein coat contains
(derived from chemicals that allow the virus to attach to
host cell) the surface of the host cell. Once the virus
Viral proteins
incorporated has attached to a cell, it enters and takes
in envelope over the cell’s reproductive mechanisms,
making many copies of itself. The host cell
Viral nucleic becomes so full of copies of the virus that it
acid dies and bursts, releasing the new viruses,
which repeat the replication process in
other host cells (Fig. 10.29). Some viruses
use the cell membrane of the host to
Protein coat
(capsid) form their own lipids and glycoproteins.
Bacteriophages (viruses that invade
100–200 nm diameter
bacterial cells) reproduce in the same way,
FIGURE 10.27 Generalised structure of a virus but instead of entering the host cell they
simply inject their genetic material into it.
328 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 328 08/08/18 7:20 pm
a b c FIGURE 10.28
Structures of different
Cold virus Mumps virus Tobacco mosaic virus Bacteriophage viruses:
a icosahedral;
b spherical virion
50 nm
Protein coat DNA c helical (filamentous);
Protein d complex
DNA
coat
25 nm 100 nm 350 nm
mRNA
2 Cell makes copies of
virus DNA.
1 Virus attaches to host cell and 3 Cell uses mRNA to make
injects nucleic acid into host cell. virus proteins.
5 Cell bursts and releases 4 New viruses are assembled.
new viruses.
FIGURE 10.29 Replication of viruses
Many diseases are caused by viruses, including:
◗ influenza
◗ measles
◗ AIDS (caused by the human immunodeficiency virus, HIV)
◗ herpes
◗ glandular fever
◗ SARS (severe acute respiratory syndrome)
◗ tobacco mosaic virus disease in plants.
The treatment of viral diseases is difficult, as any attempt to kill the virus will also affect the
host cells.
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 329
10_bio_InFocus12_2e_sb_08851_txt.indd 329 08/08/18 7:20 pm
Prions: kuru
In the highlands of Papua New Guinea in the 1950s, in a tribe of people known as the Fore, researchers
became aware of an unusual disease. It caused shivering and trembling, and often uncontrolled
laughter, and rapidly progressed to death. At least 200 people a year had succumbed to this mysterious
disease. Eventually the researchers linked this disease to the practice of eating people who had passed
away. The brain was consumed in an attempt to spare the deceased the indignity of being eaten by
worms. The pathogen was passed on in this way. The researchers won a Nobel Prize in Physiology
or Medicine for identifying a completely new infectious agent –
Amino acids in Amino acids in densely the prion. The disease was named kuru.
an alpha helix packed sheets
Classification of prions
A pathogenic prion is an abnormal protein that is capable of causing
degenerative diseases of the nervous system. Unlike other types of
pathogens, prions do not contain any genetic material (DNA or RNA).
Prions are the smallest of all pathogens.
Disease-causing prion proteins have a different structure to normal
prion proteins, which are found in the brain and spinal cord of humans
Normal prion protein Infectious prion protein and animals (Fig. 10.30). Pathogenic prions cause disease by inducing
abnormal folding patterns in the normal proteins that they come in
FIGURE 10.30 Normal prion proteins and contact with (Fig. 10.31). The abnormal proteins are deposited within the
pathogenic prion proteins have different shapes.
central nervous system and other organs.
Normal prion Infectious Infectious prion protein Both now infectious
protein prion protein comes into contact with prion proteins
normal prion protein.
FIGURE 10.31 Conversion of normal prion proteins into infectious prion proteins
The diseases caused by pathogenic prions are known as transmissible spongiform encephalopathies
(TSEs). They are called ‘spongiform’ diseases because the brain tissue of infected individuals is full of
holes, resembling a sponge (Fig. 10.32). These diseases have a very long incubation period (5–20 years),
but can progress rapidly once the first clinical signs appear. Other examples of TSEs are 'mad cow'
disease or BSE (bovine spongiform encephalopathy) and CJD (Creutzfeldt-Jakob Disease).
Science Photo Library/Innerspace Imaging
a b
Getty Images/Science Source
FIGURE 10.32 Changes in the brain caused by pathogenic prions: a normal brain tissue; b brain tissue affected by prion
disease (the white spaces are holes)
330 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 330 08/08/18 7:20 pm
Transmission of prions and TSE diseases
Prions can be contracted in the following ways:
◗ ingesting tissue containing infectious prions, such as nervous and brain tissue
◗ as a result of surgery where contaminated equipment was used
◗ receiving contaminated growth hormone injections taken from infected animals
◗ receiving contaminated corneal transplants from previously infected organ donors
◗ inheriting the mutated gene that codes for the infectious prion
◗ spontaneous formation of infectious prions.
Diseases caused by prions
Diseases caused by prions include:
◗ Creutzfeldt-Jakob disease (CJD) in humans, a rapidly progressive and fatal brain disease
◗ variant CJD in humans (related to ‘mad cow disease’ or bovine spongiform encephalopathy, which
occurs in cattle)
◗ chronic wasting disease of north American deer, elk and moose (Cervidae)
◗ scrapie in sheep and goats
◗ kuru in humans
◗ fatal familial insomnia – from the spontaneous transformation of protein in the brains of humans.
KEY CONCEPTS
● Non-cellular pathogens include viruses and prions.
● Viruses are obligate parasites.
● Viruses contain DNA or RNA in a protein coat.
● Viruses use the contents of the host cell to replicate their genetic material and create new
virions.
● Prions consist of abnormally folded prion protein.
● Normal prion protein is found throughout the brain and spinal cord in humans and mammals.
● Disease-causing prions induce abnormal folding patterns when they come in contact with other
prion proteins.
● Prion diseases have a long incubation period and are inevitably fatal once clinical signs occur.
CHECK YOUR
1 Are all bacteria pathogens? Justify your answer. UNDERSTANDING
2 Anthrax spores can survive in dry conditions for decades. Find out what makes a spore so resistant to
desiccation. 10.1a
3 Describe the characteristics that could be used to distinguish between the following pathogens:
a bacteria and viruses
b fungi and protozoans
c prions and viruses
d bacteria and fungi
e protozoans and macroparasites.
4 When treating a patient for an infectious disease, a doctor would need to know whether the treatment was
effective. How would a dead bacterium look different from a living bacterium under a light microscope?
Would you need more information before you could tell whether a pathogen is dead, rather than just
relying on its appearance? Explain your answer.
5 Identify the differences between the composition of the cell walls of bacteria, fungi and plants. Assess the
usefulness of these differences when trying to identify the causal agent of an infectious disease.
6 Explain why coming into contact with a pathogen does not necessarily result in disease.
7 Define the following terms: virulence factors, incubation period.
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 331
10_bio_InFocus12_2e_sb_08851_txt.indd 331 08/08/18 7:20 pm
8 Contrast the way in which a virus reproduces with the way prions propagate in infected brain tissue.
9 Choose two infectious diseases and briefly explain how each is commonly transmitted.
10 How would a microbe that is part of the normal microflora become a pathogen?
Modes of transmission of infectious disease
Transmission of infectious diseases involves the carrying or transfer of a pathogen from an infected host
to a non-infected organism. The mode of transmission relates directly to the ability of the pathogen to
survive outside a host cell. Many pathogens can persist outside the host in a state of dormancy. Pathogens
may exist in reservoirs, either in the environment or in living hosts. For example, spore-forming bacteria
such as anthrax can exist for years in a soil reservoir where the body fluids of an infected animal have
seeped into the soil.
The human gut can act as a reservoir for pathogens. A human may be an active carrier, harbouring
the disease in their own body, or a passive carrier, transmitting the pathogen from person to person
on unwashed contaminated hands (in a hospital setting, for example). A famous historic example of
an active carrier was Mary Mallon, also known as ‘typhoid Mary’, who was an asymptomatic carrier of
typhoid fever (Salmonella typhi). Mary was a cook for many households in New York City between 1900
and 1915. During this time, she infected around 122 people, five of whom died.
In macroparasitic infections, there are often several hosts in the life cycle and therefore several
different modes of transmission. The parasite must be transmitted between each host to reach sexual
maturity. Each stage of the life cycle must be successfully completed and multiple transmissions occur.
For example, the liver fluke (Fasciola hepatica) uses humans, sheep or cattle and snails as an intermediate
host to complete its life cycle (Fig. 10.33).
Stages in mammalian Stages in intermediate host
host (sheep) Operculum (pond snail Galba truncatula)
opens
Adult fluke in
liver (bile duct) Redias develop
Miracidium bores into inside and are
Mouth Eggs pass out in snail’s tissues. released when
faeces. Egg
Oral sporocyst
sucker splits open.
Sporocyst
Miracidium
Pharynx
Ventral Redia
sucker
Branched Cercariae
intestine (larvae)
released
Cercariae encyst on through birth
grass. pore.
Metacircaria Cercaria
eaten with leaves snail
grass. and swims.
Cercaria
FIGURE 10.33 The complex, multistage life cycle of Fasciola hepatica, or liver fluke
332 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 332 08/08/18 7:20 pm
An understanding of transmission methods is critical to the control of disease outbreaks.
For a disease to spread between organisms, a ‘chain of infection’ must be present. This chain has three
elements:
◗ a host that is susceptible to the disease
◗ a pathogen that is capable of causing the disease
◗ a mode of transmission – a way for the pathogen to get from host to host.
There are three modes of transmission, or ways that a pathogen can get from host to host:
◗ direct contact – transfer of the pathogen via exposure to infected skin or body secretions
◗ indirect contact – transfer of the pathogen to a new host via a non-living object
◗ vector transmission – transfer of the pathogen via another organism, such as an arthropod.
Direct contact
Transmission by direct contact occurs when there is physical contact between the host and a non-
infected organism. Contact between organisms of the same generation, or between organisms that are
not parent and child, is known as horizontal transmission. Contact between offspring and parent (for
example, from mother to baby during childbirth) is known as vertical transmission. Physical contact
includes:
◗ touching
◗ sexual contact
◗ kissing
◗ contact with nasal or oral secretions
◗ biting
◗ direct contact with any blood or other body fluids
◗ direct contact with wounds
◗ prenatal (before birth or during pregnancy) or perinatal (around the time of birth) transmission.
Diseases caused by direct contact include:
◗ skin infections, such as ringworm and impetigo
◗ cytomegalovirus (CMV) or glandular fever
◗ HIV/AIDS
◗ herpes simplex virus (HSV).
Indirect contact
Transmission by indirect contact occurs when the host and another organism have no direct contact
with each other. Infection occurs from a reservoir created by the host outside itself, such as contaminated
materials and surfaces or objects. A fomite is any object or substance that carries infection. Airborne
diseases are of grave concern, as they are often the most difficult to control once an outbreak occurs.
Infection may also occur via a vector.
Indirect means of transmission include:
◗ airborne transmission – coughing or sneezing (droplets can travel up to 8 metres through the air)
◗ touching an infected surface
◗ contaminated food or water
◗ infected surgical instruments that have not been sterilised correctly (surgical instruments are
generally sterilised by exposure to saturated steam under pressure, in an autoclave)
◗ vectors such as mosquitoes, ticks and fleas. (See next section.)
Examples of diseases spread by indirect contact include:
◗ measles virus – from infected droplets (bodily fluids)
◗ gastroenteritis, caused by the bacterium E. coli – from contaminated food and water
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 333
10_bio_InFocus12_2e_sb_08851_txt.indd 333 08/08/18 7:20 pm
◗ toxoplasmosis, caused by the protozoan Toxoplasma gondii – from infected cat droppings
◗ Legionnaires’ disease, caused by over 50 species of Legionella bacterium – from contaminated water
in water cooling towers
◗ influenza – exposure to droplets and other biological matter containing influenza virus particles.
Vector transmission
Vector transmission is a special case of indirect transmission of pathogens. It occurs through arthropods
such as certain species of mosquitoes, sandflies, ticks, fleas and flies, or through infected aquatic snails.
It usually involves a bite from an arthropod that is bloodsucking and transmits the pathogen during a
meal, although in some cases, animals swallow the arthropod in the act of grooming themselves (for
example, bot flies in horses, flea tapeworms in dogs). Sometimes infected plants and fungi are sources of
pathogens and can act as vectors. Mammals such as fruit bats are vectors for the Hendra virus, and pigs
may act as vectors for Menangle virus.
Every year, millions of people die from infection via a vector, and these diseases represent around 17%
of all infectious diseases in humans. Transmission of these diseases is influenced by a complex association
of environmental and social factors. For example, vector diseases are most common in warm, humid
parts of the world where the conditions for insect survival and reproduction are favourable. Mosquitoes
that transmit malaria (female Anopheles), for example, lay their eggs in water.
Diseases spread by vector transmission include:
◗ Chagas disease
◗ malaria
◗ dengue fever
◗ leishmaniasis (once considered exotic, now a reservoir in macropods)
◗ schistosomiasis
◗ onchocerchiasis
◗ canine and feline heartworm (Dirofilaria immitis)
◗ Hendra and Nipah viruses.
Case study: Equine influenza virus
Equine influenza (horse flu) is an exotic equine disease. If it became enzootic (endemic in an animal
population), it would have a devastating effect on the Australian horse industry. In August 2007, an
equine veterinarian reported several cases of sick horses in Centennial Park, Sydney. At the same time,
breeding stallions from Japan at the Eastern Creek Quarantine Station were showing signs of equine
influenza virus (EIV) infection after their importation. Laboratory tests confirmed an outbreak of EIV in
both groups of horses. Certain protocols had already been set in place in anticipation of an outbreak, as
per the Australian Veterinary Emergency Plan (AUSTVETPLAN).
Cause
Equine influenza virus is an orthomyxovirus that affects horses and donkeys. It does not infect humans.
Equine influenza is caused by two main strains of EIV, known as equine-1 (H7N7) and equine-2 (H3N8).
Symptoms include a fever (38.5°C or higher), watery nasal discharge, hacking cough, loss of appetite and
muscle pain. Horses appear depressed and may have laboured breathing.
Transmission
Equine influenza is highly contagious. It is spread:
◗ directly between infected horses through nasal secretions and other body fluids
◗ indirectly through humans who carry the virus from an infected horse to other horses via
contaminated shoes, clothing, grooming equipment, food and water buckets.
334 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 334 08/08/18 7:20 pm
Management of the outbreak
Once a diagnosis of equine influenza was confirmed, the following measures were enacted.
◗ The NSW Chief Veterinary Officer imposed
a state-wide lockdown on movement of all
Source: Moloney, Taragela and Buckley / NSW DPI Biosecurity
horses, which eventually became nation-wide,
to prevent further spread of the virus.
◗ A management centre was set up to coordinate
management at the disease control headquarters
in Orange and Menangle, NSW.
◗ Horse properties were quarantined throughout
NSW.
◗ The spread of the disease was mapped
(Fig. 10.34), and by the end of August it
was clear that the virus had spread to the
NSW Central Coast and the Hunter Valley.
Areas of high horse stocking density (such
as Dubbo) experienced the fastest spread of the
disease.
With the lockdown of horse movements
and quarantine procedures, the outbreak was
controlled by December 2007 (Fig. 10.35).
Australia was declared free of the virus in FIGURE 10.34 The movement of horses caused the equine influenza virus to
spread.
early 2008.
Control of future outbreaks
The Australian Veterinary Association suggests that mass
vaccination of Australian horses is not a justifiable option. The
Source: Moloney, Taragela and
Buckley / NSW DPI Biosecurity
equine influenza virus mutates in the same way as human 1000
influenza viruses, and so vaccination would not confer
800
immunity against new strains of the virus. Even vaccinated
Cases per week
horses can still spread the virus indirectly. Vaccination may 600
in fact delay detection of the disease.
There are a number of other ways in which future 400
outbreaks of EIV can be controlled.
200
◗ Restrict the importation of live horses to those from
approved countries. 0
1 3 5 7 9 11 13 15 17 19 21 23
◗ Subject imported horses to strict biosecurity measures, Week number
including: quarantining the horses in their own country
FIGURE 10.35 The weekly number of new cases of EIV peaked and
for 14 days prior to export; and quarantining them upon then declined steadily in 2017.
arrival, in a post-entry quarantine facility in Victoria for a
minimum of 14 days.
◗ Public education, particularly for those working in the horse industry, is vital for early detection.
◗ Provide biosecurity training for all involved in the importation of horses into Australia, including
grooms, truck drivers, cleaners and airline staff.
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 335
10_bio_InFocus12_2e_sb_08851_txt.indd 335 08/08/18 7:20 pm
INVESTIGATION 10.2
Secondary-source investigation of transmission of a disease
during an epidemic
Use the equine influenza case study described in this section to guide your own research on an infectious
disease outbreak of your choice.
1 In writing up your investigation, include the following parts:
a Title for your investigation
b Introduction – the background to the outbreak. What were the events that led to it? What are some
features of the pathogen and the hosts? Give some context to the outbreak by describing where it
began, how it was first noticed, and so on.
c Aim – write an aim for your investigation.
d Hypothesis – this is an opportunity to dig a little deeper into an area of interest by formulating a
hypothesis about a particular disease outbreak.
e Method – choose an infectious disease that you wish to study. It may be a disease of humans, animals
or plants. When considering which disease to study, you should take into account your interests and
whether the disease can easily be studied according to the parameters given. Suggestions include (but
are not limited to): measles, whooping cough, swine or avian influenza, Panama disease of bananas,
hepatitis B, HIV/AIDS, Ebola, Hantavirus, SARS (severe acute respiratory syndrome), Hendra virus and
variant Creutzfeldt-Jakob disease. From the secondary sources that you consult, identify the relevant
material you need to describe that relates to the aspects of your chosen infectious disease.
f Resources – a complete reference list should be provided in the style recommended by your teacher.
Refer to page 10 to Remember to use a number of different sources, including the Internet, books (such as medical
review the CRAAP
method.
reference material) and journals, and always assess the accuracy and reliability of these sources using
the CRAAP method.
g Communication – present your information in a way that is considered suitable by your teacher. For
example, you may like to design a fact sheet that describes information about your chosen infectious
disease according to the areas listed above. Other possibilities include a multimedia presentation, video
presentation, dramatic piece, detailed poster, or any other creative means. Brainstorm this with your
class. You may like to work individually or as a group, in which case you need to organise the group
members and assign roles. Make sure you use headings for each of the areas and include pictures/
illustrations. Refer to the case study on equine influenza as a guide to the type of information that is
required. You must include in your presentation:
– background to the outbreak
– cause – identify the specific pathogen and clinical signs of the disease
– factors affecting transmission of the pathogen
– prevention and control of the spread of the pathogen. Control refers to the strategies employed
to keep the incidence of the disease to a minimum in the population. Control measures are aimed
at eliminating the source of the infection, preventing the transmission of infection and protecting
susceptible people. Prevention refers to strategies that can be used to stop the occurrence of the
disease in individuals
– management/prevention of future outbreaks of this pathogen. Examples are: isolation of the
infected individual, interruption of the life cycle of the pathogen, immunisation programs,
prevention of food and water contamination, and education programs.
h Discussion – a general discussion of your findings that identifies major trends in your research.
Also include some of the difficulties you faced in finding reliable data and some of the ways you
overcame this.
i Conclusion – refer to your aim (and hypothesis).
336 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 336 08/08/18 7:20 pm
Identifying microbes in food or water
Microbes are all around us – they are on and in our bodies, in the air, on the surfaces around us, in water
and in food. Not all microbes cause disease; in fact, some have little or no effect on us, and others are
even beneficial. Sometimes food and water can become contaminated by pathogens. These commonly
cause symptoms such as vomiting and diarrhoea but occasionally can lead to more severe consequences,
such as kidney failure and even death. Detection of microbes in food and water is not possible with the
naked eye. However, many microbes, such as fungi and bacteria, cluster together when given suitable
conditions for reproduction and growth, including moisture, nutrients and warmth. The clusters are
known as colonies, and can be seen without the use of a microscope (Fig. 10.36).
All these conditions can be provided with the
Science Photo Library/CNRI
use of nutrient agar plates and an incubator set at
approximately 30°C. Agar is a jelly-like substance
derived from seaweed. It is dissolved in water, and
nutrients suitable for microbial growth are added
before it sets. Different pathogens require different
nutrient agars. For example, streptococci bacteria
often require a nutrient medium enriched with sheep
blood, to grow well.
The features of a colony can be used to help
identify the specific pathogen. Bacterial colonies
tend to be smooth, glossy and coloured, whereas
fungal colonies are furry and large. Bacterial colonies
can be identified according to their:
◗ colour
◗ margin FIGURE 10.36 Bacterial colonies growing on a nutrient agar plate
◗ form (basic shape)
◗ elevation (shape of the cross-section)
◗ surface features (smooth, dull, wrinkled) (Fig. 10.37).
a Form FIGURE 10.37
Different types of
bacterial colonies can
be identified, based
on their a form,
b elevation and
c margin.
Circular Irregular Filamentous Rhiziod
b Elevation
Raised Convex Flat Umbonate Crateriform
c Margin
Entire Undulate Filiform Curled Lobate
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 337
10_bio_InFocus12_2e_sb_08851_txt.indd 337 08/08/18 7:20 pm
INVESTIGATION 10.3
Primary investigation into the microbial testing of food
and water samples
Information and
communication
Sterile technique is extremely important during this investigation. Read the worksheet, The importance of sterile
technology technique, thoroughly before you start this investigation.
capability
AIM
WS
To design and conduct a practical investigation relating to the microbial testing of water or food samples
HYPOTHESIS
The importance of
sterile technique Your hypothesis should be in the form of a general statement. It should include both dependent and
independent variables.
MATERIALS
Provide a numbered list of all equipment you use in this experiment. This includes all the personal protective
equipment (PPE) you use, such as gloves, lab coats and safety goggles.
Risk Assess RISK ASSESSMENT
You must carry out a risk assessment that shows the hazard, what could happen and what procedures are
in place to minimise the hazard. Use of an online risk assessment website is highly recommended. (See the
weblink.)
!
RISK WHAT IS THE HAZARD? WHAT RISK DOES THIS HAZARD POSE? HOW CAN YOU SAFELY MANAGE THIS RISK?
ASSESSMENT
• Once the Petri dish has been sealed, it must not be opened again.
• All equipment that is used should be autoclaved. Reusable equipment can then be washed and Petri
dishes disposed of in the correct manner.
• Always wash your hands thoroughly before leaving the laboratory.
METHOD
When planning the method, you must ensure that your investigation is a ‘fair’ test. You should consider the
following:
• A control should be used to ensure the validity of the experiment. A control is designed to show what
would happen without the presence of the variable being tested. The experiment should also be designed
to test what it sets out to test.
• Identify the independent variable – the variable that is being tested in the experiment and the one that you
change.
• Also identify the dependent variable – the one that you measure/observe and record in your results.
• All other variables in your experiment must be controlled.
• Carry out a risk assessment that shows the hazard, what could happen and what procedures are in place to
minimise the hazard.
The syllabus states
that you are to
• Decide whether you are going to study food or water, and the number and sources of test samples. Try to
identify the microbes use a variety of sources. If you are going to use food in this investigation, mash each sample up in a test
present in food or tube with 2 mL of distilled water. Include instructions on how to inoculate your agar plates with the food or
water – it is not
sufficient that the
water samples.
agar plates are
merely exposed RESULTS
to air in different Draw up an appropriate table in which to record your results. This may include labelled photographs of the
environments.
agar plates before and after inoculation with the test substance.
338 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 338 08/08/18 7:20 pm
DISCUSSION
In your discussion, answer the following questions.
1 Justify and evaluate the use of a control in this experiment.
2 In this experiment, identify the:
a independent variable
b dependent variable
c controlled variables.
3 Describe some of the procedures used to prevent the contamination of samples. How could these
procedures be improved?
4 Evaluate your risk assessment. Was it adequate preparation for the investigation?
5 Compare the number and types of microbial colonies present in each sample.
6 Identify which sample was the most contaminated and suggest a reason for this.
CONCLUSION
This should answer the question asked in the aim. State the relationship between the two variables you tested.
EX TENSION
Applications of microbiological techniques in the food industry.
Use online resources to research the following:
a What results should you expect from your investigation?
b Compare the expected results with your actual results, and explain any anomalies in terms of your
technique, equipment or experimental method.
c How are these tests applied in the food industry? Find out about their application in the testing of
foods for consumption by humans. How could these tests be applied to ensuring safe drinking water
for urban and rural populations?
KEY CONCEPTS
For the transmission of an infectious disease to occur, there must be a:
● host that is susceptible to the disease.
● pathogen present that is capable of causing the disease
● way for the pathogen to get from host to host (mode of transmission).
There are three ways that a pathogen gets from host to host:
● direct contact – transfer of the pathogen via exposure to infected skin or body secretions
● indirect contact – transfer of the pathogen to a new host via a non-living object
● vector transmission – transfer of the pathogen via another organism such as an arthropod.
CHECK YOUR
1 How can a bacterial pathogen be transmitted from a carrier to a host? UNDERSTANDING
2 Can any mosquito transmit malaria between humans?
3 Contrast active and passive carriers of diseases.
10.1b
4 Use an example to show that transmission of a pathogen to the final host may involve several stages.
5 What three elements of the ‘chain of infection’ are necessary for disease transmission to take place?
6 How can hydatid tapeworms be transmitted from animals to humans?
7 Briefly outline, using examples, two ways in which pathogens may be transferred:
a directly
b indirectly
c by means of a vector.
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 339
10_bio_InFocus12_2e_sb_08851_txt.indd 339 08/08/18 7:20 pm
8 Outline the importance of conducting a risk assessment when working with biological material.
9 Justify the technique of holding the lid of an agar plate at an angle over the plate when inoculating with a
potential pathogen.
10 Identify some of the biosecurity controls in place for importing a live animal.
10.2 Robert Koch and Louis Pasteur
In the second half of the 19th century, there was a revolution in microbiology, primarily due to the
research of Louis Pasteur and Robert Koch. Working separately, Pasteur and Koch were able to make an
invaluable contribution to our understanding of infectious disease. Although they each used aspects of
the other’s work in their own research, the degree of collaboration and communication was minimal, as
they did not get along with each other.
Historical understanding of the causes of disease
Prior to the work of Koch, Pasteur and others, the cause of disease and decay was explained by the theory
of spontaneous generation. This involved the idea that life, such as maggots present in rotting flesh, arose
spontaneously from non-living things. Early scientists Redi and Spallanzani performed experiments that
showed that some form of living matter had to be present before other living things could appear. Their
work was not widely accepted, however, and the theory of spontaneous generation remained the most
widely believed explanation for disease and decay. Subsequently, Pasteur was able to disprove this theory
and establish the ‘germ theory of disease’. This theory states that germs (microbes) cause disease and
that all micro-organisms come from pre-existing micro-organisms.
Koch’s postulates
Robert Koch (1843–1910) (Fig. 10.38) was born in Germany and obtained his medical degree from
Göttingen University. Koch made many contributions to the field of microbiology and the understanding
of infectious disease. He was an expert on bacteriological techniques, and many of his techniques are
still used today.
Koch developed the agar plate technique for growing micro-organisms, and used it to culture the
isolated anthrax bacillus.
He also carried out an extensive study of the anthrax bacillus. He examined the blood of sheep that
had died from anthrax and identified rod-shaped bacteria, which he isolated and grew in cultures.
These cultured bacteria were then injected into healthy sheep, which subsequently
developed anthrax. He repeatedly showed that the anthrax spores he had obtained
Alamy Stock Photo/GL Archive
from the pure cultures he had grown could cause the disease in other animals and
kill them. These experiments added further weight to the germ theory of disease,
as they showed that a micro-organism grown outside the body caused a disease.
From this research, Koch determined that each disease is caused by a specific
micro-organism. The principles he used to identify the specific micro-organism that
was responsible for a disease came to be known as Koch’s postulates (Fig. 10.39) and are
still in use today to identify the specific micro-organism that causes a particular disease.
One of Koch’s subsequent major breakthroughs was the discovery of the bacterium
responsible for tuberculosis, Mycobacterium tuberculosis. He was also responsible for
identifying the bacterium responsible for causing cholera. He travelled extensively in
the latter part of his career, to study diseases such as bubonic plague and African
FIGURE 10.38 Robert Koch sleeping sickness.
340 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 340 08/08/18 7:20 pm
The criteria that must be met to determine whether a particular micro-organism is responsible for
causing a disease are known as Koch’s postulates (Fig. 10.39) and are given below. WS
1 The same micro-organism must be present in every diseased host. Koch's
postulates
2 The micro-organism must be isolated and cultured in the laboratory and accurately described and
recorded.
3 When a sample of the pure culture is inoculated into a healthy host, this host must develop the same
symptoms as the original host.
4 The micro-organism must be able to be isolated from the second host and cultured and identified as
the same as the original species.
Koch’s postulates FIGURE 10.39 Koch’s
postulates
1 The same micro-organism must be
present in every host presenting with
a specific disease.
2 The micro-organism must be
isolated and cultured
in the laboratory and
accurately described
and recorded.
3 When a sample of the pure culture is inoculated
into a healthy host, this host must develop the
same symptoms as the original host.
(diseased)
4 The micro-organism must be able to be isolated from the second
host and cultured and identified as the same as the original species.
Pasteur’s experiments on microbial contamination
Louis Pasteur (1822–1895) (Fig. 10.40) was born in France. Although not his original area of study,
he was credited with creating the science of microbiology and made invaluable contributions to the
understanding of infectious disease. At the request of an industrialist called Bigo, Pasteur studied the
fermentation of beet juice and found that the process was due to the presence of living organisms –
microbes called yeasts.
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 341
10_bio_InFocus12_2e_sb_08851_txt.indd 341 08/08/18 7:20 pm
Pasteur also found that other micro-organisms were responsible for the
Alamy Stock Photos/Science History Imges
souring of the alcohol produced. He was instrumental in finding that micro-
organisms (bacteria) were the cause of wine, beer and vinegar spoilage. He
also discovered that the solution to the wine and vinegar problem was to
heat these solutions long enough to kill the contaminating bacteria that
were present after fermentation. This was the beginning of the widely used
process of pasteurisation, which is still used today to ensure that products
such as milk are free of disease-causing micro-organisms and are suitable
to drink. This process was initially used in milk production to destroy the
tuberculosis bacterium.
Pasteur also found that the rotting of food was due to the activity
of living organisms. After further investigation, he joined the debate
over spontaneous generation, refuting this theory and proposing the
FIGURE 10.40 Louis Pasteur germ theory of disease. He carried out his famous ‘swan-necked flask’
experiments to gain evidence to support his theory.
These experiments involved using flasks that had long drawn-out necks (like
those of swans) that were not sealed (Fig. 10.41). Meat broth was boiled in the
Getty Images/Science & Society Picture Library
flasks and, as they cooled, the air was drawn in from outside. Any micro-organisms
present in the air did not reach the broth, as they were trapped in the narrow neck
and the curve of the glass. No bacterial or fungal growth was observed in these
flasks. Bacterial growth occurred if the curve of the flask was broken off and the
contents of the flask exposed to the air. Furthermore, tipping a flask to allow the
solution in it to reach the curve where the micro-organisms were trapped resulted
in bacterial growth occurring. This added further evidence to discredit the theory
of spontaneous generation. It supported the hypothesis that the organisms that
contaminated the broth and caused it to decay must be carried in the air and not
be spontaneously generated.
Pasteur’s flasks are on display at the Pasteur Institute in Paris and, after more
than 150 years, the broth in the swan-necked flasks is still free of bacterial growth.
This classic experiment carried out by Pasteur demonstrates how theories in
science can be disproved.
FIGURE 10.41 Pasteur’s swan-necked flask
Pasteur also uncovered the relationship between micro-organisms and disease.
As specific bacteria became associated with specific diseases, the spontaneous
generation theory became less widely supported and the germ theory of disease grew more widely
accepted. Pasteur also discovered the cause of silkworm disease and devised a test that allowed the
The work of Pasteur
in the field of selection of healthy eggs, saving the silkworm industry from potential disaster.
fermentation is Pasteur investigated the cause of anthrax and, after input from the experiments of Koch, determined
also dealt with in
Chapter 8. that animals were contracting the disease even though they had had no known contact with animals
suffering from the disease. This was due to spores from the carcasses of animals that had died from the
disease. These carcasses had been buried in fields that were being grazed by healthy animals.
In studying fowl cholera, Pasteur also developed a way to attenuate, or weaken, bacteria so that when
they are introduced into a host they can cause the body to be ready to recognise the real infection. He
produced a vaccine that prevented chickens from developing chicken cholera, and then extended this work
and developed a vaccine for anthrax. His detractors were not convinced of the effectiveness of the vaccine
and he was challenged to carry out a public field test. This trial was successful, as all animals that were given
the vaccine before being exposed to anthrax survived, and the animals that were not given the vaccine died.
WS The vaccine was found to be effective and its use was widely adopted. Pasteur went on to develop vaccines
Louis Pasteur and for a number of other diseases, such as rabies, where he used the vaccine on humans for the first time.
the germ theory Pasteur had established the principle of immunity and provided an effective way to prevent infectious
of disease
disease.
342 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 342 08/08/18 7:20 pm
INVESTIGATION 10.4
Primary investigation to model Pasteur’s swan-necked flask
experiment
You are going to plan and set up an investigation to model Pasteur’s famous experiment. When using a model
it is important to identify what the different parts of your model represent in relation to the real thing.
You will be using beef stock cubes to make a broth similar to the broth Pasteur used. Conical flasks will replace
Pasteur’s balloon flasks, and glass tubing bent into an S-shape will be used to replace the swan-necked flask.
AIM
Write an aim for your investigation.
HYPOTHESIS
Write a suitable hypothesis for your investigation.
MATERIALS
Construct a materials list for your investigation. Make sure you identify the quantities of each material that you need.
RISK ASSESSMENT
Complete a risk assessment for your investigation.
!
WHAT IS THE HAZARD? WHAT RISK DOES THIS HAZARD POSE? HOW CAN YOU SAFELY MANAGE THIS RISK? RISK
ASSESSMENT
METHOD
Write a method to test your hypothesis.
RESULTS
Record your observations in a carefully planned table.
DISCUSSION
Discuss your results, paying particular attention to:
• your observations of each flask
• how well you ensured the accuracy, reliability and validity of your experimental design and how you could
improve your experiment if applicable
• how this model is similar to and different from the actual experiments performed by Pasteur.
CONCLUSION
Summarise your findings about the conditions needed for transmission of pathogens.
KEY CONCEPTS
● Robert Koch and Louis Pasteur increased our understanding of the nature of infectious disease.
● Koch developed the agar plate technique for culturing microbes.
● Koch’s work on anthrax, cholera, bubonic plague and tuberculosis contributed to management
strategies for these diseases.
● Koch developed postulates to guide scientists in determining the causal pathogen for a disease.
● Koch showed that specific infectious diseases are caused by specific pathogens.
● Pasteur is credited with creating the science of microbiology, through rigorous experimentation.
● Pasteur identified microbes as the agents responsible for spoilage during the production of
wine, beer and vinegar, leading to the development of pasteurisation.
● Pasteur’s germ theory of disease was supported by his swan-necked flask experiment.
● Pasteur’s work contributed to the development of vaccines for diseases such as fowl cholera,
based on the principle of immunity.
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 343
10_bio_InFocus12_2e_sb_08851_txt.indd 343 08/08/18 7:20 pm
CHECK YOUR
UNDERSTANDING 1 In what ways were the causes of disease identified by Pasteur and Koch?
2 How did these scientists contribute to our understanding of the transmission of disease?
10.2 3 State the germ theory of disease. What previous theory does this attempt to disprove?
4 Briefly describe the contributions of Louis Pasteur to our understanding of infectious disease.
5 What are Koch’s postulates? How did these contribute to our understanding of infectious disease?
6 Analyse Pasteur’s swan-necked flask experiment as an example of the scientific method.
7 Justify, using a named experiment, Pasteur’s claim that introduction of an attenuated pathogen can offer
protection against subsequent infection.
8 How are Koch’s postulates applied to emerging disease outbreaks today?
9 How would contamination of glassware have affect the outcome of the swan-necked flask experiment?
10 Were Koch’s experiments on sheep ethical by today’s standards?
Causes and effects of disease
10.3
in agricultural production
Agriculture is a form of primary industry that involves the cultivation of crops and pastures and the rearing
of animals to provide meat, milk, fibres and other products for humans. It was once said that Australia
‘rode on the sheep’s back’ due to the enormous economic success of our wool industry.
The importance of agriculture in Australia
Because Australia is in the unique position of being isolated from the rest of the world, Australian agriculture
is relatively free of many of the infectious diseases that affect animals and plants in other countries. This
makes our agricultural products highly sought after around the world. Stringent biosecurity measures are
in place to reduce the likelihood of disease transmission from pathogens. The introduction of new plant
diseases could potentially devastate the horticultural industry, as well as forestry and agriculture.
Australia’s main agricultural export products are listed in Table 10.6.
TABLE 10.6 Australia’s top 10 agricultural exports (by value) in 2015
MAJOR AGRICULTURAL EXPORT PRODUCTS VALUE (A$ m) SHARE OF TOTAL (%)
Beef 9 269 19.9
Wheat 5 812 12.5
Meat (excluding beef ) 3 738 8.0
Wool and other animal hair 2 911 6.2
Alcoholic beverages 2 387 5.1
Vegetables 1 931 4.1
Live animals (excluding seafood) 1 896 4.0
Fruit and nuts 1 805 3.9
Sugars, molasses and honey 1 783 3.8
Barley 1 740 3.7
Total of all exports 44 657
Source: Department of Foreign Affairs and Trade CC BY 3.0 AU license (https://creativecommons.org/licenses/by/3.0/au/)
344 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 344 08/08/18 7:20 pm
Infectious diseases in Australian agriculture
Two types of plant and animal diseases are of concern in agriculture in Australia:
◗ endemic diseases (diseases consistently present within a country or region) such as bovine Johne’s
disease in cattle, sheep and goats, anthrax in sheep and cattle, and footrot in sheep
◗ exotic (introduced) diseases such as foot and mouth disease, avian
influenza (H5N1), bovine tuberculosis, equine influenza, and Newcastle
disease in domestic poultry and wild birds. Pathogen
A complex interplay of three factors may contribute to the development
of infectious disease in organisms of agricultural importance (Fig. 10.42):
◗ host factors – susceptibility to disease, access to pathogen, concurrent
disease or poor nutrition leading to weakened immune response, drought Infectious
and heatwave stress on the host disease
◗ pathogen factors – the pathogen’s availability, its ability to transfer between
hosts, as well as virulence factors including adhesion and invasion of host Host
Environment
tissues, and successful establishment inside host tissues
◗ environmental factors – overcrowding and lack of hygiene leading to a
build-up of wastes, which provide a suitable environment for pathogen
reservoirs; a favourable environment within the host for pathogens to FIGURE 10.42 Factors affecting the incidence of
establish and cause disease. infectious disease in agriculture
Case study: Footrot in sheep
Footrot is an infectious disease of the hooves of sheep, goats and cattle, caused by the pathogenic
bacterium Dichelobacter nodosus. It causes painful abscesses between the toes (Fig. 10.43), lameness and
weight loss, as grazing is affected.
FIGURE 10.43
Typical appearance of
a sheep’s foot infected
with footrot
Alamy Stock Photo/ Wayne Hutchinson
An outbreak of footrot on a farm depends on a number of factors being present.
◗ Pathogen factors – Dichelobacter nodosus must be present for footrot to occur.
◗ Environmental factors – the bacterium will only survive in soil outside the host for a maximum of
4 days. Pastures that are long, dense and wet aid in pathogen survival and transfer. Temperature is
important: warm weather favours growth of the bacteria.
◗ Host factors – dry feet with intact tissues are not infected. Reservoirs of bacteria may form in individual
animals’ feet for years. Some dermatitis between the toes must already be present for bacteria to
invade and establish an infection. Overgrown hooves provide a suitable environment for the bacteria.
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 345
10_bio_InFocus12_2e_sb_08851_txt.indd 345 08/08/18 7:20 pm
Factors contributing to the risk of infectious disease
WS
Some of the factors that contribute to the increased risk of infectious disease in Australian agricultural
The risk of production are outlined below.
infectious
disease in ◗ Increased mobility of human populations
agriculture
– Travellers, imported livestock and plants can carry infectious disease into Australia.
– Both cellular and non-cellular pathogens can form a reservoir in food, soil and seeds on shoes, and
in infected animals and animal products that are moved from one area to another by humans.
◗ Rise of intensive and industrial-type agriculture
– The increase in the world’s population has seen a change in the style of livestock production from
extensive pastoral systems to intensive feedlots. Feedlots carry a higher risk of disease outbreak
due to the higher stocking densities of animals. The closer animals are housed together, the more
rapidly a pathogen can spread from animal to animal or plant to plant.
◗ Changing patterns of land use
– Deforestation and irrigation practices may change the distribution of insects.
– Loss of habitat can bring bats into closer proximity to human and horse populations (Hendra and
Nipah viruses).
◗ Climate change
– Distribution and abundance of insect vectors may change.
– Changes in rainfall patterns may favour the formation of reservoirs of pathogens in soil, plants
and insects.
– Changes in ecosystems can change availability of nutrients to plants and animals and reduce
immune responses to pathogens.
◗ Antimicrobial resistance
– Antimicrobials are used to treat infections in livestock (e.g. mastitis in dairy cattle, which is an
infection of the udder with environmental and faecal bacteria). The ‘off-label’ use (use in a way
that has not been officially approved) or overuse of antibiotics on farms hastens the development
of antimicrobial resistance due to rapid natural selection of resistant bacteria. Antibiotics are
also sprayed in orchards to treat plant infections. Antibiotic-resistant bacteria may be transferred
to humans through direct contact with animals, consumption of their meat or transfer of genes
between animal bacteria and human pathogens. If this happens, common bacterial infections
may no longer be able to be treated with antibiotics.
– Antimicrobials are used whenever animals are housed in high-density situations. The close
proximity of animals facilitates easier transfer of pathogens during a disease outbreak. In this
situation, animals are more exposed to their own waste products, which harbour bacteria. As well
as being used to prevent the spread of pathogens in intensive farming systems, antimicrobials such
as avoparcin and virginiamycin are used to promote growth in pigs, chickens and feedlot cattle.
◗ Pesticide resistance
– Insecticides, acaricides, herbicides and anthelmintics are chemicals used to manage
macroparasites and weeds on farms. Their overuse has led to the emergence of resistant forms of
parasites and weeds, making it harder to manage infectious diseases on farms.
◗ Loss of genetic diversity
– Genetic variation is necessary for a population to evolve in response to a disease threat. The
use of inbreeding in animals and plants, or monoculture practices in plants, can lead to reduced
resilience of a population to a new pathogenic threat.
◗ Increase in ‘hobby farmers’
– As Australian urban populations swell, many people seek an alternative life style or ‘tree change’.
People with little knowledge or experience of animal husbandry may be unaware of the risks of
certain practices.
346 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 346 08/08/18 7:20 pm
◗ Increase in use of aquaculture as marine and freshwater animal populations decrease
– Aquaculture involves the farming of seafood. It is a growing export industry in Australia as the
world population increases and the need for a source of protein increases, but wild stocks decrease
due to overfishing, habitat loss and marine pollution. Species include fish such as salmon, tuna
and barramundi, oysters, abalone, crab, prawns and lobsters.
– Antimicrobials are used to therapeutically and prophylactically control the outbreak of bacterial
and fungal diseases due to the close proximity of organisms and the increased risk of cross-
infection. Common bacterial threats include Aeromonas spp., Pseudomonas spp. and Vibrio spp.
No antibiotics are currently registered for use in aquaculture but there may be pressure to use
antibiotics off-label.
Plant diseases of agricultural significance
A range of plants are grown commercially in Australia:
◗ grains – the seed of a cereal crop, such as wheat, corn and barley, for human and animal consumption
◗ fruits and vegetables – for domestic consumption and export
◗ fodder – food for livestock, such as oaten hay, alfalfa hay and silage
◗ fibre – filaments or threads from plant material used for textiles, such as cotton
◗ horticultural plants – plants cultivated for use in gardens and orchards
◗ forestry plants – plants used in the creation and conservation of forests for human and environmental
benefits.
Australia is relatively free of most of the world’s most damaging plant pest species. However, there is
still an array of pathogens affecting Australian plants that are a threat, not only to the natural environment
but also to our agricultural industries.
Causes of infectious diseases in plants in agriculture
In the natural environment, plants are commonly attacked by pathogens. Plants have evolved unique
ways to keep these pathogens in check, such as the abscission (dropping) of infected fruits or leaves.
When plants are grown for horticultural or agricultural purposes, they are grown in higher densities,
and pathogens that were not considered a problem previously may become significant. If soil pH,
nutrient balance and water availability are not optimal, the stress caused to plants can reduce their
natural ability to inhibit pathogen invasion and growth. Many of these pathogens gain entry through
natural openings in the plants, such as stomates, or wounds caused by insect bites or other damage
due to hail, wind or pruning.
The majority of plant infectious diseases are caused by the types of pathogens described below.
Fungi Shutterstock.com/Julie Vader
Fungi are by far the most common cause of plant disease. Terms such as
‘rust’, ‘smut’, ‘blight’ and ‘mildew’ are used to describe fungal diseases in
plants. Some have colourful names such as gummy stem blight and white
blister (Fig. 10.44). Reservoirs of fungal spores exist in contaminated seeds,
farm machinery, soil and nearby weeds, and are generally transmitted
by wind, water and contact with the reservoirs through normal farming
operations. Fungi enter plants through their stomata or any other opening
caused by mechanical damage to the plant, such as pruning and insect
bites. They damage the plant by destroying conducting tissues and
FIGURE 10.44 White blister disease looks like
absorbing nutrients from the plants. large white blisters on the leaves.
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 347
10_bio_InFocus12_2e_sb_08851_txt.indd 347 08/08/18 7:21 pm
Insects and mites
Alamy Stock Photo/Nigel Cattlin
Insects and mites not only cause direct damage to plant tissue, but may
also act as vectors for other pathogens. Examples are aphids, fruit fly, citrus
leaf miner and mealybugs. The citrus leaf miner is a moth that lays its eggs
under the leaf of the citrus plant. The larvae hatch and burrow through
leaves, leaving characteristic ‘mines’ (Fig. 10.45), and the leaves then twist
and curl. Young plants are most at risk as their growth can be severely
inhibited.
Bacteria
FIGURE 10.45 The characteristic tunnels made by
the citrus leaf miner
Reservoirs of pathogenic bacteria may occur in soil, weeds and seeds.
Humans can also harbour bacteria on their hands and equipment from
previous work with a contaminated crop of plants. However, bacteria only
Getty Images/iStock/v_zaitsev
multiply and spread when certain conditions are met. These include humid,
warm weather, overcrowding of plants, inappropriate soil conditions (water,
nutrients, pH and salinity) and poor air circulation. Examples of bacterial
diseases (Fig. 10.46) include black rot of brassicas, bacterial canker of
tomatoes and bacterial blight of peas. Pseudomonas spp. are particularly
common bacterial pathogens of plants as they are capable of tolerating a
wide range of conditions.
Nematodes
Thousands of nematode species live in soil but only a few act as plant
pathogens. An example is the root knot nematode (Fig. 10.47), a pathogen
of agricultural significance, particularly for tomato growers. The nematode
attacks plant roots, creating galls and lumps. The plants subsequently wilt,
turn yellow and die. The eggs of these nematodes can persist in the soil
FIGURE 10.46 Bacterial disease causes the tissues of for a year and reinfect the next crop. The infestation can be dealt with by
the plant to rot, change colour and become slimy repeated cultivation of the soil and exposure to the sun, combined with
removal of residual root material after harvesting to reduce reservoirs of
Visuals Unlimited, Inc./Nigel Cattlin
the eggs.
Viruses
Plant viruses are obligate intracellular parasites and are less well understood
than animal viruses. The first to be discovered was the tobacco mosaic
virus, which infects tobacco plants and produces a mottling pattern on
the leaves. The tomato mosaic virus and the pepper mild mottle virus are
FIGURE 10.47 Nematode eggs are clearly visible other examples (Fig. 10.48). All these viruses are stable in the environment
on these soybean roots.
and can persist in plant material left over after cropping. They can also
form a reservoir on contaminated equipment. Increased plant densities
and frequent handling of plants by humans appear to play a role in its
Alamy Stock Photo/Barrie Sheeman
transmission.
Phytoplasmas
Phytoplasmas are related to bacteria but do not have a cell wall. They are
transmitted from plant to plant by insect vectors, and inhabit phloem tissue.
They are pathogens of agricultural importance because they have been
reported in plants such as tomatoes, strawberries, grapes and pumpkins
FIGURE 10.48 The mottled appearance of a (Fig. 10.49).
tomato leaf infected with tomato virus
348 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 348 08/08/18 7:21 pm
Case study: Panama disease of bananas
Bananas are the largest horticultural industry in Australia
and a best-selling product in our supermarkets. Most banana
deed.en)
Wikimedia/Amityadav8. Attribution-ShareAlike
4.0 International (CC BY-SA 4.0) (https://
creativecommons.org/licenses/by-sa/4.0/
plantations are in North Queensland, which produced 95% of
Australian bananas in 2014–15. In March 2015, the pathogen that
causes Panama disease of bananas was detected on a property that
grew Cavendish bananas in the Tully Valley, North Queensland.
Cavendish bananas are the main type grown in Australia. Panama
Tropical Race 4 disease is caused by the highly contagious fungus
Fusarium oxysporum. It causes yellowing and wilting of leaves and
splitting of stems (Fig. 10.50). The conducting tissues are damaged
and so the plant is starved of water and food. The disease is
spread through root-to-root contact and contaminated soil from FIGURE 10.49 Symptoms of phytoplasma infection vary; they
machinery and shoes. include yellowing, stunting and ‘witches’ brooms (many small,
distorted shoots growing clumped together).
Farming operations ceased and the affected property was sold
to the Australian Banana Growers Council, because the fungus
contaminates the soil permanently, and remains a biosecurity risk. No other plants can be grown
commercially on this property for this reason. The perimeter fences were reinforced, all banana plants
were destroyed and stabilising ground cover was established to prevent soil runoff into neighbouring
properties and waterways. Strict quarantine rules enforced by
Biosecurity Queensland have contained the outbreak to one farm
Jeff Daniells, Queensland DAF
so far. During the outbreak, the price of bananas skyrocketed in
Australian supermarkets.
Abiotic factors that cause disease
At the start of this chapter, you read that disease arises from
an imbalance between the pathogenicity of the agent and the
defences of the host. Abiotic factors play a major role in setting
a plant up for invasion by a pathogen. These factors include any
major alterations in:
◗ temperature variation
◗ light availability
◗ chemical agents (natural and synthetic)
◗ water quantity and quality
◗ nutrient availability in soils.
As with infection of animals, for infectious diseases of plants to
exist, there must also be a chain of infection.
Effects of infectious diseases in plants
The effects of infectious disease in plants can be considered at three
levels:
◗ biological effects on the individual plant
◗ social and economic effects on the farmer FIGURE 10.50 Panama disease damages the banana plant’s
◗ social and economic effects on Australia’s economy. conducting tissues, causing an open ‘wound’ on the stem and
discolouration of the conducting tissue.
These effects are discussed on the following page.
Panama disease
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 349
10_bio_InFocus12_2e_sb_08851_txt.indd 349 08/08/18 7:21 pm
Biological effects of pathogens on individual plants
Some of the ways in which pathogens disrupt the normal operation of plant tissues are summarised in
Table 10.7. These symptoms often occur in combination.
TABLE 10.7 Effects of pathogens on plant tissue
SYMPTOM FEATURES SYMPTOM FEATURES
Death of Plants lose their ability to balance water Destruction Cell death can be caused directly through
plant uptake with water loss through diseased of tissues pathogen attachment and invasion of cells or
conducting tissue, or the ability to produce (necrosis) indirectly though the effects on photosynthetic
food (photosynthesise) because of loss of and conducting tissues.
photosynthetic tissue.
Alamy Stock Photo/flafabri
Biodiversity, Conservation and Attractions.
Michael Pez, Western Australian Department of
FIGURE 10.52 Spots of necrosis on the leaves
of a hazelnut tree, caused by the bacterium
FIGURE 10.51 Jarrah forest infected with Xanthomonas arboricola
‘dieback’ fungus, Phytophthora cinnamomi
Abnormal Normal plant growth is regulated by a series Discolouration of Leaves may turn yellow (chlorosis), indicating
growth of complex interactions between hormones tissues a problem with the production of chlorophyll.
(trophic factors) and cells. Disease processes Mosaic patterns are common with viral infections.
may interfere with the production, distribution
and action of hormones. Tumour-like galls are a
Shutterstock.com/Jean Faucett
common sign of infectious disease.
a
Imagefolk/Naturepl/Solvin Zankl
FIGURE 10.54 Peanut leaf with concentric ring
spots caused by peanut mottle virus
Wilting Wilting happens when the plant loses more water
than it takes up from the soil. Causes include root
Getty Images/iStock/KatieDobies
b
damage, and damage to or interference with
conducting tissues.
Shutterstock.com/Miyuki Satake
FIGURE 10.53 Gall wasp infestation in a citrus
tree: a wasp larvae emerging from a gall;
b wasps secrete growth-regulating chemicals FIGURE 10.55 Wilt in a tomato plant caused by
that cause abnormal swellings (galls) to develop. the bacterium Ralstonia solanacearum
350 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 350 08/08/18 7:21 pm
INVESTIGATION 10.5
Secondary-source investigation of plant diseases and their
transmission
AIM
Describe one plant disease for each of the following six types of pathogens discussed in this section: fungi,
insects and mites, bacteria, nematodes, viruses, phytoplasms
RESULTS
Create a table to summarise the plant diseases. The following table is a suggestion.
PATHOGEN
(TYPE AND ADAPTATION OF PATHOGEN
SCIENTIFIC NAME OF DISEASE NAME AND FOR ENTRY AND
ONE EXAMPLE) TRANSMISSION DESCRIPTION OF DISEASE TRANSMISSION*
*Complete this column after reading Section 10.4.
Social and economic effects of diseases in plants
The threat of infectious disease places a great burden on primary producers. Constant vigilance is
required for early detection and management. The most important consequences of a plant disease
outbreak on a farm include:
◗ reduced yields of grains, pastures, fruits and vegetables
◗ loss of trading opportunities, both nationally and internationally
◗ economic loss for the farmer, resulting in financial hardship and stress for family and local community.
The Australian economy relies heavily on the export of grains, fruits and vegetables to overseas
markets. Australia’s physical isolation and the consequent disease-free status of much of its produce gives
us unique access to markets around the world. The introduction of an exotic plant disease into Australia
could have dire consequences for the national economy.
Animal diseases of agricultural significance Table 10.8 and
the weblinks list a
The international body that oversees and coordinates the management of animal diseases at a number of animal
diseases that
global level is the World Organisation for Animal Health (OIE, originally Office International des affect agriculture.
Epizooties). An epizootic is the animal equivalent of a human epidemic. As a member nation, Australia You may wish to
examine these
must report any exotic animal disease that it detects within its borders, especially those with a further as a depth
risk of transmission to humans (zoonosis). Infectious diseases of agricultural concern in Australia, study.
including endemic and exotic diseases, are listed in Table 10.8.
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 351
10_bio_InFocus12_2e_sb_08851_txt.indd 351 08/08/18 7:21 pm
TABLE 10.8 Some infectious diseases of agricultural concern in Australia
PATHOGEN TYPE EXAMPLES OF INFECTIOUS DISEASES*
The Australian Bacterium • Mastitis
Veterinary • Foot rot
Association • Q fever
Detailed information • Brucellosis
regarding livestock • Leptospirosis
diseases and their
management • Clostridial diseases such as black disease, blackleg, tetanus, pulpy kidney, malignant
oedema
• Tuberculosis
• Pink eye
Virus • Three-day sickness (bovine ephemeral fever)
• Foot and mouth disease
World
Organisation of
• RHDV1 (calicivirus) in rabbits
Animal Health • Rinderpest
• Bluetongue
• Rabies
• Coronavirus
• Avian influenza
• Swine flu
Animal disease • Avian and porcine circoviruses
information
Fungus • Lumpy jaw (actinomycosis) in cattle
• Aspergillosis
• Ringworm (dermatophytosis)
• Cryptococcosis
• Blastomycosis
Biosecurity Protozoan • Coccidiosis
• Toxoplasmosis
• Cryptosporidium
• Babesiosis
• Trypanosomiasis
• Leishmaniasis
Farm biosecurity
Prion • Scrapie in sheep
• Bovine spongiform encephalopathy
• Chronic wasting disease of cervids (deer, moose etc)
Macroparasite • Liver fluke
• Roundworm
Aquaculture • Flystrike
industry in
Australia
*Including endemic diseases and exotic diseases not currently found in Australia
INVESTIGATION 10.6
Secondary-source activity on diseases of agricultural significance
in Australia
Table 10.8 lists some of the major diseases of agricultural significance in animals. Some are found in Australia
but many are exotic diseases not currently found in Australian agriculture.
AIM
To choose an infectious disease of agricultural significance and develop an advertisement that could be used
to convince farmers to change their practice to prevent the spread of the named plant or animal disease
COMMUNICATION
Choose a suitable medium for the advertisement. Peer evaluation of your argument must be completed prior to
submission. Your advertisement must use suitable scientific terminology and provide accurate advice to farmers.
352 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 352 08/08/18 7:22 pm
METHOD
1 Choose one of the diseases listed in Table 10.8, or select a disease that you know of. Discuss this with
your teacher first. Choosing an exotic disease is fine, because it could pose a serious threat to Australian
agriculture, should there be an outbreak here.
2 In groups of two or three, use secondary sources such as printed and online materials to conduct the
following research:
a Identify the pathogen (common and species name).
b Name the disease. Many of these diseases have a scientific as well as a common name. For example,
bovine spongiform encephalopathy is also known as ‘mad cow disease’. Try to identify as many
common names as possible for your chosen disease.
c Outline the signs/symptoms of the disease.
d How is this pathogen transferred? What are the conditions on a farm that favour transmission of the
pathogen? Think about the three factors that influence infectious disease outbreaks (host, pathogen
and environment).
e Read ahead in this chapter (Section 10.4) and identify some of the possible pathogen factors that
favour the transmission and disease-causing ability of your chosen pathogen.
f Identify the treatment for this disease. Sometimes this will involve management on a whole-farm scale,
not just treatment of an individual animal. ‘Herd health’ refers to a wholistic approach to disease on a
farm, concentrating on all factors at once.
g Identify some online resources that farmers can refer to, for advice on this disease.
h Find out whether the disease is notifiable. ‘Notifiable’ means that by law the disease must be reported
by a veterinary surgeon to a government agency, for reasons of national biosecurity. For example, foot-
and-mouth disease is notifiable throughout Australia.
RESULTS
Select the type of presentation that is most suitable. This may be a simple table, or perhaps a more visual form
of presentation such as a slideshow.
DISCUSSION
In what ways can a manager of an agricultural enterprise ensure that this particular pathogen does not
become a problem?
CONCLUSION
What are some general recommendations your group could make to a farmer regarding this disease?
Effects of infectious diseases in farm animals
Different diseases in farm animals can affect primary producers in different ways, including:
◗ death of the affected animals (e.g. Black’s disease, anthrax)
◗ loss of appetite and weight over a short or extended period (e.g. three-day sickness in cattle)
◗ economic loss to the farmer, with negative effects on profitability and production due to reduced
meat, milk and wool yields
◗ loss of international trading opportunities if Australia’s disease-free status is threatened (e.g. if foot-
and-mouth disease became endemic in Australia)
◗ human illness and disease (zoonoses) (e.g. Q-fever, brucellosis, leptospirosis)
◗ low growth rates in young animals (e.g. internal parasites such as worms)
◗ loss of fertility in females through embryonic death or stillbirths (e.g. leptospirosis, brucellosis)
◗ loss of economic value of individual animals due to blemishes or ectoparasites (e.g. warts in beef cattle).
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 353
10_bio_InFocus12_2e_sb_08851_txt.indd 353 08/08/18 7:22 pm
KEY CONCEPTS
● Australia relies heavily on its agricultural exports, because of its unique geographic isolation
and the disease-free status of much of its produce.
● Both endemic and exotic pathogens pose a risk to Australian agriculture.
● Disease outbreaks on farms result from the interplay of host factors, pathogen factors and
environmental factors.
● The risk of infectious disease is a growing threat, due to at least nine major factors including:
increased human mobility, the rise of industrial agriculture, changing patterns of land use,
climate change, and antimicrobial and pesticide resistance.
● Animal and plant diseases can have dire consequences at the farm level and at the national
level, and must be well managed.
● Local, national and international bodies exist to manage biosecurity issues arising from plant
and animal diseases.
CHECK YOUR
UNDERSTANDING 1 What is the significance of Australia’s relative geographical isolation for infectious diseases in plants and animals?
2 Distinguish between ‘endemic’ and ‘exotic’ diseases.
10.3 3 Describe three factors that contribute to an outbreak of infectious disease in an agricultural enterprise. Use
an example of a named animal or plant disease to demonstrate this.
4 Discuss the factors that contribute to the increased risk of infectious diseases in Australian animals and plants.
5 Identify the most common entry point for most pathogens into plant tissues.
6 If you were working at a local garden centre, what signs of plant ill health would you need to be aware of?
7 Justify the formation of national and international organisations to coordinate the response to disease
outbreaks of agricultural concern. Use at least two named examples.
8 List three economic impacts of infectious disease on the agricultural industry, at the level of individual
farmer, the district they live in and the nation as a whole.
9 Match each term below with the correct figure.
Wilting Necrosis
Getty Images/Daniel Allan
Alamy Stock Photo/Genevieve Vallee
FIGURE 10.56 FIGURE 10.58
Discoloration Abnormal
Shutterstock.com/evan66
Shutterstock.com/saiko3p
growth
FIGURE 10.57 FIGURE 10.59
354 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 354 08/08/18 7:22 pm
Adaptations of pathogens to
10.4
facilitate their transfer
Many Hollywood blockbusters depict a hero or villain using some novel technique to get into a
building (Fig. 10.60a). Their success or failure depends on their ability to adhere to the side of the
building, evade detection and all the security devices in place, gain entry, and remain undetected or
fight their way deeper inside.
In the same way, for a pathogen to successfully establish an infection, it must find a way to adhere to
the host’s cells, colonise the host tissues, spread to other tissues, and persist in the host long enough to
reproduce. In other words, for an organism to cause disease, it must:
1 enter the host
2 multiply in host tissues
3 resist or not stimulate host defence mechanisms
4 damage the host.
As in the movies, adhesion precedes invasion (Fig. 10.60b).
a
Alamy Stock Photo/AF archive
b
Fimbria
Adhesion
Host cell
oli receptor
Esc herichia c
Host cell
membrane
FIGURE 10.60 Adhesion and invasion: a Successful entry to a secure building involves good adhesion followed by invasion. b Bacteria adhere to a host
cell using fimbriae (or pili, which are similar to fimbriae but longer).
Pathogens have developed an array of strategies or adaptations to enable them to adhere to,
gain entry into and persist in their hosts. These strategies form part of the virulence factors for that
pathogen. Each pathogen has a ‘toolkit’ of virulence factors that help it to successfully establish itself
in host tissues. It is thought that the evolutionary strategies of pathogens are just slightly ahead of the
development of host resistance strategies. The two have evolved more or less side by side throughout
the history of life.
Table 10.9 summarises some of the strategies that the various cellular and non-cellular pathogens use
to gain access to and colonise host tissues.
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 355
10_bio_InFocus12_2e_sb_08851_txt.indd 355 08/08/18 7:22 pm
TABLE 10.9 Adaptations to facilitate adhesion to and invasion of host by pathogens
PATHOGEN VIRULENCE FACTORS*
Prions • Host B lymphocytes are thought to play a role by secreting factors (e.g. tumour necrosis factor) that enable prions to
invade follicular dendritic cells in lymphoid tissue.
• From lymphoid tissue, they invade nervous tissue through the autonomic nerves and travel to the brain.
• May ‘piggyback’ other proteins such as ferritin (abundant in meat) to facilitate movement through the gut.
Viruses Adhesion:
Source: Molecular Biology of the Cell. 4th edition. Alberts B,
Johnson A, Lewis J, et al. New York: Garland Science; 2002.
• Must enter the nucleus of the host cell to facilitate replication of the viral genome.
• Viral surface proteins adhere to host cell surface receptors and co-receptors (Fig. 10.61).
HIV !-chemokine HIV "-chemokine
Primary receptor receptor (CCR5) Primary receptor receptor (CXCR4)
(CD4) (CD4)
"-chemokine
!-chemokine
Macrophage T cell
FIGURE 10.61 Viral adhesion: HIV virus adhering to a host macrophage and T cell via receptors on
the surface of the cell
Source: Molecular Biology of the Cell. 4th edition. Alberts B, Johnson A, Lewis J, et al. New York: Garland Science; 2002.
Invasion:
• Receptor-mediated endocytosis (movement of the virus into the cell). Enveloped viruses (e.g. influenza) are enclosed
within an envelope (endosome) formed from the host cell membrane as they move into the cell (Fig. 10.62).
• Non-enveloped viruses (e.g. polio virus) form a pore in the host cell membrane and deliver the viral genome through it.
• Some viruses use the cell’s normal membrane-forming processes, follow a route through the endoplasmic reticulum
and Golgi body and then bud off from the surface.
Virus Endosome (membrane-
bound vesicle)
Fusion and
Endocytosis uncoating
Cytosol of host cell
FIGURE 10.62 Receptor-mediated endocytosis of an influenza virus
Bacteria Adhesion:
• Pili and fimbria
• Adhesins on the surface of the bacterial cell resist washing action of secretions such as urine, mucus, cilia.
• Translocation of bacterial proteins cause host cell membrane engulfment of bacteria.
• Bacterial cells form a biofilm.
Invasion:
• Enzymes such as collagenase, hyaluronidase and lecithinase break down cell contents.
• Capsules resist phagocytosis by host cells.
• Intracellular bacteria (e.g. tuberculosis): phagocytosis by macrophages and walling off in granulomas (tubercles).
• Chemical strategies to destroy host immune defences, such as leucocidin, IgA protease.
• Host cell cytoskeleton is used for intracellular movement.
• Toxins are secreted to damage host cells (endotoxins and exotoxins).
• If phagocytosed, Listeria monocytogenes secretes haemolysin, which selectively destroys phagosomal membrane
but not cell membrane.
Protozoan • Toxoplasma gondii (toxoplasmosis): microtubule protrusion into host cell facilitates entry (intracellular parasite), and
formation of a vacuolar membrane gives protection from lysosomes.
• Trypanosoma cruzi (Chagas disease) – in receptor-mediated attachment, recruits lysosomes to fuse with cell
membrane. Pathogen enters vacuole made of lysosomal membrane, then deactivates lysosomal enzymes.
356 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 356 08/08/18 7:22 pm
PATHOGEN VIRULENCE FACTORS*
Fungus Adhesion:
• Assisted by cell wall or capsule molecules that permit adhesion to host cells.
Invasion:
• Thermotolerance – heat shock proteins are synthesised to cope with body temperatures (higher than air
temperature).
• Converts from saprophytic mycelium to parasitic yeast when exposed to heat (dimorphism) (Fig. 10.63).
• Cell wall and capsules protect fungi from host attacks, e.g. alpha glucan is a cell wall polysaccharide that confers
protection.
• Hormone receptors for 17B-oestradiol on fungal cells may change the incidence of certain fungal diseases between
men and women.
• Secretion of hydrolytic enzymes causes damage to host cells and provides nutrients for fungus.
• Evasion mechanisms include capsule production, suppression of cytokine production by host cells, and reduced
fungicidal power of macrophages.
• Opportunistic fungal infections (e.g. Cryptococcus neoformans) are common in immunosuppressed patients (e.g.
HIV/AIDS, chemotherapy, lymphoma)
Saprophytic Parasitic
Temperature 258C Temperature 378C
Humidity Hormonal receptors
Nutrients Tissues
Suppressed immune response
Fungal mycelia grow and feed In the host, fungus produces spherules,
on dead or decaying matter which release endospores
FIGURE 10.63 Factors that allow fungal invasion of a host
Macroparasites • Hookworms – can secrete immunomodulatory • Ticks – highly specialised mouthparts are inserted
proteins that reduce host cell immune responses. Third into host skin to attach. Tick is anchored in skin by
larval stage (L3) in soil invades host via hair follicles ‘attachment cement’. Biologically active molecules
and migrates through circulation to lungs, trachea, are secreted in saliva to prevent vasoconstriction,
intestines. Teeth in buccal capsule anchor worm to gut and prevent host from forming a clot or initiating an
lining (Fig. 10.64). inflammatory response.
Science Photo Library/Dr. Robert Calentine,
Visuals Unlimited
Science Photo Library/Sciepro
Pharyngeal
Deep tooth
opening
(‘spine’)
Tooth
Liquefied mucosal
plug
FIGURE 10.64 Histological section through the
feeding end of a hookworm taken from a dog’s gut,
showing adaptations to decrease host immune FIGURE 10.65 The specialised mouthparts of a tick
responses. facilitate the transfer of pathogens.
*Adaptations to facilitate adhesion to and invasion of host
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 357
10_bio_InFocus12_2e_sb_08851_txt.indd 357 08/08/18 7:22 pm
Adaptations to facilitate transmission between hosts
Transmission of a pathogen refers to the passing of the pathogen from one host to another, directly or
indirectly:
◗ direct transmission through sneezing, coughing, sexual contact
◗ indirect transmission by touching a contaminated surface or object or via a vector.
Table 10.10 summarises some of the adaptations acquired by pathogens to exploit their own unique
method of transmission.
TABLE 10.10 Adaptations to facilitate transmission of pathogens
TRANSMISSION
ROUTE ADAPTATIONS TO FACILITATE TRANSMISSION EXAMPLES OF PATHOGENS
Airborne • Able to remain suspended in air for long periods. • influenza viruses
on dust and • Resists drying out.
respiratory • Pathogen causes sneezing and coughing, which causes ejection and transmission to
secretions (e.g. new host.
water droplets) • Aero-tolerant – able to tolerate a wide range of oxygen concentrations.
Waterborne • Able to colonise and proliferate in water, so environmental reservoir is present (e.g. • Legionella
from faecal material). • Vibrio
• Modified outer surface structures (e.g. fimbria, flagella) allow motility. • Giardia
• Marine-borne organisms are halotolerant (able to tolerate high salinity). • Campylobacter spp.
• Many are not destroyed by simple boiling of water or other water-treatment processes.
Vector-borne • Poorly understood at present. • Rickettsia felis now
• Changing type and number of vectors used as reservoirs and for transmission. uses fleas and
• Vector is not affected by pathogen. mosquitoes as vectors
• Form preferential reservoirs in digestive tract or salivary glands of vector for easier • malaria
transmission. • Zika virus
• Produce special surface proteins that allow attachment to vector tissues. • Hendra and lyssa
• Life cycle of pathogen is synchronised with feeding habits of hosts. viruses
Faeco-oral • Pathogens are generally very stable in varied environments, e.g. acid in stomach, low • E. coli
(Fig. 10.66) oxygen of large intestine. • Salmonella spp.
• Induction of vomiting and diarrhoea increases likelihood of transmission.
• Antimicrobial resistance genes.
FIGURE 10.66 Faeco-oral transmission of pathogens
Source: deGraaf M, Beck R, Caccio S et al. Sustained fecal-oral human-to-human transmission following a zoonotic event,
Current Opinion in Virology, Vol 22, Figure 1, pp. 1–6. Feb. 2017, With permission from Elsevier.
Soil-borne • Form endospores to resist desiccation. • Clostridium tetani
• Stable in the environment under a range of conditions. • fungi
• Grow mainly in the root zone (rhizosphere). • nematodes
• Only a few bacteria are soil-borne pathogens of plants.
358 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 358 08/08/18 7:22 pm
TRANSMISSION
ROUTE ADAPTATIONS TO FACILITATE TRANSMISSION EXAMPLES OF PATHOGENS
Sexual • Same as for vertical (See below.) • chlamydia
(venereal) • HIV/AIDS virus
• gonorrhea
• herpes simplex virus
Blood-borne • Take advantage of altered features of red cells to facilitate growth and development. • malaria parasites and
sickle cell anaemia
Vertical • Capable of transmission across the placenta where maternal and foetal cells juxtapose. • Brucella spp.
(mother to • Capable of uterine invasion. (contagious abortion
child) • Unprotected sexual activity facilitates transmission. in cattle)
• Consumption of placenta by other animals in the wild facilitates transmission. • Parvovirus
• May be aerosolised from afterbirth. • rubella virus
• chickenpox virus
• Listeria
monocytogenes
• Plasmodium falciparum
KEY CONCEPTS
● Virulence factors help a pathogen to be transmitted and gain entry to a new host.
● For infection to occur, the pathogen must be transferred to the host and then adhere to and
invade the host.
● The transfer of a pathogen between hosts may be direct or indirect.
● Pathogens have traits that maximise the success of their transfer, adhesion and invasion.
CHECK YOUR
1 Define the following terms. UNDERSTANDING
a adhesion
b fimbria
10.4
c pili
d virulence factors
e endocytosis
f invasion
2 Identify the four steps necessary for a pathogen to cause disease.
3 Describe one adaptation of each of the following pathogens that facilitates adhesion to or invasion into
host cells.
a prions
b viruses
c bacteria
d protozoa
e fungi
f macroparasites
4 What does ‘transmission’ mean in reference to the spread of infectious diseases?
5 Create a table to compare the adaptations of different types of pathogens for entry into and transmission
between hosts.
6 Describe an important strategy of a water-borne organism that facilitates transmission.
7 Where do vector-borne pathogens form preferential reservoirs? What do you think is the significance of this
for disease transmission?
8 Identify a water-borne pathogen and outline a strategy it uses to facilitate transmission.
9 Justify the statement that no one type of pathogen is any more dangerous than another.
10 How could a newborn baby pick up an infectious disease from the mother?
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 359
10_bio_InFocus12_2e_sb_08851_txt.indd 359 08/08/18 7:22 pm
10 CHAPTER SUMMARY
Cause and transmission of infectious disease: How are diseases transmitted?
WHAT IS INFECTIOUS DISEASE? CLASSIFYING PATHOGENS
Disease is any process or condition that adversely
affects the normal functioning of a living thing or Proteins Prions
parts of a living thing. An infectious disease is caused Non-cellular
by (caught from) another organism or infective agent Protein
Viruses
coat
known as a pathogen.
Microscopic
organisms
Prokaryote Bacteria
Defence Pathogen
Cellular
Eukaryote Fungi
Pathogens
Infectious
disease
Protozoans
Host Environment
Attack (pathogenicity)
Live outside
Ectoparasites
body
EXAMPLES OF DISEASES CAUSED BY PATHOGENS Macroscopic
organisms
Live inside
Endoparasites
diseases caused by bacterial pathogens body
BACTERIA NAME OF DISEASE FEATURES OF DISEASE
Bordetella Whooping cough • Runny nose, sneezing
pertussis (pertussis) • Characteristic ‘whoop’ during coughing bouts
• Gagging or vomiting KOCH’S POSTULATES
Salmonella Salmonellosis • Vomiting and diarrhoea
enterica (food poisoning) • Dehydration
• Fever and abdominal cramps
diseases caused by fungal pathogens (mycoses)
FUNGUS NAME OF DISEASE FEATURES OF DISEASE
• Epidermophyton • Tinea • Cutaneous mycoses
• Trychophyton • Tinea • Fungus secretes enzymes that break
• Ringworm down keratin 1 The same micro-organism must be
• Microsporum
• Exposure to pathogen combined with present in every diseased host.
warm, moist conditions necessary
• Redness, itching, scaliness of skin
• Ringworm may cause classic ring-
shaped lesions on skin
• Yellowing and hardening of nails
diseases caused by protozoal pathogens
PROTOZOAN NAME OF DISEASE FEATURES OF DISEASE
2 The micro-organism must be
Plasmodium spp. Malaria • Fever isolated and cultured
• Fatigue in the laboratory and
• Headaches accurately described
• Jaundice and recorded.
• Vomiting
helminth diseases in animals
HELMINTH NAME OF DISEASE FEATURES OF DISEASE 3 When a sample of the pure culture is inoculated
Enterobius vermicularis Threadworm/pinworm • Red and itchy anus into a healthy host, this host must develop the
(most common worm • Irritability and behaviour changes same symptoms as the original host.
infection in Australia) • Lack of appetite
• Restless sleep
Taenia solium (pigs) Tapeworm
• Worms may be visible in faeces
Taenia saginata (cattle)
• Weight loss (diseased)
Toxocara canis (dogs) Roundworm • Abdominal pain
Toxascaris leonina (cats) • Diarrhoea
Ascaris lumbricoides • Blood in faeces
(humans)
mites that infest animals and humans
MITE DISEASE FEATURES
Demodex canis Demodectic • Overpopulation of the parasitic organism due
(dogs) mange to immune compromise of the host
• Hair loss (alopecia)
• Itching
• Red skin 4 The micro-organism must be able to be isolated from the second
• Crusting of skin host and cultured and identified as the same as the original species.
360 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 360 08/08/18 7:23 pm
INFECTIOUS DISEASE AND AUSTRALIAN AGRICULTURE
Increasing
Human
Pesticide
Population
Increasing Effects of infectious diseases in farm animals
Intenssive
resistance
Agriculture
Different diseases in farm animals can affect primary producers
in different ways, including:
Increase in Changing land
hobby farming use patterns • death of the affected animals (e.g. Black’s disease, anthrax)
• loss of appetite and weight over a short or extended
period (e.g. three-day sickness in cattle)
• economic loss to the farmer, with negative effects on
Increase in Climate
aquaculture change profitability and production due to reduced meat, milk
and wool yields
Loss of genetic Antimicrobial • loss of international trading opportunities if Australia’s
diversity resistance
disease-free status is threatened (e.g. if foot-and-mouth
disease became endemic in Australia)
• human illness and disease (zoonoses) (e.g. Q-fever,
Plant pathogens brucellosis, leptospirosis)
• low growth rates in young animals (e.g. internal parasites
such as worms)
Fungi • loss of fertility in females through embryonic death or
stillbirths (e.g. leptospirosis, brucellosis)
Insects and • loss of economic value of individual animals due to
Bacteria blemishes or ectoparasites (e.g. warts in beef cattle).
mites
Plant pathogens Effects of pathogens on plants
• death of plant
• destruction of tissues (necrosis)
Viruses Nematodes • abnormal growth
• discolouration of tissues
• wilting
Phytoplasmas
ADAPTATION OF PATHOGENS TO FACILITATE
TRANSFER BETWEEN HOSTS
TRANSMISSION MAY BE ASSISTED BY:
• secretion of chemicals (TNF in prions)
• surface receptors (viruses) Transmission may be:
• pilli and fimbria (bacteria) • airborne
• microtubules (protozoa) • waterborne
• adhesion molecules (fungus) • vector borne
• immunomodulation (macroparasites) • faeco-oral
• mouthparts (ticks). • soil borne
• sexual
• blood borne
To enter an individual host and cause disease, pathogens • vertical.
must:
1 enter the host
2 multiply in host tissues
3 resist or not stimulate host defence mechanisms
4 damage the host.
9780170408851 CHAPTER 10 » CAUSE AND TRANSMISSION OF INFECTIOUS DISEASE 361
10_bio_InFocus12_2e_sb_08851_txt.indd 361 13/08/18 6:19 PM
10 CHAPTER REVIEW QUESTIONS Qz
Review quiz
1 Imagine a scenario where an outbreak of influenza is 12 Explain the possible effects on Australian agriculture
spreading rapidly through your school. What personal of the introduction of new infectious plant and animal
precautions would you take to ensure you did not diseases.
become a host for the influenza virus?
13 Explain how a disease outbreak in a farm relies on three
2 Explain, using an example of an infectious disease, why main factors. Use an example of an infectious disease in a
the presence of a pathogen does not necessarily lead to farm animal.
the development of symptoms of an infectious disease.
14 Use a table to summarise the nine factors that increase
3 Why do you think scientists are so obsessed with the risk of infectious disease outbreaks in Australian
classifying organisms? What advantages could there be in agricultural enterprises.
classifying pathogens accurately?
15 Summarise the features of an infectious disease in a plant.
4 Construct a table to compare and contrast the features of What are the causes of this disease? What effect could it
cellular pathogens. Carefully choose criteria that allow you have on the individual farm and Australian agriculture as a
to distinguish between them. whole (social and economic effects)?
5 Design a hospital room in an infectious disease ward. 16 Use a table to summarise the adaptations of pathogens to
Add features that you think would be useful to minimise facilitate their transmission to new hosts.
transmission of pathogens from a carrier to doctors,
17 How does the formation of endospores in certain
nurses and visitors to the ward. Think about design
bacteria facilitate their transmission to a new host? Use an
features, movement of individuals, flow of materials such
example.
as wastes, air and materials that are easy to clean and
launder. 18 Outline the features of vertical transmission of pathogens.
Use an example of a pathogen that transfers across the
6 Summarise the steps taken to control a particular
placenta.
infectious disease outbreak. Include an analysis of the
effectiveness of these measures. Suggest possible 19 Explain why the evolutionary adaptations of a pathogen
improvements to the management of this disease need to stay a step ahead of those of their host organisms.
outbreak.
20 Describe methods used by pathogens to facilitate
7 Describe the method used to test for the presence of adhesion and entry into a host. Include both cellular and
microbes in food and water. Justify two safety precautions non-cellular pathogens.
taken during this investigation.
21 Pathologists often take samples of infected tissue and
8 During your investigation of microbial testing of food and attempt to culture the pathogen in broth or on agar. Use
water, you researched the application of these techniques online sources to investigate the use of different culture
in the food industry. Use your knowledge of pathogens to mediums for bacteria and fungi.
justify two practices in the food service industry that are
22 Use an example to describe the social and economic
used to minimise pathogens in food or water.
effects of an exotic disease outbreak in Australia.
9 Using a table, summarise the features of named diseases
23 Justify the use of a control in an experiment you have
caused by direct, indirect and vector transmission.
completed during this chapter. Describe some ways in
10 Describe the contribution of Robert Koch to explaining which you ensured that pathogens were excluded from
the cause and transmission of infectious disease. In this particular sample.
particular, justify the method he used to come to his
conclusions.
11 Pasteur’s experiments on microbial contamination
showed definitively that the theory of spontaneous
generation was false. Briefly outline the experimental
method he used. Justify the design of his flasks. Explain
in your own words why we can now be confident that
pathogens must be transferred to a person for them to
get an infectious disease.
362 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
10_bio_InFocus12_2e_sb_08851_txt.indd 362 08/08/18 7:23 pm
11 Responses to pathogens
Students:
INQUIRY • investigate the response of a named Australian plant to a named pathogen through practical and/or
QUESTION secondary-sourced investigation, for example:
How does a plant or – fungal pathogens
animal respond to – viral pathogens
infection? • analyse responses to the presence of pathogens by assessing the physical and chemical changes that occur in
the host animals’ cells and tissues (ACSBL119, ACSBL120, ACSBL121, ACSBL122) CCT ICT
Biology Stage 6 Syllabus © NSW Education Standards Authority for and on behalf of the Crown in right of the State of New South Wales, 2017
Science Photo Library/R.Maisonneuve, Publiphoto Diffusion
9780170408851 363
11_bio_InFocus12_2e_sb_08851_txt.indd 363 08/08/18 7:22 pm
The states of health or disease are the expressions of the success or failure experienced by the organism
in its efforts to respond adaptively to environmental challenges.
– Rene Dubos, 1965
Source: Dubos R. ‘Man adapting’. New Haven: Yale University Press, 1965
When you walk through the Australian
Department of Biodiversity, Conservation and Attractions bush, you commonly see patches of
WS
dead eucalypts, sentinels of dieback,
Responses to the water-borne disease caused by
pathogens
the fungus Phytophthora cinnamomi
(Fig. 11.1). The fungus grows through the
warm, damp soil and infects the roots
of the tree, where the spores germinate
and grow through the tree’s root system.
As it grows, the fungus releases water-
borne spores, which swim through the
water and infect healthy roots. The roots
of an infected tree can no longer absorb
the water required to sustain life, and
FIGURE 11.1 Eucalypts killed by dieback, a fungal disease the tree slowly dies of dehydration. The
tree’s immune response is triggered as
the fungus invades the tissue of the plant root. The effectiveness of this immune response determines
whether the plant lives or dies.
This chapter examines the components of immune defence in plants and animals, and the role of
each component in responding chemically or physically to the presence of a pathogen.
11.1 Investigating plant defences
When you look at a plant, from the outside it appears that not much is going on. However, plants are
adept at avoiding infectious disease and responding to pathogenic threats. In nature, there are copious
reservoirs of pathogens in the soil and water, and yet for the most part, plant populations survive and
thrive, given the right conditions. However, plants
grown as crops on farms may be more susceptible to
Plant factors pathogen invasion, as they are generally genetically
(lines of uniform. We are all familiar with the responses of
defence)
our own bodies when a cold or flu virus invades. We
may have a fever, sore throat or muscle aches, all of
Plant disease which occur as part of the process of eliminating the
(none, mild,
pathogen. In animals we call the system responsible
severe)
for this the immune system. But plants do not have
an immune system in the way that animals do.
Pathogen
factors They do not get a fever and shiver when they catch
(virulence a virus. However, they do respond in observable
factors)
ways to limit the growth or spread of the pathogen
and save their own lives. And, just like us, they have
FIGURE 11.2 Infectious disease in plants depends on a few well-developed lines of defence that help in
both host and pathogen factors.
this process.
364 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
11_bio_InFocus12_2e_sb_08851_txt.indd 364 08/08/18 7:22 pm
Plant responses to pathogens
In both natural and cultivated environments, plants have inherent disease-resistance strategies. These
defences may be passive (such as physical and chemical barriers) or active (once the pathogen is
recognised). If a plant can prevent a pathogen from invading its tissue, or prevent the pathogen from
reproducing, then it will be resistant to that pathogen. This is determined in a complex interaction
between the plant and the pathogen at the time of infection.
Passive defences
Plants have two major types of passive defences against pathogen invasion: physical barriers and
chemical barriers.
Physical barriers
Physical barriers, such as a thick cuticle (Fig. 11.3), cell walls and small stomata, all inhibit pathogen entry.
Some pathogens secrete enzymes to break down the cuticle, and so plants with thicker cuticles are better
able to withstand this. Bark (Fig. 11.4) offers plants extra protection against pathogens that otherwise
might invade and try to reach the food source, sap, in the phloem beneath the tree bark. Vertical hanging
leaves, which do not accumulate a water film, reduce the likelihood of pathogen reservoirs building up on
the outside of leaves. Stomata tend to open during humid weather and rainstorms, which helps regulate
water balance in the plant, but is also a potential port of entry for pathogens.
FIGURE 11.3 The
Palisade Spongy cuticle and epidermis
mesophyll mesophyll are a physical barrier
preventing pathogen
Cuticle
Epidermis entry.
Stoma
Vein Vein Stoma
Lower
epidermis
FIGURE 11.4 Bark
Bark protects trunk is a strong physical
Cambium layer where barrier to pathogen
Phloem plant growth takes place entry.
Phloem for
nutrient transport
Xylem for water transport
9780170408851 CHAPTER 11 » RESPONSES TO PATHOGENS 365
11_bio_InFocus12_2e_sb_08851_txt.indd 365 08/08/18 7:22 pm
Chemical barriers
Chemical barriers, such as the presence of chemical compounds in the tissues of plants, can reduce
fungal and bacterial growth, and ward off vectors of viruses. Examples of chemicals are glucosides
and saponins. Plants may also produce enzymes that break down pathogen-derived toxins. Chemical
receptors on plant cells can detect the presence of a pathogen (for example, by detecting pathogen-
associated molecular patterns (PAMPs) secreted by bacteria) and activate the next stage of defence
(Fig. 11.5).
FIGURE 11.5
Source: Modified with permission from the Annual Review of Phytopathology, Volume
46 © 2008 by Annual Reviews, http://www.annualreviews.org
Stomata may close Open stoma Closed stoma
in response to the
presence of bacteria,
through chemical Epidermis
signalling methods
involving detection of
PAMPs.
Mesophyll cells
PAMPs PAMPs PAMPs
PAMPs PAMPs
Active defences
When its passive barriers are breached, the plant is now at grave risk of harm. The next line of defence
involves more targeted responses by the plant. Three major groups of responses are involved: recognition
of the pathogen, rapid response and delayed response.
Pathogen recognition
Plants are able to recognise pathogens by detecting certain physical and chemical signals, including
fragments from the cell walls of bacteria and fungi. Genes within the cells of the plant are thought to
regulate plant responses.
Rapid active response (minutes to hours)
Recognition of a pathogen by proteins on the surface of cells in plants causes changes in the
permeability of the plant cell membrane. This allows the movement of certain ions (calcium ions in
particular) into the cell and triggers defence responses by activating the expression of certain genes.
The release of hydrogen peroxide (H2O2) in an oxidative burst can kill microbes directly. This release of
hydrogen peroxide is often used in experiments as a chemical indication of a plant immune response.
Another response is reinforcement of the cell wall with aggregates of material in the cytoplasm near
a defect in the wall – this is known as cell wall apposition (Fig. 11.6). A third response is programmed
cell death (apoptosis), which causes a cluster of dead plant cells to accumulate around the pathogen
to isolate it, followed by the secretion of antimicrobial compounds.
366 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
11_bio_InFocus12_2e_sb_08851_txt.indd 366 08/08/18 7:22 pm
Source: Underwood W., The plant cell wall: a dynamic barrier against pathoogen
invasion. Front. Plant Sci. 3:85. doi: 10.3389/fpls.2012.00085
Fungal hyphae (orange) Epidermis (clear)
Cell wall (blue)
FIGURE 11.6 Cell wall apposition (growth in thickness and area) seals off invading fungal threads.
Delayed active response (days)
Delayed active responses limit the spread of the pathogen. One important strategy is to repair wounds in
the bark, through cork cell production and gum secretion. Lysozyme-like chemicals are also released and
have an antimicrobial action. Salicylic acid may act as a signalling agent of subsequent infections and
play a role in the plant’s ‘memory’ of a particular pathogen. This is known as systemic acquired resistance
and limits the severity of subsequent infections with that pathogen.
The responses of plants to pathogens are summarised in Figure 11.7.
FIGURE 11.7 The
types of responses
Physical by plants against
barriers pathogens
Passive defences
Chemical
barriers
Plant Rapid active
defences responses
Delayed active
Active defences
responses
Pathogen
recognition
9780170408851 CHAPTER 11 » RESPONSES TO PATHOGENS 367
11_bio_InFocus12_2e_sb_08851_txt.indd 367 08/08/18 7:22 pm
INVESTIGATION 11.1
Primary- and secondary source-investigation: Plant responses
to pathogens
Critical and Fungi and viruses are common pathogens of plants in Australia. You are to investigate a specific pathogen of
creative thinking an Australian plant and the defence responses of that plant.
The outward signs of infection of plants by pathogens were discussed in Chapter 10. Changes in colour,
Ethical
understanding
abnormal growth, mottling of leaves and death of tissues can be explained in terms of direct or indirect
damage inflicted by the pathogen and/or strategies used by the plant to destroy the pathogen or limit its
Personal and spread. Examples of fungal and viral infections are shown in Figures 11.1 and 11.8 to 11.10.
social capability
Shutterstock.com/Tunatura
Getty Images/Nigel Cattlin
FIGURE 11.8 Fungal invasion of a leaf FIGURE 11.9 Viral infections often produce mosaic
patterns on leaves.
AIMS
Alamy Stock Photo/GFK-Flora
1 To investigate the response of a named Australian
(native) plant to a named viral or fungal pathogen
through practical investigation and secondary sources
2 To design and evaluate hypotheses related to
responses of a plant to a pathogen
3 To assess the risks and consider ethical issues related
to the selection and disposal of materials
4 To evaluate and/or modify your investigation in light
of new evidence
HYPOTHESIS
FIGURE 11.10 Rose mosaic virus showing yellow
This is optional. You may like to make an informed patterns on leaves.
prediction of what types of responses you will observe
in a named disease, based on the information in
Chapter 10. What types of changes will you expect to see in fungal and viral infections? Or you may wish to
formulate your own research question based on this topic. (See page 3 for some guidelines.)
MATERIALS
List any materials that you may need to assist you with your research (e.g. magnifying glass, light microscope,
Petri dishes).
RISK ASSESSMENT
Construct a risk assessment table, with the following considerations in mind.
1 The use of gloves is recommended, to prevent biological contamination of your skin and allergic reactions
from contact with plant material.
2 The use of a face mask is strongly advised when examining plants infected with fungal material, to prevent
inhalation of fungal spores.
368 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
11_bio_InFocus12_2e_sb_08851_txt.indd 368 08/08/18 7:23 pm
3 Protective eyewear must be worn.
4 A lab coat or apron will reduce the risk of getting fungal spores on your clothing.
5 All surfaces must be wiped down with alcohol after the experiment.
6 Your teacher will advise you on the safest means of disposal of infected plant material, to prevent
transmission to non-infected plants in the environment.
7 All laboratory equipment used in this experiment should be thoroughly disinfected to remove pathogens.
This includes microscope slides.
Develop your risk assessment table using the template below.
WHAT ARE THE HAZARDS? WHAT RISK DOES THIS HAZARD POSE? HOW CAN YOU SAFELY MANAGE THIS RISK? !
RISK
ASSESSMENT
METHOD
1 Work in pairs. Choose a viral or fungal pathogen of an Australian native plant. There are many good online
resources to help you make your decision. Try to select something of interest from your local area.
2 Collect data on both the plant and the invading pathogen. It is up to you how you divide the workload, but
one of you may like to research the plant and its responses, and the other may like to research the pathogen. Royal Botanic
3 You may collect actual samples of the plant/pathogen. You may also use printed or online material Garden
Sydney
(secondary sources). Conducting a literature review is also an option (page 9). The information you will be
required to gather includes the following:
a scientific and common name of the selected Australian plant
b scientific and common name of the fungal or viral pathogen
c diagrams or photographs of a normal plant and an infected plant . Include all parts of the plant, not Australian
just those visible above ground. This may include photos of the whole plant, parts of the plant or even Government
website
images taken using light and electron microscopy. If you take photos of a plant outside the classroom,
consider using a ‘selfie stick’ for hard-to-reach parts of the plant. You may wish to include flow charts,
diagrams or other representations showing more subtle chemical and immune changes in your chosen
plant (e.g. biochemical signalling).
d an explanation of the changes the plant undergoes. You must link the cause (pathogen) to the effect
(plant response). Australian
Native Plants
4 Apply the CRAAP test to your sources (page 10). Society
The weblinks may be a good starting point for your investigation.
RESULTS
Construct a table to record your results. Use the table below as a guide.
PLANT NAME NAME OF FUNGAL OR VIRAL PATHOGEN DIAGRAMS/PHOTOS OF AFFECTED PLANT
DISCUSSION
1 Swap your research with another group and peer review each other’s research in terms of:
a reliability
b accuracy
c validity
d relevance.
2 Describe how the pathogen enters the plant.
3 In what types of ways does the plant respond to infection?
4 Describe the effect of the pathogen on the plant.
CONCLUSION
The conclusion should refer back to the hypothesis and aim.
9780170408851 CHAPTER 11 » RESPONSES TO PATHOGENS 369
11_bio_InFocus12_2e_sb_08851_txt.indd 369 08/08/18 7:23 pm
KEY CONCEPTS
● Plants respond to pathogens by both chemical and physical means.
● Passive defences include physical barriers and chemical barriers.
● Active defences include rapid and delayed responses.
● Rapid responses help to seal off any wounds and destroy pathogens quickly.
● Delayed responses limit the spread of an invading pathogen and involve complex chemical
signalling.
CHECK YOUR
UNDERSTANDING 1 An insect begins to feed on a plant’s stem and breaches the epidermis with its mouthparts. Outline
the steps the plant might take to seal the breach and deal with potential pathogens introduced by the
11.1 insect.
2 Explain why vertically hanging leaves might be an advantage to a plant in an environment that is rich in
potential pathogens.
3 What chemical response to pathogens closes stomata? Evaluate the usefulness of this response.
4 Justify the responsible disposal of pathogen-infected plant material used during school experiments.
5 A plant has discolouration on its leaves. What signs would you look for, or techniques could you use, to
determine whether the pathogen is a fungus or a virus?
6 Imagine that you are the manager of a small plant nursery. A supplier has brought in a new batch of roses
and placed them on display. You notice a day later that they are showing signs of a bacterial disease.
a What steps could you have taken to prevent these infected plants being exposed to other healthy
plants?
b What procedures would you put in place to reduce the spread of plant pathogens in your nursery?
Think of layout of the nursery, materials used in construction, and personnel routines.
11.2 Animal responses to pathogens
Every good general of the armed forces knows that a battle must be meticulously planned and organised.
A leader who can anticipate possible moves by the enemy is able to prepare in advance and train the
troops for scenarios they have not yet encountered. All soldiers have a rank and a specific role. If plan A
fails, there is plan B and, if necessary, plan C.
With living organisms, the vast array and complexity of micro-organisms to which they are exposed
presents a challenge to their defence mechanisms. Complex multicellular organisms such as animals
(including humans) and plants have a multilayered system of defences to prevent infection and colonisation
by potential pathogens. The immune system of animals is similar to an army: it is highly organised into
different levels or ranks, and it is able to anticipate invasion by pathogens it has not yet encountered. There
are multiple layers of defence, including physical and chemical responses, for when pathogens land on
and/or breach the outer boundaries of the organism.
Lines of defence
The body’s immune system consists of different levels of defence, as shown in Figure 11.11.
Innate immunity is present at birth and is genetically determined. Its responses to pathogens are
non-specific, and include both physical and chemical barriers (first line of defence) as well as cellular
responses (second line of defence).
1 The body’s first line of defence against pathogens consists of barriers to entry. These barriers may be
physical (such as skin), chemical (such as tears) or biological (such as sphincters).
370 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
11_bio_InFocus12_2e_sb_08851_txt.indd 370 08/08/18 7:23 pm
2 When a barrier is breached, the second line of defence is activated. It involves a non-specific chemical
and cellular attack on the pathogen, characterised by the process of inflammation.
Both these stages are non-specific – they act against any substance that is perceived as ‘non-self ’ and
a threat, including invading living organisms and organic and inorganic substances (such as a splinter in
the skin, a transplanted organ or dust in the eyes). The third line of
defence is discussed
Adaptive immunity is the third line of defence. This is a specific defence mechanism consisting of in Chapter 12.
specialised cells that act if the pathogen persists in its invasion.
FIGURE 11.11
Organisational levels
First line
of the body’s defences
Physical and chemical
barriers formed by tissues
Innate (inherited
and non-specific)
Second line
Inflammation: physical
and chemical
Body responses of cells
defences/
immune
system
Third line
Adaptive Immune response:
(acquired and specific) chemical responses
by cells
The arrangement of the body has implications for the immune system
The outside parts of organisms are constantly exposed to the environment. The internal compartments
that are closed off to the environment must remain sterile (free from microbial contamination). These
include the thoracic, cranial and abdominal cavities, and the blood vessels of the cardiovascular
system. The organism must prevent entry of pathogens to these spaces, or severe and overwhelming
consequences may result. This is why a ruptured appendix or a penetrating wound to the chest is an
emergency. It is also why organisms have developed elaborate mechanisms to prevent entry of pathogens
to such spaces.
Think of the body as a plastic tube or pipe (Fig. 11.12). The inside tunnel (lumen) represents the
digestive system, which is full of bacteria. Some of these bacteria are essential, such as our microflora,
Shutterstock.com/senee sriyota
FIGURE 11.12 A tube or pipe is a good scientific model for the body.
9780170408851 CHAPTER 11 » RESPONSES TO PATHOGENS 371
11_bio_InFocus12_2e_sb_08851_txt.indd 371 09/08/18 10:29 am
but some, such as E. coli, are harmful in large numbers. Both microflora and pathogens must be
excluded from the body's sterile areas. The outside of the tube or pipe is exposed to environmental
micro-organisms. The plastic itself represents the tissues of your body. The entire defence system of
multicellular organisms is dedicated to prohibiting entry of micro-organisms to the ‘plastic’ itself.
Tissues must be kept sterile. Keep this model in mind when you read further about the three lines
of defence.
KEY CONCEPTS
● The body’s defences are organised into three ‘lines’.
● The first line of defence consists of physical and chemical barriers to pathogens.
● The second line of defence is initiated by chemical signalling from damaged tissue and consists
of the inflammatory response and phagocytosis by white blood cells.
● The third line of defence is a specific defence by lymphocytes in response to chemical signals.
● Certain parts of the body must remain sterile and free of contamination by both pathogens and
microflora.
CHECK YOUR
UNDERSTANDING 1 Explain why a surgeon sterilises the skin around where they plan to make an incision during an operation.
Use your knowledge of the body’s barriers and sterile areas.
11.2a 2 In what ways are the body’s defensive systems like an army?
3 A model of the body’s defences is that of a hollow tube. In a group, brainstorm possible ways to modify
the tube model of the lines of defence to make it a more accurate representation of the body’s immune
defences.
4 Apply your understanding of evolution by natural selection to explain how plants and animals have
developed such complex and successful defences against pathogens.
5 Use the tube or pipe model to explain why a ruptured appendix is an emergency in terms of infection.
Components of the immune system
An antigen is any molecule that the body recognises as foreign and that triggers an immune response.
On the surface of cells in the body there are ‘marker’ molecules that identify the cell as belonging to
the body (‘self ’). This protects the cells in the body from attack by its own immune system.
Pathogens that enter the body have a variety of chemical markers (antigens) on their surface; the
immune system recognises these markers as not belonging to the body (‘non-self ’). In this way, the
presence of antigens causes the immune response to activate, to destroy the pathogens.
It is not only pathogens that have antigens on their surface. Any foreign cell, cell fragment, protein
debris or toxin produced by bacteria can also contain antigens. The venom of venomous snakes contains
a number of antigens. In all these examples, the immune response is activated because the body
recognises all these antigens as foreign (non-self) molecules.
When pathogens are successful in penetrating the barriers against entry into the organism, non-
specific responses that are the ‘second line of defence’ are quickly activated to try to destroy the invaders
before they can cause any damage to the body.
These second-line, non-specific defence adaptations include:
◗ inflammation
◗ phagocytosis
◗ fever (pyrexia)
◗ cell death to seal off the pathogens (granuloma formation).
These processes work together, ahead of and with the third line of defence if required, to defend the
body against attack.
372 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
11_bio_InFocus12_2e_sb_08851_txt.indd 372 08/08/18 7:23 pm
INVESTIGATION 11.2
Secondary-source investigation: Christmas trees and asthma
Mould is a fungus. It is present everywhere in the environment. In homes, mould can grow in moist areas with Critical and
poor ventilation. It is associated with health problems in humans and animals. creative thinking
A strange phenomenon has been observed in the United States in an area near New Jersey. Since 1930, Information and
there has been an increase in the severity of symptoms of asthmatics during the Christmas season. In this communication
technology
investigation, you will examine the qualitative and quantitative data associated with this research. capability
AIMS
1 To conduct an investigation to gather valid and reliable secondary data on the incidence of respiratory
disease at Christmas in Washington Township, New Jersey
2 To analyse and evaluate secondary data and information on the incidence of respiratory disease
3 To identify trends and relationships in the data and determine whether there is a link between Christmas The Christmas
tree allergy
trees and the increased incidence of respiratory disease phenomenon
4 To determine what alternatives to live Christmas trees are available
HYPOTHESIS
Write a suitable hypothesis for your investigation.
METHOD Christmas tree
allergy: mould
Construct a method to test your hypothesis. Use the weblinks to start your research. Collect both quantitative and pollen
studies
and qualitative data.
RESULTS
Record your observations in a carefully formatted table.
DISCUSSION
Mould in
1 Discuss your results, with particular attention to the link between live Christmas trees and the increased Christmas trees:
Science or
incidence of respiratory disease. Are non-living trees safer? Use data to support your answer. speculation?
2 Make recommendations based on your results.
3 Analyse the validity, reliability, accuracy and relevance of your sources.
CONCLUSION
Summarise your findings about the potential dangers of live Christmas trees, referring back to your aims and
hypothesis.
The role of the lymphatic system
As blood circulates around the body, some of the plasma moves out of the capillaries into the tissues
and becomes part of the tissue fluid. This tissue fluid then moves into a system of vessels known as the
lymphatic system. The lymphatic system consists of lymph (a milky fluid), lymph nodes, lymph vessels,
thymus, spleen, tonsils and adenoids (Fig. 11.13).
The lymph vessels form a one-way drainage system from all parts of the body back to a point
near the heart, where the cleansed lymph fluid is drained back into the blood via the thoracic duct.
The muscles that surround the vessels squeeze the fluid in one direction and valves prevent the fluid
moving backwards.
9780170408851 CHAPTER 11 » RESPONSES TO PATHOGENS 373
11_bio_InFocus12_2e_sb_08851_txt.indd 373 08/08/18 7:23 pm
At different points along the lymph
vessels, structures called lymph nodes
play an important part in the body’s
Adenoids
defence system.
Tonsils
During infections, pathogens and Cervical nodes
Thoracic duct
their products may enter the lymph Right lymph duct Left subclavian vein
fluid. The fluid is transported to the Right subclavian vein
local lymph nodes, where substances Thymus Lymph nodes
including microbes, cellular debris Bronchus- Axillary nodes
associated Intercostal nodes
and cancer cells are filtered out of the lymphoid tissue
fluid before it continues its journey. Spleen
One of the ways that infections may Peyer’s patches
Peyer’s patches
be detected is by the enlargement of
the local lymph nodes. Changes in size, Appendix
shape or texture of lymph nodes may
help to pinpoint the site of an infection, Bone marrow
Lymph nodes
as the drainage routes for the particular lliac nodes
lymph node are known. Inguinal nodes
Therefore, swollen lymph nodes
(glands) are a good indicator of the Lymphatic
vessels
body’s response to infection (Fig. 11.14).
The lymph nodes also play an important
role in the third line of defence, as you
will learn in Chapter 12.
FIGURE 11.13 The lymphatic system consists of lymph vessels,
lymph nodes and lymphoid organs such as the spleen and thymus.
FIGURE 11.14
Shutterstock.com/Alexander Raths
Lymph nodes play
an important role in
defending the body.
Swollen lymph nodes
can be an indicator of
infection.
White blood cells
White blood cells (leucocytes) play a pivotal role in the innate and adaptive responses to pathogens.
There are different types of white blood cells, which differ in:
◗ size
◗ whether they contain granules in their cytoplasm (granular or agranular)
◗ the colour of their granules and cytoplasm (pink – eosinophilic, blue – basophilic)
◗ the shape of their nucleus (lobed or mononuclear).
Table 11.3 lists the functions and locations of the different types of white blood cells. Figure 11.15
shows their appearance. Note how they differ according to the criteria listed above.
374 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
11_bio_InFocus12_2e_sb_08851_txt.indd 374 08/08/18 7:24 pm
TABLE 11.3 Cells involved in chemical and physical responses to infection by pathogens (lymphocytes are not included)
CELL TYPE CHARACTERISTICS LOCATION
Mast cell • Blood vessel dilation Connective tissues and mucous membranes
• Release of heparin and histamines
• Recruitment of neutrophils and macrophages
• Also involved in allergic reactions
Macrophage • Phagocytosis of pathogens and cancer cells Migrates from blood vessels into tissues
• Antigen-presenting cell
Natural killer cell • Kills tumour cells and virus-infected cells Circulates in blood and migrates into tissues
Dendritic cell • Antigen-presenting cell Epithelial tissues, including skin, lung and tissues of the
• Triggers adaptive immune response digestive tract. Migrates to lymph nodes upon activation
Monocyte • Differentiates into phagocytic cells such as Stored in spleen. Moves to infected tissues through
dendritic cells and macrophages blood vessels
Neutrophil • Most common white blood cell at site of trauma Migrates from blood vessels into tissues
or infection
• Releases toxins that kill or inhibit bacteria and fungi
• Recruits other immune cells to the site of infection
Basophil • Defence against parasites Circulates in blood and migrates to tissues
• Releases histamines that cause inflammation
• Responsible for some allergic reactions
Eosinophil • Releases toxins that kill bacteria and parasites Circulates in blood and migrates to tissues
Source: adapted from Lumen Learning Canada 2017, Boundless Biology, ‘Innate immune response’, https://courses.lumenlearning.com/boundless-biology/chapter/innate-immune-response/
FIGURE 11.15 Cells
Dreamstime.com/Extender01
involved in chemical
and physical
responses to infection
by pathogens. The
cells are not drawn to
Neutrophil Eosinophil Basophil Monocyte scale.
Figure 11.32 shows
dendritic cells.
TCell B Cell Natural killer Macrophage
The microbiome: a natural barrier to infection
The human body is home to a large and varied population of microbes, living mainly on the skin, in
the intestines, the colon, the mouth and the vagina in women. These microbes are known collectively
as the microbiome of the body. The body supplies these microbes with the nutrients they require and
the conditions they need to survive. In return, the presence of the microbiome inhibits the growth and
multiplication of many pathogens that encounter the body, because the natural microbes out-compete
the pathogenic ones. The microbiome thereby protects the body from many diseases.
If the conditions of the body change, and the balance of the microbiome is changed, the growth and
multiplication of harmful pathogens may not be controlled, which can lead to an increase in their numbers
and the development of disease. Of the many diseases that are caused when there is an imbalance in the
microbiome of the body, one example is candidiasis (commonly known as thrush).
Candidiasis is caused by the fungus Candida albicans. This fungus (yeast) is part of the natural
microbiome of the human body and is normally present on the mucous membranes of the female genital
tract, mouth, respiratory tract and alimentary canal. The number of C. albicans is usually kept low by
competition from other micro-organisms in the body’s microbiome. If the natural balance of the microbiome
is upset for any reason, the number of C. albicans increases and the disease candidiasis develops.
9780170408851 CHAPTER 11 » RESPONSES TO PATHOGENS 375
11_bio_InFocus12_2e_sb_08851_txt.indd 375 08/08/18 7:24 pm
One of the ways in which the natural balance of the microbiome can be upset is by taking antibiotics
to treat a bacterial infection. As well as reducing the number of pathogenic bacteria in the body,
antibiotics can also reduce the number of bacteria in the natural population of microbiome. This allows
C. albicans to multiply in an uncontrolled way and the disease candidiasis to become established.
Other factors that allow an increase in the number of C. albicans include:
◗ suppression of the immune system from inherited conditions, cancer treatment, and viruses such as
HIV/AIDS
◗ diabetes mellitus – high sugar levels predispose to Candida overgrowth
◗ use of corticosteroids, which suppress immune surveillance
◗ hormones – higher oestrogen levels in the second and third trimesters of pregnancy can predispose
to thrush
◗ use of oral contraceptives – associated with higher oestrogen levels
◗ general illness – can lead to suppression of the immune responses
◗ intravenous drug use (such as heroin).
Physical barriers against infection
Every day our computers are vulnerable to cyberattack. One of the most common ways to protect
WS them is to have an active firewall program that denies entry to common computer viruses, such as
the ‘ransomware’ viruses that plague businesses and institutions around the world. Similarly, the most
First line of
defence in the effective way to deal with the threat of a pathogen is to deny it entry to the body. Living things have an
immune system
array of natural physical firewalls or barriers to keep pathogens out.
Physical barriers are structures that the body uses to restrict entry to pathogens, by making it difficult
for the pathogen to adhere to cells or to penetrate tissues.
Table 11.4 lists some of the ways in which pathogens can enter the body.
TABLE 11.4 Routes of entry for pathogens into the body
ROUTE OF ENTRY MODE OF TRANSMISSION EXAMPLES OF PATHOGENS EXAMPLES OF DISEASES
Mucosal surfaces
Airway Inhaled droplets Influenza virus Influenza
Neisseria meningitides Meningococcal
meningitis
Gastrointestinal tract Contaminated water or Salmonella typhi Typhoid fever
food Rotavirus Diarrhoea
Reproductive tract Physical contact Treponema pallidum Syphilis
External epithelia
External surface Physical contact Tinea pedis Athlete’s foot
Wounds and abrasions Minor skin abrasions Bacillus anthracis Anthrax
Puncture wounds Clostridium tetani Tetanus
Handling infected Pasteurella tularensis Tularaemia
animals
Insect bites Mosquito bites (Aedes Flavivirus Yellow fever
aegypti) Borrelia burgdorferi Lyme disease
Tick bites Plasmodium spp. Malaria
Mosquito bites
(Anopheles)
Source: adapted from Janeway CA, Travers P, Walport et al 2001, Immunobiology: The Immune System in Health and Disease, 5th edn, New York: Garland Science
376 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
11_bio_InFocus12_2e_sb_08851_txt.indd 376 08/08/18 7:24 pm
Epithelial tissues line all the major internal cavities of the body and include the skin and mucous
membranes. Mucous membranes are the moist pink tissues lining the entry points of the body, such as the
lining of the mouth, the nasal cavity, the conjunctiva and the entrances to the digestive and genitourinary
systems. The skin and the mucous membranes have a range of strategies to restrict pathogen entry.
Skin
The skin is classified as epithelial tissue. It consists of three layers: the outer epidermis, the underlying
dermis and the lower hypodermis (or subcutaneous tissue) (Fig. 11.16). Skin is well supplied by blood,
which contributes to its effectiveness as a barrier to disease by providing early access for white blood
cells, red blood cells and platelets to any wound.
Hair shaft
Sebaceous gland Muscles FIGURE 11.16 The
Free nerve ending skin forms a physical
barrier against
pathogens.
Epidermis
(keratinised
cells)
Capillary loops
Sweat duct
Sebaceous
gland Dermis
Hair follicle
Motor nerve
Sensory nerve
Sweat gland
Adipose cells
Artery Subcutaneous
Vein tissue
The epidermis consists of sheets of cells covered
by a special barrier, called keratin. Keratin is a
Alamy Stock Photo/Science Photo Library
waterproof protein that provides an extra layer of Stratum corneum
(‘brick layer’)
security against pathogen entry. Keratin is secreted by
skin cells known as keratinocytes. Keratin separates
the organism from its environment very effectively, as
it is mechanically tough and resistant to degradation
by bacterial enzymes.
The upper layer of the epidermis, or stratum
corneum, consists of a layer of flattened and
dead skin cells in a type of ‘bricks and mortar’
arrangement (Fig. 11.17). This forms an effective
physical barrier against pathogen entry. As dead
cells exfoliate (die and flake off), they take pathogens
with them.
FIGURE 11.17 The ‘bricks and mortar’ structure of the
When there is loss of integrity (completeness) of upper layer of the epidermis makes skin an excellent
the skin barrier due to wounds or burns, the body physical barrier to pathogens.
has special processes to seal the site as quickly as
possible:
1 inflammation – this will be discussed in more detail on page 385.
2 proliferation – new cells multiply rapidly to seal the wound
3 maturation – cells mature and complete the new barrier.
9780170408851 CHAPTER 11 » RESPONSES TO PATHOGENS 377
11_bio_InFocus12_2e_sb_08851_txt.indd 377 08/08/18 7:24 pm
Mucous membranes
Many of the internal cavities of the body are continuous with the external environment. This means they
are directly exposed to pathogens on a daily basis. These cavities are lined with a special type of epithelial
tissue, called a mucous membrane, that forms a barrier to pathogen entry. The number of layers and
shapes of cells depends on the location. Mucous membranes are typically pink, moist lining tissues, such
as the lining of our mouth and nose (Fig. 11.18). They are found in the digestive (alimentary), respiratory
and genitourinary systems.
The following features of mucous membranes restrict pathogen entry.
◗ Cell junctions between epithelial cells are designed to anchor them together more effectively,
increasing cohesion and restricting access to pathogens.
◗ Many epithelial cells are lined with tiny hair-like structures called cilia, which beat in a coordinated way
to remove particles from the respiratory system (Fig. 11.19) – this is known as the muco-ciliary escalator.
It is this escalator that is damaged by cigarette smoke and contributes to the typical ‘smoker’s cough’.
◗ They are composed of sheets of cells that are constantly growing and moving upwards to replace
surface cells lost due to wear and tear or pathogen attack.
◗ They secrete a number of protective substances such as mucus, lysozyme and immunoglobulins
(antibodies). Shutterstock.com/Designua
Cilia
Shutterstock.com/Ocskay Bence
Basal cell Ciliated cell Goblet cell
FIGURE 11.18 Mucous membranes
line entry points to the body, such as FIGURE 11.19 Cilia wave in a coordinated way to expel foreign
the mouth. material.
Tight junctions
Blood vessels are lined internally by endothelial cells. These cells have special ways to adhere tightly
to each other, which helps prevent the entry of pathogens from infected tissue into the blood vessels
(Fig. 11.20). If pathogens enter the bloodstream, they can travel to distant sites and set up new centres
of infection. The presence of bacteria in the bloodstream is known as bacteraemia.
The blood–brain barrier is a particularly important example of the effectiveness of tight junctions. It is
formed by brain endothelial cells connected by tight junctions, and restricts the diffusion of microscopic
objects such as bacteria into the brain.
Basement membrane Endothelial
nucleus
Red blood
cell
Intercellular
cleft
Tight junctions Endothelial cells
FIGURE 11.20 Tight junctions between
endothelial cells form a physical barrier between
the extracellular tissues and the bloodstream.
378 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
11_bio_InFocus12_2e_sb_08851_txt.indd 378 08/08/18 7:24 pm
Mucus Dust particles
Mucus is a slippery substance secreted by cells that line the
mucous membranes. Mucus protects the linings of the body by Mucus layer traps
trapping foreign substances such as pathogens, dust and pollen. inhaled particles.
Increased mucus production in the respiratory tract (Fig. 11.21)
is often a sign of ill health, as the body attempts to flush away an
Cilia move mucus
invading pathogen. A runny nose and cough may result. Green to pharynx.
mucus can indicate the activity of white blood cells, as they secrete
Goblet cells
iron-containing enzymes to deal with pathogens.
secrete mucus.
Mucus also prevents the entry of pathogens through the
cells lining the alimentary canal. Cervical mucus plugs can guard Nucleus of columnar
the uterus against entry by pathogens during pregnancy. Some epithelial cell
intestinal mucus has been shown to contain substances that Basal cell
inhibit the replication of viruses, such as rotaviruses. Basement membrane
Peristalsis FIGURE 11.21 Mucus is produced by goblet cells that form
The alimentary canal is a long tube through which food moves part of the epithelial layer lining the respiratory tract.
from the mouth to the anus. The wall of this tube consists of
several layers, one of which is smooth muscle. Smooth muscle is not under voluntary control but acts
automatically. This muscle contracts in a coordinated way, known as peristalsis, to move food in one
direction only. Stasis (lack of movement) of the intestines can lead to intestinal bacterial overgrowth.
Bacterial overgrowth occurs because the bacteria have an opportunity to proliferate (reproduce).
Sphincters
A sphincter is a circular muscle that maintains constriction of a natural body passage or orifice and
relaxes as required by normal physiological functioning. Sphincters are found in many parts of the body
(Fig. 11.22), including:
◗ the lower oesophageal sphincter – between the oesophagus and the stomach
◗ the pyloric sphincter – between the stomach and the duodenum
◗ the ileocaecal sphincter – between the ileum (final part of the small intestine) and the large intestine
◗ the urethral sphincters – prevent the release of urine from the bladder unless done so voluntarily
◗ the sphincter of Oddi – ensures one-way flow of digestive juices from the common bile duct (from the
gallbladder and pancreas) to the duodenum.
a Oesophageal b c
Shutterstock.com/Netta07
Oesophagus sphincter Liver
Gallbladder
Pyloric Common bile Pancreas Ascending colon
sphincter duct
Valve
Sphincter of
common bile
duct
Stomach Pancreatic
Sphincter of Oddi Ileum
duct
Duodenum Ileocaecal sphincter
Sphincter of
pancreatic duct
FIGURE 11.22 Sphincters help to physically seal off compartments in the body, to reduce the likelihood of pathogen invasion: a oesophageal and
pyloric sphincters; b sphincter of Oddi and sphincter of pancreatic duct; c ileocaecal sphincter.
9780170408851 CHAPTER 11 » RESPONSES TO PATHOGENS 379
11_bio_InFocus12_2e_sb_08851_txt.indd 379 08/08/18 7:24 pm
KEY CONCEPTS
● Antigens trigger an immune response.
● Antigens may come from pathogens or from non-living material.
● Innate immune responses include inflammation, phagocytosis, fever and cell death to seal off
pathogens.
● The lymphatic system consists of many tissues and organs involved in immune responses to
pathogens.
● White blood cells play different roles in the response to pathogens.
● The human body hosts a large number of micro-organisms known as the microbiome, which
assist in the maintenance of good health.
● Physical barriers restrict entry by pathogens, by making it difficult for them to adhere to or
penetrate tissues.
CHECK YOUR
UNDERSTANDING 1 Why is it important that the body is able to detect and respond to the presence of antigens?
2 Outline the advantages of having a lymphatic system.
11.2b 3 When viewing blood samples under a light microscope, what kinds of features allow scientists to
distinguish between the different types of white blood cells?
4 What is the microbiome? How does the microbiome provide a barrier to pathogens in the human body?
Outline an example of an infectious disease caused by an imbalance in the microbiome.
5 When a person takes an oral antibiotic for a number of weeks, they sometimes develop diarrhoea. It is
often recommended by doctors that they eat yoghurt or other probiotics during their antibiotic course.
Justify the use of probiotics in this situation.
6 How do the following prevent the entry of pathogens?
a skin
b peristalsis
c mucus
d sphincters
e cilia
7 Justify the use of a Band-Aid® when you have a wound on your skin from a scrape or a cut. What is it
temporarily taking the place of?
Physical responses to infection
Sometimes cells die to seal off an area of tissue that is infected and is not being successfully defended
by the body. If the infected cells are surrounded by a wall of dead cells, this prevents the infection
from spreading to other areas and infecting them. This wall of dead cells forms a capsule known as
a granuloma (Fig. 11.23). The cells inside the
:Shutterstock.com/David Litman
granuloma then die, causing the destruction
of the pathogens that are infecting them. The
debris inside the granuloma is destroyed by
macrophages that have surrounded the ‘walled-
off ’ area. The bacteria that cause tuberculosis
and leprosy (Mycobacteriam spp.) typically
cause granuloma formations. Granulomas in
the lungs were referred to as ‘tubercles’ (thus
the name ‘tuberculosis’). Granuloma formation
FIGURE 11.23 Micrograph of a granuloma
is part of the second line of defence.
380 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
11_bio_InFocus12_2e_sb_08851_txt.indd 380 08/08/18 7:24 pm
Vomiting and diarrhoea
Vomiting (emesis) is a reflex action coordinated by the vomiting
centre (chemoreceptor trigger zone) of the brain. It happens in Kidney Bacteria and yeasts can
enter the kidneys.
response to many different signals, one of which is the presence
In nephritis, bacteria can
of pathogens in the gut (gastroenteritis). It is the body’s way of enter the blood via the
expelling harmful substances. Interestingly, hypersalivation occurs One-way renal vein, resulting in
urine flow bacteraemia.
before vomiting in order to protect your tooth enamel from
stomach acid. It is thought that dogs and cats may chew on grass Ureter
Organisms can flow up
the ureter to the kidney.
when feeling ill because grass acts as a natural emetic to help them
vomit and expel harmful substances.
At the other end of the digestive system, diarrhoea expels
Bladder
micro-organisms quickly from the gastrointestinal system.
Increased urination Regular urination flushes Urethra
out the bladder. Main access of organisms
When the bladder lining is attacked by a pathogen, a common to lower urinary tract
response by the body is inflammation (cystitis) and the need to pass
frequent small amounts of urine (pollakiuria). This is thought to be FIGURE 11.24 The one-way flushing action of urine assists in
removing bacteria.
a response by the body to help flush out pathogens (Fig. 11.24).
INVESTIGATION 11.3
Secondary-source investigation of urinary tract infections Critical and
creative thinking
Urinary tract infections (UTIs) are common in humans, particularly in the very young and in older men
and women, as well as in other animals such as dogs and cats. They are commonly caused by bacterial Information and
communication
pathogens. A person may be at greater risk of developing an infection of the urinary tract if there are other technology
disease processes at work in their body. In this investigation, you will research the predisposing factors, capability
symptoms and response of the body to the infection as well as the management and treatment of this type
of infection.
AIMS
1 To pose questions regarding the development of UTIs
2 To make predictions about the risk factors involved in UTIs
3 To analyse and evaluate evidence from secondary sources
4 To communicate scientific and technological understanding of UTIs
HYPOTHESIS
Write a suitable hypothesis for your investigation. It may relate to the types of people who are at greater risk of
UTIs or specifically to the factors that increase the risk of UTIs.
METHOD
1 Use printed and online secondary sources to gather secondary qualitative and quantitative data on the
incidence and/or prevalence of UTIs, in either humans or another species (for example, dogs, cats).
2 Find a suitable species-specific diagram of the urinary tract so that you are familiar with the following
parts: kidneys, ureters, bladder, urethra.
3 Identify the common pathogens that are most likely to cause UTIs. Where do these pathogens
come from?
9780170408851 CHAPTER 11 » RESPONSES TO PATHOGENS 381
11_bio_InFocus12_2e_sb_08851_txt.indd 381 08/08/18 7:24 pm
4 By what mechanism do these pathogens gain access to the upper urinary tract?
5 Describe the physical and chemical barriers that prevent bacteria colonising the urinary tract.
6 How does the urinary tract respond to the presence of a pathogen?
7 What signs and symptoms are produced as a result of the body’s response to the presence of the
pathogen?
8 Why are the very young and the very old more predisposed to this type of infection? What aspects of
their body or behaviour allow it to happen more often? If you have chosen to research UTIs in cats or
dogs, what types of factors increase the risk of this type of infection in these animals?
9 How are UTIs managed? Describe how these strategies aim to restore the usual chemical and physical
defences against pathogens.
Urinary tract 10 Use the weblink as a starting point for your research. Construct a list of other sources and references in
infections
the appropriate manner.
RESULTS
Record your findings in a carefully formatted table.
DISCUSSION
Make a general recommendation regarding ways to reduce the incidence of UTIs. Use your data to support
your recommendation.
CONCLUSION
In what way does management of UTIs aim to restore the normal physical and chemical defences of the
urinary tract against pathogens?
Wound healing
When there is a breach in the body’s barriers, the tissues are exposed to environmental pathogens and
the microbiome of the skin. There may be bleeding, if blood vessels have been damaged in the process.
The priorities of wound healing are to:
◗ stop the bleeding (haemostasis) to maintain normal blood pressure
◗ confront pathogens, to prevent infection
◗ heal and repair the wound, to re-establish the barrier.
These stages overlap. Stopping the bleeding is the first priority for the body. To do this, the blood
vessels contract (vasoconstriction) and a platelet plug is formed. A protein called fibrin forms a mesh, to
trap more platelets and form a clot to seal the wound. The inflammatory response then begins.
KEY CONCEPTS
● Physical defences against infection include barriers and biological functions such as peristalsis.
● Barriers such as the skin, epithelium, mucus, tight junctions, peristalsis and sphincters all play
a role in limiting access of pathogens to the body.
● Peristalsis causes the one-way movement of food matter from the mouth to the anus and
prevents faecal matter moving backwards into more sterile compartments of the gut.
● Physical responses to infection include the following.
– Vomiting and diarrhoea remove potential pathogens and their toxins quickly from the gut.
– The one-way flow of urine flushes pathogens from the urinary tract and reduces the
likelihood of pathogens moving into sterile areas such as the bladder and kidneys.
– Wound healing reseals the physical barriers against infection by pathogens.
382 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
11_bio_InFocus12_2e_sb_08851_txt.indd 382 08/08/18 7:24 pm
CHECK YOUR
1 A patient presents to a hospital with vomiting and diarrhoea after eating spoiled food. Explain why the UNDERSTANDING
body initiates this physical response to the presence of a pathogen in the gut.
2 Wound healing is a process that takes a lot of resources and energy to complete, and yet it is done 11.2c
relatively quickly in the absence of infection. Justify the ‘cost’ to the body in terms of the benefits of fast
healing of breaches to the skin and mucous membranes.
3 Having to blow your nose a lot when you have a cold is often an inconvenience. Why do the membranes
lining your nose respond to pathogens by hypersecretion of mucus from goblet cells in your nasal epithelium?
4 Assess the advantages and disadvantages of granuloma formation during a bacterial infection.
5 Cigarette smoke can cause loss of cilia on the epithelial cells lining the respiratory tract. Explain why
smokers are more predisposed to bacterial infections of the respiratory system than non-smokers.
6 Bacterial infections of the gut are often accompanied by reduction or loss of peristalsis (intestinal motility
disorder). Assess the importance of re-establishing normal gut movements as soon as possible in order to
manage the infection.
Chemical defences against infection
In combination with physical barriers, a number of non-specific chemicals are secreted by epithelial tissue
to further prevent pathogens entering the internal environment of the body. These secreted chemicals are
found in mucus, saliva, tears, urine, stomach acid and natural antimicrobial substances, as well as body fluids.
Urine
Urine is sterile until it reaches the lower urethra. The precise mechanisms by which the urinary tract
maintains sterility are not well understood. New research suggests that a microbiome may exist inside
the bladder. When an animal or human is not urinating, there is a window of opportunity for pathogens to
ascend the lower urinary tract (urethra) from the lower urethra, penis and vagina. Females have a shorter
urethra than males and therefore are at greater risk of lower urinary tract infections. Faecal bacteria
such as E. coli are a particular threat, as are normally commensal organisms such as Staphyloccoccus spp.
found on the skin in this area. In bacterial cystitis (bladder infection), organisms make it all the way up
the urethra into the bladder. The flushing activity that takes place during micturition (urination) assists
in keeping pathogens away from the bladder.
The following chemical components of urine help defend against pathogens:
◗ antimicrobial peptides (AMPs) secreted by the cells lining the urinary tract to prevent binding of
bacteria to epithelial cells and lyse (or break down) bacterial cells
◗ pH of normal human urine within the range of 4.5 to 8, with an average of 5–6 (slightly acidic).
Phagocytes such as neutrophils work best when urine is alkaline. Doctors may prescribe urinary
alkalinisers for urinary tract infections.
Sebum and sweat
Sebum is an oily material secreted by sebaceous glands. Its purpose is to waterproof and lubricate the
skin. The pH of skin is normally around 5.5 (acidic), because of the presence of lactic acid, amino acids
and fatty acids in sweat and sebum. Lysozyme is secreted in perspiration and lyses or breaks down
bacterial cell walls (Fig. 11.16).
Saliva
Saliva is produced by the salivary glands. It is a complex mixture of water, mucus, electrolytes, enzymes
such as amylase, and antimicrobial substances such as lysozyme and immunoglobulin A (IgA). Saliva
has a flushing action against microbes as well as chemical activity against them due to antimicrobial
molecules contained within it, such as IgA and other antimicrobial peptides (AMPs).
9780170408851 CHAPTER 11 » RESPONSES TO PATHOGENS 383
11_bio_InFocus12_2e_sb_08851_txt.indd 383 08/08/18 7:24 pm
Tears
Lacrimal gland Lacrimal glands (Fig. 11.25) produce tears. The glands along the eyelid edges also
Excretory ducts secrete a sebum-like substance that contributes to the tears and has antimicrobial
properties. The production of tears is called lacrimation. This process produces a
Lacrimal duct tear film that covers the cornea and conjunctiva. Goblet cells in the conjunctival
epithelium secrete mucus, which helps distribute the film evenly.
The tear film contains the following chemical substances, which have
antimicrobial properties:
Naso-lacrimal sac ◗ lysozyme, lactoferrin, lipocalin
◗ AMPs
FIGURE 11.25 Anatomy of lacrimation: tears
◗ complement
are produced by the lacrimal gland, and drain ◗ IgA
via the lacrimal duct into the nasal cavity.
◗ mucins.
Gastric (stomach) secretions
The parietal cells lining the stomach (gastric) wall secrete hydrochloric acid. This creates highly acidic
environment (pH 1–2) in the stomach, which discourages the growth and survival of microbes. In addition,
the enzyme pepsin, secreted by the chief cells of the stomach wall, is thought to play an antimicrobial
role. However, many bacterial pathogens, such as E. coli, Salmonella typhimurium and Helicobacter pylori,
can circumvent the acidic conditions of the stomach by developing adaptive mechanisms that allow
these bacteria to survive in acidic environments. Also, the act of eating may raise the stomach's pH above
the threshold needed to destroy these bacteria. Therefore, these bacteria may survive acidic stomach
conditions and pass into the intestinal tract, where they can cause gastroenteritis.
As food moves from the stomach to the duodenum, there is a rapid change in pH to around 6. This is
due to the highly basic nature of bile released into the lumen of the duodenum. This is another limiting
factor to pathogen growth.
A summary of chemical barriers is shown in Figure 11.26.
FIGURE 11.26 The
first line of defence: Tears contain lysozymes.
barriers to the entry Nasal hairs and mucus
of pathogens trap pathogens.
Saliva contains
lysozymes to kill
pathogens.
Trachea with Acid in sweat
mucus and cilia.
Skin produces antibacterial
and antifungal substances.
Pathogens cannot penetrate
unless broken.
Harmless bacteria Acid in stomach
on the skin stop kills pathogens.
pathogens multiplying.
Microflora in large
intestine
Alkaline conditions
in small intestine
Acidic Urine is acidic.
conditions
in vagina.
384 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
11_bio_InFocus12_2e_sb_08851_txt.indd 384 08/08/18 7:24 pm
KEY CONCEPTS
● Chemical defences against infection form part of the body’s strategies to keep out pathogens.
● The antimicrobial substances in urine, as well as its pH, help create conditions that are
unfavourable for the growth of pathogens.
● Sebum, sweat, saliva and tears all contain antimicrobial substances.
● Gastric acid produces a low pH in the stomach, which inhibits the growth of most pathogens.
CHECK YOUR
1 Describe the mechanisms by which urine uses chemical defences against pathogens. UNDERSTANDING
2 Assess the claim that crying is a chemical response to the possible presence of a pathogen.
3 How does the stomach discourage the growth and survival of microbes? 11.2d
4 If the fatty acids in sebum are bacteriostatic, why do pimples occur? Research secondary sources to gather
and analyse the reasons for pimple formation.
5 Would people who regularly take antacids for reflux be at a greater risk of stomach infections due to the
alteration in stomach pH?
6 Animals commonly lick their wounds after an injury. Justify the use of this response strategy in terms of
chemical defence against the presence of pathogens.
Inflammation: a chemical response
Inflammation is a chemical response that helps wound repair and leads to pathogen destruction. The
five cardinal signs of the inflammatory response are (by their latin names):
◗ dolor – pain due to the release of chemical mediators of inflammation WS
◗ calor – heat due to the increase in microcirculation
Second line of
◗ rubor – redness associated with increased microcirculation defence
◗ tumor – swelling (oedema) as fluids move from the intravascular space to the extracellular space
◗ functio laesa – loss of function due to pain and swelling.
The inflammation response is a non-specific defence mechanism and occurs at the site of infection.
When the cells are challenged by pathogens or damaged in some way, they release chemical ‘alarm
signals’. These can be histamines (trigger vasodilation and increase vascular permeability), bradykinin,
serotonin and prostaglandins (associated with the pain and fever of inflammation). These chemicals
cause the capillaries to dilate, increasing the blood flow to the site of infection or injury and causing the
area to become red, hot and swollen, painful and sometimes less mobile.
These chemicals also increase the permeability of the blood vessels, which allows certain white blood Phagocytes are
cells to move from the blood into the tissues to attack the invading pathogens (Fig. 11.27). Phagocytes described in more
detail in Chapter 12.
are a special type of white blood cell. They include neutrophils, macrophages and dendritic cells. They
are attracted to the site of inflammation by the presence of chemicals known as chemotactic factors.
Chemicals that increase the body’s temperature are released (endogenous pyrogens). This inhibits the
growth of pathogens, inactivates some enzymes and toxins made by the pathogens, and increases the
rate at which the biochemical reactions occur in the body.
When the pathogens are destroyed, they are removed along with any toxins, and the tissues are
repaired.
The presence of a pathogen is not necessary for the body to respond to invasion. When damage
occurs to tissues but the wound is sterile, damage-associated molecular patterns (DAMPS) are released
by damaged cells. This sends a chemical signal to the surrounding tissue to initiate an inflammatory
response. Afterwards, cellular replacement to restore damaged tissue occurs.
9780170408851 CHAPTER 11 » RESPONSES TO PATHOGENS 385
11_bio_InFocus12_2e_sb_08851_txt.indd 385 08/08/18 7:24 pm
Bacteria
Chemical
alarm signals
Blood Phagocytes
vessel Bacteria engulfed
by phagocytes
FIGURE 11.27 The inflammatory response: chemical signals at the site of bacterial entry attract white blood cells.
Invading bacterium
Phagocytosis: a response to
chemical signalling
Phagocytosis is the process by which phagocytes
change their shape so they can surround a foreign
Phagocyte particle, such as a bacterium, and completely
enclose it (Fig. 11.28). Once the foreign particle is
inside the cell, enzymes are released to destroy it.
1 Phagocyte moves to
1 the bacterium. Phagocytes are specialised white blood cells
or leucocytes. The main types of phagocytes are:
◗ neutrophils
2 2 Phagocyte changes ◗ monocytes/macrophages
shape so it completely ◗ dendritic cells
encloses bacterium.
◗ natural killer cells.
Phagocytosis is not always successful, as
pathogens can sometimes repel the phagocytes
3 3 Lysosomes contain and may escape before being completely
destructive enzymes.
destroyed. In severe, overwhelming infections,
Lysosomes immature neutrophils show toxic changes (and
4 Enzymes are released
are referred to as ‘toxic neutrophils’) when seen
4
and destroy bacterium. in a blood smear. This is usually due to bacterial
toxins circulating in the blood (and is a sign of
septicaemia).
5 Harmless particles
5 are released from
phagocyte.
FIGURE 11.28 The process of phagocytosis
386 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
11_bio_InFocus12_2e_sb_08851_txt.indd 386 08/08/18 7:24 pm
Neutrophils
Science Photo Library/John Bavosi
Red blood cells
All phagocytic cells, including neutrophils (Fig. 11.29),
originate in the bone marrow. They are capable of
deforming and squeezing between the endothelial cells
lining the local capillaries, to move from the blood to
the tissues (a process known as diapedesis; Fig. 11.30).
Neutrophils are the first to move to the site of the infection
Neutrophil
to inactivate pathogens. Neutrophils are short acting and
then self-destruct after a few days. They are used by the
body to fight acute (short, severe) infections. An increase
in circulating neutrophils in the blood (neutrophilia) is
indicative of an active site of inflammation somewhere in Multilobed nucleus
the body. FIGURE 11.29 A neutrophil is a large white
It was once thought that neutrophils used substances blood cell with a multilobed nucleus.
such as peroxides in their vacuoles to destroy bacteria
and fungi. It is now known that a complicated series of electron and ion flows occur, with movement
of ions into the vacuole of the phagocyte, creating conditions that result in the death of microbes,
which are then digested by enzymes such as proteases.
FIGURE 11.30
Getty Images/iStock/ttsz
Diapedesis: migration
of a neutrophil
1 Flow through a capillary
2 3 wall
5
4
1 - Tethering
2 - Rolling
3 - Activation Bacteria
4 - Adhesion
5 - Migration
Monocytes
Monocytes circulate in the blood until attracted to inflamed tissue. They migrate through capillary walls to
the inflamed tissue, where they undergo a transformation into macrophages and dendritic cells (Fig. 11.31).
The name ‘macrophage’ derives from the Greek terms for ‘big eater’. Long-lasting phagocytes can
either stay in the tissues or travel from the blood vessels into the infected tissues. They are used by the
body to fight chronic (long-lasting) infections. After the macrophage has destroyed the foreign particle,
parts of the antigen are displayed on the surface of the macrophage (antigen presentation).
When damage occurs to tissues, monocytes are recruited to the tissue from the blood. On the surface
of monocytes are toll-like receptors (TLRs), which recognise specific pathogen-associated molecular
patterns (PAMPs) released from bacterial cells. Monocytes quickly differentiate into macrophages and
dendritic cells. They remove microbes, lipids and dying cells through the process of phagocytosis.
Dendritic cells also act as antigen-presenting cells. These dendritic cells, together with macrophages,
act as ‘bridges’ between the innate and adaptive immune systems. You will see why this is important
when you study the third line of defence. Interestingly, monocytes may also differentiate into
osteoclasts (‘bone breakers’), which are cells responsible for the maintenance, repair and remodelling
of bone.
9780170408851 CHAPTER 11 » RESPONSES TO PATHOGENS 387
11_bio_InFocus12_2e_sb_08851_txt.indd 387 08/08/18 7:24 pm
123RF/designua
Monocyte
Osteoclast
Dendritic cell
Macrophage
FIGURE 11.31 Monocytes are capable of transforming into three different cell types.
The complement system responds chemically to pathogens
The complement system is a group of around twenty soluble proteins that assist other defence
mechanisms (Fig. 11.32) in destroying extracellular pathogens. These complement proteins can
stimulate phagocytes to become more active, attract phagocytes to the site of the infection or destroy
the membranes of the invading pathogen.
Source: Adapted from Janeway CA Jr, Travers P, Walport M, et al. The complement
system and innate immunity. 'Immunobiology: The Immune System in Health and
Disease'. 5th edition.New York: Garland Science; 2001. Figure 2.7 'Schematic overivew
of the complement cascade'
Classical pathway MB-lectin pathway Alternative pathway
Lectin binding to pathogen
Antigen–antibody complex Pathogen surfaces
surfaces
Complement activation
Recruitment of Opsonisation Killing of
inflammatory cells of pathogens pathogens
FIGURE 11.32 The role of complement in responding to pathogens
388 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
11_bio_InFocus12_2e_sb_08851_txt.indd 388 08/08/18 7:25 pm
Complement proteins are manufactured in liver cells and macrophages. These proteins circulate
in the blood and are a part of the initial response to infection. During the third line of defence, some
pathogens bind to proteins in the blood called antibodies (Chapter 12). Complement proteins are
attracted to pathogen-antibody complexes and bind to them as well. A layer of complement proteins
now coats the antigen–antibody complex. This acts as a signal for phagocytes and other lymphocytes
called B cells (third line of defence) to destroy the pathogen. This enhancement of the process is called
opsonisation. Some complement proteins can ‘punch’ holes in microbial cell membranes, causing the
cell contents to leak out (Fig. 11.33). All these processes form part of the innate immune response to
pathogens. (This will be discussed in more detail in Chapter 12.)
FIGURE 11.33
Source: Austin Community College, 'Immune System -
Body Defences', Inflamatory Response.
Complement proteins puncture membrane. Complement
H2O and ions proteins can destroy
pathogens by
inserting themselves
into the membrane
of the pathogen,
creating a pore.
Water and ions Cell swells
enter cell. and lyses.
Pathogen Pore of membrane
attack complex
Fever: the role of pyrogens as a chemical response to pathogens
The hypothalamus is a part of the brain that contains a special cluster of cells responsible for regulating
body temperature. It acts like a thermostat to initiate responses to keep the body temperature within a
certain set range. Normal body temperature for humans is (on average) 37°C.
The body may react to pathogens by altering the hypothalamic set point of body temperature and
allowing the tissue to heat up. It does this by releasing ‘fever-causing’ chemicals known as pyrogens
(‘fire starters’) (Fig. 11.34). We experience this elevation in body temperature as a fever. The purpose of
a fever is to kill or limit the growth of pathogens. It may also enhance the activity of white blood cells
Regulation of body
and thereby strengthen the response to the presence of the pathogen. The scientific name for fever is temperature is dealt
pyrexia. Fever is usually accompanied by sweating, chills, muscle aches and general weakness. with in Chapter 14
FIGURE 11.34
Pyrogens are
Pyrogens and fever
produced by
Exogenous Endogenous
both pathogens
pyrogens pyrogens
and phagocytes,
Bacteria acting to raise the
Phagocytic
Viruses Interleukin I hypothalamic set
cells
Endotoxins point.
Lymphokines
Elevated
temperature Hypothalamus
set-point
Prostaglandin
derivatives
9780170408851 CHAPTER 11 » RESPONSES TO PATHOGENS 389
11_bio_InFocus12_2e_sb_08851_txt.indd 389 08/08/18 7:25 pm
INVESTIGATION 11.4
The effect of temperature on the viability of pathogens
Critical and Raising the temperature of the body is one response strategy to slow down or destroy pathogens. Fever is a
creative thinking complex series of interactions between the site of infection and the brain. Chemicals called pyrogens mediate
fever. In this activity, you will design a primary investigation to analyse the effect of increased temperature on
Information and
communication pathogen growth rates.
technology Growing pathogens at or near body temperature is a high-risk activity and therefore you will simply design
capability
an experiment that could be tested in a facility with the appropriate equipment and protocols to protect you
from biological hazards.
AIM
To design and plan an investigation in order to obtain primary and secondary data on the effect of increased
temperature on the growth rate of a named pathogen
HYPOTHESIS
Write a suitable hypothesis for your investigation.
METHOD
1 Choose a named pathogen (choose from bacteria, fungi, viruses, protozoa).
2 Write a method to test your hypothesis.
3 You may need to refer to online and printed secondary resources to gather information regarding how
these pathogens are cultured in a laboratory.
4 Think about how you will be able to expose the pathogens to a range of temperatures.
RESULTS
Design a results table to record your observations.
DISCUSSION
Analyse the possible links between this experiment and the role of fever in the body in response to the
presence of pathogens.
Although a temporary (around 2–3 days) and mild fever is a normal response to pathogen invasion,
very high fever for a prolonged period is a cue to seek further medical advice, as it may be a sign of
significant illness and elevated blood temperature in the brain can cause seizures. An unexplained fever
in a child, especially younger than three months, is cause for investigation by a doctor, particularly if the
child is listless, vomiting or unresponsive to eye contact.
Cytokines
WS Cytokines are chemical messengers that are produced during an infection and they promote the
development and differentiation of T and B lymphocytes for the third line of defence. One example is
Link between
cytokines, interleukin (IL). These chemicals form a link between the innate and adaptive immune systems.
inflammation and A burst of cytokines occurs as infected cells signal to nearby uninfected cells to also release
non-infectious
diseases cytokines. Interferons are another example of cytokines. They act as a chemical signal to viruses to
stop replicating. They do this by signalling to uninfected cells to destroy RNA and reduce protein
390 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
11_bio_InFocus12_2e_sb_08851_txt.indd 390 08/08/18 7:25 pm
synthesis (Fig. 11.35). Infected cells are also signalled to undergo apoptosis (programmed cell death).
Cytokines play a role in the feelings of lethargy, muscle pain and nausea that you experience if you
have an infection. The implication of this is that the animal isolates itself and rests, and is therefore
prevented from spreading the infection to other animals.
FIGURE 11.35
Source: OpenStax College, Innate Immune Response. October 17, 2013. Provided
by: OpenStax CNX. Located at: http://cnx.org/content/m44820/latest/
Figure_42_01_02.jpg. License: CC BY: Attribution
Signals neighbouring Cytokines are
uninfected cells to chemical signals
destroy RNA and reduce released by cells
Virus protein synthesis. in response to
pathogens.
Signals neighouring
infected cells to
undergo apoptosis.
Interferon
Activates
immune cells.
KEY CONCEPTS
● Inflammation is a response to the presence of pathogens in the tissues.
● Specialised cells and tissues use a series of chemical signals to identify and destroy pathogens.
● The signs of inflammation are mediated by chemical signals and include redness, heat,
swelling, pain and loss of function.
● Histamines, bradykinin, serotonin and prostaglandins are the chemical mediators of the signs
of inflammation.
● Chemical signals include the complement system, cytokines and PAMPs.
CHECK YOUR
1 How do the five cardinal signs of inflammation relate to a chemical response from the tissues and cells of UNDERSTANDING
an infected organism?
2 Describe how the process of phagocytosis destroys pathogens in response to a chemical signal. 11.2e
3 A blood smear from a young person with a fever is examined under a light microscope. The pathologist
sees elevated numbers of circulating neutrophils. Many of them appear toxic. Explain the presence of these
cells in the young person’s blood. What process is likely to be occurring?
4 Explain the presence of monocytes in an infected tissue sample, if monocytes circulate in the blood.
5 Explain the presence of complement proteins at the site of an infection.
6 Analyse the role of cytokines in the destruction of pathogens.
9780170408851 CHAPTER 11 » RESPONSES TO PATHOGENS 391
11_bio_InFocus12_2e_sb_08851_txt.indd 391 08/08/18 7:25 pm
11 CHAPTER SUMMARY
Responses to pathogens: How does a plant or animal respond to infection?
ORGANISATIONAL LEVELS OF THE BODY’S DEFENCES First line of defence
First line
Physical and chemical
barriers formed by tissues Epithelial
Innate (inherited tisues
and non-specific)
Second line
Inflammation: physical
and chemical
Body responses of cells Skin Sphincters
defences/
immune Cytokines
system
Physical barriers
Third line
Adaptive Immune response:
(acquired and specific) chemical responses
by cells
Tight
Peristalsis
junctions
RESPONSES BY PLANTS AGAINST PATHOGENS Mucus
Physical
barriers
Passive defences
Chemical
barriers
Plant Rapid active Second line of defence
defences responses
Inflammation
Delayed active
Active defences
responses A chemical response that helps wound repair
and leads to pathogen destruction. The five
cardinal signs of the inflammatory response:
Pathogen
recognition dolor (pain), calor (heat), rubor (redness), tumor
(swelling), function laesa (loss of function).
Phagocytosis
The process by which phagocytes change
shape and completely enclose a foreign
Pyrogens and fever particle, releasing enzymes to destroy it.
Exogenous Endogenous
pyrogens pyrogens The main types of phagocytes: neutrophils,
Bacteria monocytes/macrophages, dendritic cells,
Phagocytic natural killer cells.
Viruses Interleukin I
cells
Endotoxins
Lymphokines
Elevated
temperature Hypothalamus
set-point Fever
Pyrogens are fever-causing chemical. The
Prostaglandin
derivatives purpose of a fever is to kill or limit the growth
of pathogens
392 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
11_bio_InFocus12_2e_sb_08851_txt.indd 392 08/08/18 7:25 pm
TABLE 11.3 Cells involved in chemical and physical responses to infection by pathogens (lymphocytes are not included)
CELL TYPE CHARACTERISTICS LOCATION
Mast cell • Blood vessel dilation Connective tissues and mucous membranes
• Release of heparin and histamines
• Recruitment of neutrophils and macrophages
• Also involved in allergic reactions
Macrophage • Phagocytosis of pathogens and cancer cells Migrates from blood vessels into tissues
• Antigen-presenting cell
Natural killer cell • Kills tumour cells and virus-infected cells Circulates in blood and migrates into tissues
Dendritic cell • Antigen-presenting cell Epithelial tissues, including skin, lung and tissues of the
• Triggers adaptive immune response digestive tract. Migrates to lymph nodes upon activation
Monocyte • Differentiates into phagocytic cells such as Stored in spleen. Moves to infected tissues through
dendritic cells and macrophages blood vessels
Neutrophil • Most common white blood cell at site of trauma Migrates from blood vessels into tissues
or infection
• Releases toxins that kill or inhibit bacteria and fungi
• Recruits other immune cells to the site of infection
Basophil • Defence against parasites Circulates in blood and migrates to tissues
• Releases histamines that cause inflammation
• Responsible for some allergic reactions
Eosinophil • Releases toxins that kill bacteria and parasites Circulates in blood and migrates to tissues
Source: adapted from Lumen Learning Canada 2017, Boundless Biology, ‘Innate immune response’, https://courses.lumenlearning.com/boundless-biology/chapter/innate-immune-response/
CELLS INVOLVED IN CHEMICAL AND PHYSICAL
RESPONSES TO INFECTION BY PATHOGENS
An antigen is any molecule that the body recognises as
foreign and that triggers an immune response. Neutrophil Eosinophil Basophil Monocyte
TCell B Cell Natural killer Macrophage
COMPLEMENT ACTIVATION Classical pathway MB-lectin pathway Alternative pathway
Lectin binding to pathogen
The complement system is a group of proteins Antigen–antibody complex
surfaces
Pathogen surfaces
that assist other defence mechanisms in
destroying extracellular pathogens. They
stimulate phagocytes to become more active, Complement activation
attract phagocytes to the site of infection
or destroy the membranes of the invading
pathogen.
Recruitment of Opsonisation Killing of
inflammatory cells of pathogens pathogens
9780170408851 CHAPTER 11 » RESPONSES TO PATHOGENS 393
11_bio_InFocus12_2e_sb_08851_txt.indd 393 08/08/18 7:25 pm
11 CHAPTER REVIEW QUESTIONS Qz
Review quiz
1 Explain why both plant and pathogen factors are 11 The loss of microflora from the skin or gut can lead to ill
important in the development of disease in a plant. health. Explain why microflora are needed for good health.
2 Describe the ways in which plants use barriers as a passive 12 Describe the role of the skin as a barrier to infection.
defence against pathogens.
13 Explain the various mechanisms by which mucous
3 PAMPs are chemicals secreted by bacteria that alert a plant membranes prohibit entry of pathogens.
to the presence of that pathogen. How do plants respond
14 Explain why granulomas sometimes form in response to
to the presence of PAMPs?
the presence of a pathogen. Use a specific example of a
4 The active defences available to a plant are initiated when disease in which this occurs.
it is at grave risk of harm. Outline the three main strategies
15 Vomiting and diarrhoea are very unpleasant, but are
that plants use when passive barriers are breached.
extremely important strategies against infection. Outline
5 Compare the responses of plants and animals to the the role of these processes in the response of animal
presence of pathogens in terms of physical and chemical tissues to an infection.
strategies used when threatened with an infection.
16 Discuss some of the strategies used by an animal’s body to
6 Justify the practice of carefully disposing of plant material ensure one-way flow of materials. How does this reduce
after an experiment. the likelihood of infections?
7 Describe the organisation of the animal immune system 17 Outline the role of urine, sweat, tears and gastric juice as
into ‘lines of defence’. chemical barriers to infection.
8 Contrast the innate and adaptive immune systems. 18 In animals, a fever often develops in response to an
infection. What chemical signals are involved in this
9 Outline the way in which the cells of the immune system
process?
distinguish foreign molecules from ‘self’.
19 Outline the role played by the complement system in
10 Describe the usefulness of the lymphatic system in terms
response to the presence of pathogens.
of immune surveillance.
394 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
11_bio_InFocus12_2e_sb_08851_txt.indd 394 08/08/18 7:25 pm
12 Immunity
• investigate and model the innate and adaptive immune systems in the human body (ACSBL119)
INQUIRY
QUESTION • explain how the immune system responds after primary exposure to a pathogen, including innate and
acquired immunity
How does the human
immune system respond Biology Stage 6 Syllabus © NSW Education Standards Authority for and on behalf of the Crown in right of the State of New South Wales, 2017
to exposure to a
pathogen?
Getty Images/Steven Debenport
9780170408851 395
12_bio_InFocus12_2e_sb_08851_txt.indd 395 08/08/18 7:27 pm
We are surrounded by a sea of pathogens. Yet, for the
Shutterstock.com/enieni
most part, we do not spend our lives consistently infected
with disease. This is due to the integrated actions of the
innate and adaptive immune systems in the human body,
which work together to recognise and eliminate potential
WS
invaders. Scientists think the elements of our immune
system evolved around 500 million years ago, in jawed
Immunity vertebrates called gnathostomes.
The human
12.1
immune system
The human immune system is able to recognise patterns,
and to alert other cells and tissues when the patterns
are perceived as ‘non-self ’. It sets into motion a chain
FIGURE 12.1 We are surrounded by pathogens
of events aimed at eliminating infection. Many of the from a very early age.
mechanisms by which the innate and adaptive immune
systems communicate with each other are still not well understood. However, advances in molecular
biology are slowly revealing the complex ways in which these systems communicate to keep us safe
(Fig. 12.2). Host defence systems such as the innate and adaptive immune systems arose from the
harmful effects of pathogens acting as a selection pressure on organisms. The unique arrangement
and diversity of cellular responses in these two systems is found only in vertebrates with jaws.
FIGURE 12.2 The Pathogen Dendritic cell
creativecommons.org/licenses/by/4.0/)
Source: Royal Society Publishing, Philosophical Transactions of the Royal Society B, ‘Innate
immunity and adjuvants’, by Shizuo Akira, 5 Sep 2011, Figure 1. (CC BY 4.0) (https://
innate and adaptive Finding of
immune systems pathogen and (antigen-
communicate and initial attack presenting cell)
work together to
destroy pathogens.
The area of the
diagram shaded Neutrophil
green shows the
innate response and Natural killer cell Move from
the buff-coloured area Attack infected tissue
shows the adaptive Antigenic
peptide to lymph node
response. Macrophage
Innate immunity Antigen
Pathogen-specific attack presented
to T cell
Killer T cell
(cell immunity)
Helper T cell
B cell
Antibody B cell Adaptive immunity
(humoural immunity)
396 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
12_bio_InFocus12_2e_sb_08851_txt.indd 396 08/08/18 7:27 pm
As discussed in Chapter 11, the innate immune system provides a first and second line of defence
against pathogens, through such means as:
◗ physical barriers (e.g. skin)
◗ body fluids (e.g. urine, mucus)
◗ non-specific cellular responses (e.g. phagocytosis)
◗ non-specific biochemical responses (e.g. complement activation, endogenous pyrogens).
The innate immune response is genetically pre-programmed. With repeated exposure to the same
pathogen, the body responds in exactly the same way. This is present from birth and does not alter, except
in circumstances of poor health due to other problems. It involves no ‘learning ‘or ‘memory formation’
by the body.
The adaptive immune response is the next line of defence. It swings into action when the innate
immune response fails to clear the pathogen from the body. It is often referred to as the third line of
defence, or acquired immunity.
Adaptive immune response Attacks invaders
outside cells
Attacks invaders
inside cells
There are two ‘arms’ of the adaptive immune response.
◗ The humoral response is effective against pathogens in body fluids.
◗ The cell-mediated response is effective against intracellular pathogens.
The cells responsible for generating the adaptive immune response are
known as B and T lymphocytes (or B and T cells).
◗ Some B lymphocytes (B cells) develop into plasma cells, which produce
antibodies (also called immunoglobulins) against the pathogen. Antibodies B cell T cell
are protein molecules with a specific molecular structure that helps
FIGURE 12.3 B and T lymphocytes target
them to recognise and bind to specific pathogens. This is also known as different types of antigens.
the humoral response. The word ‘humor’ was
once used to describe the main fluids of the
body. The humoral response occurs in the
blood and tissue fluids of the body. PRIMARY EXPOSURE TO PATHOGEN (Cut to the finger)
◗ T lymphocytes (T cells) transform into Innate immune response: Fails to contain the pathogen.
cytotoxic T cells (also known as ‘killer’ T cells)
and seek out infected body cells, binding
to them and destroying them. This is also
known as the cell-mediated response.
Pathogens gain access to the bloodstream.
Figure 12.4 shows a possible scenario and
pathway for a pathogen as it breaches the body’s
defences.
The adaptive immune response to pathogens
is different from the first two lines of defence, in Bloodstream carries pathogen to distant sites,
including spleen and lymph tissues.
the following ways.
◗ It is specific.
◗ It involves a great diversity of
possible responses. Adaptive immune response: B and T lymphocytes in these organs respond
◗ It has memory. to the specific pathogen and generate responses to eliminate pathogen.
◗ It is capable of self-tolerance.
FIGURE 12.4 Initiation of the innate and adaptive immune systems
9780170408851 CHAPTER 12 » IMMUNITY 397
12_bio_InFocus12_2e_sb_08851_txt.indd 397 08/08/18 7:27 pm
Antigen with The specific response
3 epitopes
Antigens are components of bacteria, viruses, fungi, worms, tumour cells
and other non-cellular materials. Antigens are generally molecules made
of protein or polysaccharides found on cell membranes and in viral coats.
Antigen molecules have regions known as epitopes that can be recognised
by specific lymphocytes in the immune system. Particular lymphocytes
Antibodies recognise the specific chemistry of each epitope and can then target these
antigens. B and T lymphocytes have complementary antigen binding sites,
known as antigen receptors, on their cell membranes. Epitopes may be
bound by cell receptors on B and T lymphocytes or by free antibodies in the
extracellular fluid (Fig. 12.5).
FIGURE 12.5 An antigen–antibody complex Antibodies are Y-shaped molecules that consist of four chains of protein –
two larger heavy chains and two smaller light chains (Fig. 12.6). There are
five types of heavy chains, which gives the five classes of antibodies: IgA, IgE,
Antigen-binding sites
Shutterstock.com/Soleil Nordic
IgG, IgM and IgD. A specific region of the molecule serves as a binding site for
antigens via the epitopes.
An antibody molecule has two binding sites. Each antigen-binding site is
Hinge region specific for a particular antigen. Pathogens may have several different epitopes
on their surface that will bind to different antibodies. When antibodies and
antigens bind, the resulting molecule is known as an antigen–antibody
Light chain complex.
B cell membrane antigen receptors have the same affinity for a specific
pathogen as the antibodies that this cell will secrete once it is transformed
into a plasma cell. T cell receptors are surface proteins but their structure is
Heavy chain unlike that of antibodies. They are not secreted from T cells but remain bound
to the cell membrane.
Diversity of pathogens
T and B cells have thousands of antigen receptors on their cell membranes. For
FIGURE 12.6 General structure of an antibody
a single T or B cell, however, each of the receptors is capable of recognising only
one of the millions of possible antigens in the world. However, each B and T cell
is different. Therefore, even though each B or T cell shows specificity, there are
millions of combinations of receptor types available to the human immune system. The combinations
are determined by a person’s genes and so are programmed from birth. Your adaptive immune system is
primed and ready to respond to millions of antigens it has not yet seen and may never see.
The clonal selection theory states that all the B cells for all the possible antigens are already present
in very small amounts in the immune system at birth. This is an astounding concept when you consider
the number and variety of things in the world that the body could perceive as ‘non-self ’. Antigens are
recognised as ‘non-self ’. When an antigen is present in the body, the B cell that is specific for that
antigen is activated, and then cloned. Once the antigen is destroyed, these cloned B cells remain, ready
for the next time this specific antigen presents itself to the body – they become memory cells. Think of
an army that has been shown an image of the enemy, and now lies in wait for that enemy to approach.
It is primed and ready to respond. It has ‘adapted’.
This explains why the adaptive immune response is so specific. If a particular cold virus enters your
body, only the B and T cells that recognise that pathogen will respond to it.
398 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
12_bio_InFocus12_2e_sb_08851_txt.indd 398 08/08/18 7:27 pm
Primary immune response
When the adaptive immune system is first exposed to a pathogen, the response by the B and T lymphocytes
MHC molecules
is referred to as a primary immune response (primary refers to ‘first’). Antibody-producing plasma cells are explained on
and cytotoxic T cells are produced, and these work to clear the infection. The body stores these pre-made page 405.
cells for the next time it encounters the same pathogen. The person will possibly now be immune to
infection by this pathogen. This immunity is therefore acquired or adaptive.
A bacterium with antigens on its surface invades the body.
Bacterium
Antigen
An immature B lymphocyte with a specific antibody on its membrane
recognises the antigen.
MHC
molecule The immature B lymphocyte encounters the specific antigen
Membrane-bound recognised by its antibody. The antigen and antibody bond and form
antibody (receptor an antigen–antibody complex. This is assisted by cytokines and
for specific antigen) signalling provided by TH lymphocytes that recognise the antigen–MHC
complex.
Antigen– In the diagram, the B cell has internalised the antigen and
MHC re-presented it on the MHC molecule, to then be presented to a
Antigen–antibody complex helper T cell. It is then that B cell activation occurs.
complex
Many divisions A series of reactions occur and the activated B lymphocyte divides
many times. This is assisted by cytokines from TH lymphocytes.
Circulating antibodies
Some of the activated B lymphocyte clones become plasma cells that
attack bacteria with
produce and secrete large amounts of antibody molecules that help
antigen.
to destroy the pathogen. Others can become memory B cells.
Plasma B Memory B lymphocytes
lymphocytes (move to lymph nodes)
FIGURE 12.7 B cells for all possible antigens pre-exist in the body and are cloned when exposed to that specific pathogen. This is how
‘memory’ of an antigen is formed (MHC: major histocompatiblity complex; TH: helper T cell).
This response is fairly fast but is short lived. The total number
Relative concentration of antibody in blood
First exposure Second and subsequent
of antibodies produced in this initial response is less than for to antigen exposure to the same antigen
subsequent infections. When the adaptive immune system is
exposed to the same pathogen on subsequent occasions, there
is a more rapid response and the production of antibodies is
much greater. This is also referred to as a secondary immune
response. This is the reason that booster vaccinations are often
Secondary
recommended for various diseases. The secondary immune Primary response
response comes about because of the existence of memory T response
and B cells that were produced in the first infection with the
pathogen.
1 2 3 4 5 6 7 8 9 10
Time (weeks)
FIGURE 12.8 The primary and secondary immune responses
9780170408851 CHAPTER 12 » IMMUNITY 399
12_bio_InFocus12_2e_sb_08851_txt.indd 399 08/08/18 7:27 pm
Do no harm
Fortunately, despite the fact that a person’s immune system is genetically pre-programmed to respond to
millions of possible antigens, it does not normally react to the tissues of that person. How is this achieved?
When you go to school, you learn about the various rules and regulations of society that help
everyone live and work safely. In your school, rules and boundaries are established to keep everyone
safe and provide a comfortable learning environment. It is not acceptable for individuals to turn against
and harm those with whom they share a school, workplace or city. B and T cells also have a period
in which they are ‘in school’. They must learn not to harm the body in which they have developed.
When they start to mature in the bone marrow (B cells) and thymus gland (T cells) they are examined
for possible tendencies to cause harm to the body. Cells that have a genetic tendency to identify self-
molecules as foreign are identified and neutralised, so they never get to mature and cause harm to the
body. The only lymphocytes that remain are those that are capable of reacting to ‘other’ and not to ‘self ’.
Scientists think that autoimmune diseases may occur when this process has not been fully effective.
KEY CONCEPTS
● The innate and adaptive immune systems defend an organism against invasion by pathogens.
● The innate immune system is genetically programmed and present at birth. It consists of non-
specific chemical and physical barriers as well as chemical and cellular responses to pathogens.
● The adaptive immune system responds to pathogens that have evaded the innate immune system.
● The adaptive immune system responds to specific pathogens, is capable of responding to a
diverse array of pathogens, remembers a primary response for future threats by the same
pathogen, and tolerates the host’s own cells.
CHECK YOUR 1 By what four general means does the innate immune system respond to pathogens?
UNDERSTANDING
2 When the innate immune response is ineffective, which immune response swings into action?
12.1a 3 Identify the four main features of the adaptive immune response on primary exposure to a pathogen.
4 Which two cell types are responsible for the adaptive immune response? Outline the role of each of these
cell types.
5 Outline the ways in which the responses of the adaptive immune system towards pathogens:
a are specific
b are diverse
c remember and tolerate ‘self’.
6 Distinguish between a primary and a secondary response to pathogens by the adaptive immune system.
7 Use your understanding of the humoral immune response to justify the shape of the curve in Figure 12.8.
The humoral response to pathogens in body fluids
After primary exposure to a pathogen that is outside the body cells (extracellular pathogen), the adaptive
immune response has strategies to target and inactivate the pathogen – this is the humoral immune response.
B lymphocytes are the cells primarily responsible for the adaptive immune response outside cells.
Mature B lymphocytes are stored in lymph nodes and peripheral lymphoid tissues, and circulate in the
blood. Lymph nodes are special glands located at key points around the body where tissue fluids drain
from major sites (Fig. 11.13).
Helper T cells release substances such as cytokines that are involved in the activation of B cells. Two
adaptive responses follow (Fig. 12.9).
1 The B cell multiplies, making many copies of itself with the same specificity as the original B cell.
2 These B cells differentiate into two possible cell types:
– plasma cells – short-lived antibody ‘factories’ or effector cells (secrete up to 2000 molecules/second)
– memory cells – long-lived and stored for subsequent infections.
400 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
12_bio_InFocus12_2e_sb_08851_txt.indd 400 08/08/18 7:27 pm
8918-eaa58b977963@4. Licensed under a Creative Commons Attribution License 3.0. (CC BY 3.0) (https://creativecommons.org/licenses/by/3.0/)
© 20 Jun 2013 OpenStax, Rice University. The Adaptive Immune Response: B-lymphocytes and Antibodies. http://cnx.org/contents/018e7fef-252c-44f3-
Primary response Secondary response
Clone of Memory
ancestral B cell
Memory cell
B cell
Activated
B cell
Antigen
Antigen bound
to receptor
Antibody
Formation molecule
of clones Plasma
Plasma
cell
cell
FIGURE 12.9 The two possible fates of activated B lymphocytes
B lymphocytes
When protein-containing antigens are present, specific T cells, called helper T cells, are activated when
they bind to the antigen. The T cells release special molecules known as cytokines. Examples of cytokines
include the molecule interleukin-2 (IL-2). When B lymphocytes are exposed to IL-2, they proliferate and
differentiate into memory cells and plasma cells (Fig. 12.10).
FIGURE 12.10 T-helper
Source: Pranzatelli MR, The
immunopharmacology of the opsoclonus-
myoclonus syndrome. Clinical
Neuropharmacology 19(1): 1-47, 1996
Activated T cells assist
in the activation and Th
transformation of
B cells into plasma Plasma Cytokines Activated
cells. cell T cell
Ts
T-suppressor
Antibodies
9780170408851 CHAPTER 12 » IMMUNITY 401
12_bio_InFocus12_2e_sb_08851_txt.indd 401 08/08/18 7:27 pm
Not all antigens promote the production of memory cells. Some bacteria have antigens composed of
long polysaccharide chains (not protein), which bind directly to B lymphocytes, causing them to multiply
and differentiate into plasma cells. However, no memory cells are made in this process. These kinds of
antigens are known as thymus-independent antigens.
Antibodies
Antibodies are molecules produced by plasma cells in response to exposure from a specific pathogen.
However, not all antibodies are the same, and nor are they found in equal concentrations around
the body.
WS
There are five classes of antibodies, also known as immunoglobulins (Ig). Table 12.1 summarises
Antibodies their features.
TABLE 12.1 The five classes of antibodies (immunoglobulins)
NAME PROPERTIES STRUCTURE
IgA Found in mucus, saliva, tears and breast milk.
Protects against pathogens.
IgD Part of the B cell receptor. Activates basophils
and mast cells.
IgE Protects against parasitic worms. Responsible
for allergic reactions.
IgG Secreted by plasma cells in the blood. Able to
cross the placenta into the foetus.
IgM May be attached to the surface of a B cell or
secreted into the blood. Responsible for early
stages of immunity.
(Source: Molnar C. & Gair J. 2013, ‘Concepts of biology’, 1st Canadian edition, Table 23.23, Gunness, PC Faculty Pressbooks Sites, https://pressbooks.bccampus.ca/
conceptsofbiologygunness/chapter/23-3-antibodies/)
402 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
12_bio_InFocus12_2e_sb_08851_txt.indd 402 08/08/18 7:27 pm
The different classes of antibodies act in different ways to neutralise a pathogen. There are five
strategies that antibodies can use to ensure that a pathogen is stopped from harming the host. The
first two ways are common to all antibodies; the final three ways are special strategies used by specific
antibody classes.
1 Neutralisation – antibodies bind to and coat pathogens, blocking their activity (Fig. 12.11a).
2 Agglutination – neutralised pathogens clump together and are surrounded by thousands of antibodies
(Fig. 12.11b).
3 Precipitation of dissolved antigens.
4 Activation of the complement system, leading to lysis of infected cells (Fig. 12.11c).
5 Opsonisation – enhanced phagocytosis by natural killer cells (NK cells) (Fig. 12.11d).
a Antigen Neutralisation b Agglutination
(toxin) Host cell
Antibody
Antigen
Pathogen
Pathogens become trapped in a
Bound antibodies block antigens from network of antibodies, making them
binding to other targets. In this case, immobile and susceptible to destruction.
the antibodies prevent toxins from
destroying a cell.
c Complement activation d Opsonisation
Complement
proteins
Phagocyte
Bound antibodies ‘tag’ pathogens
Bound antibodies activate a
for destruction, making it easier
cascade of complement proteins.
for phagocytes to locate them.
FIGURE 12.11 Four ways in which antibodies destroy pathogens: a neutralisation; b agglutination; c complement
activation and d opsonisation
KEY CONCEPTS
● The humoral immune system is a branch of the adaptive immune response that targets
pathogens in body fluids.
● The main type of cell involved in the humoral immune system is the B lymphocyte, which
develops and matures in the bone marrow.
● Mature B lymphocytes are stored in lymph nodes and circulate in the blood.
● B cells respond to pathogens by differentiating into memory cells and antibody-producing
plasma cells.
● Antibodies deal with pathogens through neutralisation, agglutination, precipitation,
complement activation and opsonisation of phagocytes.
9780170408851 CHAPTER 12 » IMMUNITY 403
12_bio_InFocus12_2e_sb_08851_txt.indd 403 08/08/18 7:27 pm
CHECK YOUR
1 Justify the need for the immune system to take a different approach to the elimination of extracellular
UNDERSTANDING
versus intracellular pathogens.
12.1b 2 Describe the two possible pathways that B cells may take upon exposure to an extracellular pathogen.
3 Explain the ways in which antibodies can respond to the presence of an extracellular pathogen.
4 What advantages does an antibody-mediated response give to a host organism over life forms that rely on
the innate immune system alone?
5 Using your knowledge of the chemical nature of antibodies, infer the possible effects of a protein
deficiency in a human due to disease or malnutrition.
The cell-mediated response to intracellular pathogens
The adaptive immune system has another branch, responsible for the elimination of pathogens located
inside host cells (intracellular pathogens). Because antibodies (which function in the humoral response)
have no direct access to these pathogens, another strategy is required to ensure the pathogen is
destroyed. This is known as cell-mediated immunity, where special types of T lymphocytes target and
destroy the entire infected host cell, along with the pathogens inside them. The process of cell-mediated
immunity relies on the action of T lymphocytes.
T lymphocytes make direct contact with infected cells via special receptors, and can also identify
tumour cells and destroy them. This is why their particular response is known as the cell-mediated
immune response (Fig. 12.12).
T lymphocytes control cell-mediated immunity, which is effective in defending the body against:
◗ protozoa, bacteria and viruses that are inside the host’s body cells
◗ macroparasites such as fungi, flatworms and roundworms (despite the fact that they are not
intracellular parasites)
◗ cancer cells and transplanted tissues (e.g. in a person who has had a kidney or lung transplant).
Antigen-MHCII
Shutterstock.com/Designua
complex on
Infected macrophage
cell
Memory
T cell
Macrophage Helper
T cell Cytokines
Killer
T cell
Cell
Receptor
dead
T cell clones
Mitosis become cytotoxic
Cytokines (killer) T cells
Antigen-MHCI
complex on
infected cell
Infected cell
FIGURE 12.12 The cell-mediated immune response
404 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
12_bio_InFocus12_2e_sb_08851_txt.indd 404 08/08/18 7:27 pm
T cells and MHC molecules
In the previous section, you learned that antibodies bind to the epitopes of pathogens in their natural
form. However, T cells recognise fragments of antigens only. These may be antigens that have been
party digested by macrophages (Fig. 12.13) or antigens partly digested by invaded cells. The partly
digested antigens are carried to and displayed on the cell surface by special protein molecules called
major histocompatibility complex molecules (MHC).
MHC molecules are the ‘self-identity’ molecules of organisms. There are over a hundred genes
that code for an individual’s MHC marker molecules. Each person has a different set of MHC marker
molecules on their cells. These molecules have a binding site for a specific antigen. There are two classes
of MHC molecules:
◗ MHCI – in every nucleated cell in vertebrates (including platelets, but excluding red blood cells,
which do not have a nucleus). Infected cells represent a fragment of antigen bound to an MHCI
molecule.
◗ MHCII – in antigen-presenting cells such as macrophages, dendritic cells and activated B cells.
Macrophages present a fragment of the antigen bound to an MHC II molecule. This is termed an
antigen-MHCII complex (Fig. 12.12).
T lymphocytes are produced in the primary lymphoid tissue of the bone marrow and mature in the
thymus gland, which is situated in the thoracic (chest) cavity. After they mature, the T cells are released
into the blood, and migrate to the spleen, tonsils, Peyer’s patches of the intestines and lymph nodes
(Fig. 11.13, page 374). The four main types of T cells (summarised in Fig. 12.13) are described below.
T cells
Helper T cells Cytotoxic T cells Memory T cells Suppressor T cells
release chemicals that activate move to the site of infection remain in the body to respond suppress the immune
the cloning of cytotoxic T cells and release chemicals that to future infections by the response when the infection
and B cells and increase destroy infected cells same antigens has been defeated
macrophage activity after the
antigen has been recognised
FIGURE 12.13 Types of T cells and their roles
Helper T cells
Helper T cells have a surface protein receptor that recognises the MHCII molecules bound to an antigen
fragment on the surface of phagocytes (‘antigen-presenting cells’) (Fig. 12.12). The helper T cells are
activated to secrete cytokines, such as IL-2 (interleukin-2), which activate both the cell-mediated and
humoral responses. IL-2 activates cytotoxic T cells and B cells that are specific for this antigen. In this way,
helper T cells are the ‘bridge’ between the two arms of the adaptive immune response. Other cytokines
that stimulate the activity of macrophages are also released by the helper T cells.
Cytotoxic T cells (Tc cells)
Cytotoxic T cells are activated by helper T cells and respond by producing many copies (clones) of
themselves. In this way, they form an ‘army’ of identical killer cells that move to the site of infection,
bind with the infected cells and release chemicals (cytokines) that destroy the infected cell. Cytotoxic
T cells use their surface receptor to recognise the MHCI–antigen complex (Fig. 12.12) typical of cells
9780170408851 CHAPTER 12 » IMMUNITY 405
12_bio_InFocus12_2e_sb_08851_txt.indd 405 08/08/18 7:27 pm
that have been infected by a virus. Through a series
Antigen-presenting macrophage of reactions, the cytotoxic T cell is able to then kill
moves to the lymph nodes.
the infected cell. This involves the production of
cytokines, which cause lysis of the infected cell.
Activates helper T cell with T cell receptor
that matches the antigen. Suppressor T cells and memory T cells
Suppressor T cells (Ts cells) are responsible for
stopping the adaptive response when the infection has
Activates T cells to clone many copies been defeated. Memory cells – all T cells make clones
that are specific to the antigen. of themselves that remain in the body to respond to
future exposure from pathogens.
Most cells become Some cells become Summary of cell mediated immunity
cytotoxic T cells memory T cells
The process of cell-mediated immunity is carried
out by T cells. (See the flow chart in Fig 12.14, the
Cytotoxic T cells Memory T cells summary below and the visual representation in
migrate to the site of remain in the body Fig 12.16.)
the infection
1 Foreign material is engulfed by macrophages,
which then display the antigen attached to their
MHCII molecules.
These cells attach to When re-exposed to
infected cell and the same antigen, 2 The antigen-presenting macrophages move to
release chemicals these cells rapidly
that destroy the cell produce many the lymph nodes, where they are inspected by
and pathogens copies of the same helper T cells that have the T cell receptor that
within it. cytotoxic T cells.
corresponds to the antigen being presented.
3 These helper T cells then activate the cloning of
Also release chemicals that: millions of cytotoxic T cells and memory T cells
that are specific for this antigen.
4 The cytotoxic T cells leave the lymph nodes and
Increase Stimulate
inflammation phagocytosis migrate to the site of the infection, where their
antigen receptors bind with the antigen displayed
FIGURE 12.14 Steps in the process of cell-mediated immunity on the infected cell.
5 These T cells then release chemicals that destroy
the cell and any pathogens within it.
6 These chemicals also increase the inflammation and attract more macrophages, which carry out
phagocytosis to help destroy the pathogens and clear up any debris.
7 Some of the cytotoxic T cells produce a chemical, called interferon, which protects the healthy cells
around an infected cell from viral invasion.
8 Once the infection has been defeated, the suppressor T cells release other chemicals to stop the
production and action of the cytotoxic T cells.
9 The memory T cells that are produced at the time and are specific to that particular antigen remain
in the body, in the lymph nodes. On re-exposure to the same antigen-containing pathogen, they cause
the rapid production of more of the same cytotoxic T cells. This prevents the body from developing
the symptoms of the disease again.
406 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
12_bio_InFocus12_2e_sb_08851_txt.indd 406 08/08/18 7:27 pm
KEY CONCEPTS
● The cell-mediated immune system is a branch of the adaptive immune response that targets
pathogens inside infected cells as well as tumour cells.
● The main cell involved is the T lymphocyte, which develops in the bone marrow and matures in
the thymus.
● Mature T lymphocytes are present in the blood, spleen, tonsils, Peyer’s patches and lymph nodes.
● There are four main types of T lymphocytes.
– Helper T cells activate the cloning of cytotoxic T cells as well as B cells.
– Cytotoxic T cells bind with pathogen-infected cells and destroy them.
– Memory T cells remain in the body to respond to future infections.
– Suppressor T cells suppress the response once pathogens have been eliminated.
1 Evaluate the importance of the placement of lymph node sites around the body.
CHECK YOUR
UNDERSTANDING
2 Why is an alternative strategy to antibody production needed for the elimination of intracellular
pathogens? 12.1c
3 Which lymphocyte provides a common link between the two arms of the adaptive immune system?
Describe its role in responses to intracellular and extracellular pathogens.
4 Which types of pathogens/cells are most likely to trigger a cell-mediated response?
5 Outline the role of MHC molecules in the activity of cytotoxic T cells.
6 Suggest the consequences of a lack of activity by suppressor T cells. Use online resources to investigate
whether there are any known diseases where this is a problem.
7 Glucocorticoids are a class of drugs that are used to suppress various allergic and inflammatory conditions.
They supress both humoral and cell-mediated responses. What must a doctor consider before placing a
patient on a course of this medication? What are some possible consequences of long-term use?
Interaction of B and T cells in the adaptive immune system
As you learned in the previous section, when a macrophage encounters
Science Photo Library/Russell Kightley
a foreign particle with an antigen attached to its surface, it surrounds
and engulfs it, in the process of phagocytosis (Fig. 12.15). In the course
of destroying the foreign material, the antigen that was present on
its surface is moved to the surface of the macrophage, which then
transports it to the lymph nodes.
The antigen-presenting macrophage is then presented to the helper
T cell that has the T cell receptor corresponding to that particular
antigen. This has the effect of activating the helper T cell.
The helper T cell can also be activated by B cells. When a B cell
encounters the antigen that corresponds to its surface antibodies,
it binds its antigens to its antibodies. It then processes the antigen,
attaches it to its surface molecules and presents this to the helper
T cells that have the matching T cell receptors.
FIGURE 12.15 A macrophage (green) engulfing
bacteria (yellow) by the process of phagocytosis
WS
Chemical
mediators and
receptors of the
immune response
9780170408851 CHAPTER 12 » IMMUNITY 407
12_bio_InFocus12_2e_sb_08851_txt.indd 407 08/08/18 7:27 pm
Chemical signals in the form of cytokines are then secreted by the helper T cell to activate more of the
same helper T cells and also macrophages. A specific cytokine chemical (interleukin-2) produced by the
helper T cell activates the production of clones of the B cells that are specific to that antigen.
Interleukin-2 also activates the production of clones of the cytotoxic T cells that have that particular
antigen receptor on their surface (Fig. 12.16).
When the immune response has successfully defeated the infection, suppressor T cells are responsible
for suppressing the activity of the B cells and cytotoxic T cells.
Macrophage Invading micro-organisms
Destroys with antigens on surface Antigen
micro-organism
Antibody
Antigens
Macrophage
Processed B cell
MHCII
molecule antigen
Antigen
displayed
B cell after antigen
T cell
processed
receptor
T cell
receptor
MHCII
Activated molecule
helper T cell
ed -2
In
cr k in
te
r l e e te
se leu
se
uk d
et
cr
r
te
in
In
-2
Memory T cells Memory B cells
Cytotoxic T cells Activated B cells
specific for antigen
Infected cells produced Cytotoxic Plasma cells
T cells
Secrete antibodies
specific for antigen
Antigen
receptors
MHCI Antigen
molecule displayed
Cytotoxic T cells join with antigen Pathogen inactivated
on the surface of the infected cells and marked for destruction
and release chemicals to destroy them. by phagocytes
Antigens inactivated
FIGURE 12.16 The immune response, showing interactions between B cells and T cells
408 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
12_bio_InFocus12_2e_sb_08851_txt.indd 408 08/08/18 7:27 pm
INVESTIGATION 12.1
A secondary source investigation into chemical signalling between
the innate and adaptive immune systems
In the past 10 years, there has been great progress in understanding the ways in which the immune system Information and
communication
detects and responds to the presence of pathogens, as well as the ways in which the innate and adaptive technology
immune systems communicate with each other. Communication between these two parts of the immune capability
system is vital to an effective and coordinated response. Literacy
The mediators of the immune response generally act by the binding of molecules to surface receptors
on host cells and pathogens. Others may have direct enzymatic effect or be directly toxic. The binding of a
molecule to a receptor is a stimulus that elicits a response from a cell.
AIMS
1 To gather and process information on the ways in which cells of the innate and adaptive immune systems
communicate with each other
2 To evaluate the importance of understanding chemical signals in the management of infectious disease
METHOD
1 Use a number of sources to research the following chemical mediators/receptors of the immune response:
a cytokines (e.g. interleukins, chemokines)
b complement proteins
c histamine
d prostaglandins
e leukotrienes
f PAMPs (pathogen-associated molecular patterns)
g TLRs (toll-like receptors)
h PRRs (pattern recognition receptors).
When using a search engine, insert key words such as ‘chemical mediators of inflammation’ or simply the
names of the molecules above.
2 Create a table to summarise your findings, including the following features:
a name of the chemical mediator or receptor
b its chemical nature (e.g. protein, lipid)
c its role in the response to pathogens.
3 Construct simple diagrams (using Word or other programs) to show how each of these features fits into the
overall response to pathogen.
4 Prepare a references list to cite all your sources (page 27).
DISCUSSION
Evaluate the importance of understanding the chemical responses to pathogens. Of what benefit might this
be to a scientist wishing to understand how to better manage an infectious disease? Justify this using an
example of an infectious disease.
CONCLUSION
Write a summary sentence to evaluate the overall usefulness of understanding the chemical responses to
infection.
9780170408851 CHAPTER 12 » IMMUNITY 409
12_bio_InFocus12_2e_sb_08851_txt.indd 409 08/08/18 7:27 pm
INVESTIGATION 12.2
A practical investigation using the light microscope to examine
the cells and tissues of the innate and adaptive immune systems
AIMS
Ethical 1 To design and perform an investigation in order to obtain primary data on the structure and sizes of cells
understanding
and tissues involved in the innate and adaptive immune systems
Personal and 2 To assess and manage the risks involved in the use of appropriate technologies and biological materials
social capability
EQUIPMENT
Work and
enterprise • light microscope
• prepared slides of human blood smears, or images of these
• slides of human skin, sweat glands, lymph nodes, respiratory or intestinal epithelium, mucosa of the
Refer to Physics stomach, or images of these
in Focus Year 11,
Chapter 2 to revise • if available, prepared slides of pathogen-infected human tissues or images of these
how to use a light • pencil and A4 paper
microscope.
• phone camera to take photos of slides under microscope
• if available, digital microscope to project images of blood smears
RISK ASSESSMENT
• Use commercially prepared microscope slides of blood, to avoid the risk of biological contamination.
• Prepare a risk assessment table outlining safety precautions when using a light microscope.
METHOD
1 Review the correct technique for focusing an image under the light microscope. Evaluate your own
technique and that of your peers as you proceed through this activity.
2 Place the tissue sample slide on the stage of the microscope and focus on low power.
3 Rotate to high power. Some sample images are provided on the next page, to help guide you in identifying the
structures.
a goblet cells in respiratory and intestinal epithelium (Fig. 12.17)
b stratified squamous epithelium of the skin (Fig. 12.18)
c sweat and sebaceous glands in the skin (Fig. 12.19)
d gastric glands (acid producers) in the epithelium of the stomach (Fig. 12.20).
4 Use the images in figures 12.18 to 12.20 to help you identify a selection of structures that play a role in the
innate immune system.
5 Record your observations in a table like the one in the Results section.
6 Place the blood smear slide on the microscope stage and focus on low power.
7 Use the images in figures 12.21 to 12.23 to help you identify a selection of structures that play a role in the
innate and adaptive immune systems.
410 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
12_bio_InFocus12_2e_sb_08851_txt.indd 410 08/08/18 7:27 pm
Science Photo Library/Herve Conge, ISM
Getty Images/iStock/Jose Luis Calvo Martin &
Jose Enrique Garcia-Maurino Muzquiz
Epithelial cells Epidermal cells
(stratified squamous
epithelium)
Goblet cell
FIGURE 12.18 The epidermis consists of a
waterproof external keratin layer as well as
FIGURE 12.17 Goblet cells secrete mucus to trap pathogens that many layers of cells. This acts as a physical
enter airways. barrier to pathogens.
Stomach H & E Secretory sheath
Science Photo Library/Microscape
Getty Images/Microscape/Science Photo
Epidermis
Gastric pits
Hair follicle
Dermis
Sebaceous
gland Gastric glands
Fat in hypodermis
Hypodermis Muscular mucosae
FIGURE 12.19 Oil and sweat both contain antimicrobial FIGURE 12.20 Stomach acid is produced by parietal cells. Acid is a
agents that form a chemical barrier to pathogens. chemical barrier to pathogens.
9780170408851 CHAPTER 12 » IMMUNITY 411
12_bio_InFocus12_2e_sb_08851_txt.indd 411 08/08/18 7:27 pm
8 Record your observations in your table.
Some sample images of the structures are provided in Figures 12.21 to 12.23. Use these to help guide you
in identifying the different blood cells.
a Innate immune system:
i neutrophils
ii eosinophils
iii basophils
iv monocytes/lymphocytes
b Adaptive immune system:
i lymphocytes (B and T cells look the same under a light microscope)
ii plasma cells (Fig. 12.23).
9 Use secondary online and printed resources to research the role of each of these types of cells and tissues
in the innate and adaptive immune response to pathogens.
Granulocytes
Getty Images/iStock/toonishwarhead
Monocyte
Science Photo Library/Steve Gschmeissner
Lymphocyte
Basophil Eosinophil
Eosinophil
Neutrophil
Neutrophil
Monocyte
FIGURE 12.21 Different types of white blood cells that
are involved in the innate response to pathogens. Each is
chemically attracted to sites of inflammation and plays a FIGURE 12.22 Blood smear showing red blood cells and different
role in destruction of pathogens. types of white blood cells
Shutterstock.com/LindseyRN
Plasma cells
FIGURE 12.23 Plasma cells are antibody-producing ‘factories’ and
play a major role in the adaptive immune response.
412 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
12_bio_InFocus12_2e_sb_08851_txt.indd 412 09/08/18 9:24 am
RESULTS
Construct a table like the one below to record your observations.
RESPONSE ON PRIMARY
CELL OR TISSUE TYPE DESCRIPTION DIAGRAM OR PHOTO EXPOSURE TO A PATHOGEN
DISCUSSION
1 Describe some of the distinguishing features of the different cells involved in the innate and adaptive
immune responses to pathogens.
2 Are cells and tissues actually coloured? Obtain some information from online and printed sources
regarding two staining techniques that are used to help make these cells and tissues clearer – for example,
Gram stain, H&E stain. Use a table to record their chemical nature and uses.
3 Imagine that you are a Biology teacher and you have been given the task of assembling a box of slides that
represents a wide selection of cells and tissues involved in the innate and adaptive responses to pathogens.
List some of the slides you would like to have in your collection. You may need to refer to other chapters in
this book as a guide.
4 Which aspects of your microscope technique do you find most difficult? In what ways could you improve
your approach to focusing a microscope?
5 What risks did you manage during this experiment?
CONCLUSION
Write a brief evaluation of the usefulness of the light microscope when examining tissue and cell samples
involved in the innate and adaptive immune responses.
KEY CONCEPTS
● The two branches of the adaptive immune system interact via helper T cells.
● Both B cells and antigen-presenting macrophages can present antigens to helper T cells to
initiate a response.
● Chemical signalling by helper T cells activates the cell-mediated and/or humoral response.
● Chemical signals are an important means of communication and coordination between the
innate and adaptive immune systems.
● The light microscope is a useful technology for examining the cellular components of each
system and understanding their distribution and effects in tissues.
CHECK YOUR
1 Justify the claim that the innate and adaptive immune responses do not act independently of each other.
UNDERSTANDING
2 Outline the role of helper T cells in adaptive immune responses.
3 Outline the purpose of memory cells (B and T) in adaptive immune responses. 12.1d
4 How does the immune system ensure that cytotoxic T cells are produced that are specific for one
type of pathogen?
5 What safety precautions are important when working with microscopes and prepared slides of biological
material?
6 What features could you use to distinguish between neutrophils, eosinophils and basophils under the light
microscope?
9780170408851 CHAPTER 12 » IMMUNITY 413
12_bio_InFocus12_2e_sb_08851_txt.indd 413 08/08/18 7:27 pm
The immune response after primary exposure to bacteria
Bacteria are the micro-organisms that most frequently cause infections in humans. The primary response
to bacteria includes natural barriers against infectious agents, as well as other innate responses and
adaptive immunity.
The innate and adaptive responses to infection caused by bacteria are outlined below.
Innate immune responses
Innate immune responses to infection by bacteria include the following:
◗ Complement proteins directly puncture the bacterial cell wall and membrane and make it susceptible
to osmotic lysis (Fig. 12.24).
◗ Opsonised bacteria (coated with antibodies and complement proteins) are phagocytosed
(Fig. 12.25).
◗ Neutrophils are particularly active during bacterial infections. Peripheral blood levels of neutrophils
increase in response to increased bone marrow production. This is especially common with Gram-
positive bacterial infections. Extreme infections may cause neutropaenia due to increased demand
for neutrophils outstripping the ability of the bone marrow to supply them.
◗ Monocytosis (increased monocyte count) may occur, particularly in the resolution phase of a
bacterial infection.
Extracellular
fluids
Complement
protein
Wikipedia/Brazucs
Cell membrane
FIGURE 12.24 Complement proteins puncture the
bacterial cell membrane.
Bacterium opsonised
Centre, Seatle, USA. ‘Immune Responses to Bacteria’,
Figure 2. British Society for Immunology.
Source: Kerry Laing, Fred Hutchinson Cancer Research
with complement
Complement
receptor
Phagocyte
FIGURE 12.25 Opsonised bacteria can be engulfed and destroyed by phagocytes.
414 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
12_bio_InFocus12_2e_sb_08851_txt.indd 414 08/08/18 7:27 pm
Adaptive immune responses
The adaptive immune response to infection by bacteria depends on whether the bacteria are intracellular
or extracellular.
Intracellular bacteria
Cell-mediated immunity is launched against intracellular bacteria (such as Salmonella), which cannot
be accessed by complement or antibodies. Infected macrophages present bacterial proteins on their cell
surface using MHCII receptors. Helper T cells detect these and release interferon, which stimulates the
macrophage to digest the bacterium-infected macrophage. This is an example of the innate and adaptive
systems working together at the same time to solve the same problem (Fig. 12.26).
Complement
Source: Steffen Jung, ‘A rescue gone wrong’. Nature
immunology 2011, Fig. 1. DOI 10.1038/ni.2161
Platelets
Opsonised
bacteria
Glycoprotein
Macrophage
Dendritic cell
Entry point for
pathogens
Innate immunity Adaptive immunity
Rapid destruction and T cell priming and memory
restoration of blood sterility Life-long protection
Immediate protection
FIGURE 12.26 Opsonisation of bacterial cells for destruction by phagocytes involves both the
innate and adaptive systems.
Extracellular bacteria
Extracellular bacterial infections (by Staphylococcus aureus, for example) are the most frequent of all.
In such cases, the protection mechanisms are mainly related to the host’s natural barriers, other innate
immune responses and antibody production by the adaptive immune system.
TABLE 12.2 Responses of the immune system to bacterial infections
NATURAL BARRIERS Structures/substances such as skin, mucous membranes, sebum, urine, gastric acid
INNATE IMMUNITY • Complement proteins
• Phagocytes (natural killer cells, neutrophils, macrophages)
ADAPTIVE IMMUNITY • Antibody production by plasma cells
• Cytokine production by T cells
• Memory B cells formed
9780170408851 CHAPTER 12 » IMMUNITY 415
12_bio_InFocus12_2e_sb_08851_txt.indd 415 08/08/18 7:27 pm
Case study: Immune responses to Vibrio cholera (cholera)
Every year, cholera affects millions of people in the developing world. The infection causes profuse
diarrhoea and vomiting (Fig. 12.27). Death is caused by the resulting severe dehydration and shock due
to fluid loss.
The bacterium that causes cholera is a curved or comma-shaped (vibrio) Gram-negative rod
(Fig. 12.28).
The human immune system responds to primary exposure to Vibrio cholera in the following ways:
◗ innate response – production of cytokines such as interleukin, migration of neutrophils into the
gut lining, and the production of antibacterial peptides (e.g. defensins) that kill bacteria directly or
possibly alter host gene expression to induce more cytokines to induce inflammation
◗ adaptive response – IgA is secreted by the gut lining to protect it from bacterial colonisation. After a
week there is an increase in circulating B lymphocytes specific to V. cholera antigens. Serum antibody
peaks at 1–3 weeks after initial infection and decreases after about a year (Fig. 12.29). B memory cells
form and provide a secondary response upon rechallenge at a later date with the same bacterium.
How cholera affects the body
Source: © 2010 MCT All rights reserved. Distributed by Tribune Content Agency
Cholera is an acute intestinal infection that causes severe diarrhoea,
dehydration and, if not treated promptly, death.
How it spreads
People ingest water In the large intestine
or food contaminated with
cholera bacteria. 1 Bacteria multiply
rapidly.
In epidemic, faeces
of diseased person
are source of
contamination.
Treatment.
Salt solution, intravenous
fluids, antibiotics
In unprepared Stomach
communities, Large intestine 2 Toxin from bacteria
death rates can penetrates cells of
be as high as 50%. intestinal wall.
Small
3 Toxin prevents
intestine
intestine from
absorbing water
from digested food;
diarrhoea,
dehydration result.
FIGURE 12.27 The pathogenic effects of cholera bacteria on the human gut
The microbiome of the gut plays a major role in regulating the immune response to diseases. All
humans provide diverse microhabitats for an array of micro-organisms. After birth, all mammals begin
to be colonised by foreign microbes. Symbiotic bacteria in the human gut have been found to prevent
inflammatory disease during colonisation. There are probably extensive molecular interactions between
the host and the bacteria that colonise the lower gut of humans.
416 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
12_bio_InFocus12_2e_sb_08851_txt.indd 416 08/08/18 7:27 pm
12
Shutterstock.com/kts design
10
Fold increase
8
6
4
2
0
0 7 14 28 56 112 224
Days after infection
Antibody-secreting cells Intestinal antibody
Serum antibody Circulating memory
B cell response
FIGURE 12.29 Timing and magnitude of adaptive
FIGURE 12.28 Vibrio cholera bacteria responses after exposure to Vibrio cholera
One role of the microbiota is in providing colonisation resistance against pathogens. It does this by:
◗ competing for space and nutrients
◗ quorum sensing – this is the bacterial cell-to-cell communication that can occur between the
pathogen and the microbiota (Fig. 12.30). For example, R. obeum, a gut microbe in humans, is able to
sense interspecies signals and can block colonisation by producing inhibitory molecules (against, for
example, V. cholera).
Understanding the mechanisms by which bacteria Interspecies cell–cell signalling
communicate with each other may be applied to restoring
Source: Amanda J. Hay, Jun Zhu, ‘Microbiota Talks Cholera out
of the Gut’, Fig. 1 Cell Host & Microbe Vol. 16, Iss 5, November
2014. Elsevier
Quorum
the health of people suffering from bacterial infections. Ruminococcus Al-2 signalling
Progress has been made in understanding how the obeum
Virulence
cholera bacterium may evade the body’s defences. It Microbiome V. cholera
has been discovered that the bacterium defends itself
by attaching small amino acids to the large molecules, Inhibitory metabolites
known as endotoxins, on its outer surface. These tiny Niche competition
amino acids change the electrical charge on the bacterial Immune priming/maturation
membrane from negative to neutral. The molecules that
are produced to fight bacteria (CAMPs) are positively Other
pathogens blocked
charged and generally bind to the negative bacterial
surface, make a pore in the membrane and kill them.
However, a neutrally charged bacterial membrane FIGURE 12.30 Complex chemical signalling occurs between
the microbiome and pathogens. AI-2 is an inhibitory molecule
provides no opportunity for CAMPs to bind. Vibrio produced by the microbiota in response to infection.
cholera are then able to invade the gut wall and cause
the dramatic symptoms seen in cholera. Although an
adaptive response follows, it does not generally reach a protective level quickly enough to enable the
person to recover before the severe diarrhoea and vomiting kill them. The body’s microbiota are also
outcompeted in the process.
If a drug could be developed that disables these amino acids, CAMPs could do their work and reduce
the invasiveness of the bacteria. The innate immune system would prevail.
9780170408851 CHAPTER 12 » IMMUNITY 417
12_bio_InFocus12_2e_sb_08851_txt.indd 417 08/08/18 7:27 pm
The immune response after primary exposure to fungi
Humans are constantly exposed to a wide range of fungi through digestion, inhalation or traumatic
injury. Most fungi cause no disease in humans. Superficial fungal infections of the skin (dermatophytes)
are common.
Innate immune responses
The innate immune system is heavily involved in the response to fungal pathogens. Physical barriers
such as the skin and mucous membranes provide a first-line barrier. Phagocytes such as dendritic cells,
neutrophils and macrophages are the main cells that use pattern recognition receptors (PRRs) on their
surface to recognise and bind to fungi. An increase in neutrophils in the peripheral blood is common.
Adaptive immune responses
Adaptive immune responses to fungi are poorly understood. Cell-mediated and humoral immunity play
a role.
◗ Phagocytosis is initiated and alerts effector cells to respond via cytokine production-induced
inflammatory responses.
◗ Dendritic cells transport ingested fungi to the lymph nodes, where helper T cells and memory T cells
are recruited.
◗ Helper T cells produce interleukin-17 and further stimulate neutrophils and macrophages.
Interleukin-17 is critical in antifungal immunity – it promotes inflammation.
Case study: Immune responses to Trichophyton rubrum (tinea)
Dermatophyte infections are common around the world. They are the main form of fungal infections of
the body skin (tinea corporis), feet (tinea pedis or ‘athlete’s foot’) and nails (tinea unguium).
Tinea pedis causes scaling, redness and itching of the feet and toes (Fig. 12.31). It is most common in
South-East Asia, Africa and parts of Australia, probably due to lack of enclosed footwear.
There is evidence that T. rubrum is able in some cases to evade the initial innate immune system
responses, and therefore the adaptive T cell responses are never activated. Both are necessary to clear
the infection.
In host tissues infected by T. rubrum:
enzymes called keratinases, which break down the skin barrier, are secreted
Getty Images/iStock/carroteater
◗ molecules in the fungal cell wall, called mannans, inhibit the immune
response and reduce replacement of superficial skin cells
◗ a hypersensitivity response (immediate or delayed) is elicited.
Responses of the immune system:
◗ Keratinocytes express TLRs (toll-like receptors) and defensins as a first-line
response.
Dendritic cells are primarily responsible for regulating the response to tinea –
◗
they suppress fungal growth and stimulate cytotoxic T cell production.
FIGURE 12.31 Tinea pedis, caused by the fungus
Trichophyton rubrum
Therefore the response to tinea is mediated by the innate and adaptive (cell-
mediated immunity) responses.
◗ PRRs recognise PAMPs, and so phagocytes express a mannose receptor that recognises mannans in
the fungal cell wall. Cytokines are released, and phagocytosis of fungal cells occurs, with proliferation
of cytotoxic T cells.
The infection becomes chronic in 20% of patients (probably due to a defective cell-mediated response).
In patients with chronic infections, depressed cytotoxic T cell responses are seen. It is suspected that
418 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
12_bio_InFocus12_2e_sb_08851_txt.indd 418 08/08/18 7:27 pm
some fungi are able to evade the mannose receptors on the cell membranes of epithelial cells and avoid
recognition, which means no cytokine is released and no phagocytosis is induced, and T cells are inhibited.
An increase in neutrophils (neutrophilia) and monocytes (monocytosis) may be seen in a full blood
count (a blood test that shows the numbers of different types of blood cells). This is an example of the
importance of the interaction between the innate and adaptive immune systems. Without the initiation
of the innate responses, the adaptive responses are not activated and infection continues unabated.
The immune response after primary exposure to viruses
Viruses must invade the cells of a host in order to replicate. Once the virus is inside a cell, the host’s
immune system has no access to the virus itself. Therefore, the infected cells use MHCI molecules on
their cell membrane to present pieces of viral protein to the outside of the cell.
As part of the adaptive immune system, cytotoxic T cells recognise specific virally infected cells. Only
T cells with the specific T cell receptors for that particular virus are activated. The cytotoxic T cell then
releases cytotoxic factors that kill the virally infected cell.
Some viruses are capable of stopping the MHCI molecules from migrating to the cell surface and
presenting viral protein. If this occurs, the immune system doesn’t know the cell is infected. However,
the innate immune system has found a way around this. Natural killer cells (phagocytes) will detect cells
with fewer than normal MHCI receptors and release cytotoxic factors, killing them as they would a virally
infected cell. These cytotoxic factors include perforin, which makes pores in the cell membrane, and
granzymes, which enter through the pores and induce programmed cell death (apoptosis) in the virally
infected cell. Cytotoxic T cells also produce cytokines (such as interferon) that prevent the replication of
viruses inside the infected cells. In addition, interferon signals neighbouring cells to increase the number
of MHCI molecules on their surface, to act as a signal for T cells.
Humoral immunity can play a role in responding to viruses before they infect cells. Antibodies
are produced by B lymphocytes. The virus becomes coated in antibodies and is no longer capable of
infecting cells. It is also a target for phagocytes. Antibodies also activate the complement system, and the
complement proteins bind to the viral envelope and damage it.
Full blood counts can be unpredictable in viral infections. The white cell count may be reduced
(leukopaenia) due to the suppression of bone marrow production of white cells by the virus. Sometimes
this is due to an increase in lymphocytes and monocytes but a greater decrease in neutrophils.
Case study: Immune responses to the Dengue fever virus
Dengue fever is a worldwide threat that affects millions of people every year. The virus that causes
Dengue is transmitted by the mosquito Aedes aegypti. It is most common in tropical countries.
Symptoms of the disease include fever, headaches, rash, vomiting, and joint and muscle pain. Pain
behind the eyes (retro-orbital pain) is a common feature. The disease commonly resolves after 1–2 weeks.
In fatal cases, death usually occurs due to haemorrhage because of a severe lack of platelets.
The Dengue fever virus infects cells of the immune system itself. This is part of its insidious nature.
The innate immune system is targeted, as the virus infects macrophages and dendritic cells. Once the
innate immune system is evaded, the virus becomes blood-borne and spreads around the body. It can
then be transmitted to another host when a mosquito takes a blood meal from the infected patient.
The usual situation with viral infections is that dendritic cells recognise viral PAMPs and release
interferons. Interferons activate the adaptive immune system, which leads to both T and B cell responses.
In some people, upon infection with the Dengue virus, certain types of interferons (type I IFN) are not
produced by the dendritic cells. This means they are unable to signal helper T cells to become activated.
There is also evidence that any type I IFN that is released has its signalling mechanisms blocked by the
virus. This is yet another example of the intricate signalling and cooperation that occurs between the
9780170408851 CHAPTER 12 » IMMUNITY 419
12_bio_InFocus12_2e_sb_08851_txt.indd 419 08/08/18 7:27 pm
innate and adaptive responses. It explains the clinical observation
Getty Images/Science Source
that the innate and adaptive immune responses are very poor in
Dengue patients.
In addition, Dengue fever virus is able to form intracellular
membrane pockets/vesicles to hide in and replicate before any
PAMPs are detected by the host cell’s PRRs.
During a primary infection, antibodies are raised against the
particular virus. There is some evidence that these antibodies are
cross-reactive against other serotypes of the Dengue virus. This
only occurs when the antibody concentration is high, as cross-
protection wanes quickly. People may have type-specific antibodies
from a Dengue fever infection for decades. B memory cells as well
as long-lived plasma cells are generated by an infection with this
virus.
In some patients, the T cells react very quickly and may actually
enhance the severity of the symptoms. This is of concern in the
Virions
FIGURE 12.32 Dengue fever virions inside host tissue development of a vaccine.
The immune response after primary exposure to protozoa
Protozoa are a group of protists that display complex multi-stage life cycles that make launching an
immune response problematic. Figure 12.33 shows the life cycle of malarial protozoa.
Attribution 2.0 Generic (CC BY 2.0). https://creativecommons.org/licenses/by/2.0/.
National Institutes of Health, National Institute of Allergy and Infectious Diseases. Creative Commons
FIGURE 12.33 Life cycle of the malaria parasite, Plasmodium
420 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
12_bio_InFocus12_2e_sb_08851_txt.indd 420 08/08/18 7:27 pm
Protozoa usually cause chronic infections, because innate immune defences are often ineffective and
the pathogen has evolved many mechanisms to resist adaptive immune defences.
Protozoa activate different immune responses than those activated by bacteria, viruses and fungi.
◗ Full blood counts usually show eosinophilia (increased number of eosinophils), because of accelerated
bone marrow production of eosinophils.
◗ Although protozoa may be phagocytosed by macrophages, many are resistant to phagocytic killing
and may even replicate within macrophages.
Protozoa also possess features known as escape/evasion mechanisms, which are strategies by
which parasites avoid the killing effect of the immune system in an immunocompetent host. Escape
mechanisms used by protozoal parasites include the following ways of ‘fooling’ the immune system:
◗ antigenic masking – escaping immune detection by covering itself with host antigens
◗ blocking of serum factors – acquiring a coating of antigen–antibody complexes or non-cytotoxic
antibodies that sterically (by arrangement of the atoms) blocks the binding of specific antibody or
lymphocytes to the parasite’s surface antigens
◗ intracellular location – the intracellular habitat of some protozoan parasites protects them from the
direct effects of the host’s immune response; by concealing the parasite antigens, this strategy also
delays detection by the immune system
◗ antigenic variation – changing its surface antigens during the course of an infection; parasites carrying
the new antigens escape the immune response to the original antigens
◗ immunosuppression of the host – the maturation of dendritic cells and monocytes is inhibited in red
blood cells infected by Plasmodium falciparum. This reduced immune response may delay detection
of antigenic variants. It may also reduce the ability of the immune system to inhibit the growth of
and/or kill the parasites.
Case study: Immune responses to Plasmodium spp. in malaria infections
People who are exposed to the malaria parasite Plasmodium falciparum develop naturally acquired
immunity. The details of how this works are still unclear. Many people in endemic areas carry a large
population of parasites in their blood but experience almost no ill effects. These levels of infection would
be fatal to a newly exposed person. Another complication is the fact that many of the surface proteins
of the protozoa show great antigenic diversity. A host would need a vast repertoire of antibodies to cope
with every variation available.
The immune responses to infection with malarial parasites are outlined below.
Innate immune responses
◗ Some individuals are inherently protected from the parasite due to a change in the structure of their
haemoglobin or red blood cells – examples are people with sickle cell anaemia, some thalassaemias,
or Duffy negative red blood cells.
◗ Natural killer (NK) cells increase in number; they cause lysis of parasite-infected red blood cells. NK
cells produce interferon, leading to macrophage activation. NK cells also induce the production of
chemokines, which activate phagocytes and help to limit the liver stage of the parasite.
Adaptive immune responses
◗ Antibodies (especially IgM and IgG) are produced by plasma cells.
◗ Helper T cells and cytotoxic T cells play a role in parasite control.
◗ Repeated infections lead to different stages of immunity, ranging from anti-parasite immunity
(prevents the parasite getting into the blood) to anti-disease immunity (no clinical signs observed
despite persistent infection), to premonition (protection from new infections due to a low-grade
infection of the blood with malaria parasites).
9780170408851 CHAPTER 12 » IMMUNITY 421
12_bio_InFocus12_2e_sb_08851_txt.indd 421 08/08/18 7:27 pm
◗ A merozoite is a stage of the Plasmodium life cycle that multiplies inside red blood cells. Antibodies
may inhibit merozoite invasion of erythrocytes or enhance the elimination of infected erythrocytes
in the spleen.
◗ Opsonisation leads to increased susceptibility to phagocytosis, destruction by cytotoxic T cells or
parasite inhibition by neutrophils and macrophages.
◗ Acquired immunity does not last long, and if a person leaves the area they become vulnerable once more.
The immune response after primary exposure to macroparasites
Parasitic worms (helminths) are a diverse group of antigenically complex organisms that infest millions
of people worldwide every year. Infestation by parasitic worms is called helminthiasis (Fig. 12.34). Most
people who are infested with worms experience few signs that they are infested, but some people suffer
from life-threatening consequences. It is mostly a
problem of developing countries.
Science Photo Library/Juan Gaertner
Pathogen factors
Pathogen factors pose unique challenges for
the adaptive and innate immune responses to
macroparasites.
◗ Many parasitic worms have multiple life stages.
◗ Many worms infest a number of hosts as they
develop. They change dramatically before being
transmitted to the next host.
◗ Chronic infestations can lead to pathological
FIGURE 12.34 A segment of intestine infested with
changes. intestinal worms
◗ Parasites may modulate their surface structure to
avoid recognition by the host.
◗ Molecular cross-talk occurs between helminths and the mammalian immune system (that is, the
parasite uses similar immune signalling molecules to those of the host); schistosomiasis is an example.
Host factors
Immune responses are predictable, with increases in interleukin, IgE, eosinophils and mast cells
detectable upon infestation.
◗ Full blood counts usually show eosinophilia in response to accelerated bone marrow production of
eosinophils.
◗ Th2 cytokines such as interleukins are increased.
◗ Immune response modulation – the initial increase in T cell reaction dampens as the infestation
becomes chronic. This is in the best interests of the host.
◗ Memory protects the host from new infection while the old infestation continues. One possibility is
that the adult parasites evade the immune system. Alternatively, the primary infestation may alter
the anatomy/physiology of the host to prevent further infestations.
◗ Antiparasite IgE levels correlate with resistance to new infestations in the host.
◗ Th2 response genes in some families help confer resistance – this is closely linked with the ability to
expel the parasite.
◗ Eosinophils kill opsonised helminths.
422 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
12_bio_InFocus12_2e_sb_08851_txt.indd 422 08/08/18 7:27 pm
INVESTIGATION 12.3
Changes in the blood during infectious disease
As part of a diagnostic routine, a doctor may ask for a full (or complete) blood count to be taken from a patient Information and
communication
with a suspected infectious disease. The blood count will determine absolute numbers and ratios of white and technology
red blood cells as well as their features (sizes, shapes, inclusion bodies in the nucleus or cytoplasm). Although capability
this does not always give a definitive diagnosis, and certainly does not identify the specific pathogen, it can
Literacy
alert the doctor as to how the immune system is responding. Different types of pathogens generally create
different patterns of white and red blood cell changes. The test can also indicate
how long the infection has been present, whether the infection is overwhelming Production of
Use and
the body’s defences, and whether the immune system is mounting an appropriate destruction
white cells
of white cells
response to the infection.
The number of circulating white cells in the blood reflects a balance between
their use (in responding to infections) and the rate of their production by the
bone marrow. Any process that changes one of these will change the dynamic
equilibrium between them and result in an increase or decrease in white cells Bone Immune
marrow response
(Fig. 12.35).
When the total count of a white cell increases, generally the suffix ‘philia’ is added
to the name of the white cell. For example, an increase in neutrophils is referred to
as ‘neutrophilia’. For some cells, the suffix ‘cytosis’ means increased production. For
example, monocytosis refers to increased production of monocytes. When white
cells decrease, the suffix ‘paenia’ is added to the name. For example, neutropaenia
indicates a lower than normal number of neutrophils in the peripheral blood. FIGURE 12.35 The blood level of
A typical pathology report based on a full blood count looks something like the white cells reflects both production
and use levels.
one in Figure 12.36.
COMPONENT YOUR VALUE STANDARD RANGE UNITS FLAG
White blood cell count 5.4 4.0 – 11.0 K/uL
Red blood cell count 5.20 4.40 – 6.00 M/uL
Haemoglobin 16.0 13.5 – 18.0 g/dL
Haematocrit 47.2 40.0 – 52.0 %
MCV 91 80 – 100 fL
MCH 30.8 27.0 – 33.0 pg
MCHC 33.9 31.0 – 36.0 g/dL
RDW 12.7 < 16.4 %
Platelet count 149 150 – 400 K/uL Low
Differential type Auto
Neutrophil % 56 49.0 – 74.0 %
Lymphocyte % 23 26.0 – 46.0 % Low
Monocyte % 13 2.0 – 12.0 % High
Eosinophil % 7 0.0 – 5.0 % High
Abs. Neutrophil 1 0.0 – 2.0 %K/uL
Abs. Lymphocyte 3.1 1.0 – 5.1 %K/uL
Abs. Monocyte 1.2 0.0 – 0.8 %K/uL
Abs. Eosinophil 0.7 0.0 – 0.5 %K/uL
Abs. Basophil 0.0 0.0 – 0.2 %K/uL
FIGURE 12.36 A typical full blood count with a differential count of white blood cells
9780170408851 CHAPTER 12 » IMMUNITY 423
12_bio_InFocus12_2e_sb_08851_txt.indd 423 08/08/18 7:27 pm
AIMS
1 To collect valid and reliable secondary data on typical changes in the blood profile for different infectious
diseases
2 To analyse and evaluate sec ondary data and information on full blood counts
HYPOTHESIS
Write a suitable hypothesis for your investigation.
METHOD
1 Use a number of sources to research the changes in white blood cells during bacterial, fungal, protozoal,
viral and macro-organism infections.
When using a search engine, insert key words such as ‘white cell changes in bacterial infections’.
2 Using the information you have gathered, create a table to record the following data:
a the type of pathogen
b any changes in the total number of white cells
c any other unusual features of the white cells – for example, more immature forms (can indicate bone
marrow response to infection through increased WBC production), strange shapes, structures inside
nucleus or cytoplasm (‘inclusion bodies’)
d explanation for the changes in the particular cells based on their primary role in responding to pathogens
e any changes in red cells (e.g. numbers, shape or increased nucleated red cells)
f include the ‘normal range’ for these cells (usually given in brackets on RHS of report)
g Make a small table and record the scientific units in the table. Find out what the symbols stand for.
3 Include a reference list of websites or any other resources used.
DISCUSSION
1 Evaluate the usefulness of the full blood count as a diagnostic tool for doctors when they suspect a patient
has a bacterial infection.
2 Sometimes there are no changes to the peripheral blood during an infection. How might this be
explained?
3 Find out the clinical significance of the following:
a neutrophila with a ‘left shift’
b toxic neutrophils
c neutrophils with Dohle bodies.
4 What types of pathogens generally cause eosinophilia?
5 What types of pathogens generally cause neutrophilia?
6 How common is basophilia?
CONCLUSION
Write summary sentences related to the aim of this investigation.
424 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
12_bio_InFocus12_2e_sb_08851_txt.indd 424 09/08/18 9:07 am
KEY CONCEPTS
● The immune system responds to extracellular bacterial infections by producing increased
numbers of neutrophils; complement proteins punch holes in bacterial cell walls.
● Intracellular bacteria are dealt with by cytotoxic T cells.
● The gut microbiome plays a key role in defence against pathogens such as the cholera
bacterium.
● Fungal infections are mostly prevented by barriers such as the thick keratin layer of the skin.
● Phagocytes engulf invading fungi; cytotoxic T cells may become involved; neutrophilia and
monocytosis may be seen in the full blood count.
● Leukopaenia (reduced white cell count in the blood) is a common response to viral infections.
● Protozoa typically cause eosinophilia in response to accelerated bone marrow production of the
cells.
● Some protozoa have strategies to evade the immune response.
● Macroparasites such as worms cause eosinophilia and increased IgE levels in the peripheral
blood.
● A full blood count is a useful start in identifying the presence of pathogens in the body but is
not accurate when used on its own.
Choose one of the pathogen case studies presented in the preceding section and answer the following
CHECK YOUR
UNDERSTANDING
questions for that pathogen.
1 Identify the scientific name of the pathogen. 12.1e
2 Describe the effects of this pathogen on the host.
3 Outline the barriers that are present to prevent entry by this pathogen.
4 Describe the primary cellular responses of the innate immune system to the presence of this pathogen.
5 Describe the primary cellular responses of the adaptive immune system to this pathogen.
6 What chemical responses help to mediate the responses of cells to the presence of this pathogen?
7 Outline the types of changes in the full blood count you might expect to see when this pathogen has been
present in the body for some time.
Modelling the innate
Shutterstock.com/Mopic
12.2 and adaptive immune
systems
WS
In science, a model is a representation of an idea, an object or even
a process or a system. The model is used to describe and explain Cells of the adaptive
immune system
phenomena that cannot be experienced directly. Models are central to
what scientists do, in their research and when communicating their
explanations.
Models are a simplified representation of an imagined reality. They
are used to link theory with experiment, by guiding research and
enabling predictions to be developed and tested experimentally.
Models have always been important in science, and continue to
be used to test hypotheses and predict information. Often they are
FIGURE 12.37 A model of
not accurate, because the scientists may not have all the data. It is the DNA double helix shows
important that scientists test their models and be willing to improve important component parts and
how they fit together.
them as new data becomes known. It can take time to get a model right.
9780170408851 CHAPTER 12 » IMMUNITY 425
12_bio_InFocus12_2e_sb_08851_txt.indd 425 08/08/18 7:28 pm
INVESTIGATION 12.4
A practical investigation to model the responses of the innate
and adaptive immune systems
Information and You are to model one of the three main responses of the immune system to invading pathogens. This includes
communication
technology the cellular and chemical components of each system, as well as the different types of pathogens dealt with
capability (e.g. intracellular versus extracellular; toxins versus viruses).
Literacy AIM
To model the components and responses of the human immune response, to explain the immune response to
Personal and
social capability
pathogens
METHOD
1 You will work individually or in a group, and become ‘expert’ in one of the types of responses of the human
immune system.
Modelling the 2 Use online or printed resources available to you.
immune system
3 Choose one of the following three immune responses:
• innate responses (first or second line) (you may choose one aspect, e.g. chemical barriers)
• adaptive response – humoral
• adaptive response – cell-mediated.
4 Choose a form for your model. Here are some suggestions:
• a 3D model of the cells in both of the systems made from various materials (e.g. playdough)
• a computer animation using the software of your choice (e.g. PowerPoint, Blender, Poser, Adobe After
Effects, Go Animate, Minecraft)
• a 2D model, such as a poster
• a board game that incorporates the cells and their functions
• a role play
• a story board or series of cartoons
• There are also a number of suggestions for immune system models and games on the Internet. Use the
search words ‘simulate immune system + student’. Also consider suggestions from other students or
your teacher.
5 Your model should demonstrate an accurate understanding of the following:
• Identify the specific pathogen (Chapter 10) or other antigen (e.g. toxin).
• Identify the chemical and cellular components of the immune response.
• Outline the circumstances that trigger the response.
Acting out the
immune response • Indicate the speed of the response (minutes, hours, days).
• Indicate the presence or absence of memory formation from this response.
• Give some indication of the site of these reactions (e.g. in tissues, in lymph nodes).
6 When completed, your model can be presented to the class.
7 All students should complete the summary below when all models have been presented.
A system of many 8 Create a bibliography/reference list in the appropriate format (page 27).
hats
426 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
12_bio_InFocus12_2e_sb_08851_txt.indd 426 08/08/18 7:28 pm
RESULTS
Copy and complete the following table individually after all models have been presented.
ACQUIRED HUMORAL ACQUIRED CELL-
FOCUS AREAS INNATE RESPONSE RESPONSE MEDIATED RESPONSE
What initiates the response?
How fast is the response?
Cellular components
Chemical components
Presence or absence of memory formation
(+/−)
DISCUSSION
1 In what ways did modelling make it easier to explain a concept to others?
2 What are some of the limitations of the model you created (what couldn’t it explain)?
3 How important is the role of models in science education? Why are models of particular value to science?
EX TENSION
There are a number of excellent modelling activities available online. The weblink provides examples of the
wide range of ways in which immune responses can be modelled by a class.
KEY
CONCEPTS
● Models are used by science to explain concepts in simple and effective ways.
● Models often allow scientists to make predictions.
● Models may be in the form of physical structures or mathematical equations.
● Models are constantly changing as new information comes to light.
1 Outline some of the features of a good scientific model.
CHECK YOUR
UNDERSTANDING
2 Suggest reasons why a physical model of a scientific concept may be more appropriate than a written
explanation in certain circumstances. 12.2
3 What are some of the challenges faced when designing a model for something as complex as the innate
and adaptive immune responses?
4 Describe some of the ways in which you evaluated your own model and made improvements during your
investigation.
5 Discuss the value of peer assessment and review of scientific models. In what ways did this assist or hinder
your model making?
6 Think of two established scientific models you have studied in any Science class. What features of these
models have made them so successful and enduring?
9780170408851 CHAPTER 12 » IMMUNITY 427
12_bio_InFocus12_2e_sb_08851_txt.indd 427 08/08/18 7:28 pm
12 CHAPTER SUMMARY
Immunity: How does the human immune system respond to exposure to a pathogen?
INNATE AND ADAPTIVE IMMUNE SYSTEMS WORK TOGETHER
Pathogen Finding of Dendritic cell
pathogen and (antigen-
initial attack presenting cell)
Neutrophil Innate –
Natural killer cell Move from second line of defence
Attack infected tissue
Antigenic
peptide to lymph node Immune
Macrophage
responses
Antigen
Pathogen-specific attack Innate immunity presented Adaptive –
to T cell third line of defence
Killer T cell
(cell immunity) Helper T cell
B cell
Antibody B cell
Adaptive immunity
(humoural immunity)
Third line of defence – adaptive immunity
The adaptive immune response:
B and T lymphocytes are capable of
recognising foreign molecules, called • is specific
antigens (‘antibody generators’). Antigens • has a diverse range of responses
are components of bacteria, viruses, fungi, • has memory
worms, tumour cells and other non-cellular • has self-tolerance.
materials.
Relative concentration of antibody in blood
Attacks invaders Attacks invaders First exposure Second and subsequent
outside cells inside cells to antigen exposure to the same antigen
Secondary
Primary response
response
B cell T cell
1 2 3 4 5 6 7 8 9 10
Time (weeks)
Primary response Secondary response
Humoral Clone of
ancestral
Memory
B cell
cell
(extracellular pathogens)
Memory
B cell
– neutralise pathogens Activated
B cell
Adaptive immune Antigen
response
(B and T lymphocytes)
Antigen bound
to receptor
Cell-mediated Antibody
molecule
(intracellular pathogens) Formation
of clones Plasma
Plasma
cell
– destroy pathogen- cell
infected cells
428 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
12_bio_InFocus12_2e_sb_08851_txt.indd 428 08/08/18 7:28 pm
Neutralisation
Attached to B
IgD, IgM
cell membranes
Antibodies
(immunoglobulins)
Modes of
Opsonisation Agglutination
action of
Free in extracellular
IgA, IgE, IgG, IgM
fluid
The human body recognises patterns of self and non-self – this is the Complement
activation
basis of all immune responses.
Antigen-presenting macrophage
moves to the lymph nodes.
Common responses to different
pathogens
Activates helper T cell with T cell receptor
that matches the antigen. • Bacteria Neutrophilia
• Viruses Leukopaenia
Activates T cells to clone many copies
that are specific to the antigen. • Fungi Neutrophilia;
monocytosis
Most cells become Some cells become • Protozoa Eosinophilia;
cytotoxic T cells memory T cells
altered red cell
architecture;
Cytotoxic T cells
migrate to the site of
Memory T cells
remain in the body
increased IgM
the infection and IgG
• Macroparasites Eosinophilia;
These cells attach to
infected cell and
When re-exposed to
the same antigen,
increased IgE
release chemicals these cells rapidly
that destroy the cell produce many
and pathogens copies of the same
within it. cytotoxic T cells.
Also release chemicals that:
Increase Stimulate
inflammation phagocytosis
T cells
Helper T cells Cytotoxic T cells Memory T cells Suppressor T cells
Release chemicals that activate Move to the site of infection Remain in the body to respond Suppress the immune
the cloning of cytotoxic T cells and release chemicals that to future infections by the response when the infection
and B cells and increase destroy infected cells same antigens has been defeated
macrophage activity after the
antigen has been recognised
Using models to aid understanding
Scientific models Use and
Production of
destruction
• Useful to represent white cells
of white cells
complex ideas or objects,
or objects that are very
large or small
• Predictive of some aspect Bone Immune
of the object or idea marrow response
• Modified as knowledge
increases
• e.g. double helix model
of DNA, heliocentric
model of the solar system
9780170408851 CHAPTER 12 » IMMUNITY 429
12_bio_InFocus12_2e_sb_08851_txt.indd 429 08/08/18 7:28 pm
12 CHAPTER REVIEW QUESTIONS Qz
Review quiz
1 ‘The innate immune system includes those responses to 12 Outline the role of MHC class I and MHC class II in the
pathogens that are genetically programmed and available response to pathogens.
from birth.’ Is this statement true or false?
13 Evaluate the role of the light microscope when examining
2 Identify the four main features of the innate immune the tissues and cells involved in the innate and adaptive
system. immune responses.
3 Briefly distinguish between the two arms of the adaptive 14 What are some of the features of a good scientific model?
immune system. Use an example you have studied in class.
4 Describe in detail the cellular and chemical mechanisms 15 Assess the role of peer feedback when conducting a
that allow the adaptive immune system to respond to practical or secondary sources task. Why is it important for
specific pathogens. scientists to peer review each other’s work?
5 Draw the structure of an antibody. Label the antigen- 16 Explain the processes that affect the balance of different
binding site and the light and heavy chains. types of white cells in the blood. How might this help a
doctor to diagnose an infectious process?
6 Explain the aspects of the adaptive immune response that
allow it to respond to a wide diversity of pathogens upon 17 Evaluate the role of full blood counts in the assessment of
primary exposure. a patient presenting with symptoms of an infection.
7 What is the difference between a primary response and a 18 Compare the roles of the humoral and cell-mediated
secondary response to a pathogen? immune responses with regard to the type of pathogen
targeted and how pathogen destruction is brought about.
8 Evaluate the role of B and T memory cells in the adaptive
immune response. 19 Compare and contrast the MHC class I and MHC class II
molecules.
9 Describe the roles of antibodies in the response to
pathogens. 20 The adaptive immune system is sometimes described as more
‘sophisticated’ or ‘important’ than the innate immune system.
10 What mechanisms allow T cells to respond to pathogen-
Evaluate whether either or both of these adjectives fits.
infected cells? Use a flow chart to summarise the
processes involved in identification and destruction of 21 Draw a diagram that shows all the different defences
intracellular pathogens. encountered by an antigen when it enters the body. Be sure
to indicate how these different defences communicate.
11 Create a table to summarise the roles of the following cells:
a helper T cells
b cytotoxic T cells
c suppressor T cells
d memory T cells.
430 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
12_bio_InFocus12_2e_sb_08851_txt.indd 430 08/08/18 7:28 pm
Prevention, treatment
13 and control of disease
Students:
INQUIRY • investigate and analyse the wide range of interrelated factors involved in limiting local, regional and global
QUESTION spread of a named infectious disease EU IU
How can the spread of • investigate procedures that can be employed to prevent the spread of disease, including but not limited to:
infectious diseases be (ACSBL124) CCT EU ICT IU
controlled? – hygiene practices
– quarantine
– vaccination, including passive and active immunity (ACSBL100, ACSBL123) EU ICT
– public health campaigns
– use of pesticides
– genetic engineering
• investigate and assess the effectiveness of pharmaceuticals as treatment strategies for the control of infectious
disease, for example: CCT EU ICT IU
– antivirals
– antibiotics
• investigate and evaluate environmental management and quarantine methods used to control an epidemic or
pandemic CCT IU
• interpret data relating to the incidence and prevalence of infectious disease in populations, for example: ICT N
– mobility of individuals and the proportion that are immune or immunised (ACSBL124, ACSBL125)
– Malaria or Dengue Fever in South East Asia AAEA
• evaluate historical, culturally diverse and current strategies to predict and control the spread of disease
(ACSBL125) ATSIHC AAEA CCT IU L
• investigate the contemporary application of Aboriginal protocols in the development of particular medicines
and biological materials in Australia and how recognition and protection of Indigenous cultural and intellectual
property is important, for example: ATSIHC S
– bush medicine
– smoke bush in Western Australia
Biology Stage 6 Syllabus © NSW Education Standards Authority for and on behalf of the Crown in right of the State of New South Wales, 2017
Science Photo Library
9780170408851 431
13_bio_InFocus12_2e_sb_08851_txt.indd 431 08/08/18 7:34 pm
The increased mobility of humans due to air and
Getty Images/Dimas Ardian
sea travel has had a profound impact on our ability
to limit the spread of infectious disease. Regular
and inexpensive international travel has allowed
a greater proportion of the world’s population to
holiday or work overseas. When people travel, they
take their pathogens with them. People who may
be carrying an infectious disease then expose new
populations to the pathogen. Some airports, such
as those in Hong Kong or Seoul, use temperature-
sensing equipment to screen people as they move
FIGURE 13.1 A temperature monitor at Inchoen through the arrivals gate, to detect possible carriers
International Airport in Seoul, South Korea
of diseases such as influenza (Fig. 13.1).
Limiting the spread
13.1
of infectious disease
Applying the scientific method to the understanding of infectious disease avoids a lot of wasted energy
pursuing the wrong course of action, as well as reducing panic.
Factors involved in monitoring and control
Because of the ease with which humans can travel, disease monitoring and control is carried out at three
levels: local, regional and global (Fig. 13.2).
FIGURE 13.2 The
Shutterstock.com/Johan Swanepoel
Shutterstock.com/pisaphotography
Shutterstock.com/Schwabenblitz
three levels of disease
monitoring and
control
Local Regional Global
Local factors
Local factors are usually related to a neighbourhood, village, town or city. Major factors that influence the
spread of disease include sanitation, especially how waste and sewage are disposed of. This is especially
important after typhoons and hurricanes, where the sewerage system is disrupted. Overcrowding
increases the chance of host-to-host transmission. Poor communication networks and roads may limit
access to medical treatment, hospitals or even medical information.
Animal husbandry practices, such as keeping chickens and pigs, may facilitate the transmission of
avian and swine flu from animals to humans. Keeping horses in south-eastern Queensland in the same
area as wild fruit and insectivorous bats has led to the emergence of Hendra and Australian bat lyssavirus.
Intercultural Local cultural and spiritual beliefs may influence attitudes to medical advice, burial rituals and
understanding
suspicion towards Western medical practices. In Madagascar, for example, a traditional ceremony
known as famadihana involves exhuming dead relatives and dancing with them through the streets.
Health officials believe that this has contributed to a deadly outbreak of plague.
432 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
13_bio_InFocus12_2e_sb_08851_txt.indd 432 08/08/18 7:34 pm
Regional factors
The United Nations divides the world into five regions: Africa, the Americas, Asia, Europe and Oceania
(Australia, New Zealand, Melanesia, Micronesia and Polynesia). The geography of a region influences
disease transmission. A region may be characterised by mountains, deserts, rainforests or grasslands,
and these geographical factors determine whether a population in that region is highly mobile or
relatively isolated. People living in mountainous regions or on islands have a natural isolation factor and
this reduces their chances of being exposed to infected individuals.
Around 60% of the world’s population live in coastal regions. Bacteria and viruses reside in sea water and
seafood. For example, hepatitis A virus may be concentrated in molluscs, such as oysters and clams. The
source of these microbes is sewage disposal. This is a huge challenge to infectious disease control in regions
such as South-East Asia, which have high coastal populations who rely on seafood as a source of protein.
Increased trade of fresh food around regional areas creates a possible source of pathogen transmission.
For example, faecal contamination of frozen mixed berries imported from China in 2016 contributed to a
number of Australians testing positive for hepatitis A.
Local seasonal variations in temperature and precipitation patterns may influence the availability
of vectors. Monsoon-related infectious disease outbreaks such as cholera, typhoid, malaria and
leptospirosis have been observed in equatorial regions.
Global factors
The increased movement of people around the globe due to travel and work (page 446) and migration of
refugee populations also introduces difficulties in limiting the spread of infectious disease. Many refugees
have experienced trauma, food insecurity, overcrowding and lack of access to basic health care, such as
vaccinations. Pre-migration medical examinations are carried out to exclude such infectious diseases as
tuberculosis, measles, malaria and polio.
Misuse of antibiotics and other antimicrobial medications has led to a rise in resistant bacteria.
This is a global threat to infectious disease control. Many strains of tuberculosis are now resistant to the
antibiotics traditionally used to treat this disease.
An important factor that has arisen in the control of infectious disease is the ease of communication Intercultural
understanding
afforded by the Internet. It is possible to transmit accurate and up-to-date data on disease outbreaks
as they occur. Communication between scientists is of vital
importance in the control of infectious disease.
Pathogen factors
Factors involved in disease transmission
When there is an outbreak of an infectious disease, there is
usually not one single cause. The causes are multifactorial
(Fig. 13.3), involving local, regional and global factors. Only
when the factors affecting transmission are understood can Global,
effective strategies to limit the spread of infectious diseases regional and local
Environmental/
Societal factors factors involved in
be implemented. geographic factors
disease
transmission
Pathogen factors
Each pathogen is different. Some are virulent and can cause
disease even when present in low numbers, while others
only do so in large numbers. Some pathogens form natural
reservoirs in food, water and the environment. Others are Host factors
not environmentally resilient and must be transferred
directly from host to host. The incubation period may be short
or long. Some pathogens are easily neutralised by water and
FIGURE 13.3 Four factors affecting infectious disease outbreaks
9780170408851 CHAPTER 13 » PREVENTION, TREATMENT AND CONTROL OF DISEASE 433
13_bio_InFocus12_2e_sb_08851_txt.indd 433 08/08/18 7:34 pm
disinfectants, whereas others are more resilient. The strategies used by pathogens to cause disease are
called virulence factors.
Once the biology of the pathogen is understood, control strategies can be put in place to target the
specific features of the pathogen.
Host factors
Just because a host is exposed to a pathogen does not automatically mean they will succumb to the
disease. The human immune system has a number of barriers that for the most part are effective at
dealing with challenges by pathogens (Fig. 13.4). There are a number of reasons why these barriers may
not be effective and the pathogen continues to invade the host. Any concurrent illness in the host may
reduce the effectiveness of the host’s defence systems. For instance, cancer or HIV/AIDS patients and
those with diabetes may be less resistant to another pathogen. Malnutrition can put a strain on the
ability of a host to avoid infection. People in a developing nation with ongoing food shortages due to
war, drought or poverty may be unable to avoid infection. The use of certain pharmaceuticals, such as
corticosteroids or anticancer medications, may lower the body’s barriers against pathogens.
FIGURE 13.4 Brain
Opportunistic Cryptococcal meningitis
infections are more Toxoplasmosis
likely when the
immune system is Eyes
weakened. CMV (cytomegalovirus)
Mouth and throat
Cold sores and ulcers
Thrush (candidiasis)
Lungs
Histoplasmosis
PCP (pneumocystis carinii pneumonia)
TB (tuberculosis)
Stomach
CMV
Cryptosporidiosis
MAC (mycobacterium avium complex)
Liver
HCV (hepatitis C virus)
Reproductive system
Genital ulcers
HPV (human papilloma virus) and cervical cancer
Menstrual problems
PID (pelvic inflammatory disease)
UTI (urinary tract infections)
Vaginal yeast infections (candidiasis)
Environmental and geographic factors
Alamy Stock Photo/Images & Stories
Certain environments may predispose to the spread of infectious
disease. Wherever a pathogen is able to build up a large reservoir in the
environment, there is a greater risk of outbreak. For instance, natural
disasters such as earthquakes, hurricanes and volcanic eruptions may
lead to poor sanitation and an increase in cholera-causing bacteria in
local waterways (Fig. 13.5). Environmental conditions may favour the
preservation of the pathogen in the environment. This is especially
so in countries affected by malaria. For instance, mosquitoes require
warm weather and a water body to reproduce and transmit the malaria
parasite. Large-scale destruction of rainforests may expose reservoirs
FIGURE 13.5 Typhoon Haiyan: a breakdown in infrastructure of hitherto unknown pathogens and put at risk those who use the land
increases the risk of water-borne bacterial diseases.
for housing and agriculture.
434 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
13_bio_InFocus12_2e_sb_08851_txt.indd 434 08/08/18 7:34 pm
INVESTIGATION 13.1
Processing data and information on the factors limiting
spread of disease
During late 2017, the south-eastern United States and the Caribbean were devastated by a series of hurricanes,
Critical and
which caused widespread damage to infrastructure including water and power supplies, roads, homes and creative thinking
agricultural crops. Many communities, particularly in Puerto Rico, were isolated from the outside world for
weeks. Despite this, the death rate from water-borne infections such as cholera was relatively low. After the Intercultural
Haitian earthquake of 2010, however, the story was very different – thousands of people died from cholera and understanding
other infectious diseases.
In this activity, you will work in a group of three to compile a management plan for a region that has Personal and social
experienced a natural disaster, incorporating the four factors affecting the spread of disease. capability
AIMS Information and
communication
1 To select qualitative and quantitative data and information on management of the spread of an infectious technology
capability
disease using a range of formats
2 To apply quantitative processes to the analysis of infectious disease control
3 To evaluate and improve the quality of data obtained in your research
METHOD
1 With your group, brainstorm all the effects of a hurricane on communities. Include effects on both the
natural and built environments.
2 Use your list to develop a series of immediate and long-term challenges to public health that could arise
from the effects of a hurricane. These may include wound- and non-wound-associated infections.
3 Use online, printed resources and the weblinks to the right to gather the following quantitative and
qualitative data on the spread of infectious disease during these two natural disasters (2010 and 2017): Epidemics
after natural
a the incidence and mortality rates from cholera and other infectious diseases disasters
b the incidence and death rate from wound infections
c a map of the area of devastation
d the populations of people affected
e the socio-economic factors affecting Haiti compared with the south-eastern United States (levels of 2016 Hurricane
Matthew
poverty, health care available, median wages, levels of unemployment)
f the quality of the built environment, in terms of building design and materials, water and power supply,
for both regions and its effect on mortality rates.
4 Examine the data you have gathered. Organise it in a way that allows you to make a comparison of the four
factors involved in disease spread. Communicable
diseases
RESULTS following
natural
Present your findings using an appropriate format as agreed with your teacher. Include a complete list of references. disasters
DISCUSSION
1 Write an evaluation of the main factors that led to the vast difference in infectious disease rates in Haiti in
2010 compared with the United States in 2017.
Why disease
2 Make recommendations based on your evaluation. What needs to change in the management of natural hits harder
disasters in developing nations? after disasters
in developing
3 Evaluate the accuracy, reliability and validity of your data. Which sources of information were best at nations
providing data that could be used to make a judgement?
CONCLUSION
Summarise some of the factors that increase the risk of infectious disease spread after a natural disaster.
9780170408851 CHAPTER 13 » PREVENTION, TREATMENT AND CONTROL OF DISEASE 435
13_bio_InFocus12_2e_sb_08851_txt.indd 435 08/08/18 7:34 pm
Ethical Other societal factors
understanding
In Australia, preventable diseases such as chickenpox and measles are making a comeback. Anti-
vaccination campaigns may influence people in deciding whether to have themselves and their children
vaccinated. Lack of education regarding the factors involved in an epidemic can contribute to poor
decision-making on the part of the public. Poverty and lack of access to vaccines and education is a
factor in more remote communities.
The advent of mass human population movements due to armed conflict is a phenomenon that is
gaining pace in the early 21st century. An unprecedented number of people are fleeing conflict in Africa
and the Middle East, with many travelling thousands of kilometres from their homes. These people are
at risk of malnutrition, exposure to the elements and exhaustion, all of which contribute to a lowering of
their resistance to invading pathogens. While in transit, refugees stay in camps, where the hygiene of the
food and water is questionable. Overcrowding increases the likelihood of host-to-host transmission, with
the very young and very old most vulnerable. In cases where refugees are fleeing over a large distance, they
may pass through transit zones where there is a greater exposure to pathogens due to the environmental
conditions. There is evidence that the choice of route between origin and destination has affected the
incidence of infectious diseases in refugees arriving in camps.
Isolated societies with small gene pools may be at greatest risk of disease outbreaks. A lack of variation
in innate immunity and the absence of adaptive immunity can be devastating for a small and isolated
population. When Aboriginal Australians were first exposed to European diseases such as smallpox,
many succumbed due to a lack of previous exposure.
The rise of international travel by air and sea means an increase in the likelihood of transmission of
disease outbreaks. A person carrying a pathogen as an air passenger on a long-haul flight is contained in
a small space with a large number of people in close proximity, all sharing an air supply.
KEY
CONCEPTS
● There are a wide range of factors involved in limiting the spread of disease and these can be
identified at a local, regional and global scale.
● The causes of disease transmission are multifactorial and involve pathogen, host,
environmental/geographical and societal factors.
CHECK YOUR 1 Explain why disease transmission needs to be dealt with at local, regional and global levels.
UNDERSTANDING
2 List the four main factors involved in infectious disease outbreaks and provide one example of each.
13.1 3 List factors about the pathogen that affect the rate and extent of disease transmission.
4 List reasons for the differences in infectious disease prevalence in different societies. What role do culture
and education play in the spread of infectious disease?
5 Justify why the correct management of an environment alone could have the potential to eradicate
infectious disease in an area. Use an example.
Preventing the spread
13.2
of infectious disease
Throughout history, humans have been investigating ways in which the spread of disease can be
prevented. Over 3000 years ago, the Chinese and Hebrews, along with some other cultures, were
advocating cleanliness in food, water and personal hygiene. The Hebrews had rules to be followed to
ensure that the health of their population was maintained. Some of these rules included washing people
and objects, proper disposal of refuse and excreta, protection of the water and food supply, and isolation
of diseased individuals. For example, people suffering from leprosy were forced to live outside the walls
of the city. Principles of good health were also developed by certain groups of the Chinese population
436 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
13_bio_InFocus12_2e_sb_08851_txt.indd 436 08/08/18 7:34 pm
and included hygiene rules and exercises. Similarly, the people of Mesopotamia followed principles of
cleanliness, used toilets and constructed primitive sewerage systems.
While many cultures have practised the principles of good health, infectious diseases such as bubonic
plague and cholera have caused widespread death over many years.
Hygiene
Hygiene can be divided into two types: personal and community hygiene.
Personal hygiene involves each person keeping their body and any openings on it clean. This reduces
the risk of pathogens entering our bodies, or transmission of these pathogens to others, thus causing
disease. It also inhibits the build-up of micro-organisms on our bodies. Personal hygiene includes the
following practices:
◗ Hands should always be washed with soap and water before preparing and eating food and after
going to the toilet (Fig. 13.6). This prevents the spread of pathogens that cause symptoms such
as diarrhoea.
◗ The body and hair should be washed regularly and teeth cleaned, to prevent the build-up of pathogens
(particularly bacteria) to numbers sufficient to cause disease. For example, a build-up of bacteria in
the mouth can cause gingivitis (resulting in swollen, bleeding gums and loss of teeth).
◗ Always cough or sneeze into a handkerchief or tissue. This prevents airborne droplets from spreading
to others. You should not sneeze into your hands, as you will then transmit the pathogens from your
hands to whatever you touch next.
The Australian Institute of Food Safety
FIGURE 13.6 The
Australian Institute
of Food Safety’s ‘A
guide to washing your
hands’ poster
Community hygiene helps prevent the build-up of pathogenic organisms in the community. When the
infrastructure that supports and maintains community hygiene breaks down, there is a rapid spread of
disease, as was seen in the aftermath of the tsunami that hit South-East Asia in 2005.
Community hygiene includes the following measures:
◗ Sewage and garbage disposal reduce the risk of pathogen numbers increasing and spreading
throughout the community. Sewage treatment plants may incorporate the use of UV disinfection for
management of pathogens in waste water.
9780170408851 CHAPTER 13 » PREVENTION, TREATMENT AND CONTROL OF DISEASE 437
13_bio_InFocus12_2e_sb_08851_txt.indd 437 08/08/18 7:34 pm
◗ Sterilisation and disinfection of equipment in hospitals,
Shutterstock.com/leungchopan
doctors’ surgeries, dentists and hairdressers/barbers reduces
the risk of the spread of pathogens from one person to another.
◗ City planning reduces overcrowding (Fig. 13.7) and therefore
reduces the risk of the transmission of diseases throughout
the population – this is important in controlling disease.
Clean food and water
Many pathogens can be transferred from person to person,
or from environment to person, in food. For example,
salmonellosis is a disease caused by Salmonella bacteria and is
transmitted in undercooked food, especially of animal origin. In
FIGURE 13.7 Overcrowded cities can put a strain on water and order to control the transmission of disease from food sources,
water management, leading to poor disease control. guidelines that must be followed by food handlers have been
introduced for storing, preparing and serving food.
It is important that water quality is maintained in order to minimise the risk of pathogens multiplying
and to reduce the risk of the transmission of pathogens in contaminated water.
Domestic water quality must comply with strict standards and guidelines in order to reduce the
incidence of disease. In Australia, governments establish these standards and the water is tested daily to
ensure these standards are met.
Water that has been contaminated with the faeces of animals could contain unsafe levels of
pathogens, such as the protozoans Cryptosporidium and Giardia, and if consumed could cause symptoms
such as abdominal cramps, diarrhoea, nausea and vomiting. Cholera is a potentially fatal disease that is
transmitted in water contaminated with untreated sewage.
The treatment of water to destroy pathogens and prevent their further multiplication reduces the
transmission of disease and is very important in the successful control of disease.
INVESTIGATION 13.2 a
Food safety standards
Work and Food safety standards are enforceable guidelines for Australian food businesses. The aim of these standards is to
enterprise minimise the spread of pathogens from contaminated food and water, which could cause ill health and/or death.
Civics and AIM
citizenship
To research and assess the Australian Food Safety Standards, including guidelines for:
• personal hygiene practices
• maintenance of utensils used for cooking
• storage of raw and cooked foodstuffs
Food Standards
Australia and • processing (meat)
New Zealand
• preparation and cooking methods
METHOD
1 Use online and printed sources to examine the Australian Food Safety standards, to gather information on
the above aspects of food safety. Concentrate on those aspects of the guidelines that are there to limit the
Food safety spread of pathogens and therefore control disease outbreaks.
fact sheet
2 Gather your data from reliable, accurate and valid sources.
438 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
13_bio_InFocus12_2e_sb_08851_txt.indd 438 08/08/18 7:34 pm
RESULTS
Present your findings using an appropriate format as agreed with your teacher. Include a complete list
of references.
Department
of Primary
DISCUSSION Industries –
Food Authority
Outbreaks of infectious disease still occur in commercial premises despite the laws and guidelines. Suggest
reasons why contamination from pathogens in food will always be a risk despite our advanced scientific
understanding of the control of infectious disease.
INVESTIGATION 13.2 b
Analysing quantitative data from the 2010 Haitian earthquake
When natural disasters such as earthquakes occur, they generally have a more devastating effect where there Critical and
is a greater population density. Management during and after a natural disaster is complicated by economic, creative thinking
social and cultural factors. Although many deaths are a direct result of collapsed buildings, a great proportion
of deaths are attributable to infectious disease spread after the disaster. In this activity, you will analyse data Numeracy
regarding the 2010 Haitian earthquake and use this to make informed judgements about the factors that affect
Information and
the spread of infectious disease after a natural disaster. communication
technology
AIMS capability
1 To derive trends, patterns and relationships in data and information
2 To assess the relevance, accuracy, validity and reliability of data
METHOD
1 Examine Figure 13.8. What is the general trend in the data?
licenses/by/2.0),
© Doocy et al.; licensee BioMed Central Ltd. 2013. Creative
Commons Attribution License (http://creativecommons.org/
80
Crude mortality rate (deaths/1000)
70 Males
Females
60
Total
50
40
30
20
10
0
0–9 10–19 20–29 30–39 40–49 50–59 60+
Age category
FIGURE 13.8 Age- and sex-specific mortality rates following the 2010
Haitian earthquake
9780170408851 CHAPTER 13 » PREVENTION, TREATMENT AND CONTROL OF DISEASE 439
13_bio_InFocus12_2e_sb_08851_txt.indd 439 08/08/18 7:34 pm
2 Complete the final column in Table 13.1. Identify any trends in the data.
3 Identify possible factors that could have affected the death rates of males and females.
TABLE 13.1 Mortality estimates from the 2010 Haitian earthquake, according to individual and household
characteristics
TOTAL EXPOSED TOTAL DEATHS MORTALITY RATE (%)
Overall 6383 153
Sex
Male 3052 71
Female 3379 76
Age category
0–17 2299 37
18–49 3689 92
50+ 548 24
Education level
None 289 11
Primary 1237 27
Secondary 3685 83
Higher education 1273 31
Crowding
<2.0 1927 35
2.0–2.9 1566 37
3.0–3.9 949 23
4.0+ 2094 58
Current location
Neighbourhood 3258 63
Camp 3278 90
Multilevel building
1 level 3999 76
>1 level 2031 67
Source: adapted from Doocy S, Cherewick M & Kirsch T 2013, ‘Mortality following the Haitian earthquake of 2010:
a stratified cluster survey’, Table 2, https://pophealthmetrics.biomedcentral.com/articles/10.1186/1478-7954-11-5
DISCUSSION
1 The spread of infectious disease is affected by four main factors (page 443). Using each of these factors,
explain the trends in the data in Table 13.1 and Figure 13.8.
2 Assess the accuracy of the data in Figure 13.8. What factors do you think determine the ability of scientists
to collect accurate population and demographic data in countries such as Haiti?
3 Explain why accurate data in natural disasters such as this earthquake is vital in the management of
infectious disease spread.
4 What other individual or household factors in Table 13.1 would assist our understanding of the spread
of disease?
CONCLUSION
From your analysis of the data provided, which individuals were most likely to die from disease after the
earthquake in Haiti in 2010?
440 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
13_bio_InFocus12_2e_sb_08851_txt.indd 440 08/08/18 7:34 pm
KEY CONCEPTS
● The spread of disease may be limited by a combination of strategies, including hygiene
practices around food and water.
● Personal and community hygiene are designed to limit the transfer of pathogens from person
to person.
● Food and water cleanliness are designed to control the outbreak of disease by reducing the pool
of pathogens in food and the environment.
● During natural disasters, many of the factors affecting the spread of disease come into play all
at once. This can cause a massive increase in the spread of infectious diseases.
CHECK YOUR
1 Australia has some of the strictest food and water hygiene practices in the world. Justify the cost (in time
UNDERSTANDING
and personnel) of the practices put in place to ensure adherence to the recommended guidelines.
2 Scientists have a very good understanding of the causes and management of food and water-borne 13.2a
diseases. Why, then, do we still hear in the media about incidents of food poisoning in Australia despite our
knowledge and technology?
3 Imagine you have completed a first-hand investigation to identify microbes in food or in water. Assess
how the equipment you used would be useful in the field during a disease outbreak. Which aspects of the
investigation would be the most challenging? List the precautions you would take to make sure that your
surroundings and equipment were sterile when completing the investigation. Justify these precautions.
4 Explain how each of the following assists in the control of disease in a fast-food establishment:
a personal hygiene practices
b food practices
c water practices.
5 Describe the processes involved in the treatment of water to ensure that it meets the guidelines issued by
the National Health and Medical Research Council to make it safe for drinking. Explain how these processes
reduce the risk of infection from pathogens.
Quarantine
Australia is one of few countries in the world that remain free of the world’s most serious pests and
diseases. Originally, this was due mainly to our geographical isolation. This isolation decreased as
international travel and trade increased, which led to the need for a more sophisticated and thorough
system to prevent the entry of pests and diseases into our country. The Department of Agriculture and
Water Resources (DAWR) is responsible for maintaining Australia’s reputation as a relatively disease-
free country.
Australia is home to many unique flora and fauna species, as you will know from the Year 11 Biology
course. Australia also has a very large agricultural industry that supplies large amounts of food for local
consumption and export (worth $30 billion per year). Our agricultural exports are in high demand in
many countries because of Australia’s reputation of being free of the serious pests and diseases that are
common in other areas. If these pests and diseases were to gain entry into Australia, they would have a
devastating effect on Australia’s animals and plants.
The role of quarantine is to minimise the risk of exotic pests and diseases entering Australia, in order
to protect our native flora and fauna, our agricultural industries, our environment and our health.
Australia’s thousands of kilometres of coastline, and proximity to neighbouring regions such as
South-East Asia and the Pacific nations, which have pests and diseases that are not present in Australia,
make it particularly vulnerable to pest and disease invasions. These pests and diseases could be brought
into Australia by people, animals and plants. They could also be brought in by animal and plant products,
or in soil that is on shoes or machinery.
9780170408851 CHAPTER 13 » PREVENTION, TREATMENT AND CONTROL OF DISEASE 441
13_bio_InFocus12_2e_sb_08851_txt.indd 441 08/08/18 7:34 pm
Animal quarantine
Animal quarantine involves all animals that come into Australia spending time at quarantine stations,
to ensure that they are free of disease before they are released. If you wanted to bring pets into Australia,
you would have to leave them in quarantine for a number of weeks. These animals would be examined
regularly for signs of disease.
Plant quarantine
Plant quarantine involves examining all plants, parts of plants and plant products (fruits, seeds, cuttings,
bulbs and wood) brought into Australia, for pests or diseases. Many of these items are refused entry
into Australia. In some cases the items are allowed into Australia only after being treated by quarantine
officers, to ensure that any likely pests or pathogens are destroyed. Live plants must be kept at quarantine
stations until any diseases that may be present have had time to develop.
Human quarantine
The captains of aircraft and ships are required to notify Australian Quarantine and Inspection Services
(AQIS) if any passengers or crew are displaying any symptoms of prohibited diseases, such as rabies,
yellow fever, malaria, SARS (severe acute respiratory syndrome) or avian influenza (bird flu). Aircraft are
also sprayed with insecticide to kill any pests that have entered Australia with the aircraft. All Australian
international airports have mosquito-trapping programs to enable the quick detection of any mosquitoes
entering the country. These mosquitoes could be acting as vectors in the transmission of disease.
Northern Australia Quarantine Strategy
The northern part of Australia is only a short distance from countries that have many exotic pests and
diseases not present in Australia. The Northern Australia Quarantine Strategy (NAQS) was established
as an early warning system to protect this susceptible area of Australia. This system involves the use
of ‘sentinel’ animals such as cattle and pigs that are regularly checked for diseases, such as Japanese
encephalitis and blue tongue. Sentinel animals are so called because they are in effect ‘standing guard’
or ‘watching out’ for invading pathogens or pests. If they develop symptoms of a disease not yet seen in
Australia, it is an early warning sign that these pathogens are a threat to Australia, and strategies can then
be put in place to halt their spread. Insect traps are also set up and checked regularly for insects such as
screw-worm flies, Asian honeybees and papaya fruit-flies.
The DAWR also has many roles in keeping Australia free of infectious diseases (Fig. 13.9).
Vaccination
You learned about
Vaccination involves the introduction of a vaccine into the body. Immunisation is the process in which
the primary and the body reacts to a vaccine by going through the immune response. This response produces memory
secondary immune
responses in
cells for the antigen and confers immunity to the body, so that if the antigen enters the body again in the
Chapter 12. future, the secondary response will occur and the person will avoid the worst symptoms of the disease.
Vaccination primes the immune system to deal with a pathogen it has never been in contact with.
There are several important reasons why we don’t just let the body experience the disease and build up
a natural immunity.
Active acquired immunity is when the immune response occurs and memory cells are produced. It
can be naturally induced, as the body undergoes the immune response and suffers the symptoms of the
disease. It can also be artificially induced, through the use of vaccines, which cause the production of
memory cells without the body experiencing the symptoms of the disease.
Vaccines contain cultures of micro-organisms, which may be either:
◗ living but attenuated (weakened) and therefore harmless (rabies, poliomyelitis, measles), or
◗ dead (typhoid, whooping cough).
442 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
13_bio_InFocus12_2e_sb_08851_txt.indd 442 08/08/18 7:34 pm
3.0 (CC-BY 3.0) Australia licence.
The Departament of Agriculture and Water Resources A Creative Commons Attribution
Surveillance &
diagnostics
(understand and quantify
the impact of pests
Data & intelligence and diseases) Treatment &
(prevent exotic pests and
recovery
diseases from entering
(demonstrate the absence
and establishing in
PREPAREDNESS of pests and diseases)
Australia)
PREVENTION ERADICATION
National biosecurity
RD&E priorities
Communication,
Risk & decision tools community attitudes
(improved & awareness
decision-making (socioeconomic drivers
tools and risk analysis) of adopting best
General practice)
surveillance
(manage the pests and
CONTAINMENT diseases that are already ENGAGEMENT
in Australia)
MANAGEMENT
FIGURE 13.9 DAWR has many roles in keeping infectious diseases out of Australia (RD&E: research, development and
extension).
Vaccines may also contain modified toxins called toxoids (tetanus, diphtheria). They may be given
orally, by injection or by scratching the skin surface.
Vaccines are harmless to the body and will not cause the disease that they are specific for. They
contain the antigens that cause the body to undergo an immune response and produce memory cells for
that particular antigen. If the body is exposed to that antigen in the future, the secondary response will
be activated and the antigen will be destroyed before any symptoms of the disease are experienced. The
immunity formed in this way is usually lifelong. Each vaccine is specific for only one type of antigen and
will therefore give immunity for only one type of disease.
For a vaccine to be effective, a series of vaccinations (booster shots) should be given over a number
of years. Each time the vaccine is introduced into the body, a small response is produced. Over a series of
vaccinations, the lymphocytes will more rapidly recognise the antigen and the numbers of memory cells
produced will be enough to give immunity for a long time.
In some cases, the numbers of memory cells decrease over time and booster injections have to be
given to increase the number of circulating memory cells, to ensure that immunity is maintained for that
disease. For example, booster injections must be given to maintain immunity to tetanus, as the number
of memory cells for this disease decreases over time.
Passive acquired immunity involves the introduction of antibodies (immunoglobulins) into the body
to prevent a disease from developing. These antibodies have been produced by another organism that
has had the disease. For example, if you have been exposed to hepatitis A, you may be given injections of
immunoglobulins (antibodies) to prevent you from contracting the disease. This immunity will last for
only a couple of months, as no memory cells are produced.
Vaccines are a vital part of the solution to infectious disease control. Investigation 13.2c shows the
effectiveness of vaccines in controlling a group of childhood infectious diseases.
9780170408851 CHAPTER 13 » PREVENTION, TREATMENT AND CONTROL OF DISEASE 443
13_bio_InFocus12_2e_sb_08851_txt.indd 443 08/08/18 7:34 pm
INVESTIGATION 13.2c
Ethical
understanding
Evaluating scientific claims
You will evaluate the effectiveness of a vaccination program in preventing the spread of diseases including
Information and
communication
smallpox, diphtheria and polio. You will evaluate the claims made by health authorities regarding the efficacy
technology of vaccination programs.
capability
AIM
To analyse and evaluate primary and secondary data and information on vaccination programs and their
effectiveness in limiting the spread of infectious diseases
METHOD
Immunise
Australia Program Task 1 Read the information at the Immunise Australia Program weblink and then answer the questions below.
1 Explain why it is necessary to vaccinate against polio.
2 Outline the vaccination schedule in Australia.
Task 2 Read the information at the Polio immunisation weblink and then answer the questions below.
1 Is the current vaccine given in Australia the oral or injectable vaccine?
Polio
immunisation 2 Are any of the side effects of the injectable polio vaccine long term (lasting several years or a lifetime) or life
threatening?
3 Explain why it is important to eradicate polio globally.
Task 3 Read the information at the WHO poliomyelitis weblink and then answer the questions below.
1 Outline the aims of the Global Polio Eradication program, which began in 1988 and was revised in 2012.
Better Health 2 Polio is still endemic (present) in three countries: Afghanistan, Pakistan and Nigeria. There are also currently
Channel: Polio
immunisation outbreaks in the Horn of Africa, western central Africa and Syria.
Using information from the weblink, explain the science behind this statement:
We wouldn’t have the outbreaks if we didn’t have the polio virus continuing to circulate in the
endemic countries.
– P. Crowley, UNICEF (‘The World Today’ ABC Radio)
Task 4 Read the information at the Polio outbreak sparked by vaccine weblink and then answer the questions below.
WHO
poliomyelitis 1 Explain why people in certain countries believe that polio vaccination is a plot to sterilise them.
2 Find out whether science verifies or discredits this claim.
Task 5 Go to the Polio eradication weblink and read the sections titled, ‘Polio eradication basics’ and ‘Weakest
link no. 1’. Then answer the question below.
1 Do scientific studies and explanations verify or discredit this claim in Nigeria? Justify your answer.
Polio outbreak
sparked by Task 6 Read the information at the Progress towards eradication weblink and then answer the questions below.
vaccine 1 Discuss the change in morbidity (number of cases), mortality (% population deaths), incidence (number of
new cases in a specific time) and prevalence (number affected at any one time) of polio from 1998 to 2014.
2 Describe how these figures are expected to change within 10 years if polio is not eradicated in these
endemic countries.
DISCUSSION
Polio eradication
1 State the World Health Organization’s standpoint on polio vaccination. Do you agree or disagree with this
standpoint? Justify your answer.
2 Analyse the reasons why a small proportion of the population remain deeply suspicious of vaccinations.
3 Evaluate the websites used in this activity in terms of their relevance, accuracy, validity and reliability.
Progress 4 Use online resources to examine and evaluate the claims made about a link between autism and vaccination.
towards
eradication CONCLUSION
Summarise the arguments in favour of vaccination as one strategy for limiting the spread of infectious disease.
444 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
13_bio_InFocus12_2e_sb_08851_txt.indd 444 08/08/18 7:34 pm
Public health campaigns
The scale and complexity of infectious diseases can seem overwhelming. We are confronted every day
with news images of human suffering, particularly the rise of infectious diseases associated with the
wave of human population movement that is taking place during the 21st century. However, any initially
overwhelming task can be broken down into a series of smaller steps – you will
be familiar with using this approach in completing large and complicated school
assessment tasks.
The approach to controlling infectious diseases can be broken down into four
categories, known as RICE (Fig. 13.10):
Resolution
◗ Resolution of governments and health organisations (such as the World Health
Organization) to find solutions to infectious disease
◗ Information in the form of epidemiological studies and scientific studies of
the pathogen and its mode of transmission so that the solution is based on Information
accurate data; includes increased national funding for scientific research/and
training of scientists and medical personnel
◗ Coordination of efforts on a local, regional and global scale so that resources Coordination Education
are used efficiently
◗ Education of human populations on a local, regional and global scale regarding
FIGURE 13.10 Three levels of approach to
factors affecting infectious disease transmission. infectious disease limitation
There are a number of ways in which disease can be controlled and/or
prevented. You have already read about two strategies: vaccination and quarantine. Another strategy for
control and/or prevention of disease is the implementation of public health programs.
Government regulations ensure that standardised procedures are followed when handling, cooking
and storing food. Strict guidelines must also be followed in hospitals, surgeries and clinics when
sterilising equipment and when health workers move from patient to patient. When these guidelines
and procedures are followed, the spread of pathogens is prevented; in turn this prevents the occurrence
of diseases such as food poisoning and hepatitis. Government regulations are also in place to ensure that
garbage is disposed of correctly, drinking water is treated effectively, and sewage is removed and treated.
If these sanitation procedures are followed correctly, the spread of pathogens is prevented and, hence,
the occurrence of disease in individuals and communities is prevented.
The law requires that certain diseases be reported to authorities if they are detected. This allows the
early detection of these diseases and allows appropriate strategies to be put in place in order to control
their spread through the community. Examples of notifiable diseases are measles, botulism, cholera,
meningococcal infection, pertussis (whooping cough) and malaria.
Public immunisation programs (such as childhood immunisation) for diphtheria, tetanus, whooping
cough, measles, mumps and rubella help to prevent these diseases. Mass immunisation programs for the
human papilloma virus have also been introduced, to help prevent cervical cancer.
Use of pesticides
Pesticides are chemicals used to kill the pests of plants and animals, including pathogens and the
vectors that transmit pathogens between organisms. Killing these pests and vectors reduces the
occurrence of disease or controls the spread of disease through the population. Pesticides can be
classified into three groups:
◗ insecticides – kill insects
◗ fungicides – kill fungal pathogens
◗ herbicides – kill weeds.
9780170408851 CHAPTER 13 » PREVENTION, TREATMENT AND CONTROL OF DISEASE 445
13_bio_InFocus12_2e_sb_08851_txt.indd 445 08/08/18 7:34 pm
One of the best-known insecticides used to kill insects acting as vectors is DDT. It was used widely
during World War II to controlled the spread of typhus. DDT killed the lice that transmitted the pathogen
(bacteria) that caused the disease. DDT has also been used widely to kill the Anopheles mosquito, which
carries the plasmodium that causes malaria. DDT controlled the spread of malaria, as transmission of
the pathogen was prevented by the death of the vector. However, the effectiveness of DDT was reduced
as mosquitoes developed resistance to it due to natural selection. Many countries have since banned
the use of DDT because of its harmful effects on the environment. Some malaria-infested countries still
use DDT to control mosquito numbers, even though it is not as effective. Other insecticides, such as
pyrethrum, are now also used. These insecticides are less harmful to the environment and more effective
in controlling mosquito numbers. This in turn controls the spread of malaria to some extent.
Another vector controlled by the use of insecticides is the aphid that carries the potato leaf-roll virus,
which causes stunted growth and serious loss of yield in potato plants. Pesticides are used to kill the
aphids and therefore control the spread of the virus that causes this devastating disease.
Pesticides are also used widely to spray items brought into Australia, to kill any insects or other
organisms present. This prevents the spread of any diseases associated with these insects.
One problem associated with the use of pesticides is the ability of insect vectors and disease-causing
organisms to build up resistance, which reduces the effectiveness of the pesticide and increases the need
for the development and use of stronger pesticides.
The use of pesticides is also being discouraged further by their damaging effects on the environment.
The use of natural pesticides is gaining popularity – these are developed from natural sources such as
onions and garlic. In addition, companion plants may be grown in vegetable gardens. These plants are
grown within a crop and are said to have insecticidal properties. They may even attract beneficial insects.
Genetic engineering
Ethical Genetic engineering involves altering the genetic composition of an organism. By altering the
understanding genetic make-up of organisms, it is possible to make them resistant to diseases. This prevents the
disease occurring and controls the spread of disease through the population. Organisms with genes
from other organisms inserted into their own genetic material are called transgenic species. (See
Chapter 9, page 295.)
Using genetic engineering to produce disease-resistant plants and animals prevents the occurrence
of disease in individual organisms, controls the spread of disease through the population, and reduces
Ethics of GM
foods the incidence of the particular diseases and pests.
The use of genetically modified organisms has not been universally accepted, however. There are
concerns that resistance to the insecticides produced by the genetically altered organisms will develop
WS and they will no longer be effective. There are also concerns about the effect these organisms will have
on the environment and biodiversity. There are also many ethical issues to be considered, especially
GM livestock and concerning public labelling of products derived from genetically modified organisms.
public concerns about
genetically modified
organisms
KEY CONCEPTS
● A wide range of measures can be employed to prevent the spread of infectious diseases.
● Hygiene practices prevent the creation of a pool of pathogens from which disease can spread.
● Quarantine practices limit the spread of pathogens by isolating infected hosts until the
pathogen is eliminated, thus preventing transmission from host to host.
● Vaccination prepares the host for any future challenge from a pathogen.
● Public health programs raise levels of awareness and knowledge about the causes and
transmission of infectious disease. This enables people to make more informed choices based
on scientific knowledge.
● Pesticides are designed to kill pathogens directly or eliminate the vectors that transmit them.
● Genetic engineering is one option for creating organisms that are resistant to the effects of the
pathogen without having to rely on costly vaccination programs.
446 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
13_bio_InFocus12_2e_sb_08851_txt.indd 446 08/08/18 7:34 pm
1 What is the aim of quarantine in relation to disease prevention?
CHECK YOUR
UNDERSTANDING
2 Provide two reasons why Australia is a difficult country to quarantine.
3 Australia’s quarantine procedures are some of the strictest in the world. Justify the strict quarantine 13.2b
procedures employed for animals, plants and humans at airports and seaports in Australia.
4 Explain why booster shots are necessary.
5 Distinguish between active acquired immunity and passive acquired immunity.
6 Assess the effectiveness of the RICE approach to infectious disease limitation (Fig. 13.10).
7 How would you respond to the claim that pesticides are effective in the short term for eliminating vectors
but in the long term have serious negative consequences that outweigh the short-term benefits?
8 Evaluate the data in Figure 13.11. What types of variables would have to be controlled to draw a valid
conclusion about death rates from infectious disease and the introduction of vaccination programs for
various infectious diseases?
160
Source: healthsentinel.com (www.healthsentinel.com/Vaccines/Vaccines.htm)
Measles
Scarlet fever
140 Whooping cough
Data gap (pertussis)
Diphtheria
120
100
Deaths per 100000
Diphtheria vaccine: Pertussis vaccine:
80 started use in widespread use in
the 1920s the 1950s
60 Data gap
Measles vaccine:
introduced1968
40
20
0
38
44
86
50
56
62
68
74
80
92
98
03
09
15
21
27
33
39
45
51
57
63
69
75
18
18
18
18
18
18
18
18
18
18
19
19
19
19
19
19
19
19
19
19
19
19
19
18
Year
FIGURE 13.11 Mortality rates from infectious diseases in England and Wales before and after the introduction of vaccination
Pharmaceuticals for controlling
13.3
infectious disease
The term chemotherapy has become very much associated with cancer treatment. However, in clinical
terms, ‘chemotherapy’ means the use of any drug to treat any disease. The chemotherapeutic approach
to infectious disease control involves the use of medications to control infectious diseases in humans,
plants and animals. Antimicrobial agents are designed to control infectious diseases caused by microbes.
9780170408851 CHAPTER 13 » PREVENTION, TREATMENT AND CONTROL OF DISEASE 447
13_bio_InFocus12_2e_sb_08851_txt.indd 447 08/08/18 7:34 pm
The main classes of antimicrobials are listed in Table 13.2.
TABLE 13.2 Classes of antimicrobial drugs
CLASS OF MEDICATION PATHOGENS TARGETED EXAMPLES
Antibiotics (antibacterials) Bacteria Penicillins, tetracyclines, polymixins, sulfonamides,
cephalosporins
Antivirals/ antiretrovirals Viruses • Tamiflu® (oseltamivir) used to treat influenza
(antiviral)
• Abacavir (antiretroviral used in HIV/AIDS
treatment)
Antifungals Fungi Fluconazole, amphotericin B, caspofungin
Antiprotozoals Protozoa Doxycycline, metronidazole, mefloquine
Antiviral medications
Antiviral medications are used to control viral infections. They do not kill viruses, but inhibit their
development inside infected cells. They do not cure the disease but simply slow down its progress,
allowing the body’s natural defences to take over. If taken early in the course of the disease, symptoms
will be milder and of shorter duration. They stop the spread of viral diseases and therefore are a useful
addition to the control of epidemics and pandemics.
Many people in the developing world may carry a number of viruses, including hepatitis B and C, and
HIV. Management of these viral infections is complicated – simply dosing people with antiviral drugs
does not ensure a cure. One of the major problems in the developing world is access to medications and
compliance with dosing regimens. Many of these drugs need to be taken for months or for life.
Antivirals are a relatively recent development compared to antibiotics. The viruses most commonly
targeted by antiviral drugs include:
◗ HIV (HIV is the virus; AIDS is the disease caused by the virus)
◗ seasonal influenza A
◗ herpes
◗ hepatitis B and C.
Viruses use the host’s cells to produce new virus particles, making it very challenging to develop a
class of drugs that stops viral replication without killing the host cells. With the rise of the HIV epidemic
in the 1980s, there was a coordinated global medical research effort that led to great advances in our
understanding of the biology of the virus.
The genetics of viruses vary in the following ways:
◗ They may contain DNA or RNA.
◗ The genetic material may be single-stranded (ss) or double-stranded (ds). For example, the hepatitis
B virus is a dsDNA virus; HIV is a ssRNA virus.
Once the life cycle and genetics of viruses were better understood, scientists identified a number of
possible target stages for antiviral drugs. Figure 13.12 shows the main stages in viral replication in a host
cell. Combination therapy targeting different stages of the virus life cycle may enhance the effectiveness
of antiviral management.
Three antiviral medicines to treat influenza are registered for use in Australia:
◗ oseltamivir (Tamiflu®)
◗ zanamivir (Relenza®)
◗ amantadine (Symmetrel®).
448 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
13_bio_InFocus12_2e_sb_08851_txt.indd 448 08/08/18 7:34 pm
FIGURE 13.12
Stages in the
replication of a virus
5 Release of
in a host cell
new viruses
from host cell 1 Attachment
and infection to host cell
of new cells
4 Viral 2 Release of
particles viral genome
assembled and enzymes
into a into host cell
complete virus
3 Viral
replication
using host cell
machinery
These compounds are effective against seasonal influenza A strains, but scientists are still cautious
about their effectiveness against a pandemic of influenza A subtype H1N1. There is evidence of beneficial
effects in patients with lower respiratory complications, such as pneumonia. Reduced death rates were
associated with the use of Tamiflu® and Relenza® during pandemics in 2009–2011. Further trials are
needed. The question of efficacy is important, as nations stockpile these types of medications in case of
a pandemic. The efficacy of a medication is its ability to produce the desired outcome. These drugs have
greater efficacy when taken early in the course of the illness. There are concerns, however, about the
safety of their widespread administration to populations during outbreaks.
Antibiotics
Antibiotics are used to control bacterial infections. They work by either killing or slowing down the
growth of bacteria. Antibiotics are not effective against viruses.
Antibiotics are most effective when:
◗ they are used solely for the treatment of bacterial infections and not viral infections
◗ bactericidal antibiotics are used to kill rather than inhibit growth of the bacteria (penicillins,
cephalosporins)
◗ narrow-spectrum antibiotics are chosen that target the specific pathogen
◗ they are able to get to the site of infection and kill the bacteria (the blood–brain barrier, necrotic and
granulating tissue may be barriers)
◗ therapeutic blood levels are maintained
◗ the whole course is taken, to reduce the risk of bacterial resistance – although a recent scientific
paper has questioned the validity of this central dogma of antibiotic treatment. Doctors will need to
wait and see what subsequent studies may find before they change this practice
◗ a Gram stain and culture and sensitivity tests are done, to ensure that the appropriate antibiotic
has been chosen and that the bacterium has been correctly identified as the causal agent of the
disease.
9780170408851 CHAPTER 13 » PREVENTION, TREATMENT AND CONTROL OF DISEASE 449
13_bio_InFocus12_2e_sb_08851_txt.indd 449 08/08/18 7:34 pm
INVESTIGATION 13.3
The effect of introducing penicillin on death rates from infections
Information and Antibiotics selectively kill or inhibit bacteria. In this way, they contribute to the control of infectious disease
communication
technology by reducing the pool of living bacteria available in hosts. Antibiotics have no efficacy against viruses. The
capability discovery of penicillin by Alexander Fleming in 1928 and the subsequent commercial development of
antibiotics has had a dramatic effect on death rates from bacterial infections. This is most notable in the
reduction in infant mortality and perinatal deaths of mothers.
METHOD
Use the data in Figure 13.13 to analyse the relationship between death rates from infectious diseases and the
introduction of penicillin (an antibiotic) in the early 1940s.
RESULTS
1 Justify the addition of chlorine to drinking water, based on the information in Figure 13.13. How does this
reduce the death rate from infectious disease?
2 What is the general trend in the graph over the 20th century?
3 What effect did the introduction of penicillin have on death rates from infectious diseases?
4 What was happening in the world at the time that penicillin was introduced? Comment on the ‘good
timing’ of its introduction.
5 Use online secondary resources to gather information about the first introduction of penicillin.
a How was it administered (tablet, injection or other)?
b What effects did doctors report, especially those who were field medics in the army during WWII?
c How is penicillin made? What is the source of the active ingredient?
Source: Centers for Disease Control and Prevention
1000
40 States have
health Influenza pandemic
departments
Annual death rate (per 1000)
800
600
Last human-to-human
transmission of plague
400 First use of penicillin
First continuous Salk vaccine introduced
municipal use of Passage of Vaccination
200
chlorine in water in US Assistance Act
0
1900 1920 1940 1960 1980 2000
Year
FIGURE 13.13 Death rates from infectious diseases in the USA, 1900–1996
CONCLUSION
Comment on the relationship between the introduction of penicillin and death rates from infectious disease.
450 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
13_bio_InFocus12_2e_sb_08851_txt.indd 450 08/08/18 7:34 pm
Antibiotic resistance
Bacterial resistance limits the effectiveness of antibiotics in controlling outbreaks of infectious diseases.
This problem arises as an antibiotic becomes less effective over time in treating a particular bacterial
disease. The rise of MRSA (methicillin-resistant Staphylococcus aureus or ‘golden staph’) in hospitals is of
particular concern.
You are aware of the effect of a selection pressure on a population of organisms. In the presence of
a mutation or gene (genotype) that confers resistance to an antimicrobial substance, bacteria are able
to survive or grow in higher antimicrobial concentrations than most other bacterial strains of the same
species (phenotype). Overuse of antibiotics during the 20th century has caused this serious problem.
KEY CONCEPTS
● Pharmaceuticals are used to treat infectious diseases caused by pathogens.
● Pharmaceuticals reduce the available pool of pathogens in hosts and therefore limit
transmission rates.
● Antibiotics target bacterial pathogens by slowing their multiplication rate or killing them directly.
● Antivirals are a relatively new class of pharmaceuticals and are used in the treatment of viral
diseases such as influenza and HIV/AIDS.
● Bacterial resistance to antibiotics is a major challenge and is mostly due to the overuse of
antibiotics during the 20th century.
CHECK YOUR
1 Distinguish between antivirals and antibiotics.
UNDERSTANDING
2 List the viruses most commonly targeted with antiviral drugs. Explain why.
3 Explain why it is necessary to understand the biology of viruses in order to manage them. 13.3
4 List three situations when antibiotics are most effective.
5 Explain how bacteria are developing resistance to antibiotics.
6 Imagine that you are a doctor in a suburban medical practice. It is winter and a particularly virulent strain of
influenza is spreading through the community. Many school students are infected. A mother brings in her
Year 6 child, who is coughing and sneezing and has a high temperature. Using a special diagnostic test kit,
you diagnose influenza. The mother insists on antibiotics for her child, but there are no signs of a secondary
bacterial infection at this stage. What advice do you give the parent? Justify your answer.
Environmental management
13.4
and quarantine methods
When an outbreak of infectious disease occurs, it is important for scientists to carry out a full evaluation
of their management strategies. Meticulous collection of data and other observations help scientists to WS
evaluate such things as routines and procedures, the effect of medications, the training of staff, and other
Limiting the
issues. In this way, recommendations can be made to make the process more efficient and successful the spread of an
infectious
next time a similar event occurs. disease–polio
Case study: Ebola virus disease 2014–2016
Ebola virus disease is a severe infectious disease caused by the Ebola virus. It is extremely contagious
and causes rapid death. Ebola is a ssRNA virus with many subtypes. It is, however, easily preventable.
It spreads when people have close direct contact with body fluids and mucous membranes (as well as
items contaminated by these) from infected individuals, including sexual transmission.
9780170408851 CHAPTER 13 » PREVENTION, TREATMENT AND CONTROL OF DISEASE 451
13_bio_InFocus12_2e_sb_08851_txt.indd 451 08/08/18 7:35 pm
Ebola virus first appeared in Africa in 1976. A large outbreak occurred in West Africa in 2014–2016.
‘Patient zero’ appears to have been a two-year-old child who died in southern Guinea in December 2013.
Transmission is most likely through close human contact with wild animals who are reservoirs of the
virus ( for example, by consuming their meat) – reservoirs may be the body tissues and fluids of apes,
antelope, fruit bats and porcupines. In fact, fruit bats are suspected to be the natural reservoir. Burial
rituals that involve direct contact with the body of an affected person can contribute to transmission.
The incubation period is between 2 and 21 days. Symptoms start as fever and tiredness, headache
and a sore throat. This progresses to vomiting, a rash, diarrhoea, and oozing of blood from the mucous
membranes and stools. The bleeding is due to a coagulation failure resulting from liver damage (a healthy
liver produces clotting factors).
Management of the disease is supportive, with intravenous or oral fluids to replace losses and
maintain circulating blood volume, broad-spectrum antibiotics to prophylactically manage potential
secondary bacterial infections, antipyretics for fever, and analgesia for pain.
The death rate of this outbreak (of 9216 confirmed cases) was around 50%. Cases were documented
in six countries outside Africa.
Control of the epidemic
Preventing the transmission of pathogens in the clinical setting of a serious epidemic requires the use of
procedures and protocols called controls. These include environmental and quarantine measures.
Administrative controls involved the initial organisation of the response and deciding which people
were responsible for which parts of the overall management strategy, and obtaining funding.
Environmental and engineering controls included provision of facilities for barrier nursing (that is,
providing care in strict infection control conditions) and work spaces, water and hygiene controls, hand
hygiene and safe waste management (leak-proof bags and covered bins, ventilation control, sterilisation
of patient care equipment and linen). Another important aspect was the provision and maintenance of
personal protective equipment (PPE), including gown and coveralls, gloves, face shield, waterproof boots,
head cover and respirator (Fig. 13.14). All health workers and visitors were trained to use this equipment
correctly (Fig. 13.15).
Getty Images/Carl De Souza/AFP
AAP Image/Mick Tsikas
FIGURE 13.14 Health workers wearing PPE bring food to patients FIGURE 13.15 A health worker undergoing training in Darwin
kept in isolation at an Ebola treatment centre in Sierra Leone.
Quarantine/isolation procedures were carried out by isolating patients in a single room or otherwise
providing a space of at least three metres between patient beds. The same clinical staff were assigned to
a single patient, as was all the medical equipment for their care (such as stethoscopes). All visits were
restricted, except for parents of a child. Disposal of all sharps (needles, scalpels) in a puncture-proof
container was vital to prevent needle-stick injuries. Contaminated environmental surfaces were cleaned
452 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
13_bio_InFocus12_2e_sb_08851_txt.indd 452 08/08/18 7:35 pm
and disinfected with 0.5% chlorine solution as soon as possible after exposure to a patient. All surfaces
were cleaned with detergent once a day and cleaners also wore PPE. When laboratory staff were using
equipment that could aerosolise (disperse through the air) the virus (when centrifuging blood samples,
for example), respirators were worn. Samples taken from infected humans and animals were handled
only by trained staff and processed in properly equipped laboratories. Any tissues or body fluids for
disposal were placed in clearly marked sealed bags for incineration. Any exposed person was isolated
and monitored for 21 days after exposure, to help reduce transmission.
All Ebola survivors and their sexual partners received
Getty Images/Dominique Faget
counselling and were advised to use condoms until two
negative results were obtained for virus presence in semen. The
virus may persist in recovered individuals in the testes, eyes and
nervous system. It can be shed in breast milk. This may occur
for up to nine months after infection. Border checkpoints were
established with armed guards, to prevent movement of people
in and out of the quarantine area (Fig. 13.16).
Longer-term measures include reducing wildlife-to-human
transmission by ensuring that meat is cooked thoroughly.
Wearing gloves is also recommended when handling animal
reservoirs. Poverty is a driving factor for the hunting of these
animals, both as food and for the pet trade.
FIGURE 13.16 Soldiers from the Liberian army monitor a border
Cultural beliefs and practices may prevent individuals checkpoint as part of efforts to control the Ebola outbreak.
seeking care at hospitals; instead they may consult traditional
and spiritual healers. Working with community leaders could
help to better manage this problem. Mistrust of governments
and foreign workers may lead to the destruction of treatment
Getty Images/Carl De Souza/AFP
units and even the murder of staff; this is a major limiting factor
to controlling Ebola outbreaks that must be addressed in the
future.
Reducing human-to-human transmission through good
hygiene and environmental control procedures during and after
infection is vital. Reducing the risk of sexual transmission through
the use of safe sex and hygiene for 12 months after infection is one
way of establishing good infection control in this area.
Outbreak containment measures may include prompt and
safe burial of the dead (Fig. 13.17). After the outbreak has been
contained, mandatory quarantine for workers returning from
Ebola-affected countries should be a standard requirement. FIGURE 13.17 An Ebola victim being buried a grave in the village of
An earlier and more robust response might have controlled Kailahun, Sierra Leone.
the epidemic sooner. The appearance of cases in the USA and
Europe made the international community respond more
vigorously.
WS
KEY CONCEPTS
● Managing the environment during an epidemic reduces the pool of available pathogens.
● Quarantine measures are designed to reduce the possibility of transmission of pathogens from Controlling an
infected to non-infected hosts. epidemic or
pandemic
● Meticulous planning is part of epidemic and pandemic management, and includes education
and training for all staff involved.
● Successful management of a pandemic requires goodwill and cooperation between the
population and health workers.
● The Ebola epidemic of 2014–2016 is a good example of a successful strategy to limit the spread
of a highly infectious viral disease.
9780170408851 CHAPTER 13 » PREVENTION, TREATMENT AND CONTROL OF DISEASE 453
13_bio_InFocus12_2e_sb_08851_txt.indd 453 08/08/18 7:35 pm
CHECK YOUR 1 What is Ebola?
UNDERSTANDING
2 How is Ebola transmitted between hosts?
13.4 3 What is the length of the incubation period? What does this mean?
4 For each of the following categories, state what controls were put in place to prevent the transmission of
the pathogen:
a environmental
b quarantine
c long-term.
5 Evaluate the effectiveness of the control measures put in place in the case of Ebola, in view of the data in
Figure 13.18.
Source: Adapted from Centers for Disease Control and Prevention
600
Guinea
500
Reported new cases of
Liberia
Ebola per week
400 Sierra Leone
300
200
100
0
Mar Apr May Jun Jul Aug Sep Oct Nov Dec Jan Feb Mar Apr May Jun Jul
2014 2015
Pre-EOC activation 1st quarter EOC 2nd quarter EOC 3rd quarter EOC 4th quarter EOC
FIGURE 13.18 Reported cases of Ebola from March 2014 to July 2015 (EOC: Centers for Disease Control Emergency Operations Center)
13.5 Incidence and prevalence of a disease
The control of infectious disease outbreaks may have a new and powerful ally in the online world.
When people get sick, they commonly turn to the Internet to research their symptoms. Social media is
a forum for letting their friends and families know how sick they are and the details of their symptoms.
Each of these interactions with the online environment is time stamped and possibly even geo-tagged
(geographically identified). Digital epidemiology may be a way to trace, in real time, the way in which an
infectious disease is moving through a population. Although this promises to be a valuable source of
data, considerations such as privacy issues will prevent this happening for some time.
For now, the accumulation of real-time data on infectious diseases is currently managed in Australia
by both Federal and State/Territory governments. Much progress has been made over the last 100 years,
and deaths from infectious diseases have been reduced from 13% of deaths to just 1.3% in 2009. The
constant threat of new and emerging diseases as well as the re-emergence of old diseases (tuberculosis,
pertussis, measles) requires a robust system of data gathering and analysis.
The type of data that must be collected includes:
◗ incidence and prevalence of the disease – determines the pool of pathogens already present in
a population
◗ mobility of the population – determines how easy it is for the pathogen to spread
454 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
13_bio_InFocus12_2e_sb_08851_txt.indd 454 08/08/18 7:35 pm
◗ percentage of the population that is immunised against an infectious disease – determines what
proportion of the population are vulnerable and may act as carriers for the pathogen.
Incidence
The incidence of an infectious disease is the number of new cases occurring during a specified time. It
can also be thought of as the infection rate, or the probability (risk) of contracting the disease. It can be
expressed as a percentage (number per 100) or as a number per 100 000 (or 1000 or 10 000 and so on) of
the population.
To calculate the incidence of a disease as a percentage, the following formula can be used:
number of new cases during a specified time
× 100
size of population at start of monitoring period
For example, of 1000 students in a school, 25 new cases of influenza appeared this week.
25
incidence/risk = × 100 = 2.5%
1000
The risk of a student getting the disease that week was 2.5% or 2.5 new cases per 100 population.
Prevalence
The prevalence of a disease is the proportion of the population that have the disease at a particular point
in time. Whereas incidence refers only to new cases, prevalence refers to all cases, both previous and
current. Prevalence is also expressed as a percentage.
The prevalence of a disease can be calculated using the following equation:
all new and previous cases during a time period
× 100
population during the time period
For example, a survey was conducted in the same school on the total number of students who had
experienced influenza over the three months of winter. There were 1000 students in the school, and
150 students had contracted influenza in that winter.
150
prevalence = × 100 = 15%
1000
So 15% of the student population (or 15 out of 100) had experienced the disease during winter.
Mobility
The mobility of a population is an important factor in the assessment of potential disease outbreaks.
Humans act as carriers for pathogens and may spread the disease to new locations when they move.
The Australian Bureau of Statistics maintains data records on the movement of people within Australia The Australian
Bureau of
from state to state as well as migration rates from overseas. Just as importantly, social trends, such as Statistics
numbers of Australians who travel overseas by plane and boat each year, are carefully monitored. In the
case of Ebola, the mobility of the population played a key role in both the spread and the containment
of the disease.
The rate of immunisation of a population is a key factor in analysing data relating to infectious disease.
The Australian Government’s Immunise Australia Program aims to promote and inform people about
the value of immunisation in reducing disease transmission through a community. When a significant
proportion of the population have been immunised, this creates herd immunity. Herd immunity relies on Immunise
Australia
high numbers of individuals being vaccinated, to reduce the chances of unvaccinated individuals coming Program
into contact with the disease-causing microbe. When a population has herd immunity, everyone in that
population, including unvaccinated individuals, is protected against epidemics.
9780170408851 CHAPTER 13 » PREVENTION, TREATMENT AND CONTROL OF DISEASE 455
13_bio_InFocus12_2e_sb_08851_txt.indd 455 08/08/18 7:35 pm
INVESTIGATION 13.5A
Investigating the incidence and prevalence of malaria in Cambodia
Malaria remains one of the leading causes of death of children in South-East Asia. The infecting microbe is
Numeracy
Plasmodium falciparum, carried by various species of Anopheles mosquito vector. Figure 13.19 shows the
total number of malaria cases treated in Cambodia between 2000 and 2011. Table 13.3 lists the Cambodian
population in 2000, 2005 and 2010. Use this information to answer the questions that follow.
Sylvie Manguin, Source: Epidemiology Unit, CNM, 31 Jan. 2012, page 292.
Graph from: Anopheles mosquitoes - new insights into malaria vectors’ - book edited by
140 12
11.0 10.8
Total treated cases
120 Incidence rate per 1000
9.6 10
8.6
Incidence rate per 1000 population
No. cases malaria treated (‘000)
100 7.5 7.2
8
80 6.2
5.5
60 6
4.2 4.1 4.3
4.1
40
4
20
2
10
0 0
2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011
Year
FIGURE 13.19 Incidence rate of malaria treated cases per 1000 population, Cambodia, 2000 to 2011
TABLE 13.3 Population of Cambodia
YEAR POPULATION (MILLIONS)
2000 12 447
2005 13 358
2010 14 138
QUESTIONS
1 What is the general trend shown in Figure 13.19?
2 What was the incidence of malaria in the Cambodian population in:
a 2000
b 2005
c 2010?
3 What was the prevalence of malaria in the Cambodian population in:
a 2000
b 2005
c 2010?
4 Provide three possible reasons for the significant drop in the number of cases of malaria being treated in
2007 and 2008, from the peak in 2003.
456 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
13_bio_InFocus12_2e_sb_08851_txt.indd 456 08/08/18 7:35 pm
KEY CONCEPTS
● Data collection is vital in controlling infectious disease outbreaks.
● Epidemiological studies help to identify patterns, causes and effects of disease conditions.
● Management strategies require constant monitoring and up-to-date information.
● Important data to be collected includes the incidence and prevalence of the disease, the
mobility of the population and rates of immunisation.
● Malaria and dengue fever are infectious diseases of concern in South-East Asia, and require
accurate data collection if they are to be managed effectively.
CHECK YOUR
1 Use examples to distinguish between the incidence and prevalence of a disease.
UNDERSTANDING
2 Out of 500 students at a school, 30 new cases of influenza appeared in a week. Calculate the incidence of
the disease at this school. 13.5
3 A city has a population of 150 000. In this city, 10 000 people contracted an infectious disease. Calculate the
prevalence of the disease in this population.
4 Every four years, a large number of people from nations all over the world gather at the Summer Olympic
Games. Comment on the potential risks of an event like this for the potential transmission of infectious
diseases. What steps might organisers take to reduce the likelihood of disease outbreaks at such events?
5 Suggest reasons why it is unwise for an individual to rely on herd immunity instead of being vaccinated
against a disease.
6 What steps would you take as an individual to avoid contracting an infectious disease on a long - haul plane flight?
Predicting and controlling
13.6
the spread of disease
The word epidemiology derives from the Greek words meaning ‘the study
Source: NSW State Archives
of people’. In terms of infectious disease, epidemiology is the study of
the incidence and distribution patterns of disease that lead to its cause,
management and control.
Historic control of the spread of disease
Quarantine measures were first used in Dubrovnik, Croatia, in 1377 to
control the outbreak of plague. The first permanent plague hospital, or
lazaretto, was opened on the island of Santa Maria di Nazareth in 1423.
In 1467, a similar hospital for leprosy patients was opened in Marseille,
France. Lazarettos were strategically located so that they had a natural
barrier such as a sea, river or mountain, to separate them from populated
areas. Similar strategies were used during the global SARS (severe acute
respiratory syndrome) outbreak in 2003, when sufferers were isolated
either in hospitals or in their homes. Such strategies were used to contain
infection and to delay the spread of the disease; from a social point of view,
they also helped avert panic and maintain social stability.
It would probably surprise many young people to know that Sydney
has experienced many epidemics during its short history: measles
(1866–67), scarlet fever (1876–76), smallpox (1789, 1881–82, 1913–17), the
Asiatic Flu pandemic (1890–91), plague (1900) and the Spanish influenza
FIGURE 13.20 Plague Proclamation poster displayed
pandemic (1918–19). The responses to these early epidemics laid the in Sydney, 1 February 1905
foundations for the public health system in New South Wales.
9780170408851 CHAPTER 13 » PREVENTION, TREATMENT AND CONTROL OF DISEASE 457
13_bio_InFocus12_2e_sb_08851_txt.indd 457 08/08/18 7:35 pm
INVESTIGATION 13.6
Historic control of a disease outbreak
Information and John Snow is known as the ‘father of field epidemiology’. He proposed and tested hypotheses regarding the
communication
technology 1854 epidemic of cholera in London (Golden Square). His use of maps to record deaths was a key factor in
capability pinpointing the source of the pathogen to a single water pump in Broad Street.
AIM
To evaluate the contribution of the work of
Literacy
Alamy Stock Photo/Pictorial Press Ltd
John Snow to the prediction and control of
infectious disease spread
METHOD
WS
1 a Use printed and online sources to
Preventing the investigate the following aspects of
spread of an
infectious John Snow’s identification of the cause
disease - polio of cholera:
i the date of the outbreak
ii the location
iii symptoms observed in patients
iv statistics on the prevalence of the
disease during this outbreak
v historical/cultural explanations
for the disease at the time and
effectiveness of control methods
FIGURE 13.21 John Snow’s map of cholera cases in London
vi Snow’s methodology in
approaching the study of the
disease
vii statistical data including maps and tables
viii Snow’s proposed cause and solution, and responses by the authorities at the time.
b Evaluate the effectiveness of John Snow’s epidemiological approach to the Golden Square cholera
outbreak.
2 Record all data in the appropriate format.
3 Present a reference list in the appropriate format.
4 Present your findings in a format agreed upon with your teacher.
DISCUSSION
1 Do you agree that John Snow is the ‘father of field epidemiology’? Use what you have learned about him to
justify this statement.
2 Evaluate John Snow’s approach to disease control against the scientific method.
3 What can modern-day epidemiologists learn from John Snow?
458 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
13_bio_InFocus12_2e_sb_08851_txt.indd 458 08/08/18 7:35 pm
Cultural control of the spread of disease
Culture refers to integrated patterns of human behaviour, including the language, thoughts, Intercultural
understanding
communications, actions, customs, beliefs, values and institutions of racial, ethnic, religious or social
groups. Some cultural beliefs can hamper attempts to prevent and contain a disease.
In 2014, the Ebola outbreak in Africa was able to spread because of a combination of poverty, famine WS
and corruption, along with the traditional ritual of paying respects to the deceased through close contact
Preventing
with the corpse. Control measures needed to include educating the public to abandon these traditional mosquito-borne
diseases by using
cultural belief systems. vector control
Different cultures have developed ways of controlling disease, even without fully understanding the
true nature of it. In the Philippines, traditional foods play a large part in preventing and curing disease. Epidemiology is
Garlic and onions are believed to lower blood pressure. It is now known that onions contain quercetin, discussed
in detail in
which is a natural supplement that aids in lowering blood pressure. Mosquito nets were said to have been Chapter 16.
used by the Egyptian queen Cleopatra (69–30 BCE) even though the connection between malaria and
mosquitoes was not known.
KEY CONCEPTS
● Historically, different strategies including quarantine have been used to prevent the spread Sociocultural
of disease. factors in the
control and
● John Snow is known as the ‘father of field epidemiology’. prevention
● Disease control is influenced by culture, and this needs to be taken into account when of parasitic
developing control measures. diseases
CHECK YOUR
1 Define ‘epidemiology’. UNDERSTANDING
2 How does quarantine assist in controlling infectious diseases?
3 Who is John Snow and why is his work with cholera considered important?
13.6
4 How does culture influence the spread and treatment of infectious diseases?
5 Use the weblinks to find out what sociocultural factors influence the spread and treatment of infectious
diseases.
Aboriginal protocols in the
13.7
development of medicines
Many indigenous cultures around the world have used traditional methods to treat infectious and non-
infectious diseases. Aboriginal Australians are the custodians of a rich and detailed knowledge base of
medicinal native Australian herbs, fruits and vegetables. Traditionally, Aboriginal people lived healthy
Social and
lives. However, on occasion there was a need to manage wounds from burns, stings and bites as well as cultural factors
in the successful
food poisoning from meats. control of TB
Substances from plants such as tannins, mucilage, oils, latex and alkaloids were used for medicine.
The plant material was usually crushed and used as a poultice or infused with water to drink. Animal fat
was often incorporated into the plant material. This increased the fat solubility of the plant substance
and increased absorption rates into the tissues.
There has been a renewed interest in traditional Aboriginal medical knowledge. Databases are being
compiled by different groups to ensure that these traditional approaches to disease control are not lost.
One example of this is the Macquarie University Indigenous Bioresources Research group – see the
weblink.
9780170408851 CHAPTER 13 » PREVENTION, TREATMENT AND CONTROL OF DISEASE 459
13_bio_InFocus12_2e_sb_08851_txt.indd 459 08/08/18 7:35 pm
Scientists are now discovering that many bioactive compounds are contained in these traditional
bush medicines. Some contain antimicrobial properties that are useful in managing certain infectious
diseases. Alkaloid compounds from the Moreton Bay Chestnut (Castanospermum austral) or black bean
Customary
Medicinal are showing promise in the management of HIV/AIDS. It must be remembered that many of these plants
Knowledgebase
(CMKB) – database contain potentially deadly compounds as well. Aboriginal people use specialised preparation techniques
of native plants to minimise harmful effects.
In 1798, English botanist James Smith named the genus
Shutterstock.com/Emma Jones
Conospermum, meaning ‘cone seed’. These plants are commonly
known as smokebush and grow mostly in south-west Western
Australia, with some species occurring in NSW and Tasmania. Some
species of this plant have very big and woolly white flowers that
resemble drifting smoke (Fig. 13.22). These plants are a member of the
Proteaceae family. Indigenous people have used the smokebush for
healing. Scientists have now investigated the properties of this plant
and its potential uses against cancer and HIV/AIDS.
Bush medicine is a new branch of horticulture that promises
to be a fertile area for the development of new and effective
treatments against a range of pathogens. Scientists must separate
the useful from the deadly before these treatments can be used
FIGURE 13.22 Smokebush, used as a medicinal plant by
Indigenous peoples commercially.
INVESTIGATION 13.7
Aboriginal protocols in medicines and biological materials
Aboriginal AIM
and Torres
Strait Islander
histories and
1 To gather and process data on the current use of common biological materials by Aboriginal people
culture (bush medicine)
2 To establish how Indigenous cultural and intellectual property is to be protected
Sustainability
METHOD
1 Use online and printed resources to gather information on the properties and uses of the plants and
Ethical
understanding animals listed in the table below. You are not limited to these – your teacher will guide you as to the
number of materials to be researched.
2 Be sure to use publications that are authored or endorsed by Aboriginal or Torres Strait Islander people. You
may be able to involve local Aboriginal communities when gathering information. It is traditional uses that
you are investigating in this activity.
3 Use a table like the one shown here to record your results.
PLANT OR ANIMAL TRADITIONAL PROPERTIES AND USES AS ANTIMICROBIALS PHOTO
Emu bush leaves
Tea tree leaves
Kakadu plum fruit
Witchetty (witjuti) grub
460 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
13_bio_InFocus12_2e_sb_08851_txt.indd 460 08/08/18 7:35 pm
RESULTS
You could present your findings in a table like the one on the previous page.
QUESTIONS
1 Why is it preferable to gather information from sources that are authored by Aboriginal people? Outline
some of the possible problems when using sources that are not from the Aboriginal community.
2 Suggest reasons why it is more difficult to find information on bush medicine than Western forms
of medicine. Indigenous
people and
3 Discuss the role of traditional medicine in the modern world. Is there value in retaining the knowledge that intellectual
property
has been passed down for thousands of years?
4 Much of the knowledge about traditional medicines is handed down orally and has not been written
down. Suggest a way in which we might be able to record this knowledge for future generations so it is
not lost forever.
5 What does the law say about indigenous people, biodiversity and their intellectual property? (See the
weblink.)
Use the Internet to answer the following questions.
6 To take out a patent on a piece of technology or idea, what steps must be taken? What features of
intellectual property must be satisfied for a patent to be awarded?
7 Do you consider Western intellectual property laws to be biased against the rights of indigenous peoples?
Use evidence from your research to justify your answer.
8 Research the re-discovery by Western scientists of the WA smokebush in the 1960s. What financial and
legal arrangements were made between the WA government and the Australian pharmaceutical company
AMRAD? Did Aboriginal people receive any recognition of their traditional knowledge or financial benefit
from the exploitation of the plant?
CONCLUSION
Summarise the ethics using bush medicines, and their value to the health and wellbeing of Aboriginal people.
KEY
CONCEPTS
● Traditional medicine, such as Aboriginal bush medicine, is a valuable source of knowledge that
needs to be preserved for future generations.
● The intellectual property rights of Indigenous peoples are not well supported in Australia as yet.
1 An overseas tourist finds a previously unknown species of plant in the outback. They claim that chewing
CHECK YOUR
UNDERSTANDING
the plant relieved their indigestion. The plant grows in an area traditionally owned by Aboriginal peoples.
a Who owns the plant? What does the law say? 13.7
b Does the tourist have any intellectual property rights to this biological material? Could they take out a
patent and sell the plant as an indigestion medicine?
9780170408851 CHAPTER 13 » PREVENTION, TREATMENT AND CONTROL OF DISEASE 461
13_bio_InFocus12_2e_sb_08851_txt.indd 461 08/08/18 7:35 pm
13 CHAPTER SUMMARY
Prevention, treatment and control of disease: How can the spread of infectious diseases be controlled?
Monitoring and control Factors affecting disease outbreaks
The three levels of disease monitoring and control Pathogen factors
Global,
regional and local
Environmental/
Societal factors factors involved in geographic factors
disease
transmission
Local Regional Global
Host factors
Personal and community hygiene Biosecurity
Sterilisation
DAWR has many roles in keeping infectious diseases out of Australia
of medical
equipment
Sewage and City planning
Surveillance &
garbage to avoid diagnostics
disposal overcrowding (understand and quantify
the impact of pests
Data & intelligence and diseases) Treatment &
(prevent exotic pests and
recovery
diseases from entering
(demonstrate the absence
Community and establishing in
of pests and diseases)
Australia) PREPAREDNESS
hygiene
PREVENTION ERADICATION
National biosecurity
RD&E priorities
Use a tissue
to cough or
sneeze Communication,
Body, hair Risk & decision tools community attitudes
Hand (improved & awareness
and teeth decision-making (socioeconomic drivers
washing
cleaning tools and risk analysis) of adopting best
General practice)
surveillance
(manage the pests and
CONTAINMENT diseases that are already ENGAGEMENT
Personal in Australia)
hygiene
MANAGEMENT
Public health campaigns
Three levels of approach to infectious disease limitation
Genetic
engineering
Hygiene
Pesticides
practices
Resolution
Limit infectious
disease spread
Information
Public
health Quarantine
campaigns
Coordination Education
Vaccination
462 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
13_bio_InFocus12_2e_sb_08851_txt.indd 462 08/08/18 7:35 pm
Antimicrobial drugs
CLASS OF MEDICATION PATHOGENS TARGETED EXAMPLES
Antibiotics (antibacterials) Bacteria Penicillins, tetracyclines, polymixins, sulfonamides,
cephalosporins
Antivirals/ antiretrovirals Viruses • Tamiflu® (oseltamivir) used to treat influenza
(antiviral)
• Abacavir (antiretroviral used in HIV/AIDS treatment)
Antifungals Fungi Fluconazole, amphotericin B, caspofungin
Antiprotozoals Protozoa Doxycycline, metronidazole, mefloquine
Protocols
Control of an epidemic (e.g. Ebola)
Administrative protocols Environmental and Quarantine/isolation protocols
Who is ivolved and and how will it engineering protocols Infected people and contaminated
be funded Barrier nursing/hygiene objects do not leave the site (short
and long term)
Incidence and prevalence
Incidence Prevalence
The incidence of an infectious disease is the number of The prevalence of a disease is the proportion of the population that
new cases occurring during a specified time. have the disease at a particular point in time.
To calculate the incidence of a disease can as a all new and previous cases during a time period
percentage, use the following formula: × 100
population during the time period
number of new case during a specified time
× 100
population at start of monitoring period
Cultural controls
Incidence and
prevalance
Phillipines -
garlic and
onions
DATA
Mobility of
needed for Cultural
population
disease control practices
to limit
Egypt - disease Aboriginal -
mosquito alkaloids in
nets morton bay
Immunisation chestnut
rates
('her immunity')
9780170408851 CHAPTER 13 » PREVENTION, TREATMENT AND CONTROL OF DISEASE 463
13_bio_InFocus12_2e_sb_08851_txt.indd 463 08/08/18 7:36 pm
13 CHAPTER REVIEW QUESTIONS Qz
Review quiz
1 Explain why limiting infectious disease transmission does 13 In 2015, a famous Hollywood couple brought their
not rely on one factor alone but a combination of factors. Yorkshire terriers into Australia on a private plane,
bypassing quarantine. The then Australian Deputy Prime
2 Assess the effect of increased mobility of populations in
Minister and Minister for
the transmission of infectious diseases.
Agriculture was adamant
3 Imagine a scenario where garbage is not collected that the dogs, Pistol and Boo,
from homes and businesses for one month. How could needed to be immediately Johnny Depp’s dogs
individual householders manage their own disease risk removed from the country
during this crisis? or face being euthanased.
The couple eventually removed the dogs and issued
4 Justify research into alternatives to antibiotics in the
an apology in the face of legal action by the Australian
treatment of bacterial diseases. Is it possible to avoid using
Government.
pharmaceuticals entirely?
In your opinion, did the Australian Government overreact?
5 Compare the disease transmission risk between an Assess the claim made by the minister that the dogs
overcrowded city such as Jakarta with a spacious city such posed a biosecurity risk. Read more about it in the
as Perth, WA. Assess the factors that are most likely to be weblink.
of greatest concern in an overcrowded city.
14 Fears are spreading about the appearance of a new
6 Compare and contrast tissues and handkerchiefs in terms ‘superbug’ strain of the malarial parasite Plasmodium
of their ability to limit transmission of infectious diseases. falciparum. The new strain has been reported in five
7 Evaluate the effectiveness of a current public health South-East Asian countries but is of particular concern
campaign in limiting disease transmission. What along the border between Cambodia and Thailand. Why
aspects would you change to increase awareness and is the likelihood of the spread of this pathogen greater
compliance? now than in past centuries? Assess some of the factors
involved.
8 Assess Australia’s role in allowing Indigenous people to
claim intellectual property rights on biological materials. 15 In 2017, a new study questioned the long-held belief of
scientists that it is essential to complete the entire course
9 Airborne transmission of pathogens such as pulmonary of antibiotics you are prescribed. The opinion piece was
tuberculosis, measles and chickenpox is of great concern published in the British Medical Journal. Would you take
to public health authorities. Assess the reasons why this report at face value? What more information would
airborne pathogens require stricter hygiene precautions in you like to know? Where would you look for further
hospitals than waterborne diseases such as giardia. information on this very important topic?
10 How would you advise a worker who is responsible for the 16 Antibiotics have been found in samples taken from
safe disposal of biological waste in a hospital? What types Australian waterways. Suggest some of the ways in
of protocols would protect the worker and the public which antibiotics used in animals and humans could
from this potential source of pathogens? make their way into our waterways. What are the
11 Australia is relatively free of natural disasters such as possible consequences of this for the health of the
earthquakes and hurricanes, where infectious diseases environment?
often increase. What role do you think Australia should 17 Describe what the world would be like if antibiotics and
play in offering assistance to other nations that experience antivirals did not exist.
natural disasters? Do we have a ‘duty of care’ to other
countries? 18 In what way do antibiotics and antivirals affect evolution
by natural selection in humans and animals?
12 If pathogens are the cause of infectious disease, explain
why scientists allocate resources to investigating the 19 Pharmaceutical companies are often criticised for the high
features of target host organisms. What potential benefit price of pharmaceuticals. Use secondary resources to find
could arise from understanding the host’s involvement in out some of the stages involved in the development of a
disease spread? new chemical entity. Find out how much it costs in time
and money, and then assess whether the high prices are
justified.
464 CHAPTER SEVEN
MODULE 11 » CHEMISTRY
» INFECTIOUS DISEASE 9780170408851
13_bio_InFocus12_2e_sb_08851_txt.indd 464 08/08/18 7:36 pm
20 Imagine that you are transported back to the time of 23 Imagine that the rates of a certain type of waterborne
Hippocrates (400 BCE). Assuming you can speak ancient disease are higher in a particular area in a big city in
Greek, what advice would you give Hippocrates about South-East Asia.
investigating the causes of a sudden outbreak of an a Outline the immediate steps you would take to
infectious disease in the local community? investigate the cause.
21 During the Spanish Flu outbreak of 1918–1919 in Sydney, b Make a list of the important data you would collect.
most workplaces and all schools were closed. Describe c What recommendations would you make regarding
what advantages we have today, if the same outbreak limiting transmission of the disease?
were to occur now. Why could most work and schooling
continue relatively unaffected? 24 You are a doctor and you are interviewing a patient who
has been using traditional bush medicine to manage their
22 When cultural practices clash with accepted hygiene headaches. The patient reports that 50% of the time the
practices, how should the situation be resolved? headache disappears. Outline an approach you would take
Brainstorm some ideas about ways in which both science to investigate the efficacy of the traditional medicine. What
and culture can work out such issues. Suggest an example information do you need to collect to be able to assess
of a situation where this occurs. whether the bush medicine is actually having an effect?
9780170408851 CHAPTER 13 » PREVENTION, TREATMENT AND CONTROL OF DISEASE 465
13_bio_InFocus12_2e_sb_08851_txt.indd 465 08/08/18 7:36 pm
» END-OF-MODULE REVIEW MODULE 7 : INFECTIOUS DISEASE
Answer the following questions.
1 A patient presents to their doctor with a red, raised and 4 Another student who does not study Biology argues that
itchy patch of skin that is weeping fluid. The doctor plants get sick because they do not have an immune
suspects an infection but is not able to pinpoint which system. How would you persuade them that this is an
pathogen is responsible. The doctor presses a microscope inaccurate assessment? Use specific examples.
slide onto the wound (an impression smear) and places
the slide under a microscope for examination. 5 Pharmaceuticals such as corticosteroids are useful in
a Which classes of pathogens would be visible under the the suppression of the inflammatory response in certain
light microscope? conditions (e.g. autoimmune disease). Patients are
administered an initial dose, which is gradually reduced
b What steps need to be taken to make the tissue more
over time. Justify the practice of doctors prescribing the
easily seen on the slide?
minimum dose of a corticosteroid that suppresses the
c What types of cells might the doctor see on the slide autoimmune disease.
if the body has launched an inflammatory response
against the pathogen? 6 ‘It is possible that immune responses that are meant to
protect us sometimes end up harming us.’ Justify this
2 You have been asked to design a new state-of-the art statement, using examples you have studied.
animal shelter for your community.
a What principles and protocols would you include 7 Despite advances in technology and education programs,
in your design to reduce the likelihood of infectious many sexually transmitted infectious diseases are on the
disease transmission between the animals in the rise again. Assess the reasons for this. Justify the statement
shelter? that infectious disease control involves not just good
b You notice that some of the dogs in a pen at the medicine but also compliance with guidelines.
end of a run are sneezing and coughing. Outline the
8 Evaluate the role of government agencies in control of
immediate steps you would take. Justify your actions
infectious diseases.
in terms of your understanding of the principles of
disease transmission. 9 Assess the role of social media as a tool for the collection of
c What advice would you give those who work in animal data on infectious disease rates in populations.
shelters regarding hygiene practices to limit the
transmission of infectious diseases? 10 Discuss the role of indigenous populations around the
world in contributing to the management of infectious
3 Many people in Sydney work in offices where large diseases.
numbers of staff are crowded into small spaces. Assess
this design in terms of disease transmission. As an
office manager, re-design an office space to reduce the
likelihood of colds and flu getting out of hand in winter.
Why might it make financial sense to a company to spend
money on a refit of their office space for this purpose?
466 MODULE SEVEN » INFECTIOUS DISEASE 9780170408851
13_bio_InFocus12_2e_sb_08851_txt.indd 466 08/08/18 7:36 pm
▻ Microbial analysis of drinking water. Is bottled water free of microbial contamination?
▻ Locate a tree doctor in your area. What are some of the latest techniques in treating infectious disease
and repairing wounds in plants?
▻ What is the effect of microgravity on the immune responses in plants? Send a plant experiment to the
International Space Station.
▻ If you have a vet school nearby, make contact with them and ask to be involved in some aspect of
research into the immune response in companion animals – for example, do birds respond in the
same way as dogs and cats to pathogens? What about fish?
▻ New discoveries in the use of stem cells for autologous transplants – can we store stem cells when we
are young and use them in the future in case of accident or illness?
▻ Vaccine production for new and emerging diseases.
▻ Is the innate immune system really incapable of forming memory? What are the latest animal models
telling us?
▻ Does sneezing into your elbow really reduce the number of pathogens you release into the air?
▻ How do vets manage infectious disease transmission in their hospitals? Contact your local veterinary
surgeon and ask to visit. Design your own veterinary hospital to ensure minimal risk of transmission of
pathogens. What design principles are important in waiting rooms, consultation rooms and surgical
suites? How are patients with highly infectious diseases (such as parvovirus-infected dogs) managed?
▻ How are infectious diseases controlled in refugee populations in camps? Design a refugee camp to
minimise the transmission of infectious diseases.
▻ Is simple hand washing enough to eliminate the spread of influenza through a school population?
▻ Assess the effectiveness of hospital hygiene protocols. Visit your local hospital and learn the principles
of design. Choose a particular aspect and redesign it to make it cheaper and more convenient, to
increase compliance by doctors, nurses and visitors, or some other aspect, e.g. hand washing stations.
▻ What potential benefits could come from using virtual reality / 3D worlds in teaching school and
university students the principles of infection control? Is it possible to design an ‘outbreak scenario’ in
the virtual world?
▻ Is a doctor’s surgery waiting room a place where infectious diseases are transmitted? Visit your local
doctor and inquire about the risks and protocols undertaken to reduce the transmission of pathogens
in the waiting room. Formulate some suggestions of your own to rethink the waiting room.
▻ Visit your local childcare centre and learn about the protocols and designs to reduce disease
transmission between children. How would you design your own childcare centre to improve these
procedures? Think about the materials and the elements of design to make the centre easy to keep
clean and yet still safe and appealing for the clients.
9780170408851 CHAPTER 13 » PREVENTION, TREATMENT AND CONTROL OF DISEASE 467
13_bio_InFocus12_2e_sb_08851_txt.indd 467 09/08/18 9:11 am
» MODULE EIGHT
NON-INFECTIOUS
DISEASE AND DISORDERS
14 Homeostasis
15 Non-infectious diseases
16 Epidemiology
17 Prevention
18 Technologies and disorders
Shutterstock.com/DrimaFilm
468 9780170408851
14_bio_InFocus12_2e_sb_08851_txt.indd 468 08/08/18 7:38 pm
14 Homeostasis
INQUIRY Students:
QUESTION
• construct and interpret negative feedback loops that show homeostasis by using a range of sources, including
How is an organism’s but not limited to: (ACSBL101, ACSBL110, ACSBL111) CCT ICT
internal environment – temperature (ACSBL098)
maintained in response – glucose
to a changing external • investigate the various mechanisms used by organisms to maintain their internal environment within tolerance
environment? limits, including:
– trends and patterns in behavioural, structural and physiological adaptations in endotherms that assist in
maintaining homeostasis (ACSBL099, ACSBL114) ICT
– internal coordination systems that allow homeostasis to be maintained, including hormones and neural
pathways (ACSBL112, ACSBL113, ACSBL114)
– mechanisms in plants that allow water balance to be maintained (ACSBL115) ICT
Biology Stage 6 Syllabus © NSW Education Standards Authority for and on behalf of the Crown in right of the State of New South Wales, 2017
Shutterstock.com/Mopic
9780170408851 469
14_bio_InFocus12_2e_sb_08851_txt.indd 469 08/08/18 7:38 pm
Optimal metabolic efficiency in an organism is essential for the overall
health and wellbeing of that organism. The maintenance of a relatively
constant internal environment in an organism, called homeostasis,
is essential so that enzymes can function effectively, which in turn
optimises metabolic efficiency.
Regulatory systems in plants and animals act to maintain balance in
their internal environments. Some of the conditions that these systems
regulate are: blood pressure, temperature, pH, water, concentrations of
salt, glucose, oxygen and carbon dioxide, and metabolic wastes.
FIGURE 14.1 Maintaining a
constant internal environment is
important for the maintenance
14.1 Homeostasis of health and wellbeing.
Homeostasis is the maintenance by an organism of a relatively constant internal state, regardless of
external changes in the environment. The word homeostasis comes from the Greek words homoios,
meaning ‘like’ or ‘the same’ and stasis, meaning ‘state’. This implies a state of balance or constancy,
where conditions ‘stay the same’ in the internal environment of living organisms, to allow them to
function at their optimal metabolic efficiency despite changes in the external environment.
The importance of homeostasis
Living organisms are made of cells, which must function efficiently to maintain life. In order to bring
about optimal metabolic efficiency, all chemical reactions within cells must occur efficiently and be
effectively coordinated. These reactions are catalysed by enzymes, which are very sensitive to changes
in their environment. It is essential therefore that internal conditions be maintained at a level that
allows the optimal functioning of enzymes to ensure that optimal metabolic efficiency is maintained.
Enzymes are extremely sensitive to the temperature and pH of the internal environment, and
changes to these as well as to the concentration of substrates in the reactions will affect their activity.
It is also very important to maintain water and salt concentration, along with the removal of wastes
such as carbon dioxide and other metabolic wastes, in order to maintain internal conditions that allow
maximum enzyme activity.
Maintenance of homeostasis
Homeostasis involves an enormous amount of coordination and control in an organism. In mammals,
both the nervous system and the endocrine (hormonal) system are involved in homeostasis. The phrase
‘relatively constant internal state’ used in the definition of homeostasis indicates that some change in
FIGURE 14.2 Graph
showing homeostasis
as the maintenance of
a relatively constant Upper value triggers
internal environment. a response to counteract
Normal range
The value of the the increase
variable fluctuates
within a narrow range
Set point (ideal value)
of tolerance limits
around a set point.
Lower value triggers
a response to counteract
the decrease
Time
470 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
14_bio_InFocus12_2e_sb_08851_txt.indd 470 08/08/18 7:38 pm
the internal environment is allowed for. Variables in the internal environment, such as temperature or
glucose concentration, are maintained within a narrow range, known as the tolerance limits. Each of
these variables has an ideal or normal value, called the set point.
Homeostasis is maintained as long as there is only a narrow range of fluctuation within the tolerance
limits around the set point. If the fluctuation is larger and exceeds the upper or lower tolerance limits, a
mechanism comes into operation to return the body to the normal range.
KEY CONCEPTS
● Optimal metabolic efficiency is essential for an organism’s overall health and wellbeing.
● The maintenance of a relatively constant internal environment in an organism is essential so
that enzymes can function effectively, which in turn optimises metabolic efficiency.
● Homeostasis is defined as the maintenance by an organism of a relatively constant internal
state, regardless of external changes in the environment.
● Both the nervous and endocrine systems are involved in coordinating and controlling the
process of homeostasis.
● All internal conditions have an ideal or set point. The internal conditions are maintained within
narrow limits (tolerance limits) around this set point.
The negative feedback system
Homeostasis is brought about in two main stages:
1 Detecting change : sensory cells or receptors within the body detect a change in a particular component
of the internal environment, such as the temperature of the body or the pH of the blood. This change
in the internal environment is called a stimulus.
2 Counteracting the change : a response occurs that will
Stimulus
reverse (or counteract) the change. This response is Changes occur in
brought about by the effector organs (such as muscles or internal condition
glands) and will restore the body to its relatively constant
internal state.
The link between these two stages is the control centre. Receptor
Detects the
The control centre, which is responsible for maintaining change Controlled condition
fluctuations around the set point, receives information back to normal
Sends messages via
from the receptors about a change in a condition either nerves/hormones
too far above or below the set point. It then determines an
appropriate response and sends a message to the effectors
to carry out activities that will bring about a response that Control centre
Analyses messages
counteracts (or reverses) the stimulus and returns the levels and initiates actions
to the set point. Once acceptable levels are achieved, as Negative
detected by the receptors, this information is fed back via feedback
Directions sent via
the receptors to the control centre, which then directs the
nerves/hormones
effectors to cease their actions.
Effectors
This self-regulating system is known as a negative
Muscles, organs
feedback mechanism. The message from the receptors to and glands
the control centre and the response that is directed by the
control centre to change the original stimulus in some way Carry out
is the feedback. This feedback is called ‘negative’ because Counteracts
the stimulus
the response counteracts the stimulus – it corrects the Response
change and returns it to the set point. This process can be
represented by a generalised negative feedback loop, as
FIGURE 14.3 Generalised negative feedback loop showing the
shown in Figure 14.3. process by which the body maintains homeostasis
9780170408851 CHAPTER 14 » HOMEOSTASIS 471
14_bio_InFocus12_2e_sb_08851_txt.indd 471 08/08/18 7:38 pm
Coordination of the homeostatic mechanism
The negative feedback systems that maintain homeostasis can be coordinated by the nervous system,
the endocrine system or a combination of both, depending on which particular condition in the internal
environment is involved.
The nervous system communicates within the body by relaying information throughout the body
in the form of nervous impulses. The endocrine system does this by the release of chemical messengers
You will learn more called hormones.
about the nervous The hypothalamus, a region in the lower central part of the brain, is an important control centre for
and endocrine
systems and the maintaining homeostasis. It contains receptors for certain factors such as body temperature, acts as
hypothalamus on a link between the nervous and endocrine systems, and sends messages to the effectors to carry out
pages 487–493.
responses necessary for the maintenance of many homeostatic conditions.
KEY CONCEPTS
● The two stages by which homeostasis occurs are:
1 detecting the change
2 counteracting the change.
Negative
feedback loops ● The control centre receives information from the receptors, analyses it and sends instructions
Watch the animation to the effectors to carry out a response that counteracts (reduces) the stimulus.
and outline the
role of the different ● Once the receptors detect acceptable levels, the control centre directs the effectors to cease
components of their action.
negative feedback
● This process is called a negative feedback mechanism.
loops.
● The hypothalamus is an important control centre in a negative feedback system.
● Messages are carried as nerve impulses or as hormones. Both the nervous and endocrine
systems are involved in the coordination of a negative feedback system.
Negative feedback loops
Specific negative feedback loops can be used to show the way in which the body maintains set levels for
specific internal conditions. For example, the regulation of body temperature can be summarised by a
negative feedback loop, as shown in Figure 14.4.
In the negative feedback mechanism indicated by this loop, thermoreceptors detect changes in
temperature (stimulus). Some of these receptors are in the skin and others are in the hypothalamus,
where they monitor the temperature of the blood as it circulates through the brain. The receptors in the
hypothalamus are sensitive to extremely small temperature changes.
In this case, the hypothalamus is also the control centre for temperature regulation in the mammalian
body, which means that the receptors do not have to transmit the information very far in order for a
response to be initiated.
Cooling the body
When receptors detect an increase in the body temperature (stimulus), messages are sent to the anterior
(front) area of the hypothalamus, which is the heat-loss control centre. Messages are then sent via the
nervous system to effectors that initiate processes to lose heat and cool the body down.
These processes include:
◗ vasodilation, which involves the blood vessels dilating (expanding), bringing blood closer to the skin
and allowing heat to escape (Fig. 14.5)
◗ activation of the sweat glands to secrete liquid sweat, which removes heat from the body when it
evaporates (changes state from liquid to gas) (Fig. 14.6)
◗ activation of the thyroid gland to lower the rate of metabolism in cells by reducing the amount of the
hormone thyroxin produced. This generates less heat in the body.
The combined effect of these processes is a decrease in body temperature, which counteracts the
stimulus and returns the temperature to its set point (or normal level).
472 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
14_bio_InFocus12_2e_sb_08851_txt.indd 472 08/08/18 7:38 pm
Control centre
Effectors
Hypothalamus
t#MPPEWFTTFMT
activates
t4XFBUHMBOET
cooling
t$FMMT
mechanisms
Responses
Receptor
Hypothalamus
Blood vessels Sweat glands Cells
Dilate – heat loss Secrete sweat Metabolic rate
– evaporation decreases– less
leads to heat loss heat generated
Stimulus
Increased body Body temperature
temperature returns to set point
Normal internal
body temperature
Body temperature
returns to set point
Stimulus
Decreased body
temperature
Blood vessels Muscles Cells Hair erector
$POTUSJDUo $BVTFTIJWFSJOH Metabolic rate cells
reduce heat loss increases – Erect hair
produces heat traps air
Receptor
Hypothalamus
Responses
Control centre Effectors
Hypothalamus t#MPPEWFTTFMT
activates t.VTDMFT
heating t$FMMT
mechanisms t)BJSFSFDUPSDFMMT
FIGURE 14.4 Negative feedback loop, showing internal body temperature regulation
9780170408851 CHAPTER 14 » HOMEOSTASIS 473
14_bio_InFocus12_2e_sb_08851_txt.indd 473 08/08/18 7:38 pm
Evaporation of sweat
Temperature rises Heat loss by radiation
Very little
No sweating radiation
Superficial
Superficial capillaries
capillaries enlarge
contract (vasodilation)
(vasoconstriction)
Sweat glands
produce
Layer of fat sweat Layer of fat
Sweat glands inactive
Very little heat loss Increased heat loss
FIGURE 14.5 Vasodilation increases heat loss.
Evaporation
Water
vapour Hair
Sweat Pain
droplet Heat receptors
Sweat pore
Epidermis
Sweat
duct
Sweat
gland
Increased heat loss
FIGURE 14.6 Evaporation of sweat brings about heat loss.
Warming the body
When receptors detect a decrease in the body temperature (stimulus), messages are sent to the
posterior (back) area of the hypothalamus, which is the heat-gain control centre. Messages are sent
via the nervous system to effectors that initiate processes to conserve heat and warm the body. These
include:
◗ vasoconstriction, which involves the blood vessels constricting (narrowing), removing blood from the
skin surface and conserving heat (Fig. 14.7)
◗ contraction of the hair erector cells, causing hair/fur to stand on end, which traps a layer of warm air
around the body, reducing heat loss
◗ release of thyroid-stimulating hormone (TSH) by the pituitary gland under the direction of the
hypothalamus, which causes the thyroid gland to increase the amount of the hormone thyroxin
produced. This will increase the rate of metabolism, generating more heat in the body
◗ rapid contraction of muscles in a process called shivering, which generates heat in the body.
474 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
14_bio_InFocus12_2e_sb_08851_txt.indd 474 08/08/18 7:38 pm
The combined effect of these processes is an increase in body temperature, which counteracts the
stimulus and returns the temperature to its set point (or normal level).
Environment 14°C FIGURE 14.7
Vasoconstriction
conserves heat by
Skin surface 25°C reducing heat loss How body
Skin surface 22°C temperature is
from the skin to the
environment. controlled
Core 37°C Core 37°C
Before vasoconstriction After vasoconstriction
Heat loss from skin (25°C) to Heat loss from skin (22°C) to
environment (14°C) = 11°C environment (14°C) = 8°C
INVESTIGATION 14.1
A secondary source investigation into the regulation of glucose
concentration in the blood
INTRODUCTION
The concentration of glucose in the blood must be maintained at a consistent level (set point) for the optimal Information and
communication
metabolic functioning of the body. This concentration is regulated by a negative feedback mechanism, which technology
can be represented in the form of a negative feedback loop. capability
The concentration of glucose is regulated by the hormones insulin and glucagon, which are produced in Critical and
the pancreas. These hormones act on numerous tissues in the body. creative thinking
AIMS
• To investigate the role of the pancreas in the regulation of glucose levels in the blood
• To construct a negative feedback loop that represents the regulation of glucose concentration in the blood
METHOD
Regulation of
glucose levels
1 Using the background information in the weblink as a starting point, research the processes involved in the in the blood
regulation of blood glucose concentration.
2 Make sure you use a number of different sources and check the relevance, accuracy, validity and reliability
of each source.
3 Answer the questions below to help guide your research.
4 Using the information you have gathered, construct a negative feedback loop to represent the processes
involved in keeping the glucose concentration in the blood within tolerance levels. Refer to Chapter 1,
page 10 for
QUESTIONS guidance on to
how to assess
1 Outline the importance of glucose in the human body. the relevance,
accuracy, validity
2 Suggest when the concentration of glucose in the blood could: and reliability of
sources.
a increase b decrease.
3 Describe what could happen to the body if the blood glucose concentration became:
a too high b too low.
9780170408851 CHAPTER 14 » HOMEOSTASIS 475
14_bio_InFocus12_2e_sb_08851_txt.indd 475 08/08/18 7:38 pm
4 Identify the two hormones involved in the regulation of the blood glucose concentration.
5 Where are the receptors for detecting the concentration of glucose in the blood located?
6 Describe the processes that occur to bring the blood glucose concentration back to its set point when it is:
a too high
b too low.
7 Copy and complete the table below.
GLUCOSE CONCENTRATION IN THE BLOOD
FACTOR TOO HIGH TOO LOW
Stimulus
Receptor
Control centre
Effectors
Response
Result
RESULTS
1 Construct a negative feedback loop to represent the regulation of blood glucose concentration.
2 Describe the processes involved in the regulation of blood glucose concentration.
DISCUSSION
Explain the importance of:
a regulating the concentration of glucose in the blood
Homeostasis b maintaining homeostasis in the body of an organism.
of different
conditions in the CONCLUSION
body
Write summary sentences related to the aims of this investigation.
CHECK YOUR
1 Define ‘homeostasis’.
UNDERSTANDING
2 a Identify the two systems involved in the control and coordination of homeostasis and the form in
14.1 which messages are carried in each system.
b How are the messages carried in each system?
3 Explain why homeostasis is important.
4 Sketch a graph that indicates how an internal condition (such as body temperature) can vary about a set
point within upper and lower tolerance limits.
5 a What are the two main stages of homeostasis?
b What is the role of the control centre in homeostasis?
c Identify an important control centre in the brain.
6 Define ‘negative feedback mechanism’.
476 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
14_bio_InFocus12_2e_sb_08851_txt.indd 476 08/08/18 7:38 pm
7 Copy and complete the following table using the information in the negative feedback loop shown in
Figure 14.4.
BODY TEMPERATURE
COMPONENT OF MECHANISM TOO HIGH TOO LOW
Stimulus
Receptor
Control centre
Effectors
Response
Feedback
Result
8 The negative feedback mechanism shown in Figure 14.8 controls the level of oxygen (O2) in the blood.
a Identify the following components of this negative feedback mechanism from the model shown:
i stimulus
ii receptor
iii control centre
iv effector
v response
vi feedback.
b Describe how the levels of oxygen in the blood are controlled.
Bone marrow
Secretes
hormone
erythropoietin
Increased red blood
Kidney
cell production
Detected by
Decreased level Increased level of
of O2 in blood O2 in blood
Normal level
of O2 in blood
FIGURE 14.8 Negative feedback mechanism controlling the level of O2 in the blood
9780170408851 CHAPTER 14 » HOMEOSTASIS 477
14_bio_InFocus12_2e_sb_08851_txt.indd 477 08/08/18 7:38 pm
14.2 Mechanisms to maintain homeostasis
Numerous mechanisms are used by organisms to maintain their internal environment within tolerance
limits. These include adaptations of various types as well as internal coordination systems, such as
the nervous and endocrine systems. All these systems play an important role in the maintenance of
homeostasis, to allow the organism to achieve optimal metabolic efficiency, which contributes to the
health and wellbeing of the organism.
Internal coordination systems
The nervous and endocrine systems are internal systems that work together to ensure that homeostasis
is maintained. The role of these systems is to coordinate and provide pathways of communication for the
negative feedback systems that operate within the body to maintain homeostasis. The two systems work
together or individually to provide a pathway for relaying messages via nerves or hormones, from the
receptors to the control centre and then on to the effectors to initiate a response, which will counteract
the stimulus and ensure that the internal condition remains within tolerance limits.
The transport of messages in each system is very different. Nerve impulses are transported very
quickly along nerves to specific locations in the body. Messages sent using hormones are in the form of
chemical substances that are transferred to regions of the body in the bloodstream at a much slower rate
than the transmission of nerve impulses.
Receptors
In both systems, receptors are responsible for detecting stimuli in the form of any changes from the set
point that are outside the tolerance limits. Receptors contain sensory cells and can take numerous forms
depending on the stimuli that activate them.
In their more complex form, receptors are concentrated in particular areas, forming sense organs
such as the eye, the ear and the tongue. In many animals, including humans, receptors in sense organs
detect stimuli in the external environment.
Interoceptors are receptors within the body that detect internal stimuli related to homeostasis.
Receptors may be named according to the type of energy or molecules they detect.
The receptors that are important in homeostasis are as follows.
◗ thermoreceptors detect changes in temperature. Thermoreceptors in the skin are nerve endings
that are sensitive to heat or cold and send information to the brain about the external temperature.
Internal thermoreceptors in the hypothalamus detect the temperature of the blood as it flows through
the brain
◗ chemoreceptors detect the concentration of certain chemicals inside the body. Chemoreceptors are
located in certain blood vessels and detect the pH as well as levels of certain chemicals, such as
carbon dioxide and oxygen
◗ osmoreceptors detect changes in osmotic pressure and are located in the hypothalamus. Osmotic
pressure in the blood is determined by the concentration of substances dissolved in the blood plasma.
Small changes in osmotic pressure cause the body to implement processes that regulate the amount
of water in the body, keeping it within the tolerance limits.
478 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
14_bio_InFocus12_2e_sb_08851_txt.indd 478 13/08/18 6:03 PM
KEY CONCEPTS
● The nervous and endocrine systems coordinate and provide communication pathways to
maintain homeostasis.
● In the nervous system, nerve impulses are transported very quickly along nerves to specific
locations in the body.
● In the endocrine system, glands produce hormones in the form of chemical substances that
are transferred to regions of the body in the bloodstream at a much slower rate than the
transmission of nerve impulses.
● Receptors detect stimuli.
● External receptors are often grouped together in sense organs.
● Internal receptors (interoceptors) detect internal stimuli.
TYPE OF RECEPTOR STIMULI DETECTED
Thermoreceptor Changes in temperature
Chemoreceptor Changes in pH and concentration of chemicals
Osmoreceptor Changes in osmotic pressure
The nervous system
Brain
The neural pathways by which messages travel in the body are provided by Central
the nervous system. As well as providing a communication pathway, the nervous
system
nervous system acts as a control centre to coordinate activities that maintain
homeostasis within the body. Spinal cord
The nervous system has two main parts: the central nervous system
(CNS) and the peripheral nervous system (PNS) (Fig. 14.9). Peripheral nervous
The CNS is composed of the brain and spinal cord; the PNS comprises all system
other nerves throughout the body that are not part of the CNS.
The peripheral nerves carry information to and from the CNS. The
information carried by nerves consists of ‘messages’ transmitted in the form
of electrochemical impulses.
Some actions involving the nervous system may take place voluntarily,
but all those involved in homeostasis take place without conscious thought.
They are involuntary and many are innate, unconditioned reflexes in
response to a particular stimulus.
Neurons
The millions of units that make up the nervous system are called nerve cells
or neurons. Although no two neurons are exactly alike in size, shape and
function, they all contain three common structures (Fig. 14.10):
◗ a cell body that contains a nucleus and many of the organelles found in
other cells. These form the ‘grey matter’ of the CNS FIGURE 14.9 The two main parts of the nervous
system: the central nervous system and the
◗ one or more fine branching extensions, called dendrites, that are peripheral nervous system
extensions of the cytoplasm of the cell body. Dendrites receive messages
in the form of impulses from other axons and conduct these nerve
impulses towards the cell body. In sensory neurons the single, elongated
dendrite is called a dendron Different parts
◗ one single, very long extension of the cytoplasm of the cell body, called of the nervous
system
an axon. Axons conduct messages away from the cell body and form the
‘white matter’ of the CNS.
9780170408851 CHAPTER 14 » HOMEOSTASIS 479
14_bio_InFocus12_2e_sb_08851_txt.indd 479 08/08/18 7:39 pm
Incoming message To next
neuron
Nucleus
se
Dendrites
impul
eu ral
n of n
ctio
Dire
Axon
terminals
Nodes
of Ranvier
Myelin
sheath
Soma Axon
(cell body)
FIGURE 14.10 Structure of a typical neuron
Neurons are classified according to their function and the direction in which the nerve impulses are carried.
◗ Sensory neurons carry impulses from the sensory cells in the peripheral nervous system to the CNS.
They usually have the cell body at the side, one long dendron and short axons.
◗ Motor neurons transfer messages from the CNS to effectors such as muscles or glands. The dendrites
are usually short and the axon quite long.
◗ Interneurons (also known as association or connector neurons) are located within the CNS and are the
link between the sensory and motor neurons. They have short dendrites and either long or short axons.
The three major types of neurons – sensory, motor and interneurons – are shown in Figure 14.11.
Connector neurone
(interneurone)
Sensory
neurone
Dendron Sense organ
(pressure receptor
Cell body in the skin)
Axon branches
Dendrites
Axon
Axon Cell body
Dendrites
Axon branches
ion
ir e c t
Impuls e d
Axon
Myelin sheath Motor neurone
FIGURE 14.11 The structure of the three major types of neurons: sensory, motor and connector (interneurons)
480 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
14_bio_InFocus12_2e_sb_08851_txt.indd 480 08/08/18 7:39 pm
When a nervous impulse is transferred from the axon of one neuron to the dendrites of the adjacent
neuron it must cross a small gap, or synapse, as the adjacent neurons do not actually touch (Fig. 14.12).
The fibres of the neurons are gathered into bundles held together by a connective tissue
sheath to form the nerves (Fig. 14.13). This provides a structured pathway for the transmission of
electrochemical impulses along the axons of the neurons.
The messages transmitted by neurons as nerve impulses are in the form of electrochemical impulses.
This is the quickest way to initiate responses by the body to stimuli in order to coordinate and maintain
homeostasis.
Axon Dendrite
ge
ssa
Me
Soma
WH Freeman (www.whfreeman.com)
Source: Purves et al., Life: The Science of Biology, 4th
Edition, by Sinauer Associates (www.sinauer.com) and
Myelin sheath
Nerve
Synapse
Axons
Connective tissue
Axons
Blood vessel
FIGURE 14.12 The gap between the axon terminals FIGURE 14.13 A nerve contains many
and dendrites of adjacent neurons is called a synapse. neurons bundled together.
Transmission of nerve impulses – the action potential
Electrochemical impulses involve a change in the electrical potential of the cell membrane of the
axon – this temporary change is known as an action potential. This is brought about by a change in the
concentration of electrically charged chemicals, called ions, on either side of the cell membrane of the
axon. In other words, the change in the concentration of the chemicals by movement across the cell
membrane causes an electrical impulse.
Sodium ions (Na+), potassium ions (K+) and chloride ions (Cl–) are important for the transmission
of electrochemical messages in the nervous system. These ions are on both sides of the cell membrane,
both inside and outside the cell, but their concentrations differ. Also inside the cell are large negatively
charged organic ions (M–).
A factor that has an influence on the movement of these ions across the cell membrane is that the
cell membrane is selectively permeable. It allows some substances to pass through easily, such as K+
ions, but hinders the passage of Cl– and Na+ ions. The large M– ions are unable to move through the cell
membrane.
At rest
A neuron is said to be at rest if it is not transmitting any electrochemical messages. In this state the ions
inside and outside the cell attempt to balance themselves out. This is not possible, as Na+ ions can only
move through the cell membrane of the neuron through special ion channels, which are closed when the
neuron is at rest. There are a large number of Na+ ions outside the cell compared to the number of K+ ions
inside the cell. Also, there are a large number of organic M– ions trapped inside the cell.
9780170408851 CHAPTER 14 » HOMEOSTASIS 481
14_bio_InFocus12_2e_sb_08851_txt.indd 481 08/08/18 7:39 pm
Because of this there are more total negative charges on the inside of the cell than on the outside,
and there is said to be a potential difference across the membrane. The value of this potential difference,
called the resting membrane potential, is –70 mV (millivolts). The inside of the membrane is said to be
negative in relation to the outside of the membrane – the membrane is polarised (Fig. 14.14).
FIGURE 14.14 The
More positive ions
resting potential Cell
of the axon cell outside cell membrane
membrane
membrane is –70 mV. 1 1 1 1 1
More negative Difference
The membrane is 2 2 2 2 2 is –70 mV
polarised. ions inside cell
2 2 2 2 2
membrane
1 1 1 1 1
Axon
Neuron
Action potential – depolarisation and repolarisation
When a stimulus is detected by a neuron, it causes sodium channels in the cell membrane to open.
Because there are many more Na+ ions outside the neuron than inside, the Na+ ions move into the
neuron and reduce the overall negative charge. If the stimulus is ‘strong’ enough to open enough Na
channels to allow Na+ ions to move into the neuron and change the resting potential to its threshold
value of –55 mV, the movement of Na+ ions into the neuron will continue independently of the stimulus.
This causes the inside of the membrane to become more positive in relation to the outside of the
neuron, and the potential to move to 0 mV and beyond. The membrane has been depolarised. Just as
quickly, the potassium channels open and K+ ions move out of the neuron, causing the repolarisation
of the membrane. The potassium channels stay open a little longer and the action potential goes past
–70 mV (hyperpolarisation) before returning to its original resting state. This rapid depolarisation and
repolarisation is called the action potential (Fig. 14.15).
Watch these
animations and
summarise the
steps involved
in an action 1 Slow depolarisation of
potential. the membrane brings the
+30 potential to the threshold.
+15 3
Membrane potential (mV)
0 2 Sodium channels in the
Action potential membrane open; sodium
–15 ions flood into the cell;
Use the
membrane becomes
–30 Threshold depolarised; membrane
interactive to 2
deepen your –45 voltage rises.
understanding of
the way in which –60 1 Resting
action potentials –70 membrane 3 Sodium channels close
are formed 4 potential and membrane becomes
and how nerve repolarised.
impulses move
along neurons.
4 Membrane returns to
0 1 2 3 4 5
resting state.
Time (ms)
FIGURE 14.15 Graph showing an action potential
482 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
14_bio_InFocus12_2e_sb_08851_txt.indd 482 08/08/18 7:39 pm
The action potential is only activated if the stimulus is strong enough to cause the potential to reach
a threshold value of –55 mV. Once this value is reached, the action potential goes ahead automatically.
If the threshold value is not reached, there is no action potential and therefore no nerve impulse is
generated. Either the threshold potential is not reached or a full action potential is fired. This is the
‘all or none’ principle.
Each action potential causes another action potential in the neighbouring region of the neuron. This
series of action potentials along the neuron is the nerve impulse (Fig. 14.16).
Cell body Axon
Signal
Dendrites
Action potential
occurring
Membrane still in
refractory period
Membrane able to
generate an action
potential
FIGURE 14.16 Transmission of a nerve impulse along an axon
Bridging the gap: synapse
When a nerve impulse reaches the axon terminal, it has to move across a small gap, the synapse, to the
dendrites of the next neuron (Fig. 14.17). The action potential triggers the release of chemicals, called
neurotransmitters, from the synaptic vesicles. These chemicals move across the synapse to receptors
in the dendrites in the adjacent neuron, initiating an action potential in order to continue the nerve
impulse.
FIGURE 14.17
Neurotransmitters
transfer nerve
impulses across the
synapse.
Pre-synaptic neuron
Synaptic gap Synapses
Neurotransmitters Watch the
Receptor site animation and
Post-synaptic neuron create a flow chart
to show how
electrical impulses
are transferred
from one neuron to
the next.
9780170408851 CHAPTER 14 » HOMEOSTASIS 483
14_bio_InFocus12_2e_sb_08851_txt.indd 483 08/08/18 7:39 pm
INVESTIGATION
INVESTIGATION 14.2
7.1
A secondary-source investigation to graph action potential
INTRODUCTION
Action potential is important for the movement of electrochemical impulses along a neuron. A series of
action potentials along a neuron is what makes up a nerve impulse. In this investigation you will be required
Numeracy to graph the provided values for the change in electrical potential between the inside and outside of the cell
membrane of the axon of a neuron. These values are recorded as an action potential is generated and goes to
completion before being stimulated in the neighbouring region.
AIM
To graph an action potential
METHOD
1 Use the information provided in Table 14.1 to draw a line graph of the membrane potential against time.
2 Label the following areas on the graph: resting potential, threshold, depolarisation, maximum action
potential, repolarisation, hyperpolarisation and resting potential at the end.
TABLE 14.1 Membrane potential measured against time
MEMBRANE MEMBRANE
POTENTIAL (mV) TIME (ms) POTENTIAL (mV) TIME (ms)
–70 0 –76 2.25
–70 0.25 –74 2.5
–65 0.5 –72 2.75
–50 0.75 –71 3.0
+10 1.0 –70 3.25
+34 1.25 –70 3.5
a
–50 1.5 –70 3.75
–60 1.75 –70 4.0
Membrane potential (mV)
–80 2.0 0
3 Explain what is happening at each of the labelled stages. This
can be presented in a table, as a dot point summary or in any 250
other appropriate fashion. 270
RESULTS
1 Draw a line graph from the information presented in the table. Time (milliseconds)
2 Provide a summary of what is happening at each of the b
labelled stages.
Membrane potential (mV)
DISCUSSION
0
1 Look at the graphs in Figure 14.18, which shows two stimuli of
different strengths changing the membrane potential of the
neuron. 250
Is an action potential generated in both (a) and (b)? Justify 270
your answer.
2 Does a stronger stimulus cause a stronger action potential?
Explain why or why not. Time (milliseconds)
CONCLUSION FIGURE 14.18 Change in membrane
potential in response to stimuli a and b
Write a summary sentence to address the aim of this investigation.
484 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
14_bio_InFocus12_2e_sb_08851_txt.indd 484 08/08/18 7:39 pm
INVESTIGATION 14.3
A first-hand and secondary-source investigation to investigate
the structure of neurons, and to observe and model neurons Information and
communication
INTRODUCTION technology
capability
The nervous system is an integral part of the communication system in the body. Neurons that make up the
nerves have a structure that is specifically suited to their function. In this investigation you will research the Literacy
function of the structures in a typical neuron and observe the structure of neurons both directly and indirectly.
You will also construct a model of a neuron to be reviewed by your peers. Critical and
creative thinking
AIMS
Personal and
• To provide a written description of the function of the different parts of a typical neuron social capability
• To observe the structure of neurons
• To construct a model of a neuron
MATERIALS
• access to reference books and the Internet
• digital camera
• monocular microscopes
• prepared slides of the following:
– cross-section of spinal cord – motor neuron – brain tissue
• materials to construct a model of a neuron; this could include, but is not limited to, the following:
– coloured cardboard – small pasta tubes – plastic tubing of different
– straws – pipe cleaners thicknesses
3D model of a
– thin foam-like material – coloured paper – glue typical neuron
– wool – spherical foam balls – scissors
– knife
RISK ASSESSMENT
WHAT ARE THE WHAT RISK DOES THIS
!
RISK
HAZARDS? HAZARD POSE? HOW CAN YOU SAFELY MANAGE THIS RISK? ASSESSMENT
Knife Sharp edges can cause cuts. Use knife with care, hold by the handle and keep fingers away from
sharp edge of knife.
Microscope slides/ Sharp edges can cause injury if Handle with care. Push gently on coverslip. Always focus by
coverslips broken. moving objective lens away from slide.
METHOD
A Research
1 The basic structure of a neuron has been covered on page 480 and is shown in Figure 14.10.
2 Refer to Figure 14.10 and note all the labelled areas.
3 Research numerous sources in order to outline any distinguishing features of, and the function of, each of
the labelled structures.
4 Collate the information you have found and present it in an appropriate written form, such as a dot-
pointed summary or a table.
5 Research using the Internet and other secondary sources to find labelled images of neurons seen through
the light microscope and electron micrographs of neurons, similar to the ones shown in this chapter.
6 Access the website shown in the weblink or similar, to view a 3D model of a typical neuron.
9780170408851 CHAPTER 14 » HOMEOSTASIS 485
14_bio_InFocus12_2e_sb_08851_txt.indd 485 08/08/18 7:39 pm
B Observing neurons
1 Obtain a microscope and the prepared slides supplied.
2 Following the correct microscope procedures, focus each of the slides provided, first on low power and
then on high power.
3 Observe any neurons present and identify any of the structures visible with the help of the images you
have researched in Step 5 above.
Refer to Chapter 1 4 If possible, take a photo of one the neurons observed using your mobile phone, print it out and label the
page 10 for guidance structures you identified.
on to how to assess
the relevance, 5 If it is not possible to take a photo, draw a labelled scientific diagram of one the neurons you observed.
accuracy, validity and
reliability of sources. C Making a model
1 Working in pairs, design a model of a motor neuron.
2 This model could take any form – it could be 2D, using cardboard as a base with different materials
representing each of the structures present in a neuron, or it could be a 3D structure.
3 The different parts of the model should be identified, either with labels or with a key.
4 The materials you use for your model should be easily obtainable.
5 When your model is complete, submit it for peer review in a manner determined by your teacher.
RESULTS
Your results should include:
• information about the structures and functions of the structures in a typical neuron, recorded in a dot point
summary, table or other appropriate form, as instructed in the steps above
• a labelled photo or scientific diagram of one of the neurons you observed using the light microscope
• a completed model, including labels, of a motor neuron.
DISCUSSION
1 Assess the relevance, accuracy, validity and reliability of the secondary sources you used to find the
required information about neurons.
2 Suggest any improvements that could have been made to this investigation.
3 a Outline why scientists use models.
b Describe how constructing a model of a motor neuron improved your understanding of neurons.
CONCLUSION
Write a few summary sentences to address the aims of this investigation.
KEY CONCEPTS
● The two main parts of the nervous system are the central nervous system (CNS) and the
peripheral nervous system (PNS).
● The nervous system contains millions of neurons (nerve cells), which transmit messages via
electrochemical impulses.
● A typical neuron contains a cell body, dendrites and an axon.
● The three types of neurons are sensory neurons, motor neurons and interneurons (connector neurons).
● The synapse is the small gap between the axon terminals and dendritic terminals of adjacent
neurons.
● Nerves are made up of bundles of neuronal fibres.
● A stimulus will cause a change in ion concentrations across the cell membrane of the axon,
which in turn alters the membrane potential.
● If the membrane potential reaches the threshold value, an action potential involving
depolarisation, and then repolarisation, is instigated.
● Each action potential causes another action potential in the next region of the neuron. This
series of action potentials along the neuron is the nerve impulse.
486 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
14_bio_InFocus12_2e_sb_08851_txt.indd 486 08/08/18 7:39 pm
● If the threshold value is not reached, there will be no action potential and therefore no nerve
impulse generated.
● Neurotransmitters released at the axon terminal transfer the ‘message’ across the synapse to
the adjacent neuron and stimulate an action potential in the dendrites of the receiving neuron.
CHECK YOUR
1 a What is the role of receptors in the body? UNDERSTANDING
b Name three types of receptors and describe the function of each.
2 a Name the two main parts of the nervous system. 14.2a
b Outline the structure and function of each part.
3 a Sketch a diagram of a typical neuron.
b Label the dendrites, cell body, nucleus, axon, myelin sheath and nodes of Ranvier.
c Draw an arrow on your diagram to indicate the pathway of the nerve impulses along the neuron.
4 Construct a table that summarises the three types of neurons and their functions.
5 Identify the form that messages take when travelling along neurons.
6 Summarise the steps involved in the passage of a nerve impulse along a neuron. This could take the form
of a flow chart.
7 Name the small gap between adjacent neurons, and outline how nerve impulses move across this gap.
The central nervous system
The central nervous system (CNS) is made up of the brain and the spinal cord, and is integral to the
maintenance of homeostasis. Both the brain and the spinal cord are made up of two types of nervous
tissue: grey matter and white matter. Grey matter consists mainly of neuron cell bodies, while white
matter is nerve fibres surrounded by myelin sheaths, which cause the white appearance. In the brain, the
grey matter tends to be on the outside, whereas in the spinal cord it is in the centre.
The brain
The brain is the main control centre of the body and is therefore a very complex organ. It consists of
numerous parts that all work together to ensure the efficient functioning of the body. The brain largely
controls the maintenance of homeostasis.
The major parts of the brain are shown in Figure 14.19.
Cerebrum
Corpus callosum
Hypothalamus
Pituitary gland
Cerebellum
Medulla oblongata
FIGURE 14.19 Cross-section of the brain, showing the major regions
9780170408851 CHAPTER 14 » HOMEOSTASIS 487
14_bio_InFocus12_2e_sb_08851_txt.indd 487 08/08/18 7:39 pm
The hypothalamus is a small area of the brain that is located centrally and close to the pituitary
gland. It is the control centre for the regulation of the many activities in the body that are required to
The endocrine
system is discussed
maintain a stable internal environment (homeostasis). It achieves this by directing effectors to carry out
on pages 488–492. a response either by sending messages via neural pathways or by chemical messages (hormones). Some
of the conditions that need to be regulated are heart rate, body temperature, blood pressure, and the
concentration of oxygen and carbon dioxide in the blood.
The hypothalamus is also the main link between the nervous system and the endocrine system. It is
Complete the responsible for hormone secretions and directs the actions of the pituitary gland in coordinating other
interactive to
build a brain and glands to secrete hormones in order to maintain homeostasis.
nervous system
The spinal cord
The spinal cord extends from the medulla oblongata down through the vertebral column to the waist
area (Fig. 14.9). It contains the nerve fibres that provide the link for the pathway of nerve impulses
between the peripheral nervous system and the brain (Fig. 14.20).
The two main functions of the spinal cord are:
Science Photo Library/Manfred Kage
Grey matter ◗ to act as a conduction pathway for nerve impulses from the receptors
around the body to the brain, and for nerve impulses from the brain to the
White matter effectors. This is essential for the efficient functioning of all areas of the body,
including the maintenance of homeostasis
◗ to coordinate reflex actions, such as removing your hand quickly when you
FIGURE 14.20 Cross-section of spinal cord touch something hot, before you feel the pain.
KEY CONCEPTS
● The CNS is made up of the brain and the spinal cord, and acts as the major control and
coordination area for the maintenance of homeostasis.
● The main regions of the brain are the cerebrum, the cerebellum and the medulla oblongata.
Virtual dissection
● The corpus callosum provides a pathway for messages between the two sides of the brain.
● The hypothalamus provides a link between the nervous and endocrine systems, to assist in the
maintenance of homeostasis.
WS ● The spinal cord provides a pathway for nervous impulses between the brain and the rest of the
body.
Brain dissection
CHECK YOUR
UNDERSTANDING 1 Identify the areas of the brain indicated in Figure 14. 21.
14.2b (f )
(a)
(b)
(c)
(e)
(d)
FIGURE 14.21 Major regions of the brain
2 Describe the two main functions of the spinal cord.
3 Compare the distribution of white and grey matter in the brain and spinal cord.
488 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
14_bio_InFocus12_2e_sb_08851_txt.indd 488 08/08/18 7:39 pm
The endocrine system
The endocrine system, along with the nervous system, regulates the activity of the body. Its main
components are hormones, which are chemical messenger molecules secreted by endocrine glands. The
word ‘endocrine’ comes from endo meaning ‘from within’ and krine meaning ‘to secrete’.
These hormones are transported by the bloodstream to cells possessing the receptors for the
particular hormone. The hormones cause these cells to change their activity in a way that will maintain
homeostasis within the body. Hormones achieve this by influencing the activity of particular enzymes or
the concentration of these enzymes in the cells, known as target cells. Figure 14.22 shows the location of
the major glands of the endocrine system and the hormones they produce.
Hypothalamus: thyrotropin-releasing
hormone and others
Pituitary gland: TSH,
antidiuretic hormone
Pineal gland: melatonin
Thyroid gland: thyroxine
Thymus
WS
Parathyroid glands (usually
four): parathyroid hormone
Hormonal
regulation of
homeostasis
Adrenal glands
(two): hydrocortisone,
corticosterone, Pancreas: insulin,
aldosterone glucagon
Ovaries (two) in
females: oestrogen,
progesterone Testes (two) in males: testosterone
FIGURE 14.22 The location, hormones produced and function of the major glands of the endocrine system
Glands in the
endocrine
system
Glands can be stimulated to secrete hormones by messages from the nervous system, by other Create a table to
summarise the
hormones or by receptors located in the particular gland. characteristics
of each gland in
the endocrine
Pituitary gland system: location,
hormone(s)
The pituitary gland, situated just below and working in close collaboration with the hypothalamus, is produced and effect
of hormone(s).
often referred to as the master gland. It releases hormones, often on direction from the hypothalamus, to
regulate the activity of other glands.
9780170408851 CHAPTER 14 » HOMEOSTASIS 489
14_bio_InFocus12_2e_sb_08851_txt.indd 489 08/08/18 7:39 pm
There are two distinct regions of the pituitary gland: the front (anterior) and the back (posterior)
(Fig. 14.23). Hormones released by the hypothalamus control the anterior area of the pituitary gland,
while the posterior section is controlled by nerve impulses.
Hypothalamus
Infundibulum
Posterior lobe
Pituitary gland
Anterior lobe
Bone of skull
FIGURE 14.23 The pituitary gland is closely connected to the hypothalamus.
One hormone secreted by the anterior section controls growth. Other hormones secreted act on other
glands to control the activity of the thyroid, the adrenal gland and the gonads (ovaries and testes).
One of the hormones secreted by the posterior section of the pituitary gland is antidiuretic
hormone (ADH), which helps to regulate the concentration of water in the body. If receptor cells in the
hypothalamus detect that the levels of water in the body are too low, the hypothalamus stimulates the
pituitary gland to release ADH. This acts to conserve water in the body by promoting its reabsorption
by the kidney tubules. The opposite occurs when the level of water in the blood is too high – the
hypothalamus detects this and directs the pituitary gland to reduce its production of ADH. This leads to
Production and less water being absorbed in the kidneys and the increased excretion of water.
action of ADH
The following glands and the hormones they produce are primarily involved in the maintenance of
further stable internal conditions (homeostasis) within the body.
Thyroid and parathyroid glands
The thyroid gland consists of two lobes located on either side of the neck (Fig. 14.24). The follicles in this
gland predominantly produce an iodine-containing hormone called thyroxine. The amount of thyroxine
produced is controlled by thyroid-stimulating hormone, which is released by the anterior pituitary gland.
a Cartilage of b
larynx
Pharynx
Thyroid Parathyroid
gland Thyroid
glands gland
Oesophagus
Right lobe Left lobe
Back of
Trachea trachea
FIGURE 14.24 The location of the a thyroid and b parathyroid glands
490 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
14_bio_InFocus12_2e_sb_08851_txt.indd 490 08/08/18 7:39 pm
The release of thyroxine is in turn controlled by the hypothalamus when it releases a regulatory hormone
into the pituitary gland. One of the reasons this may occur is that receptors in the hypothalamus detect
a drop in the body temperature to below the tolerance limit.
Thyroxine is the means by which the message is transferred to the cells to increase their metabolic
rate. In this process, energy is released for a number of purposes, one of which is to provide heat to
maintain body temperature.
The parathyroid gland is made up of a number of small glands embedded in the surface of the thyroid
gland (Fig. 14.24b). Its function is to maintain the level of calcium in the blood. Calcium is required for the
successful transfer of nerve impulses in the nervous system and allows muscles to contract properly. The
parathyroid gland monitors the blood flowing through it. When it detects that the calcium level is too
low, it secretes parathyroid hormone (PTH). This hormone travels to the following effectors:
◗ bones – release calcium into the blood
◗ small intestines – absorb more calcium from digested food
◗ kidneys – reabsorb more calcium in the tubules.
The net result of this is to increase calcium levels, thus returning them to normal levels.
If the calcium levels detected are too high, the parathyroid gland stops secreting PTH.
Adrenal glands a b
The adrenal glands are located on the top of each kidney Adrenal gland Adrenal
cortex
(Fig. 14.25) and are made up of two distinct parts. The outer
portion of the adrenal gland is known as the adrenal cortex and
the inner region is the adrenal medulla. These regions have very
different functions and secrete different hormones.
The hypothalamus regulates activities in both regions.
Some of the hormones produced by the cortex are regulated by
negative feedback involving the hypothalamus and hormones
produced by the pituitary gland. The medulla is regulated by
nerve impulses from the hypothalamus.
Adrenal cortex Kidney Adrenal
medulla
When the hypothalamus is stimulated by receptors, it produces
a hormone that in turn stimulates the pituitary gland to FIGURE 14.25 The adrenal glands are located at the top of the
kidneys and have two parts – the adrenal medulla and the adrenal
produce another hormone that stimulates the production of
cortex. a external view of the kidney with adrenal gland;
hydrocortisone (cortisol) and corticosterone by the cortex region b longitudinal section through the adrenal gland
of the adrenal glands.
Cortisol regulates how the body manages stress and how it converts carbohydrates, fats and proteins
to energy. It also plays a role in regulating cardiovascular function and blood pressure.
Cortisol and corticosterone work together to regulate the immune response and suppress
inflammatory reactions.
Another hormone secreted by the adrenal cortex is aldosterone, which increases the reabsorption
of sodium ions and decreases the reabsorption of potassium ions in the kidney. If receptor cells in the
kidneys detect low levels of sodium ions, they stimulate the adrenal cortex to produce more aldosterone,
which causes greater reabsorption of sodium ions and decreased reabsorption of potassium ions. This
results in sodium and potassium levels returning to values within their tolerance limits. The opposite
occurs if the levels of sodium are too high and the levels of potassium are too low. The levels of sodium
ions in the blood are linked to the maintenance of blood volume and blood pressure. A low level of sodium
ions in the blood will reduce blood volume and therefore blood pressure.
9780170408851 CHAPTER 14 » HOMEOSTASIS 491
14_bio_InFocus12_2e_sb_08851_txt.indd 491 08/08/18 7:39 pm
Pancreas
The endocrine portion of the pancreas consists of structures called pancreatic islets or the islets of
Langerhans (Fig. 14.26), where the hormones insulin and glucagon are produced. These islets contain
two types of cells – alpha and beta cells.
Gallbladder
Islet of Langerhans
Beta cell
Coeliac Alpha cell
Aorta artery
Common bile duct
Tail of pancreas
Pancreatic duct
Duodenum
Body of pancreas
FIGURE 14.26 The pancreas, showing the alpha and beta cells in the islets of Langerhans
Chemoreceptors in the beta cells detect high levels of glucose in the blood and stimulate the
production of insulin. Insulin causes glucose to be removed from the blood in a number of ways:
◗ In the liver, the glucose is converted into glycogen and fat.
◗ Skeletal muscles convert the glucose into glycogen.
◗ Glucose is converted into fat in fat storage tissue.
When the levels of glucose decrease, the production of insulin decreases.
Alpha cells in the islets of Langerhans produce glucagon in response to low levels of glucose in the
blood. Glucagon causes the levels of glucose in the blood to increase by stimulating the production of
glucose, by:
◗ the breakdown of glycogen in the liver
◗ the breakdown of fat in the liver and the fat storage tissues.
When the level of glucose increases back to normal, the production of glucagon is reduced.
KEY CONCEPTS
● The endocrine system assists in the regulation of homeostasis and has two main parts: the
glands and the hormones they secrete.
● Hormones are transported by the bloodstream and cause cells to change their activity in a way
that will maintain homeostasis.
● Glands can be stimulated to secrete hormones by messages from the nervous system, by other
hormones or by receptors located in the particular gland.
CHECK YOUR
UNDERSTANDING 1 Name the two main components of the endocrine system.
2 Define ‘target cells’.
14.2c 3 Outline the different ways in which glands can be stimulated to secrete hormones.
4 Why is the pituitary gland often referred to as the ‘master gland’?
492 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
14_bio_InFocus12_2e_sb_08851_txt.indd 492 08/08/18 7:39 pm
5 a Outline the relationship between the hypothalamus and the pituitary gland in maintaining
homeostasis for certain internal conditions.
b Provide an example to demonstrate the interaction you described in a, in controlling the level of one
named internal condition.
c Draw a labelled negative feedback loop to summarise the example you provided in b.
6 Describe the role of the hormones insulin and glucagon in maintaining the level of glucose in the blood.
7 Outline the relationship between the thyroid and parathyroid glands, and describe the contribution of
each of these glands in maintaining homeostasis.
8 Predict the effect on the body of a disease called Addison’s disease, which causes a decrease in the
production of the hormones cortisol and aldosterone.
9 a Construct a feedback loop using the information provided on page 491 to summarise the control of
calcium levels in the blood.
b Research the condition ‘osteoporosis’ and explain how this condition is related to the maintenance of
calcium levels in the blood.
10 Discuss, using examples, how the endocrine system contributes to the maintenance of homeostasis.
14.3 Adaptations in endotherms
Endotherms are organisms that are able to maintain their body temperature within a very narrow range
of tolerance limits despite variations in the ambient temperature (temperature of the environment).
These organisms rely on internal sources such as metabolic activity in order to maintain their body
temperature.
An adaptation is a characteristic that an organism possesses that will increase the survival and
reproductive chances of that organism in its environment. Endotherms show a combination of
adaptations to assist them in the regulation of body temperature, otherwise known as thermoregulation.
Endotherms that live in areas of high temperature need adaptations that reduce their exposure to
heat and increase their ability to lose heat. Those that live in colder environments benefit from having
adaptations that increase their ability to gain heat and reduce their heat loss.
Adaptations can be divided into three major groups:
◗ behavioural – the way an organism acts Adaptations were
discussed in
◗ structural – the physical characteristics of the organism Biology in Focus
◗ physiological – the way the organism’s body functions. Year 11,
Chapter 8.
Behavioural adaptations
One behavioural adaptation seen in endotherms to assist in thermoregulation is that they alter the
position of their body and/or move to different areas to increase or decrease the amount of exposure of
their surface area to the sunlight.
If the ambient temperature is too high, they may change the position of their body to reduce the
surface area exposed, seek shade, shelter in burrows or move into water to cool down.
During the hottest part of the day, the red kangaroo (Macropus rufus) will seek or and sit in a position
where its hind legs and tail are shaded by the rest of its body – they are positioned at right angles to the
body, with the tail pointing forward, to reduce the large surface area exposed to the sun (Fig. 14.27a).
Fairy penguins (Eudyptula minor) move into water to cool down. Many penguin species, including fairy
penguins, huddle together in cold conditions to reduce the surface area of each penguin exposed to
the cold and thus conserve heat (Fig. 14.27b). The mountain pygmy possum (Figure 14.30b) curls into
a ball, drawing all appendages (legs, nose, ears and tail) in towards the body to reduce the surface area
9780170408851 CHAPTER 14 » HOMEOSTASIS 493
14_bio_InFocus12_2e_sb_08851_txt.indd 493 08/08/18 7:39 pm
exposed to the cold. They also use a burrow to shelter from the cold in shorter periods of low ambient
temperature.
a b
Alamy Stock Photo/Nature Picture Library
Getty Images/iStock/Totajla
FIGURE 14.27 Behavioural adaptations to assist temperature regulation: a red kangaroos lying in the shade; b penguins huddling
together for warmth
Nocturnal activity is another common behavioural adaptation
Alamy Stock Photo/cbstockfoto
to assist in regulating body temperature. It is seen in birds and
mammals that live in habitats where the daytime temperature
is very high. Nocturnal animals remain relatively inactive
during the heat of the day, so that they do not generate
additional metabolic body heat as result of increased activity.
An example is the bilby, Macrotis lagotis, which inhabits
hot, dry regions of Australia (Fig. 14.28). The bilby shelters in
its burrow during the day to avoid the heat, and comes out at
night to forage for food.
Migration is another behavioural adaptation that assists
in thermoregulation. Migrating organisms move to a different
FIGURE 14.28 The bilby has a number of adaptations to assist in habitat that is within their tolerance range.
temperature regulation, including retreating into a burrow, nocturnal
activity, high surface area to volume ratio and large, flat ears. The grey plover (Pluvialis squatarola) (Fig. 14.29a) breeds
in the northern hemisphere between May and August, then
migrates to Australia during August and stays until April.
This migration allows the birds to avoid the severe weather of winter. Many aquatic endotherms migrate
from one area to another to avoid being exposed to extreme temperatures. Humpback whales (Megaptera
novaeangliae) (Fig. 14.29b) in the southern hemisphere migrate annually from their southern feeding
grounds to the warmer waters in the north to mate.
Structural adaptations
Structural adaptations that assist with temperature control include insulation, such as fur, hair and
feathers, which trap a layer of air next to the skin, reducing the amount of heat lost. The feathers of fairy
penguins provide an insulating layer to reduce the amount of heat lost. This layer of air can be altered
depending on the ambient temperature. In cold conditions the feathers are lifted away from the skin,
increasing the air layer and providing a greater degree of insulation. In hotter conditions the feathers lie
flat against the skin, trapping a smaller amount of air.
494 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
14_bio_InFocus12_2e_sb_08851_txt.indd 494 08/08/18 7:39 pm
Shutterstock.com/Simonas Minkevicius
a b
Shutterstock.com/Yann Hubert
FIGURE 14.29 Endotherms that migrate to avoid severe winter weather conditions include a the grey plover and
b the humpback whale.
Blubber is another form of insulation to reduce heat loss from organisms living in water, such as the
Australian fur seal (Arctocephalus pusillus) (Fig. 14.30a).
The surface area to volume ratio is also an important structural component of temperature regulation. Refer to Chapter 3
Animals that live in colder environments, such as the polar bear, are usually larger with a small in Biology in Focus
Year 11 to revise
surface area to volume ratio. This means that there is only a small surface area for heat loss compared to SA:V ratios.
the volume, which allows the body to conserve heat. Smaller animals that live in colder environments,
such as the mountain pygmy possum, have small ears to reduce the surface area for heat loss, thereby
conserving heat. The mountain pygmy possum (Burramys parvus) lives above 1400 metres in the alpine
regions of south-eastern Australia. It has short legs, a round body and small ears with limited circulation,
which all assist in minimising heat loss (Fig. 14.30b).
In hotter environments, animals are usually much smaller, with a large surface area to volume ratio,
which allows them to lose heat more easily. Many animals that live in hot environments have large, thin
ears that allow rapid heat loss. Examples are the bilby (Fig. 14.28) and the African elephant.
Alamy Stock Photo/Auscape International Pty Ltd
Getty Images/iStock/photodeer
a b
FIGURE 14.30 Structural adaptations to assist in thermoregulation: a layers of blubber in the Australian fur seal provide
insulation to minimise heat loss; b the mountain pygmy possum has a small surface area to volume ratio and small ears, to
minimise heat loss.
Physiological adaptations
Physiological adaptations focus on functions within the body. Metabolic activity can be altered to assist the
organism in maintaining its body temperature within the tolerance range. In low ambient temperatures,
the main source of heat in the body of endotherms is that generated as a result of the metabolic activity
9780170408851 CHAPTER 14 » HOMEOSTASIS 495
14_bio_InFocus12_2e_sb_08851_txt.indd 495 08/08/18 7:39 pm
of their cells, particularly the muscle and liver cells. One of the methods by which heat generation occurs
is shivering, which, along with increased metabolic rate, produces heat that will increase the body
temperature. Conversely, reduced activity by the animal leads to less heat production, which helps to lower
the body temperature.
Some organisms use hibernation or torpor to escape the extremes of temperature. Hibernation is an
extended period of inactivity in response to cold, where the body temperature does not drop below 30°C,
but the heart rate and oxygen consumption drop considerably. Hibernation is a mild form of torpor and
is less intense, but may last for a longer period of time.
The mountain pygmy possum hibernates during cold winters to escape below-freezing temperatures
Countercurrent and to reduce the amount of energy required to keep its body warm.
exchange
Torpor is a short-term hibernation where the body temperature drops much lower (below 30°C) and
metabolism, heart rate and respiratory rate decrease, accompanied by a reduced response to external stimuli.
The common wombat (Vombatus ursinus) slows its metabolism to a third of its normal rate on hot
days, particularly when sheltering in its burrow. This is a useful strategy, as wombats do not have sweat
glands to assist in heat loss. Evaporative cooling such as sweating, panting or licking saliva onto the
body surface is another common cooling mechanism. As water
evaporates from the body, heat is removed.
Towards cold tail or foot
Warm blood Organisms can also regulate blood flow to increase or
in artery decrease the amount of heat lost to the surroundings. Because
blood carries heat, and usually the body temperature of an
organism is higher than that of its surroundings, vasodilation
Heat transfer of capillaries near the skin surface increases the amount of
heat released. This mechanism is used in the red kangaroo
(along with the behavioural adaptation of licking the forearm to
Warm blood increase heat loss as the saliva evaporates).
in vein Blood flow can also be increased or decreased at extremities
From cold tail, flipper or foot
to control temperature. The bilby (Macrotis lagotis) has an
Shutterstock.com/Valentyna Chuklyebova
Heat exchange extensive network of capillaries throughout the ear that aid in
from arteries
Artery releasing heat to its surroundings. Furthermore, a mechanism
to veins
Reduced heat called countercurrent exchange (Fig. 14.31) allows the warm
Vein
loss from foot blood in arteries (flowing from the heart towards the extremities)
to heat the cooler blood in the veins coming back from the cold
extremities, before this blood is returned to the heart. This
occurs in the feet of the platypus (Ornithorhynchus anatinus) as
well as the fins of the Australian fur seal, so that the internal core
FIGURE 14.31 Countercurrent heat exchanges reduce heat loss temperature is not lowered by cool blood returning from limbs
at the extremities.
that have a large surface area exposed to the cold water.
KEY CONCEPTS
● Endotherms are organisms that rely on internal sources, such as metabolic activity, to maintain
WS
their body temperature within a very narrow range of tolerance limits despite variations in the
ambient temperature.
Adaptations to
endothermy ● Adaptations of endotherms to maintain body temperature:
BEHAVIOURAL STRUCTURAL PHYSIOLOGICAL
• Change position/ alignment • Insulation • Changes to metabolic rate
of body • Surface area to volume ratio • Hibernation/torpor
• Burrow related to body shape and • Evaporative cooling
• Nocturnal activity size of structures such as • Regulation of blood flow to
• Migration ears surface and extremities
• Countercurrent exchange
496 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
14_bio_InFocus12_2e_sb_08851_txt.indd 496 08/08/18 7:39 pm
CHECK YOUR
1 Define the following terms: UNDERSTANDING
a adaptation
b endotherm
14.3
c thermoregulation.
2 Unlike endotherms, which are able to regulate their body A
temperature, the body temperature of ectotherms depends on
the ambient temperature. On the graph shown in Figure 14.32,
Body temperature
identify which line represents each of the following, and explain B
why:
a an endotherm
b an ectotherm.
3 Describe what is meant by the each of following types of
adaptations, and provide an example of each in relation to
temperature regulation:
Environmental temperature
a behavioural
b structural FIGURE 14.32 Body temperature in relation to ambient
c physiological. temperature, for an endotherm and an ectotherm
4 Explain why many animals that live in colder environments are
much bigger than animals that live in warmer environments.
5 a Describe how the process of countercurrent heat exchange works.
b Explain how this process assists in the maintenance of body temperature. Use a diagram to aid your
explanation.
6 The following is a list of adaptations present in a range of endotherms:
i curls into a ball, limbs drawn in vi panting
ii large, thin ears vii red face
iii burrowing viii lips and nose appear blue
iv basking in the sun ix thick fur.
v shivering
a Identify which adaptations would be present in animals that live in a cooler environment.
b For each adaptation you identified in a, determine whether it is structural, behavioural or physiological.
c For each adaptation you identified in a, describe how it assists in regulating the body temperature of
the endotherm.
Mechanisms to maintain water
14.4 balance in plants
The main form of water loss in plants is by means of transpiration – evaporation of water from the stomata
of leaves. Transpiration serves two main functions: it lifts water and dissolved ions from the roots and up
the stem to the top of plants in a continuous transpiration stream; and it is a form of evaporative cooling,
a process that is essential in regulating temperature in plants. Stomata also need to be open to allow the
exchange of gases for photosynthesis. Plants that live in areas where water is in limited supply (usually
hot, dry areas) must achieve a balance between how much water the plant can afford to lose for cooling
purposes, transpiration, exchange of gases and the risk of dehydration.
Xerophytes are plants that live in arid conditions and have adaptations that equip them to achieve
this balance and survive in their hostile environment. Most of these adaptations are evident as
modifications of leaves, but other organs may also show modifications. Stems and leaf stalks (petioles)
9780170408851 CHAPTER 14 » HOMEOSTASIS 497
14_bio_InFocus12_2e_sb_08851_txt.indd 497 08/08/18 7:39 pm
have sparsely distributed stomata, but are green, because they have photosynthetic tissue. This can be
used to advantage in allowing xerophytes with reduced leaves to carry out essential functions to survive
in their arid habitat.
Reducing internal temperature
Some plants have developed structural features or physiological mechanisms other than transpiration to
reduce their internal temperature, allowing the plants to use less water for evaporative cooling but still
keep their temperature within the correct range for metabolism.
◗ Their leaves may be coated in a shiny waxy cuticle or a thick, leathery cuticle. This ensures that all
the epidermal cells are waterproof, preventing loss of water by evaporation from these surface cells.
◗ The leaf may have white hairs to reflect sunlight, which will reduce the temperature on the surface of
the leaf and thus reduce evaporation.
Reducing the exposure of transpiring plant structures to sunlight
Plant organs that have the most abundant stomata have the greatest rates of transpiration. In some
plants, the exposure of these organs (and their stomata) to light is reduced by:
◗ the orientation of the leaves so that stomata are
Alamy Stock Photo/lee avison
not exposed to direct light
◗ reduced surface area of organs that have the
highest proportion of stomata
◗ the complete loss of transpiring plant organs,
such as leaves (Fig. 14.33) or leaf-like parts of the
plant (for example, flowers). (These plants need
to have some additional adaptations to prevent
overheating, increase their photosynthetic tissue
or ensure pollination, because of their loss of leaf
or petal surface area.)
Some examples of adaptations that reduce water
loss are:
◗ reduced leaf size – some plants have smaller leaves,
with each leaf divided into pinnae or leaflets. Other
plants have leaves that are reduced to tiny brown
bracts or scales, and their photosynthetic function
is taken over by other parts of the plant, such as
cladodes (photosynthetic stems) and phyllodes
(photosynthetic leaf stalks). The photosynthetic
stems or stalks that take over the function of the
FIGURE 14.33 The leaves of some cacti are reduced
leaves have very few stomata and therefore the to spines, to reduce water loss (as well as protecting
amount of water lost by transpiration is reduced, them against being eaten by animals).
while the photosynthetic surface area is still
sufficient. Many phyllodes and cladodes have the added features of hairs and/or sunken stomata
◗ reduced size of flowers or no petals can reduce the amount of water a plant requires and also reduce
evaporation of water from flower surfaces
◗ shedding leaves reduces the overall amount of water lost from leaves
◗ orientation of leaves on the stem helps minimise water loss because the stomata are not directly
exposed to sunlight during the hottest part of the day.
498 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
14_bio_InFocus12_2e_sb_08851_txt.indd 498 08/08/18 7:40 pm
Regulating the opening and closing of stomata
Some plants minimise the loss of water by only opening the stomata during the cooler parts of the day,
such as early morning and late afternoon. At these times when the temperature is lower, evaporation is WS
reduced and therefore water loss is minimised. Mechanisms to
The difference in water concentration between the plant and the surrounding atmosphere determines conserve water
in plants
how much water is lost by transpiration. On a hot, dry day, the water concentration in the air is much
lower than in the internal tissues of the leaf, and so more water is lost by transpiration than on a cooler
or more humid day.
Because plants cannot change their external environment, many have adaptations that allow them
to create their own smaller ‘microclimate’ in the air immediately surrounding each leaf. Structures such
as hairy leaves, rolled leaves and sunken stomata trap water in the immediate vicinity and in this way
keep the air around the plant humid, by preventing the moist air being swept away by dry air currents
and by creating a barrier to evaporation. These adaptations allow plants to keep their stomata open for a
longer period of time, as little water is lost and so gaseous exchange for photosynthesis can occur freely.
Water storage
Shutterstock.com/Michelle Duguid
Some plants, called succulents, have adaptations such as
fleshy stems or leaves that swell up and retain moisture
when it is available; they then survive by using this moisture
during dry periods.
Fruits
Fruits are structures that are removed from plants so that the
seeds they contain can be dispersed. Many plants produce
woody fruits rather than fleshy fruits, which reduces the
amount of water lost from the plant when the fruits fall off
FIGURE 14.34 Because the fruit of plants such as banksias is woody
(Fig. 14.34). and dry, the plant does not lose water when the fruit falls.
INVESTIGATION 14.4
A first-hand and secondary-source investigation into mechanisms
in plants to maintain water balance
INTRODUCTION
Many plants possess adaptations that allow water balance to be maintained by minimising water loss while still Information and
communication
maintaining necessary functions such as cooling of the plant and photosynthesis. technology
These adaptations are discussed on pages 497–9. capability
AIM Personal and
social capability
To provide examples of adaptations by plants to maintain water balance and explain how these adaptations
assist in this process
9780170408851 CHAPTER 14 » HOMEOSTASIS 499
14_bio_InFocus12_2e_sb_08851_txt.indd 499 08/08/18 7:40 pm
MATERIALS
• samples of leaves with different adaptations for maintaining water balance: hakea, eucalypt, banksia, wattle,
casuarina and pigface are some examples that could be used
• binocular microscopes, hand lens
• newspaper
• gloves
RISK ASSESSMENT
!
RISK WHAT ARE THE WHAT RISK DOES THIS
ASSESSMENT HAZARDS? HAZARD POSE? HOW CAN YOU SAFELY MANAGE THIS RISK?
Binocular microscope Sharp edges can cause cuts, damage to Handle with care, ensure glass areas are not chipped
limbs if dropped. or broken.
Plant tissue Could cause allergic reaction. Always wear gloves when handling plant tissue. Wash
hands immediately after examination.
METHOD
1 Working in groups for this investigation, refer to the information provided on pages 497–9 about the
different adaptations of plants to allow water balance to be maintained.
2 Use numerous secondary sources to find specific examples of plants that possess these types of
adaptations. Each member of the group should be assigned specific adaptations to research, and the
results from all group members can then be collated.
3 You will need to name the plant that possesses the specific adaptation, describe the adaptation, draw a
scientific diagram and explain how this adaptation assists in maintaining water balance in the plant.
4 Record your findings in a table like the one supplied in the Results section. This table would be most
effective displayed in landscape.
RESULTS
1 Record your results in a table like the one below.
HOW THIS ADAPTATION
NAME OF DESCRIPTION OF DIAGRAM OF ASSISTS IN MAINTAINING
TYPE OF ADAPTATION PLANT ADAPTATION ADAPTATION WATER BALANCE
Shiny waxy cuticle on leaf
Covering of tiny, white hairs
on leaf
Reduced leaf size
Phyllodes
Reduced flower size
Orientation of leaves
Sunken stomata
Curled leaves
Succulent
Regulation of opening and
closing of stomata
2 Individually observe the specimens of leaves provided at each workstation, and determine the adaptations
present on each leaf that would assist in the maintenance of water levels in the plant it originated from.
3 For each leaf, draw a diagram of the adaptation and describe how this adaptation assists in the
maintenance of water levels.
500 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
14_bio_InFocus12_2e_sb_08851_txt.indd 500 08/08/18 7:40 pm
DISCUSSION
1 Discuss the benefits of working as part of a team.
2 Outline the type of environment in which each of the adaptations researched would be necessary for a
plant to survive.
3 Plants could conserve water by keeping their stomata closed at all times. Discuss the reasons why the
stomata cannot remain closed at all times.
CONCLUSION
Write a few sentences that summarise your findings as related to the aim.
KEY CONCEPTS
● The main form of water loss from plants is transpiration, which is required to move water up
the xylem and for evaporative cooling.
● Water is also lost when stomata are open for gas exchange.
● Plants that live in areas of low water availability must achieve a balance between how much
water the plant can afford to lose for cooling, transpiration, exchange of gases and the risk of
dehydration.
● Xerophytes are plants that live in arid conditions and have adaptations that equip them to
achieve this balance and survive in their hostile environment.
● They do this by:
– reducing the exposure of transpiring plant structures to sunlight
– reducing the internal temperature
– regulating the opening and closing of the stomata
– reducing the difference in water concentration between the plant and the outside air
– storing water
– producing woody fruits.
CHECK YOUR
1 Define the following terms: UNDERSTANDING
a transpiration
b transpiration stream 14.4
c xerophytes.
2 Outline the adaptations of plants to achieve the following:
a reduce the internal temperature
b reduce the difference in water concentration between the plant and the outside air.
In each case, explain how these adaptations help to conserve water ,and provide examples of plants that
have these adaptations.
3 a Distinguish between a cladode and a phyllode.
b Explain how cladodes and phyllodes assist the plant to conserve water.
c Provide examples of plants that possess cladodes or phyllodes.
4 a Define ‘succulent’.
b Explain how this type of adaptation assists plants to maintain water balance.
9780170408851 CHAPTER 14 » HOMEOSTASIS 501
14_bio_InFocus12_2e_sb_08851_txt.indd 501 08/08/18 7:40 pm
14 CHAPTER SUMMARY
Homeostasis: How is an organism’s internal environment maintained in response
to a changing external environment?
MAINTAINING HOMEOSTASIS
Homeostasis is the maintenance of a relatively constant internal state, Stimulus
regardless of external changes. Changes occur in
internal condition
Upper value triggers Receptor
a response to counteract Detects the
Normal range
the increase change Controlled condition
back to normal
Set point (ideal value) Sends messages via
nerves/hormones
Lower value triggers
a response to counteract Control centre
the decrease Analyses messages
and initiates actions
Time
Negative
feedback
It is important to maintain internal conditions at a level that allows Directions sent via
nerves/hormones
optimal functioning of enzymes to ensure optimal metabolic efficiency.
Effectors
The two main stages of homeostasis are: Muscles, organs
and glands
• detecting change
• counteracting change. Carry out
The body maintains homeostasis using negative feedback mechanisms, Counteracts
the stimulus
Response
e.g. maintenance of body temperature and glucose level.
Coordination
of homeostasis
COORDINATION BY THE ENDOCRINE SYSTEM
Nervous system Endocrine system
Hypothalamus: thyrotropin-releasing
hormone and others
Pituitary gland: TSH,
antidiuretic hormone
CNS Peripheral Hormones Glands Pineal gland: melatonin
Brain Thyroid gland: thyroxine
Central
nervous
system
Spinal cord
Thymus
Parathyroid glands (usually
Peripheral nervous
system four): parathyroid hormone
Adrenal glands
(two): hydrocortisone,
corticosterone, Pancreas: insulin,
aldosterone glucagon
Ovaries (two) in
females: oestrogen,
progesterone Testes (two) in males: testosterone
502 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
14_bio_InFocus12_2e_sb_08851_txt.indd 502 08/08/18 7:40 pm
COORDINATION BY THE NERVOUS SYSTEM
Axon Dendrite
• Neurons are nerve cells that make up the nervous
system and carry electrical messages in the form of
ssa
ge electrical impulses.
Me
• A typical neuron consists of a cell body, dendrites and
axon.
Soma
Myelin sheath • There are three main types: sensory, motor, interneurons.
• A synapse is the gap between the axon of one neuron
and the dendrites of a neighbouring neuron.
• Neurotransmitters transfer impulses across the synapses.
Synapse
MAINTAINING BODY TEMPERATURE
Adaptations to maintain body temperature – endotherms
BEHAVIOURAL STRUCTURAL PHYSIOLOGICAL
• Change position/ alignment of body • Insulation • Changes to metabolic rate
• Burrow • Surface area to volume ratio related • Hibernation/torpor
• Nocturnal activity to body shape and size of structures • Evaporative cooling
• Migration such as ears • Regulation of blood flow to surface and
extremities
• Countercurrent exchange
Towards cold tail or foot
Warm blood
in artery
Heat transfer
Warm blood
in vein
From cold tail, flipper or foot
Heat exchange
from arteries
Artery
to veins
Reduced heat
Vein
loss from foot
MAINTAINING WATER BALANCE
Mechanisms to maintain water balance in plants
Need to find a balance between transpiration, exchange of gases,
evaporative cooling and the need to conserve water
Reducing internal Reducing exposure Regulating the
to sunlight opening and Water storage Fruits
temperature
closing of stomates
9780170408851 CHAPTER 14 » HOMEOSTASIS 503
14_bio_InFocus12_2e_sb_08851_txt.indd 503 08/08/18 7:41 pm
14 CHAPTER REVIEW QUESTIONS Qz
Review quiz
1 Describe the importance of homeostasis in living 10 Research information about sclerophyll plants and answer
organisms. the following questions.
2 Explain, using an example, what is meant by a a What is a sclerophyll plant?
negative feedback mechanism and its importance in b Provide two Australian examples of sclerophyll plants
living systems. and identify some adaptations that each of these
plants possesses to assist in temperature regulation.
3 Explain the relationship between metabolic rate and
temperature regulation in birds and mammals. c Explain how each of these adaptations assists the plant
to conserve water.
4 Assess the importance of the role of the nervous system in
maintaining homeostasis. 11 Discuss the processes that a plant has to balance in order
to maintain proper functioning while conserving water.
5 a Using the information provided on page 491 about
the secretion of aldosterone to maintain the balance of 12 Refer to the graph in Figure 14.35.
sodium (Na+) and potassium (K+) ions in the blood and
gb ird
your own research, construct a negative feedback loop min
Mass-specific metabolic rate (mL O2/gram/hour)
to summarise the steps that occur: 40 Humng)
i
+ (fly
i when levels of Na are too high
ii when levels of Na+ are too low. 8
Hint: You may wish to include both loops in the one 7
diagram, like the one shown for temperature regulation in
Figure 14.4. 6 )
rest
rd (at
b For each of the loops you have drawn for question a, 5 gbi
identify the: min
4 Hum
i stimulus iv effector use
3 d mo
ii receptor v response. Fiel ous
e
em
iii control centre
2
H ous
Bat t
1 Cat Dog uman orse ephan
6 Discuss how the endocrine system assists in maintaining H H El
the health and wellbeing of organisms. 0
0.01 0.1 1 10 100 1000 10 000
7 At times, endocrine glands malfunction, causing secretion Mass (kg)
of incorrect levels of hormones. Research the effects on
FIGURE 14.35 Graph comparing mass of an organism with metabolic rate
the body of the following:
a The thyroid gland secretes: a Make a general statement about the trend shown in
i too much thyroxine this graph.
ii too little thyroxine. b Explain why an elephant has a lower metabolic rate
than a house mouse.
b Too much cortisol is circulating in the bloodstream.
c The adrenal cortex does not produce enough aldosterone. 13 Refer to the diagrams in Figure 14.36.
8 a Research and identify the types of adaptations
possessed by endotherms that help them to balance
their water levels in hot, dry environments.
b Explain how each of the adaptations you identified in a
assists in maintaining water balance.
c Support your research with named examples and
the adaptations they possess. Include at least one A B C
behavioural, structural and physiological adaptation. FIGURE 14.36 Organisms in different habitats exhibit
different structural adaptations.
9 Assess the importance of adaptations by an organism
in helping to regulate internal body conditions such as
a Identify which of the organisms would most likely live:
temperature.
i in a hot, dry environment
ii in a cold environment.
b Justify each of your choices in a.
504 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
14_bio_InFocus12_2e_sb_08851_txt.indd 504 08/08/18 7:41 pm
16 Epidemiology
Students:
• analyse patterns of non-infectious diseases in populations, including their incidence and prevalence, including
INQUIRY QUESTION but not limited to: ICT, IU, L, CC
Why are epidemiological – nutritional diseases
studies used? – diseases caused by environmental exposure
• investigate the treatment/management, and possible future directions for further research, of a non-infectious
disease using an example from one of the non-infectious diseases categories listed above ICT, IU, L
• evaluate the method used in an example of an epidemiological study
• evaluate, using examples, the benefits of engaging in an epidemiological study
Biology Stage 6 Syllabus © NSW Education Standards Authority for and on behalf of the Crown in right of the State of New South Wales, 2017
Getty Images/PeopleImages
9780170407281
9780170408851 541
16_bio_InFocus12_2e_sb_08851_txt.indd 541 08/08/18 7:44 pm
The incidence of a particular disease, the cause of which is unknown, could be increasing in a population.
This disease might be causing severe symptoms for the sufferers, and could quite often result in death.
This leads scientists to ask questions such as: Are there patterns to this disease? What could be the cause
of this disease? What control measures can be put in place to help prevent this disease?
In order to answer these questions, an epidemiological study can be undertaken. The word
‘epidemiology’ comes from epi and demos, Greek words meaning ‘upon’ and ‘people or populace’
respectively. It is a study of ‘that which is upon people’. Epidemiologists study disease in a population, as
opposed to those who study it in an individual organism. The World Health Organization’s (WHO 2018)
definition of epidemiology is:
the study of the distribution and determinants of health-related
states or events (including disease), and the application of this
study to the control of diseases and other health problems. Various
Dreamstime.com/Masterofall686
methods can be used to carry out epidemiological investigations:
surveillance and descriptive studies can be used to study
distribution; analytical studies are used to study determinants.
Source: Word Health Organiation 2018, ‘Health topics. Epidemiology’,
http://www.who.int/topics/epidemiology/en/
Epidemiology can be used to study both infectious and non-infectious
diseases as well as events such as suicides, car accidents and work-related
accidents. Epidemiology helps to determine what causes the disease, as well as
who is affected, and where and how to intervene to prevent further occurrence.
Studies can target limited public health resources at the specific causes and
populations affected.
FIGURE 16.1 Epidemiology is the scientific study Public health authorities use the results of epidemiological studies to develop
of patterns in data to help determine the cause
of disease and the effectiveness of preventative strategies for controlling disease and improving public health. Epidemiological
strategies. studies can also be used to evaluate strategies that are already in place to
control or treat disease and health-related conditions.
Analysis of patterns
16.1 of non-infectious disease
Epidemiological studies play a major role in identifying patterns in the incidence, distribution, prevalence
and mortality rates of disease. These studies also investigate the possible causes of disease and whether
certain population groups are at greater risk of developing a certain disease. They go on to determine the
strategies that would be most effective in controlling disease in the population.
Accepted scientific and mathematical models are used to statistically analyse the data that has been
collected, to provide information about these trends. This analysis provides information to determine
the trends for the overall population as well as for subsets of the population such as males, females,
different races and different locations. Data is often presented in different forms, such as tables and
graphs, to help understand the trends and patterns in data.
KEY CONCEPTS
● Epidemiology is the study of patterns of disease in populations.
● An epidemiological study can:
– determine the cause of a disease and which populations are affected by the disease
– help to develop strategies to control disease and improve public health
– evaluate the effectiveness of strategies in place to treat/control disease.
● Analysis of data allows the identification of patterns and trends in the incidence, prevalence
and mortality rates of disease.
● This information can then be used to identify areas and ways in which the overall health of the
population can be improved.
542 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
16_bio_InFocus12_2e_sb_08851_txt.indd 542 08/08/18 7:44 pm
Analysing data
Investigations 16.1 and 16.2 are about analysing patterns of non-infectious diseases in populations. In
Investigation 16.1 you will analyse the data that you collected about a nutritional disease in Investigation WS
15.3 in the previous chapter. In Investigation 16.2 you will analyse the data presented about the incidence, The parameters
mortality and prevalence of colorectal cancer in populations. It is your choice as to whether you complete of epidemiology
only one of these investigations or both.
INVESTIGATION 16.1
A secondary-source investigation to analyse patterns
of a nutritional non-infectious disease in populations
INTRODUCTION
Information and
In this investigation you will analyse the data about a nutritional disease that you collected in the previous communication
chapter. You will analyse the incidence and prevalence of the disease, although you may also wish to include technology
capability
analysis of other data such as mortality. Ensure that you use correct scientific terminology at all times.
AIM Intercultural
understanding
To analyse patterns of a nutritional disease in populations
METHOD Literacy
1 Review Chapter 15 and write down the definitions of incidence and prevalence (page 524).
Civics and
2 For each set of data that you collected about your selected nutritional disease (in Investigation 15.3), citizenship
describe the trend in the data for the incidence and prevalence of the disease, and describe any differences
between the groups being studied.
3 Include analysis of data between different groups in the population such as gender, age, race and regions
of the world.
4 If you have information in one particular form you could convert it into another form. For example, if you
have tables containing data you could convert this information into graphs as part of the analysis.
5 Suggest reasons for each of the trends that you have described.
6 For at least one set of data, compose questions about trends in the data and use the data collected to
answer the questions.
7 Predict future trends for each of the data sets you have studied.
8 Provide summary statements about the incidence, distribution and prevalence of your selected nutritional
disease in Australia and the world. These statements should address the differences between groups in the
population, based on age, gender, race and regions of the world.
9 Develop inquiry questions and hypotheses to identify a concept that could form the basis of future
research into your chosen nutritional disease.
RESULTS
1 Include any graphs or tables that you have drawn from the data collected.
2 Record the questions that you have composed for one set of data and the answers obtained using
that data.
9780170408851 CHAPTER 16 » EPIDEMIOLOGY 543
16_bio_InFocus12_2e_sb_08851_txt.indd 543 08/08/18 7:45 pm
DISCUSSION
1 Describe trends for each set of data collected about your selected nutritional disease and differences
described between the groups being studied.
2 Suggest reasons for each of the trends you have described.
3 a Describe what data about prevalence indicates.
b Identify the link between prevalence data and the 5-year survival rate data.
4 Provide summary statements about the incidence, mortality and prevalence of your nutritional disease
in Australia and the world. These statements should address the differences between groups in the
population, such as age, gender, race and regions of the world.
5 Outline the inquiry questions and hypotheses you have developed to direct areas of future research into
your chosen nutritional disease.
CONCLUSION
Write summary statements relating to the aim of this investigation.
INVESTIGATION 16.2
A secondary-source investigation to analyse data about the
incidence, mortality and prevalence of colorectal cancer
INTRODUCTION
Information and Colorectal cancer, or bowel cancer, includes all cancers of the colon and the rectum. Of those people who
communication develop colorectal cancer, 25% have some sort of hereditary influence. The other 75% of people who develop
technology
capability colorectal cancer have no family history of this cancer. Age is one of the risk factors associated with colorectal
cancer, with a sharp increase in the incidence of colorectal cancer after the age of 50.
Intercultural The chance of developing colorectal cancer is also increased by exposure to nutritional and environmental
understanding factors associated with lifestyle. Smoking and drinking alcohol are two of the lifestyle factors that increase the
risk of developing colorectal cancer.
Literacy Nutritional behaviours such as eating red meat, especially when charred, and consuming processed meats
that have been preserved, salted, cured or smoked, also increase the likelihood of developing colorectal cancer.
Civics and
Other risk factors, such as being overweight or obese and a lack of physical activity, also increase the chance of
citizenship developing colorectal cancer.
AIM
To analyse patterns of colorectal cancer in populations
METHOD
1 Refer to the graph in Figure 16.2 of the estimated age-specific incidence and mortality rates for colorectal
cancer in Australia, by sex, for 2017 and answer the questions in the Analysis of results and discussion section.
2 Refer to the graph in Figure 16.3 showing the age-standardised incidence and mortality rates for colorectal
cancer in Australia and answer the questions in the Analysis of results and discussion section.
544 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
16_bio_InFocus12_2e_sb_08851_txt.indd 544 08/08/18 7:45 pm
Source: Australian Institute of Health and Welfare.
Creative Commons BY 3.0 (CC-BY 3.0) licence.
600
500
Rate (per 100 000)
400
300
200
100
0
4
!
0–
5–
–1
–1
–2
–2
–3
–3
–4
–4
–5
–5
–6
–6
–7
–7
–8
85
10
15
20
25
30
35
40
45
50
55
60
65
70
75
80
Age group (years)
Males – incidence Females – incidence Persons – incidence
Males – mortality Females – mortality Persons – mortality
FIGURE 16.2 Estimated age-specific incidence and mortality rates for colorectal cancer, by sex, Australia 2017
Source: Australian Institute of Health and Welfare.
Creative Commons BY 3.0 (CC-BY 3.0) licence.
100
80
Rate (per 100 000)
60
40
20
0
68
70
72
74
76
78
80
82
84
86
88
90
92
94
96
98
00
02
04
06
08
10
12
14
19
19
19
19
19
19
19
19
19
19
19
19
19
19
19
19
20
20
20
20
20
20
20
20
Year
Males – incidence Females – incidence Persons – incidence
Males – mortality Females – mortality Persons – mortality
FIGURE 16.3 Age-standardised incidence rates for colorectal cancer 1982–2013 and age-standardised mortality
rates for colorectal cancer 1968–2014, by sex, in Australia
3 Refer to the following information on the prevalence of colorectal cancer in Australia and summarise it in a
table in the Results section.
At the end of 2012 there were:
• 13 078 people living who had been diagnosed with colorectal cancer that year
• 52 630 people who had been diagnosed with colorectal cancer in the previous 5 years (2008–2012)
• 129 497 people who had been diagnosed with colorectal cancer in the previous 31 years (1982–2012).
4 Refer to the graph in Figure 16.4, which shows the 5-year relative survival rate from colorectal cancer,
1984–1988 to 2009–2013, and answer the questions in the Analysis of results section.
The 5-year relative survival rate provides the percentage (%) chance of an individual being alive 5 years
after being diagnosed with colorectal cancer.
9780170408851 CHAPTER 16 » EPIDEMIOLOGY 545
16_bio_InFocus12_2e_sb_08851_txt.indd 545 08/08/18 7:45 pm
Source: Australian Institute of Health and Welfare.
Creative Commons BY 3.0 (CC-BY 3.0) licence.
80
5-year relative survival (%)
Males Females Persons
70
60
50
40
0
1984–1988 1989–1993 1994–1998 1999–2003 2004–2008 2009–2013
Year
FIGURE 16.4 5-year relative survival from colorectal cancer, 1984–1988 to 2009–2013
5 Refer to Table 16.1, which lists incidence, mortality and prevalence data on colorectal cancer worldwide for
2012, and answer the questions in the Analysis of results and discussion section.
TABLE 16.1 Incidence, mortality and prevalence data worldwide for colorectal cancer, 2012
ESTIMATED NUMBERS MEN WOMEN BOTH SEXES
(THOUSANDS)
CASES DEATHS 5-YEAR PREV. CASES DEATHS 5-YEAR PREV. CASES DEATHS 5-YEAR PREV.
World 746 374 1953 614 320 1590 1361 694 3544
More developed 399 175 1164 338 158 966 737 333 2130
regions
Less developed 347 198 789 276 163 624 624 361 1414
regions
WHO Africa region 16 11 32 15 11 31 31 22 63
(AFRO)
WHO Americas 125 57 362 121 55 342 246 112 705
region (PAHO)
WHO East 18 12 40 15 10 33 33 21 73
Mediterranean
region (EMRO)
WHO Europe region 255 120 686 216 108 573 471 228 1258
(EURO)
WHO South-East Asia 68 48 122 52 37 93 120 85 216
region (SEARO)
WHO Western Pacific 264 125 711 195 100 518 460 225 1229
region (WPRO)
IARC membership 418 187 1181 351 167 976 769 353 2157
(24 countries)
United States of 69 29 214 65 27 199 134 55 413
America
China 147 79 338 107 60 245 253 139 583
India 37 28 50 27 21 37 64 49 87
European Union 193 83 536 152 69 417 345 152 953
(EU-28)
Reproduced with permission from Ferlay J., Soerjomataram I., Ervik M., Dikshit R., Eser S., Mathers C., Rebelo M., Parkin D.M., Forman D., Bray, F. GLOBOCAN 2012 v1.0, Cancer Incidence and Mortality
Worldwide: IARC CancerBase No. 11 [Internet]. Lyon, France: International Agency for Research on Cancer; 2013. Available from: http://globocan.iarc.fr, accessed on February 2017.
6 Refer to the graphs in Figure 16.5 showing the age-standardised incidence and mortality rate of colorectal
cancer for all ages combined, by Indigenous status, in NSW, Vic., Qld, WA and NT. Then answer the
questions in the Analysis of results and discussion section.
546 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
16_bio_InFocus12_2e_sb_08851_txt.indd 546 08/08/18 7:45 pm
a b
BY 3.0 (CC-BY 3.0) licence.
Source: Australian Institute of Health
and Welfare, 2017. Creative Commons
Age-standardised incidence
Age-standardised mortality
100 20
rate (per 100 000)
rate (per 100 000)
80 15
60
10
40
5
20
0 0
Indigenous Non-Indigenous Indigenous Non-Indigenous
Indigenous status Indigenous status
FIGURE 16.5 Colorectal cancer rates by Indigenous status: a age-standardised incidence rate of colorectal cancer for all ages combined, by
Indigenous status (NSW, Vic., Qld, WA and NT, 2008–2012); b age-standardised mortality rate from colorectal cancer for all ages combined, by
Indigenous status (NSW, Qld, WA, SA and NT, 2010–2014)
7 Refer to the graph in Figure 16.6 showing the age-standardised incidence and mortality rate for colorectal For an
explanation of
cancer in different regions of the world, and compose three questions relating to this data. Provide answers the meaning of
to these questions using the data. the term ‘age-
standardised’
rates, see
Chapter 15,
Male Female page 524.
Reproduced with permission from Ferlay J., Soerjomataram I., Ervik M., Dikshit R., Eser S., Mathers C., Rebelo M., Parkin D.M., Forman D., Bray,
Research on Cancer; 2013. Available from: http://globocan.iarc.fr, accessed on February 2017.
F. GLOBOCAN 2012 v1.0, Cancer Incidence and Mortality Worldwide: IARC CancerBase No. 11 [Internet]. Lyon, France: International Agency for
Australia/New Zealand
Western Europe
Eastern Europe
Southern Europe
Northern Europe
Incidence
More developed regions Mortality
Central and Eastern Europe
Northern America
Micronesia
Eastern Asia
World
Caribbean
South America
Western Asia
South-Eastern Asia
Less developed regions
Southern Africa
Polynesia
Melanesia
Central America
Northern Africa
Eastern Africa
South-Central Asia
Middle Africa
Western Africa
50 40 30 20 10 0 10 20 30 40 50
Estimated age-standardised rates
(world) per 100 000
FIGURE 16.6 Age-standardised incidence and mortality rate for colorectal cancer in different
regions of the world, 2013
9780170408851 CHAPTER 16 » EPIDEMIOLOGY 547
16_bio_InFocus12_2e_sb_08851_txt.indd 547 08/08/18 7:45 pm
RESULTS
1 Construct a table to summarise the information provided in Step 3 of the Method section.
2 Develop three questions about the data in Figure 16.6 and provide answers to these questions using
the data.
ANALYSIS OF RESULTS AND DISCUSSION
When you are addressing each of the activities indicated, ensure that you use correct scientific terminology.
Also ensure that you distinguish between measurements such as incidence (the actual number of new cases
diagnosed) and the rate per 100 000 (either age-standardised or age-specific).
1 Refer to Figure 16.2. For both the age-specific incidence and mortality rates:
a Outline the trend shown for all persons.
b Outline the difference between males and females.
c Suggest hypotheses to account for the differences outlined.
d Predict future trends for each.
2 Refer to Figure 16.3. For both the age-standardised incidence and mortality rates:
a Outline the trend shown for all persons.
b Outline the difference between males and females.
c Suggest hypotheses to account for the differences outlined.
d Predict future trends for each.
3 Refer to Figure 16.3.
a Suggest reasons why both the age-standardised incidence and mortality rates have fallen in
recent years.
b Predict future trends for each. Explain the basis of your prediction.
4 Refer to Figure 16.4, Table 16.1 and the table you constructed showing prevalence.
a Describe, in general terms, what the data about prevalence indicates.
b Identify the link between the prevalence data and the 5-year survival rate data.
c Outline the trend in the 5-year survival rate for colorectal cancer.
d Suggest reasons for the trend shown.
e Predict future trends in the 5-year survival rate for colorectal cancer in Australia.
f Compare the 5-year prevalence data for colorectal cancer in different regions of the world.
5 Refer to Figure 16.5.
a Comment on the difference in incidence and mortality rate for colorectal cancer between the
Indigenous and non-Indigenous populations.
Incidence and b Develop inquiry questions and hypotheses to investigate/research reasons for these differences.
prevalence of
cancers 6 Provide summary statements about the incidence, mortality and prevalence of colorectal cancer in
Watch the videos Australia and the world. These statements should address the differences between different groups in the
about different types
of cancer to determine population such as those defined by age, gender, race and regions of the world.
the incidence and
prevalence of different CONCLUSION
types of cancer.
Write summary statements relating to the aim.
548 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
16_bio_InFocus12_2e_sb_08851_txt.indd 548 08/08/18 7:45 pm
CHECK YOUR
1 The graph in Figure 16.7 shows the age-standardised incidence rate for lung cancer, 1982–2013, and the UNDERSTANDING
age-standardised mortality rates for lung cancer, 1968–2014, by gender, in Australia.
16.1
Commons BY 3.0 (CC-BY 3.0) licence.
Source: Australian Institute of Health and Welfare. Creative
120
100
Rate (per 100 000)
80
60
40
20
0
68
70
72
74
76
78
80
82
84
86
88
90
92
94
96
98
00
02
04
06
08
10
12
14
19
19
19
19
19
19
19
19
19
19
19
19
19
19
19
19
20
20
20
20
20
20
20
20
Year
Males – incidence Females – incidence Persons – incidence
Males – mortality Females – mortality Persons – mortality
FIGURE 16.7 Age-standardised incidence rate for lung cancer, 1982–2013, and age-standardised mortality rates
for lung cancer 1968–2014, by gender, in Australia
a Outline the trend shown in the graph for the age-standardised incidence rates of lung cancer for:
i females
ii males.
b Suggest hypotheses to account for these trends.
c Outline the trend shown in the graph for the age-standardised mortality rates of lung cancer for:
i females
ii males.
d Suggest hypotheses to account for these trends.
e Predict future trends in the age-standardised mortality rates of lung cancer in both males and females.
f Describe how this information could be used to improve the health of the population.
2 Refer to the graphs in Figure 16.8 showing the prevalence of diabetes mellitus (types 1 and 2) for different
age groups in the Australian population in 2001 and 2014–2015. These graphs show the percentage (%) of
the population in different age groups that had diabetes mellitus.
9780170408851 CHAPTER 16 » EPIDEMIOLOGY 549
16_bio_InFocus12_2e_sb_08851_txt.indd 549 08/08/18 7:45 pm
Attribution 2.5 Australia (https://creativecommons.org/licenses/by/2.5/au/)
Australian Bureau of Statistics, 4364.0.55.001 - National Health Survey: First Results, 2014-15. Creative Commons
FIGURE 16.8 a
Prevalence of 2001
diabetes mellitus for 25
% of total Australian population
different age groups
Male
as a percentage of 20
the total Australian Female
population, a in 2001
and b in 2014–2015 15
10
05
0
0–14 15–24 25–34 35–44 45–54 55–64 65–74 751
Age group (years)
b
2014–15
25
% of total Australian population
20
15
10
05 Male
Females
0
0–14 15–24 25–34 35–44 45–54 55–64 65–74 751
Age group (years)
a For both 2001 and 2014–2015:
i Which age group for both males and females had the highest percentage of individuals with some
form of diabetes?
ii Describe the overall trend for the percentage of the population with diabetes mellitus.
b i Fill in the following table with information obtained from the appropriate graph.
PROPORTION OF THE POPULATION WITH DIABETES MELLITUS (%)
MALES FEMALES
YEAR AGE 45–54 AGE 75+ AGE 45–54 AGE 75+
2001
2014–2015
ii Compare the proportion of males with diabetes between the age groups shown in 2001 and
2014–2015.
iii Compare the proportion of females with diabetes between the age groups shown in 2001 and
2014–2015.
iv Outline the trends shown in the proportion of males and females with diabetes mellitus in
2014–2015.
3 a Define ‘epidemiology’.
b Outline why epidemiological studies are used.
550 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
16_bio_InFocus12_2e_sb_08851_txt.indd 550 08/08/18 7:45 pm
Treatment, management
16.2 and future directions
Treatment of a disease will depend on the type of disease. Some non-infectious diseases, such as vitamin
or mineral deficiency, simply require the correct amount of the vitamin/mineral to be included in the
diet, whether in food or by supplementation. The treatment of the nutritional disease scurvy, which is
caused by lack of vitamin C, simply involves adding appropriate amounts of vitamin C to the diet either
by eating foods rich in vitamin C or by taking vitamin C supplements.
Other diseases, such as cancer, require more complex treatments to try to cure the individual.
Some diseases, especially those caused by genetic factors, have limited treatments available, and so
screening, early diagnosis and management of the symptoms is the best way to deal with the disease.
Research into many types of diseases, a greater understanding of the way in which the disease
manifests in the body, along with developments in the understanding of the way systems in the body
work, all contribute to the development of more successful treatments for disease. For example, the
disease cystic fibrosis has no successful treatment at present and management strategies concentrate
on reducing the severity of the symptoms. Research is currently being undertaken into the use of gene
therapy to treat this disease.
Melanoma: a disease caused by environmental exposure
There are many treatment options available to sufferers of melanoma, depending on the stage at which
the disease is diagnosed (Fig. 16.9).
Shutterstock.com/ilusmedical
FIGURE 16.9 The
stage at which
Epidermis melanoma
is diagnosed
Cancer cells determines the
best treatment
Dermis option.
Blood supply
Subcutaneous
tissue Stage 0 Stage I Stage II Stage III Stage IV
Confined to Confined to Still localised Reaches lymph Spreads via lymph
epidermal skin but thicker nodes nodes and blood
region of skin than stage I supply to other
organs
Treatment
The most common treatment for melanoma that has been detected early is surgery, and this is
often the only treatment required. Surgery involves removing the tumour and the skin around the
tumour to ensure that none of the cancerous cells are left behind, to reduce the risk of a recurrence of
the melanoma.
For more advanced cases of melanoma, a range of treatment options are available, including
radiation, chemotherapy, targeted therapies and immunotherapy. The type of treatment used will
depend on numerous factors, including how far the melanoma has progressed, and the person’s age
and health.
9780170408851 CHAPTER 16 » EPIDEMIOLOGY 551
16_bio_InFocus12_2e_sb_08851_txt.indd 551 08/08/18 7:45 pm
Radiation
When cells are exposed to X-rays, normal cells can repair their DNA more easily than cancer cells can.
X-rays damage the DNA of the cancer cells and kill them. Care must be taken in directing the radiation
to the specific cells that are intended for destruction. This radiation can be administered externally or by
placing a radioactive source in the body near the cancer cells.
Chemotherapy
Chemotherapy drugs slow the growth of cancer cells, but they have not been particularly effective in
Treatment for treating melanoma, and so are not used to treat this form of cancer as much as in other cancers.
melanoma
Watch the video
and summarise the Targeted therapies
main treatments for
Targeted therapies involve the use of drugs that
AAP Photos/AP/Merck/Michael Lund
melanoma.
affect the molecules that control the growth
of the tumour cells, which effectively stops
the growth and spread of the tumour to other
organs. Melanoma cells have mutations that
cause the uncontrolled division of cells, leading
to the growth of tumours. Targeted therapy
drugs interrupt the pathways that cause this
uncontrolled division of melanoma cells.
Immunotherapy
Immunotherapy treatments effectively cause
the body’s own immune system to fight the
melanoma. Two approaches are in the early
stages of development and use.
One of the approaches is to use drugs called
‘checkpoint inhibitors’ that cause the immune
system to recognise and destroy melanoma
FIGURE 16.10 Immunotherapy drugs, such as Keytruda®,
cause the immune system to recognise and destroy
cells (Fig. 16.10). Cancer cells cause the immune
melanoma cells. system to ignore them. Checkpoint inhibitors
reverse this effect and have proved successful in
a number of patients.
The other approach is to use vaccinations as a method of treatment rather than prevention. An
antigen is produced using the melanoma cells, and when injected allows the immune system to more
easily identify and destroy the melanoma cells.
Future directions
Future research is required to further develop targeted therapies and immunotherapy treatments for
melanoma. The use of targeted therapies is based on the different types of mutations that cause the
uncontrolled cell division that occurs in melanoma. Drugs have been developed to interrupt these
specific pathways. Scientists are aware that numerous other mutations are yet to be identified, and so
research is continuing in order to identify these. Once these mutations are identified, further drugs will
then be developed to interrupt many more of these pathways.
Currently there are only two immunotherapy drugs available for use and these are not successful on
all patients with melanoma. Further research is required to develop a greater variety of immunotherapy
drugs, so that the majority of patients can benefit from this form of treatment of melanoma.
The use of vaccines to treat melanoma is in its early stages. More research is required to further
refine this process and make it consistently effective. Further research may also involve investigating the
relationship between melanoma and other cancers.
552 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
16_bio_InFocus12_2e_sb_08851_txt.indd 552 08/08/18 7:45 pm
INVESTIGATION 16.3
A secondary-source investigation of the treatment, management
and future directions for a non-infectious disease
INTRODUCTION
In this investigation you will concentrate on a non-infectious disease selected from nutritional diseases
or those caused by environmental exposure. Of the many types of these diseases, some can be treated
successfully. For others, however, there is currently no successful treatment and so the only option is to
manage the symptoms.
In diseases where treatment is either non-existent or not fully effective, research is an important tool to try
to develop appropriate treatments to improve the health outcomes of those with the disease.
AIM
To outline the treatment/management of, and possible future directions for further research into, a nutritional Information and
disease or a disease caused by environmental exposure communication
technology
capability
METHOD
1 Choose a nutritional disease or a disease caused by environmental exposure. Review the information in Literacy
Chapter 15 about these types of diseases.
2 Research, using a wide range of reliable secondary sources, to find the following information about your
selected disease:
a current methods of treatment and/or management
b possible future directions for research to improve treatment and/or management.
3 You may wish to add to your knowledge of the treatment/management by talking to a person who has the
disease, or to a doctor.
Before you conduct the interview, you should carefully formulate the questions you are going to ask, in
order to obtain the information you require.
Research ethical approaches and questions to ask, and questions to avoid asking in order not to offend the
person being interviewed.
4 Present your information in a style of your choosing that is clear, easy to read and consistent with the type
of information you collect. Ensure that you use appropriate scientific language.
5 Assess the accuracy, reliability, validity and relevance of all data obtained.
6 Acknowledge your sources, using an accepted referencing style.
RESULTS
1 Present information about your selected disease in regards to:
a treatment and management of the disease
b possible future directions for further research to improve the treatment and/or management Refer to Chapter 1,
page 10, for
of this disease.
guidance on
2 Include in your presentation an assessment of the accuracy, reliability, validity and relevance of all how to assess
data obtained. the relevance,
accuracy, validity
and reliability of
DISCUSSION sources.
1 Distinguish between the treatment and management of a disease.
2 Discuss the importance of treatment/management of non-infectious disease.
CONCLUSION
Write summary sentences that address the aim of this investigation.
9780170408851 CHAPTER 16 » EPIDEMIOLOGY 553
16_bio_InFocus12_2e_sb_08851_txt.indd 553 08/08/18 7:45 pm
KEY CONCEPTS
● Treatment of non-infectious disease depends on the type of disease.
● Management of symptoms is the only option for non-infectious diseases that have no
successful treatment strategies.
● Treatment options for melanoma include surgery, radiation, chemotherapy, targeted therapies
and immunotherapy.
● Further research is required to develop a greater variety of targeted therapy and
immunotherapy drugs and vaccines to treat melanoma.
CHECK YOUR
UNDERSTANDING 1 Distinguish between the terms ‘treatment’ and ‘management’ when referring to non-infectious disease.
2 List, in order of effectiveness from least to best, the options available to treat melanoma.
16.2 3 Scientists are concentrating on uncovering the mutations that occur in skin cells as part of their quest to
develop future treatments for melanoma. Explain why they are doing this.
Methods used in epidemiological
16.3 studies
There are three major types of epidemiological studies:
◗ descriptive
◗ analytical
◗ intervention.
Descriptive and analytical studies are observational studies, which help us to understand the causes
of diseases.
Descriptive studies
Descriptive studies are usually the first type of study conducted when investigating the cause of a disease.
These studies provide information about the patterns of the disease, including the frequency of the
disease, which section of the population is affected (age, gender, occupation, socioeconomic status and
so on), the geographical location and whether there was a particular time period in which individuals
were affected. Data including information about age, sex, diet, occupation, drinking habits, location of
work and home and places visited are collected from individuals with the disease, and commonalities
are determined in order to find a possible cause. Hypotheses are proposed about the cause of the disease.
In an early epidemiological study undertaken to determine the cause of lung cancer, the data collected
included, among other things, information about the age, sex, smoking habits, diet, occupation and
drinking habits of people with lung cancer and people without lung cancer.
Analytical studies
Once a descriptive study has been completed, analytical studies are used to collect more data, which is
then statistically analysed to test hypotheses as to the likely cause(s) of the disease. The morbidity (number
of cases of the disease) and the mortality (percentage of the population that dies from the disease) are two
indicators that can be used in these studies. Data about the incidence (number of new cases in a specific
period) and the prevalence (number of people affected at any one time) are also compiled in these studies.
Case-control studies and cohort studies are two types of analytical studies that can be used.
554 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
16_bio_InFocus12_2e_sb_08851_txt.indd 554 08/08/18 7:45 pm
Case-control studies
Case-control studies compare people with the disease (cases) to
people without the disease (controls) and look for differences in Review medical histories
exposure to the possible causes of the disease (Fig. 16.11). A large
range of data, including age, sex, diet, location, lifestyle, occupation
Cases
and exercise habits is collected from both groups and then analysed Patients with the disease
to determine the likely cause of the disease.
A case-control study that was set up in London in 1947 by
Compare Conclusion
Richard Doll compared patients with lung cancer to patients with
medical histories
other conditions. Information about many of the factors in their
lives, including their smoking habits, was collected and analysed.
The results of this study showed that most of the individuals with
lung cancer were smokers. Doll was the first to suggest a link Review medical histories
between smoking and lung cancer. Controls
Healthy subjects
Cohort studies
FIGURE 16.11 The principles of a case-control study
Cohort studies involve studying two or more similar groups of
people who are free of the disease (Fig. 16.12). These groups
differ in one main factor: their exposure to the potential cause
of the disease. One of the groups is exposed to the possible
cause of the disease and the other group is not. These groups
are followed over a long period of time, to compare the Follow up
resulting incidence of the disease being studied. Exposed to risk factor
For example, after the 1947 case-control study that No disease
established a link between smoking and lung cancer, A. B. Hill
conducted a cohort study in England in 1951. This study Compare disease
followed more than 40 000 doctors over a 10-year period. incidence
One group of doctors were smokers (the test group) and the Not exposed to risk factor
other group were non-smokers (the control group). At the No disease
end of the study it was found that the test group had a much Follow up
higher incidence of lung cancer than the control group. This
study also revealed that the greater the number of cigarettes
smoked daily, the greater the chance of developing lung FIGURE 16.12 The principles of a cohort study
cancer.
Intervention studies
Intervention studies are used to test the effectiveness of a treatment (for example, a clinical trial of a new
drug) or the effectiveness of a public health campaign. The aim of an intervention treatment is to change
the behaviour of the population as a whole in order to reduce the incidence of the disease.
One type of intervention study is an experimental study, which is often used to test the
effectiveness of a new type of drug. In this type of study, people who are suffering from a particular
condition are observed for a set time period. Participants are randomly placed into two groups. One
group receives the trial drug, while the other group receives a placebo. The effects of the ‘medication’
on individuals in each group are recorded and statistically analysed to determine the effectiveness
of the drug being studied.
If it is impossible to set up a randomised trial, a quasi-experimental study is carried out. This differs
from an experimental study in that the researcher chooses the subjects who receive the drug/treatment.
9780170408851 CHAPTER 16 » EPIDEMIOLOGY 555
16_bio_InFocus12_2e_sb_08851_txt.indd 555 08/08/18 7:45 pm
An example of this is the testing of the effectiveness of a vaccine for influenza in hospital workers. Workers
in one department of the hospital would be given the vaccine and those in another department would
not – the incidence of influenza would then be compared between the two groups. In a further example,
Quit now the effectiveness of campaigns such as the ‘Quit now – smoking while pregnant’ campaign to reduce the
Read the number of pregnant women smoking can be evaluated using an intervention study.
methodology,
effectiveness and
conclusions drawn The types of epidemiological studies are summarised in Figure 16.13. Epidemiological studies should:
from this campaign.
◗ be conducted over a long period of time
◗ study very large sample sizes (thousands)
◗ collect a range of relevant data from a large group of both affected and unaffected people (case-
WS control). This data could include age, sex, diet, occupation, lifestyle and exercise habits
◗ have included participants that represent the wider population
Types of
epidemiological ◗ use control groups who are not exposed to the potential cause of disease but are similar in all other
studies respects to the test group (cohort studies)
◗ collect data on the incidence, prevalence, mortality and morbidity rates of the disease being studied
◗ statistically analyse the data to identify patterns and trends in the occurrence of the disease
◗ identify the possible cause of the disease and any risk factors
◗ develop a management plan with strategies to control or eliminate the disease and educate the public
◗ evaluate the effectiveness of control and treatment programs.
Epidemiological
studies
Disease detective
Work through this
interactive activity
as an epidemiologist
trying to determine
the cause of a disease.
Observational Experimental
Descriptive Analytical Controlled Quasi-experimental
Case-control Cohort
FIGURE 16.13 The different types of epidemiological studies
556 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
16_bio_InFocus12_2e_sb_08851_txt.indd 556 08/08/18 7:45 pm
Errors in epidemiological studies
There are two major types of errors in epidemiological studies:
◗ random errors
◗ systematic errors.
Random errors
Random errors are unpredictable variations in the data and have an inconsistent effect on measurement
within a study. They make the study less precise but do not shift the results of the study in a particular
direction. The effects of random error can usually be corrected using statistics. Random errors can occur
simply through differences in the subjects being studied. Therefore, ensuring that the separate groups
being studied are homogenous will increase the precision of the study and reduce random error. Ensuring
a large sample size for the study can also reduce random error.
Systematic errors
Another name for systematic errors is bias. This encompasses any process during the study that causes a
Revise random and
consistent deviation in measurement from what the true value should be. Systematic errors result in an systematic errors
incorrect estimate of the effect of exposure to a particular factor and the cause of a disease. in measurement in
Chapter 1, pages
The two main types of bias are selection bias and information bias. 19–21.
◗ Selection bias is bias in selecting subjects to include in the study. In any study, the subjects must be
representative of the population that is to be studied. A number of factors in the selection process can
cause bias, so that the sample studied is not representative of the population. These factors include:
– sampling bias, in which the way the subjects are chosen or where they are chosen from does not
lead to a sample that represents the population that is to be studied
– volunteer bias, in which those who volunteer for a study have a vested interest in the condition in
some way and may already be at a higher risk than those who do not volunteer
– healthy worker bias, in which participants who are working (in employment) are generally
healthier than participants who are not. If only working participants are included in the study,
then those who have left employment due to ill health will not contribute, as they should, to the
study, especially if the study is related to exposure at the place of employment
– prevalence/incidence bias, in which only current cases are included in the study. Those who have
recovered or died should also be included.
◗ Information bias involves errors in taking measurements or recording information. Inaccurate or
incomplete measurements and observations will result in information bias if the inaccuracy affects
each study group differently. Some of the different types of information bias are:
– misclassification bias, in which some of the subjects are already suffering from the condition and
are undiagnosed at the start of the study
– recall bias, in which subjects’ ability to recall varies. Those who are affected by the condition will
have a much greater recall of factors than those who have not been affected
– ascertainment bias, in which all members of the study group are not followed up to the same degree
– interviewer bias, in which the interviewer indirectly leads the study participant to the answer to
the questions
– measurement bias, in which measurements are consistently inaccurate (overstated or
understated). This can be reduced by using multiple observers, taking repeated measurements,
and establishing standards and objective definitions of measurements beforehand
– loss to follow-up bias, in which not all subjects who began the study are available at the end of
the study.
9780170408851 CHAPTER 16 » EPIDEMIOLOGY 557
16_bio_InFocus12_2e_sb_08851_txt.indd 557 08/08/18 7:45 pm
A confounding factor is a type of systematic error that occurs when an unrecognised factor may be
WS affecting the results of a study and leading to bias. A particular factor may be attributed as having caused
Comparing
a disease, but another factor could also have contributed to the same disease. For example, asbestos
random and workers and non-asbestos workers were studied to find the occurrence of lung cancer in each group. A
systematic errors
confounding factor that needed to be taken into account in this study is whether the study participants
were smokers, as this factor could also contribute to the development of lung cancer.
KEY CONCEPTS
● Large sample size and long periods of study are important requirements of epidemiological
studies.
● Descriptive, analytical and intervention studies are the major types of epidemiological studies.
● Descriptive studies provide the who, what, where and when, and generate hypotheses about
causes of disease.
● Analytical studies test hypotheses and provide the why and how, to determine the cause of
the disease.
● Intervention studies are used to test the effectiveness of a treatment for a disease, or the
effectiveness of a public health campaign.
● Random and systematic errors can occur in epidemiological studies.
● Random errors reduce precision but do not skew (bias) the results of a study.
● Systematic errors shift the results of a study in a particular direction and include selection bias,
measurement bias and confounding factors.
CHECK YOUR
UNDERSTANDING 1 Construct a table to summarise the different types of epidemiological studies, the methods used in each
and the types of information obtained.
16.3a 2 An epidemiological study was carried out to identify the risk factors that could lead to obesity. In this
study, thousands of obese individuals from a wide range of locations and societies were surveyed about
a large number of factors in their life, including their diet, level of activity, occupation, amount of sleep,
socioeconomic status, gender, hair, skin and eye colour, and ethnic background.
a Identify the type of epidemiological study carried out in the example above.
b What would be the purpose of this study?
c Describe further investigations that could be undertaken, to obtain more data about obesity.
d Outline how health authorities would use the data obtained from the initial and subsequent studies.
e Outline the two types of errors in epidemiological studies.
3 Construct a table to summarise the types of systematic errors.
Evaluating an epidemiological study
Intercultural
Epidemiological study: The Pima Indian population
understanding
Many independent studies have linked increased physical activity with a change in body mass and
composition, with all these factors contributing to a reduced incidence of type 2 diabetes. A cohort study
was carried out on the Pima Indian population, in the Gila River Indian Community, a native American
population living in Arizona (Fig. 16.14). This study examined the role of physical activity in the development
of type 2 diabetes (independently of the resulting change to body mass and composition). This study was
carried out between 1987 and 2000 with 1728 non-diabetic Pima individuals aged 15–59 years.
The Pima Indian population has been part of a longitudinal population-based study of diabetes
since 1965. In this study, anyone who lives in a designated part of the community and is over the
age of 5 years can participate. As part of this study, the same individuals are examined every two
years and a glucose test is performed to determine whether the person has type 2 diabetes. A physical
examination is also performed, along with measurement of height and weight and the recording of the
person’s medical history.
558 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
16_bio_InFocus12_2e_sb_08851_txt.indd 558 08/08/18 7:45 pm
Method
◗ From 1987, as well as the usual testing and measurement, the participants in the study who were
15–59 years old were also interviewed about their physical activity. The interview was conducted by
trained personnel who implemented a scientifically valid and reliable questionnaire.
◗ Each participant’s leisure and occupational activity for the past year was assessed separately. Only
physical activity that was greater than normal everyday tasks such as bathing and dressing was used.
◗ From a list of common activities, participants were asked to report on their leisure activities over the
past year, along with the frequency and duration of each activity.
◗ To measure occupational activity, the participants were asked to report on all the jobs they had had in
the previous twelve months. For each job, the average work schedule (months, days and hours), time
spent walking or riding to work, the number of hours spent sitting and the most common activities
that were performed when not sitting, were recorded.
◗ Activities were weighted according to their intensity, using scientifically accepted models. Estimates
were calculated separately for both the leisure and occupational activities as hours per week and
averaged over the previous year. The activity level of each individual was subsequently classed as
either high or low.
◗ If the interviewer judged that a participant was incapable of reporting their activity correctly, their
results were excluded from the analysis.
◗ To be included in the analysis, participants had to have a baseline measure of activity and at least
one follow-up visit. Values for each individual were calculated from the baseline measurements until
diabetes developed or until the last examination.
◗ Incidence rates were calculated by age group, gender and physical activity using a scientifically
approved model. Pima Indians
The results of this study indicated that, in most age groups, and for males and females, the incidence Watch the video
to determine the
rate of diabetes was lower in those who had higher levels of physical activity than in those who had low prevalence of
diabetes in the
levels of physical activity (Fig. 16.15). Pima population.
Getty Images/H. Edward Kim
FIGURE 16.14 Pima Indians from the Gila River Indian Community
9780170408851 CHAPTER 16 » EPIDEMIOLOGY 559
16_bio_InFocus12_2e_sb_08851_txt.indd 559 08/08/18 7:45 pm
American Journal of Epidemiology, Volume 158, Issue 7, 1 October 2003, Pages 669–675.
Source: American Journal of Epidemiology, Physical Activity, Obesity, and the Incidence
of Type 2 Diabetes in a High-Risk Population Andrea M. Kriska Aramesh Saremi Robert
L. Hanson Peter H. Bennett Sayuko Kobes Desmond E. Williams William C. Knowler
FIGURE 16.15
Diabetes incidence 100
Incidence (per 1000 person-years)
rates by age and Physical activity
gender for total Low High
physical activity 80
levels, from the
study of 1728 Pima
Indians without 60
diabetes, Gila River
Indian Community,
1987–2000 40
20
0
15–24 25–34 35–44 451 15–24 25–34 35–44 451
Men Women
Age group (years)
Evaluation
To evaluate involves making a judgement about something and using evidence to support your
judgement. The evidence used should be based on specific criteria relevant to the particular scenario
being evaluated.
The validity of the method used in an epidemiological study should be evaluated on whether it
follows accepted epidemiological principles for the particular type of study being carried out. Any errors
and bias, including confounding variables, should be considered when assessing the validity of the study.
Criteria common to most epidemiological studies include large sample size, long period of study, use of
scientifically approved methods of conducting the study, collecting data and analysing results. Other criteria
will depend on the type of study – for example, whether it is a case-control, cohort or experimental study.
In the Pima Indian example:
◗ The study size of 1728 individuals and the 13-year time period over which it occurred satisfy the
epidemiological requirements of a large sample size and a long period of study, reducing the effect of
sampling bias.
◗ In a cohort study such as this, two or more similar groups of people who are free of the disease should be
studied. The major difference between the groups should be the factor that is being studied. This study
satisfies these requirements, as non-diabetic Pima Indians from the same designated areas and aged
15–59 were studied. The groups varied in the amount of physical activity that was part of their daily life.
Other factors also ensured the validity of the Pima Indian study:
◗ The diagnosis of diabetes was made by objective means – scientifically approved testing at the first
and each follow-up visit. This reduced the likelihood of measurement bias.
◗ Trained interviewers used a scientifically valid questionnaire to determine the activity levels of
participants. The trained interviewers and objective questionnaire reduced both interviewer and
measurement bias.
◗ Using mathematical models, participants’ physical activities were weighted for their intensity level,
and the activity levels of each individual were then classified as either high or low.
◗ Scientifically tested models were used to analyse the results and determine the incidence rates of
diabetes related to activity levels and BMI index.
◗ Data was excluded from analysis if individuals were thought to have incorrectly reported activity
levels, which reduced recall bias.
WS
◗ The written report of the study was peer reviewed before publication.
Epidemiological The methodology used in this epidemiological study is judged to be valid, as it follows the
studies crossword
puzzle epidemiological principles outlined earlier.
560 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
16_bio_InFocus12_2e_sb_08851_txt.indd 560 08/08/18 7:45 pm
INVESTIGATION 16.4
A secondary-source evaluation of the methodology of an
epidemiological study
INTRODUCTION
In this secondary-source investigation you will research secondary sources to find an example of an
epidemiological study and evaluate the method used in this study. Working in pairs or groups would be
beneficial in the successful implementation of this investigation. A suggestion is that you prepare and present
a report in an appropriate way to the class for peer review.
AIM
To evaluate the validity of the method used in a sourced epidemiological study of a non-infectious disease/
condition or related component
METHOD
For acceptable
1 Either individually, or in pairs or groups, use a variety of secondary sources to research an epidemiological methods
study about a topic of interest. of scientific
referencing, refer
2 Some options you may wish to research: to Chapter 1,
• an experimental study such as a randomised controlled trial of a new drug or treatment for a page 27.
non-infectious disease/condition
• a case-control study aimed at determining the cause(s) of a non-infectious disease
• a cohort study aimed at identifying factors that affect the incidence of a particular non-infectious disease.
3 Identify the type of epidemiological study you have chosen and make a summary of the method used.
4 Choose the criteria that you are going to use to make a judgement about the validity of the method. This
will depend to some extent on the type of study you have chosen.
5 In a table, list the criteria to be used and the components of the method used in the study that satisfy
these criteria.
6 Provide a bullet point summary of any limitations identified in the methodology of your chosen study. This
should include any evidence of bias in the study.
7 Make a judgement about the validity of the method used in the study and provide a summary of the
evidence that supports your judgement.
8 Prepare a scientific argument that supports or refutes the claims made in the study based on your
evaluation of the method.
9 Present your information in an appropriate manner, either for a written report or a class presentation for
peer review if required.
10 Reference your researched information in an acceptable way.
RESULTS
1 Provide a summary of your chosen epidemiological study.
2 Construct a table, such as the one below, to match the requirements of a valid method in epidemiological
study with the components of your chosen study.
CRITERIA FOR VALID METHODOLOGY COMPONENTS OF CHOSEN STUDY
3 Make a bullet point summary of any limitations identified in the methodology of your chosen study.
4 Present your judgement about the method used and a summary of evidence, in an appropriate way.
5 Prepare an appropriate class presentation, if required.
9780170408851 CHAPTER 16 » EPIDEMIOLOGY 561
16_bio_InFocus12_2e_sb_08851_txt.indd 561 08/08/18 7:45 pm
DISCUSSION
1 Outline the process to follow when you are asked to ‘evaluate’ something.
2 Discuss ways in which identified limitations in the method of your chosen study could be improved.
3 Outline the benefits of working in a team.
4 Assess the relevance, reliability, validity and accuracy of the secondary sources used in this investigation.
CONCLUSION
Provide summary sentences that address the aim of this investigation.
KEY CONCEPTS
● To ‘evaluate’ means to make a judgement about something, based on certain criteria. Evidence
should be provided to support the judgement that has been made.
● Evaluation of the validity of the method used in an epidemiological study is determined by how
well it follows accepted epidemiological principles.
● Along with large sample size and long periods of study, the use of scientifically approved
methods of implementing a study, collecting data and analysis of results are the main
requirements of epidemiological studies.
CHECK YOUR
UNDERSTANDING 1 State the hypothesis being tested in the Gila River Indian Community study.
2 How was the study sample determined?
16.3b 3 What quantitative measurements were taken of this sample?
4 What qualitative measurements were taken of this sample?
5 Assume your class has been given the task of evaluating the methodology used in a case-control study
to help to determine the cause of lung lead poisoning. Outline the advice you would provide to a fellow
student who is unsure of how to carry out this task.
6 A scientist carried out a cohort study of the association between taking oral contraceptives and the risk of
developing thrombosis. The steps followed in the study are outlined below.
1 A group of women from the building in which the scientist worked took part in the study –
approximately 350 women in total. None of these women suffered from thrombosis at the start of the
study. Some took the contraceptive pill for the period of the study and others didn’t.
2 The scientist realised that she had more women who didn’t take the oral contraceptive pill than those
who did, so she removed enough of them to make equal numbers.
3 At the initial meeting, the scientist gave each woman a scientifically valid questionnaire about many
factors in her life, including whether she had thrombosis or not.
4 Subsequent visits were carried out at yearly intervals, where valid questionnaires were again used and
medical check-ups given, to determine whether thrombosis was present or not.
5 This process was continued for five years and the results were statistically analysed using approved
scientific and mathematical models.
6 The study’s results were then posted by the scientist on her colleague’s website page.
Evaluate the method used in this epidemiological study and suggest improvements that could be made to
this study.
16.4 Benefits of epidemiological studies
The benefits of epidemiological studies are numerous and were outlined earlier in this chapter (page 542).
Some of the types of epidemiological studies used, along with some examples of each, were provided on
pages 554–6.
562 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
16_bio_InFocus12_2e_sb_08851_txt.indd 562 08/08/18 7:45 pm
INVESTIGATION 16.5
A secondary-source investigation to evaluate the benefits
of an epidemiological study
INTRODUCTION
A benefit is anything that provides an advantage to someone. Benefits can be short-term (such as being paid
to walk the neighbour’s dog), meaning that the advantage is immediate, or long-term (such as insurance),
meaning that you might not receive the advantage for many years.
Benefits can also be direct or indirect. Direct benefits can be quantified, such as receiving pocket money for
helping around the house. Indirect benefits are those that cannot be directly quantified but have an impact on
you, such as your sister preparing your school lunch for you.
AIM
To evaluate the benefits of engaging in an epidemiological study
METHOD
Re-read the information about the Gila Indian River community (pages 558–60). Work in a group of 2–3 to
brainstorm all the benefits that would have resulted from such a study. List these benefits in a results table like
the one shown in the Results section. Within your group, decide whether the benefit is short- or long-term and
direct or indirect.
RESULTS
Record your results in a table like the one below.
TYPE OF BENEFIT
(TICK APPROPRIATE BOX/BOXES) WHO GETS THE
BENEFIT IDENTIFIED
BENEFIT?
SHORT-TERM LONG-TERM DIRECT INDIRECT
DISCUSSION
1 Discuss the benefits of working as a team.
2 With reference to all the benefits you have identified, and the people who have been advantaged by these
benefits, do you think that the Gila Indian River study provided value to those involved? Back up your claim
with examples from the study.
CONCLUSION
Write a few summary sentences that relate to the aim of this investigation.
CHECK YOUR
1 a List three major benefits of undertaking an epidemiological study. UNDERSTANDING
b State who gains the benefit in each case.
2 Distinguish between:
16.4
a short- and long-term benefits
b direct and indirect benefits.
9780170408851 CHAPTER 16 » EPIDEMIOLOGY 563
16_bio_InFocus12_2e_sb_08851_txt.indd 563 08/08/18 7:45 pm
16 CHAPTER SUMMARY
Epidemiology: Why are epidemiological studies used?
Epidemiology is the study of patterns of disease in populations.
Epidemiological study
Analysis of data allows
the identification of
patterns and trends
Determines the Guides the development Evaluates the in the incidence,
cause of disease and of strategies to control effectiveness of prevalence and mortality
which populations disease and improve strategies in place to rates of disease.
are affected public health treat/control disease
Analysis of data to determine the populations affected
Age-standardised incidence
Age-standardised mortality
100 20
rate (per 100 000)
rate (per 100 000)
80 15
60
10
40
5
20
0 0
Indigenous Non-Indigenous Indigenous Non-Indigenous
Indigenous status Indigenous status
These graphs indicate that even though Prevalence of diabetes mellitus, 2014 –15
the incidence rate of colorectal cancer is 25
% of total Australian population
only slightly higher for non-Indigenous
populations than Indigenous populations, 20
the mortality rate is much higher for non-
Indigenous populations. 15
The prevalence of diabetes mellitus is
10
6% higher for males in the 65–74 age
group than it is for females in the same Male
05
age group. Females
0
0–14 15–24 25–34 35–44 45–54 55–64 65–74 751
Age group (years)
Develop strategies to control disease
Melanoma treatment
Surgery Radiation Chemotherapy Targeted therapies Immunotherapy
• Remove • X-rays • Slows growth • Drugs interrupt • Checkpoint inhibitors
tumour damage DNA of cells the pathways that cause the immune
of cancer cells • Not as cause uncontrolled system to recognise
effective cell division and destroy melanoma
cells
564 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
16_bio_InFocus12_2e_sb_08851_txt.indd 564 08/08/18 7:46 pm
Epidermis
Cancer cells
Dermis
Blood supply
Subcutaneous
tissue Stage 0 Stage I Stage II Stage III Stage IV
Confined to Confined to Still localised Reaches lymph Spreads via lymph
epidermal skin but thicker nodes nodes and blood
region of skin than stage I supply to other
organs
Future directions for melanoma treatment
Further research into targeted therapies, immunotherapies and vaccines.
Evaluate effectiveness of strategies to control disease
• Make a judgement based on criteria using evidence to support the judgement.
• The method used in study should follow accepted epidemiological principles. Errors should be included in evaluation.
• Criteria common to most epidemiological study include: large sample size, long period of study, using scientifically
approved methods of implementing the study, collecting data and analysing results.
METHODS USED IN EPIDEMIOLOGICAL STUDIES
Epidemiological Descriptive studies
studies
Collect information about frequency of the disease, population
affected, location and time, and hypotheses are proposed
from this
Observational Experimental Analytical studies
Collect and analyse data
TYPES OF ANALYTICAL STUDIES
Descriptive Analytical Controlled Quasi-experimental • Case-control studies – compare people who have the
disease (cases) with people who do not have the disease
(controls).
• Cohort studies – study two or more similar groups
Case-control Cohort
who are free of the disease. One group is exposed to the
possible cause of the disease while the other group is not
exposed.
Case-control study Cohort study
Errors in epidemiological
studies
Review medical histories
Cases Follow up
Patients with the disease
Exposed to risk factor
No disease Random errors Systematic errors
Compare Conclusion
Unpredictable; Also known as bias –
medical histories Compare disease
incidence reduce precision selection bias, information
Not exposed to risk factor
No disease
but do not skew bias and confounding
Review medical histories Follow up
the results factors; shift the results
Controls
of a study away from the
Healthy subjects true results
Intervention studies
Test the effectiveness of a treatment for a disease, or the effectiveness of a public health campaign.
9780170408851 CHAPTER 16 » EPIDEMIOLOGY 565
16_bio_InFocus12_2e_sb_08851_txt.indd 565 08/08/18 7:46 pm
16 CHAPTER REVIEW QUESTIONS Qz
Review quiz
1 Experimental studies are often used to test the effectiveness of a new drug in the treatment of a disease.
a Outline the recommended steps in the process when a study of this type is used for this purpose.
b Discuss the ethical issues that may arise in relation to this type of study.
Questions 2–6 refer to the following figures.
http://www.who.int/mediacentre/factsheets/fs310/en/
Source: Global Health Estimates 2016. The Top 10 Causes of Death - Reprinted
from Fact sheet N°310 – Updated May 2014. World Health Organisation, 2018
Lower respiratory infections
Diarrhoeal diseases
Stroke
Ischaemic heart disease
HIV/AIDS
Tuberculosis
Malaria
Preterm birth complications
Birth asphyxia and birth trauma
Road injury
0 18 36 54 72 90
Deaths (per 100 000 population)
FIGURE 16.16 The top 10 causes of death in low-income economies, 2015
http://www.who.int/mediacentre/factsheets/fs310/en/
Source: Global Health Estimates 2016. The Top 10 Causes of Death - Reprinted
from Fact sheet N°310 – Updated May 2014. World Health Organisation, 2018
Ischaemic heart disease
Stroke
Lower respiratory infections
Chronic obstructive pulmonary disease
Tuberculosis
Diarrhoeal diseases
Diabetes mellitus
Preterm birth complications
Cirrhosis of the liver
Road injury
0 24 48 72 96 120
Deaths (per 100 000 population)
FIGURE 16.17 The top 10 causes of death in low-middle income economies, 2015
566 CHAPTER EIGHT
MODULE 11 » CHEMISTRY
» NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
16_bio_InFocus12_2e_sb_08851_txt.indd 566 08/08/18 7:46 pm
mediacentre/factsheets/fs310/en/
- Reprinted from Fact sheet N°310 – Updated May 2014.
Global Health Estimates 2016. The Top 10 Causes of Death
World Health Organisation, 2018 http://www.who.int/
Ischaemic heart disease
Stroke
Chronic obstructive pulmonary disease
Trachea, bronchus, lung cancers
Lower respiratory infections
Diabetes mellitus
Alzheimer disease
Road injury
Liver cancer
Stomach cancer
0 28 56 84 112 140
Deaths (per 100 000 population)
FIGURE 16.18 The top 10 causes of death in upper-middle-income economies, 2015
mediacentre/factsheets/fs310/en/
Source: Global Health Estimates 2016. The Top 10 Causes
of Death - Reprinted from Fact sheet N°310 – Updated May
2014. World Health Organisation, 2018 http://www.who.int/
Ischaemic heart disease
Stroke
Alzheimer disease
Trachea, bronchus, lung cancers
Chronic obstructive pulmonary disease
Lower respiratory infections
Colon and rectum cancers
Diabetes mellitus
Kidney disease
Breast cancer
0 30 60 90 120 150
Deaths (per 100 000 population)
FIGURE 16.19 The top 10 causes of death in high-income economies, 2015
2 Identify how many infectious diseases and how many non-infectious diseases are in the top 10 causes of death for each
income group. Present your answer in a table.
3 Compare the top 10 causes of death in each income-economy group.
4 Discuss possible reasons for the similarities/differences observed in Question 3.
5 How could you check the accuracy of your proposed reasons in Question 4?
6 Explain why it is important to collect data for different groups of people.
9780170408851 CHAPTER 16 » EPIDEMIOLOGY 567
16_bio_InFocus12_2e_sb_08851_txt.indd 567 08/08/18 7:46 pm
7 Table 16.2 shows the prevalence of obesity as a percentage of the total population for age and gender in Australia in 2014–
2015. The population aged over 18 in Australia at this time was approximately 17.9 million.
TABLE 16.2 Percentage obesity by age and gender, Australia, 2014–2015
AGE GROUP PROPORTION OF INDIVIDUALS WHO ARE OBESE (%)
(YEARS)
MALES FEMALES TOTAL
18–24 17.3 17.3 17.1
25–34 20.8 17.3 19.0
35–44 26.7 30.7 28.6
45–54 33.2 33.0 33.0
55–64 36.8 34.9 35.9
65–74 38.2 32.7 35.4
75–84 32.4 27.1 29.6
85+ 11.2 21.5 17.8
Total 28.4 27.4 27.9
Source: Australian Bureau of Statistics (ABS). Australian Health Survey 2014/15 (4364.0) CC BY-2.5
Australia licence
a Using the value given for the total population over 18 in 2014–2015, calculate:
i the number of males and females over 18 who were obese
ii the total number of Australians over 18 who were obese.
b Identify the age group with the highest proportion of obese individuals, for males, females and total.
c Draw a line graph from the information presented in Table 16.2. Use a key to indicate which line represents males, females
and the total percentage.
d From this line graph, outline the trends by age group shown in the prevalence of obesity for males and females.
e Describe how this information could be used to improve the health of the population.
8 The incidence of a type of non-infectious disease (called P disease) has increased in particular areas over the last few years.
Initial descriptive studies have been carried out and it has been hypothesised from these results that the cause of P disease is
exposure to pollutants in a body of water that supplies a limited number of houses and factories in a rural city. Design a case-
control study that could be used to test this hypothesis.
9 Prepare an answer to the Inquiry question: Why are epidemiological studies used?
568 CHAPTER EIGHT
MODULE 11 » CHEMISTRY
» NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
16_bio_InFocus12_2e_sb_08851_txt.indd 568 08/08/18 7:46 pm
17 Prevention
Students:
• use secondary sources to evaluate the effectiveness of current disease-prevention methods and develop
INQUIRY QUESTION strategies for the prevention of a non-infectious disease, including but not limited to: CCT
How can non-infectious – educational programs and campaigns PS
diseases be prevented? – genetic engineering EU
Biology Stage 6 Syllabus © NSW Education Standards Authority for and on behalf of the Crown in right of the State of New South Wales, 2017
Shutterstock.com/Chinnapong
9780170408851 569
17_bio_InFocus12_2e_sb_08851_txt.indd 569 08/08/18 7:46 pm
Prevention of disease is always a much better option than suffering the debilitating effects of a disease
or its treatment. Treatments often involve the use of drugs, many of which have side effects that cause
more problems. Some diseases, such as cystic fibrosis, have no effective treatment, meaning that the
only option is to manage and reduce the severity of the symptoms. With these diseases, the quality of
life of affected individuals is compromised and there is a continuing financial burden on the individual,
their family and the health system.
Strategies to prevent non-infectious diseases and disorders are important, not only to reduce the
suffering of individuals and improve their quality of life, but also to improve the overall health and
wellbeing of the population. Prevention also reduces the financial burden on both the individual and the
health system, allowing resources to be directed to other areas (Fig. 17.1).
Source: Foundation for Alcohol Research
and Education
FIGURE 17.1 Prevention of disease is always preferable
17.1 Educational programs and campaigns
Many preventable non-infectious diseases are caused by nutritional imbalances
or exposure to environmental factors, including lifestyle factors (see Chapter 15).
Data obtained from epidemiological studies identifies the diseases that are
most prevalent in populations and the groups that are most at risk. This assists
health authorities and governments to develop strategies aimed at preventing
the diseases that are of most concern because of their incidence, prevalence and
© Randy glasbergen/glasbergen.com
mortality.
Strategies for prevention are varied and include educational programs and
public health campaigns, genetic engineering and government legislation. These
include financial levies imposed on substances that are thought to be detrimental
to health.
Educational programs and campaigns use strategies to provide information
and educate the population about the effects of a disease and the risk factors that
increase the chance of developing that disease. Suggestions about how to avoid
the risk factors are a part of these programs and campaigns, educating members
of the population in the hope that they will change their behaviour to reduce their
FIGURE 17.2 Prevention of non-infectious exposure to these risk factors and lower their chances of developing the disease
diseases is closely linked to following a healthy (Fig. 17.2).
lifestyle.
570 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
17_bio_InFocus12_2e_sb_08851_txt.indd 570 08/08/18 7:46 pm
A successful public health campaign has a number of key
Source: National Center for Biotechnology Information, U.S. National Library of Medicine
al commitm
Politic ent
components (Fig. 17.3):
◗ an evidence base for action
a package of a limited number of high priority evidence-based Te
n
◗
tio
chn
ica
interventions ica
un
lp
effective performance management with real-time monitoring, ac
m
◗
ka
m
Co
evaluation and program improvement ge
◗ partnerships between the public and private sectors
◗ communication of accurate information to healthcare workers Evidence base
and the public M
political commitment. an
ag
s
◗
ip
em
sh
There are many examples of educational programs and public en
er
t
tn
r
health campaigns that have been implemented in Australia to
Pa
change the behaviour of members of the population (Fig. 17.4).
These include the QUIT program, the National Alcohol Strategy,
the Diabetes Helpline, ‘Slip, Slop, Slap, Seek, Slide’, ‘Kids Matter’,
‘Jump Rope For Heart’, ‘Alcohol. Think again’, the Needle and
Syringe Program, and the Pregnancy, Birth and Baby helpline. FIGURE 17.3 The six key criteria for an effective public health
These campaigns were developed as a result of national strategic campaign
plans aimed at preventing common and emerging diseases.
Legislation
Non-infectious diseases are a major cause of death, disease and disability in the population. This places
a strain on the health system and economic development, and affects the wellbeing of many individuals
in a population.
The main risk factors associated with non-infectious disease are tobacco, alcohol, unhealthy diet and
lack of physical activity. A major challenge for people who have the desire to change their behaviour is
the addictive nature of some of these risk factors. Educational programs and public health campaigns
are often not enough to change the behaviour of members of the population. Therefore it is essential that
governments introduce legislation to minimise these risk factors in the population.
This legislation could be in a number of forms, to target different aspects of the specific risk factor. It
could prohibit the promotion and marketing of the use of the risk factor, including a ban on advertising
and sponsorship. It could increase tax (levy) on the risk factor, to deter the purchase of products related
to the risk factor. For example, legislation to tax alcohol and tobacco products is in place to deter the
purchase of these products. There is currently a push for a ‘sugar’ tax to be introduced, to deter people
from consuming too many sugary soft drinks (Fig. 17.5, page 574). Legislation is also used to restrict the
places and times in which the risk factor can be used – for example, a ban on alcohol consumption in
certain areas and restrictions on the operating hours of bars, bottle shops and hotels. Legislation has also
been introduced to enforce the clear labelling of food products in supermarkets and the kilojoule content
of take-away foods.
Some of the legislation that has been introduced by the government to reduce the use and effects of
tobacco include:
◗ a ban on all tobacco advertising, promotion and sponsorship
◗ a ban on smoking in the workplace and in public places
◗ plain paper packaging of cigarettes, containing pictorial, graphic warnings and no logos, colours,
brand images or promotional information
◗ an increase in taxes on tobacco products.
9780170408851 CHAPTER 17 » PREVENTION 571
17_bio_InFocus12_2e_sb_08851_txt.indd 571 08/08/18 7:46 pm
Components of public health campaigns
• National Days or weeks to raise awareness and educate people about a disease, such as National Diabetes Week, Skin
Cancer Action Week, Heart Week
• Online resources to assist individuals and groups in implementing lifestyle behaviour changes
• Advertising campaigns that saturate all forms of media, including social media, detailing effects of a disease and risk
factors that increase the likelihood of developing the disease. These include catchy slogans and sometimes graphic
images of the effects of the disease on the body, e.g. the risk of exposure.
• The use of social media and influencers
• Apps that can be downloaded to assist with reducing exposure to risk factors
• Posters and advertising boards in many public places, including roadside (e.g. bus stops), sporting stadiums, railway
stations or other places where large numbers of people will see them.
• Tailoring the delivery of the message to the target audience for maximum engagement , e.g. involving sporting teams
in campaigns, such as ‘Quit B Fit’ slogan on football players’ shorts
• Screening those at risk for factors that indicate an increased likelihood of developing the disease, e.g. screening for
pre-diabetes
• National helplines, such as the Quitline
• Support programs such as dietary and physical activity advice for those who are overweight and obese
• Legislation to reduce risk factors associated with non-infectious diseases/disorders, e.g. lockout laws to reduce the risk
of alcohol-related injuries leading to brain injuries, plain paper packaging on cigarettes and restriction of all cigarette
advertising in all forms including online.
• Funding for organisations that provide support services to educate and support those trying to change their lifestyle
behaviours, including the Heart Foundation, Diabetes Australia, Cancer Council Australia and many more
• Excise on some products, such as alcohol and cigarettes, as a deterrent to buying these products
© Cancer Institute NSW
Source: Diabetes Australia
Cancer Council
Victoria
FIGURE 17.4 Examples of health campaigns in Australia
572 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
17_bio_InFocus12_2e_sb_08851_txt.indd 572 08/08/18 7:47 pm
Alamy Stock Photo/Jeffrey Blackler
Source: Lung Foundation Australia
© Commonwealth of Australia, Department of Health, National Tobaco Campaign
Foundation for Alcohol Research and Education
Shutterstock.com/Arcady
Impact of
alcohol
Discuss how this
animation may help
motivate someone
to reduce their
alcohol intake.
FIGURE 17.4 (Continued)
9780170408851 CHAPTER 17 » PREVENTION 573
17_bio_InFocus12_2e_sb_08851_txt.indd 573 08/08/18 7:47 pm
Flavoured
Institute 'A sugary drinks tax', November 2016.
Source: Based on Stephen Duckett and Hal Swerissen, Grattan
Tax of 40 c per 100 grams of sugar mineral water
1.25 L
Drink
Sports drink Energy
Soft drink 600 mL Fruit drink drink
375 mL Soft 6 × 200 mL 250 mL
drink
2L
Sugar content
37.5 g 200 g 36 g 120 g 87.5 g 27.5 g
Tax 15 c 80 c 14 c 48 c 35 c 11 c
FIGURE 17.5 The impact of the proposed sugar content tax on retail
prices of sugary drinks
KEY CONCEPTS
● Prevention of disease is always the preferred option.
● Prevention reduces the burden of disease – physical, financial and psychological – on the
individual and the health system.
● Changing the behaviour of individuals will prevent many non-infectious diseases.
● Strategies to change behaviours include education programs and campaigns, legislation,
support groups, and targeting those at risk.
● Epidemiological studies provide data to identify areas of risk, to direct strategies for prevention.
CHECK YOUR
UNDERSTANDING 1 Outline the advantages of preventing non-infectious disease.
2 How does changing the lifestyle behaviour of individuals help to prevent non-infectious disease?
17.1a 3 Identify some strategies in common use to prevent non-infectious disease.
4 What are three pros and three cons of the introduction of a sugar tax to deter people from drinking
sugar-laden soft drinks?
5 Describe the role of epidemiological studies in assisting the prevention of non-infectious disease.
Evaluating the effectiveness of educational programs and campaigns
Comparing incidence and prevalence data before and after the implementation of educational programs
and public health campaigns can provide a measure of the effectiveness of the strategies employed.
QUIT campaign
Smoking remains the leading preventable cause of death in the Australian population, with 15 500
smoking-related deaths each year. The QUIT campaign was developed as an educational program and
Cancer Council campaign to reduce the prevalence of smoking-related diseases in the population.
Watch the video and Lung cancer is just one of many smoking-related diseases, which include many types of cancers,
follow the interactive
that educates people heart disease and other lung diseases. Many epidemiological studies have been carried out to determine
about cancer and its the cause of lung cancer, and the findings have universally demonstrated a clear link between smoking
prevention. Outline
how these would help and the increased incidence of lung cancer (Fig. 17.6). The studies have also shown a clear link between
to prevent cancer.
cigarette smoking and reduced life expectancy.
574 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
17_bio_InFocus12_2e_sb_08851_txt.indd 574 08/08/18 7:47 pm
FIGURE 17.6 Data
Foundation (www.saylor.org).
Source: Kimball's Biology Pages © John W. Kimball, distributed under a Creative Commons
Attribution 3.0 Unported (CC BY 3.0) license and made possible by funding from The Saylor
Average number of cigarettes smoked per person per year
5000 200 from long-term
Annual deaths from lung cancer per 100 000 population
epidemiological
studies shows a direct
link between smoking
and lung cancer.
4000 Male smoking
150
3000
Male lung Female
cancer 100
smoking
2000
50
Female lung
1000
cancer
0 0
1900 1920 1940 1960 1980
Year
Studies comparing smokers and non-smokers show that smokers have a 10 times greater chance
than non-smokers of dying from lung cancer. Further studies show that the more cigarettes smoked each
day, the greater the incidence of lung cancer. It has also been shown that the longer a person smokes,
the greater their chance of developing lung cancer. Exposure to passive smoking also increases the risk
of developing lung cancer.
The campaign to reduce smoking and, hence, smoking-related diseases has a multifaceted approach
that involves education to raise awareness of risk factors, as well as legislative changes. The QUIT
program has evolved over many years, and runs in conjunction with many strategies, including:
◗ the use of slogans such as ‘Quit for life’, ‘Quit B fit’ and ‘iCanQuit’ (Fig. 17.7a)
◗ graphic images in the media and on cigarette packets to highlight the dangers of cigarette smoking
(Fig. 17.7b)
◗ showing people with lung cancer in their own life situations, expressing the wish that they had given
up smoking earlier so that their life was not cut short
◗ a national helpline to support smokers in their quest to change their behaviour and break the smoking
habit
Wellington Aboriginal Corporation Health Services National
Tackling Indigenous Smoking Program
AAPImage/AP/Minister for Health and Ageing
a b
FIGURE 17.7 Strategies used in the QUIT campaign: a Quit B Fit campaign, part of the Indigenous anti-smoking program;
b plain paper packaging with graphic images of the effects of smoking
9780170408851 CHAPTER 17 » PREVENTION 575
17_bio_InFocus12_2e_sb_08851_txt.indd 575 08/08/18 7:47 pm
◗ legislation requiring plain paper packaging on all cigarette packets and storage of cigarette packets
in cupboards out of sight of consumers, to reduce the appeal of tobacco products to consumers and
prevent tobacco companies using the packaging to downplay the harmful effects of tobacco
◗ increased excise on tobacco products to make them more expensive, in a bid to discourage consumers
from buying them
◗ legislation to restrict advertising, including Internet advertising, of tobacco products
◗ raising the legal age for smoking to 21 (currently under consideration by the Australian Government).
The campaign to reduce the smoking rate in Australia and, hence, reduce the prevalence, incidence
rate and mortality rate of smoking-related diseases such as lung cancer is a long-term one. The list
below outlines the strategies put in place by governments and public health organisations over the
past 44 years.
◗ 1973 – health warnings first mandated on all cigarette packs in Australia
◗ 1976 – bans on all cigarette advertising on radio and television in Australia
◗ 1986 to 2006 – phased in bans on smoking in workplaces and public places
◗ 1990 – bans on advertising of tobacco products in newspapers and magazines published in
Australia
◗ 1992 – increase in the tobacco excise
◗ 1993 – Tobacco Advertising Prohibition Act 1992 prohibited broadcasting and publication of tobacco
advertisements
◗ 1994 to 2003 – bans on smoking in restaurants
◗ 1995 – nationally consistent text-only health warnings required
◗ 1998 to 2006 – bans on point-of-sale tobacco advertising across Australia
◗ 2006 – graphic health warnings required on packaging of most tobacco products
◗ 2010 – 25% increase in the tobacco excise
◗ 2011 – first complete state or territory ban on point-of-sale tobacco product displays
◗ 2012 – offence for any person to publish tobacco advertising on the internet or other electronic
media
◗ 2012 – introduction of tobacco plain packaging, and updated and expanded graphic health
warnings
◗ 2012 – reduction in the duty free allowance from 250 cigarettes or 250 grams of cigars or tobacco
products to 50 cigarettes or 50 grams of cigars or tobacco products from 1 September 2012
◗ 2013 – first 12.5% tobacco excise increase on 1 December.
◗ 2014 – change from bi-annual indexation based on the Consumer Price Index (CPI) to bi-annual
indexation based on average weekly ordinary time earnings (AWOTE)
◗ 2014 – 12.5% excise increase on 1 September
◗ 2015 – 12.5% excise increase on 1 September
◗ 2016 – release of the Post Implementation Review of Tobacco Plain Packaging
◗ 2016 – 12.5% excise increase on 1 September
◗ 2017 – additional four annual 12.5% tobacco excise increases implemented on 1 September each year
from 2017 to 2020 inclusive
◗ 2017 – reduction in duty free tobacco allowance, 25 grams of duty free tobacco (cigarette, loose leaf
etc), plus one open packet; equivalent to approximately 25 cigarettes
◗ 2017 – harmonisation of the taxation of roll-your-own tobacco and other products such as cigars,
with manufactured cigarettes
(Source: Australian Government, Dept of Health 2017, ‘Tobacco control timeline’, http://www.health.gov.au/internet/
publications/publishing.nsf/Content/tobacco-control-toc~timeline)
576 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
17_bio_InFocus12_2e_sb_08851_txt.indd 576 08/08/18 7:47 pm
The graph in Figure 17.8 shows changes in the prevalence of smoking in the Australian population
Evaluate
from 1990 to 2013, in relation to the strategies implemented to control tobacco products since 1990. means to judge
This graph indicates that strategies implemented to control the prevalence of smoking in the the quality,
importance
Australian population have been somewhat successful, as the rate of smoking reduced from just over or value of
24% in 1991 to approximately 13% in 2013. It is predicted that the prevalence of smoking will decrease something.
further with the continuation and expansion of these strategies.
As well as statistics showing the decrease in smoking prevalence due to the QUIT campaign and
other government strategies, statistics on the incidence of disease caused by smoking can be studied to
further evaluate the effectiveness of these strategies. The incidence and mortality rates from lung cancer
are shown in Figure 17.9.
Source: Australian Government, Dept of Health, 2017, ‘Tobacco control timeline’,
30
28 27.7
Age-standardised daily smoking prevalence (%)
26
24 23.7
Commencement of
Tobacco Advertising 22.3
22 Prohibition Act (1993)
21.3
20 Commencement of
bans on smoking in 19.1
restaurants (1994)
18 Graphic health warnings
Commencement of
applied to packaging on
first National Tobacco
most tobacco products (2006) 16.3
16 Campaign (1997)
25% tobacco excise
Commencement of increase (2010) 14.7
14 bans on point-of-sale
Commencement of tobacco plain
tobacco advertising (1998)
packaging and updated and
expanded health warnings (2012)
12 Annual staged 12.5%
tobacco excise increases
(2013–2020)
10
1990 1995 2001 2004–05 2007–08 2011–12 2014–15
Year
FIGURE 17.8 Age-standardised daily smoking prevalence in the general population of people aged 18 years and older and key
tobacco control measures implemented in Australia since 1990
FIGURE 17.9
Commons BY 3.0 (CC-BY 3.0) licence.
Source: Australian Institute of Health and Welfare. Creative
120 Age-standardised
incidence rates
100 for lung cancer
1982–2013 and
Rate (per 100 000)
80 age-standardised
mortality rates
60 for lung cancer
40 1968–2014, by sex
20
0
68
70
72
74
76
78
80
82
84
86
88
90
92
94
96
98
00
02
04
06
08
10
12
14
19
19
19
19
19
19
19
19
19
19
19
19
19
19
19
19
20
20
20
20
20
20
20
20
Year
Males – incidence Females – incidence Persons – incidence
Males – mortality Females – mortality Persons – mortality
9780170408851 CHAPTER 17 » PREVENTION 577
17_bio_InFocus12_2e_sb_08851_txt.indd 577 08/08/18 7:47 pm
The graph shows an initial increase in the mortality rate from lung cancer for males from 1968 to 1982,
followed by a decrease in the mortality rate from 1982 to 2014. It also shows a gradual increase in the
mortality rate from lung cancer for females from 1968 until the rate becomes relatively steady from 2002.
Figure 17.9 shows that males have a higher mortality and incidence rate for lung cancer than females.
It also shows that, for males, the incidence rate per 100 000 for lung cancer has decreased steadily since
1982. It is predicted that the rate will continue to decrease.
The female incidence rate of lung cancer per 100 000 was much lower than the rate for males in 1968,
but showed a steady increase until 2014, when it was much closer to males. Again, compared to males,
the female mortality rate was much lower in 1968, but increased steadily until 2014, when the difference
in mortality rates between males and females was much closer.
The difference between the trends for males and females could be explained by the fact that lung
cancer takes several decades to develop (as shown in Fig. 17.6). While the rate of smoking is decreasing
now for both males and females, the decrease in the rate of smoking occurred earlier in males (1960s)
than in females (late 1970s).
The rate of smoking is predicted to continue to decrease for both sexes. While the incidence and
mortality rates from lung cancer are also predicted to continue to decrease for males, the incidence and
mortality rates for females are predicted to increase before eventually decreasing.
These statistics show that the education programs, public health campaigns and legislation have
been successful in reducing the rate of smoking in both males and females. As a result of this decrease
in smoking rates, the incidence and mortality rates of lung cancer in males have decreased, and are
predicted to also decrease for females.
While the rate of smoking has decreased, there has been an increase in the use of e-cigarettes, by
young people especially. The rationale behind the use of e-cigarettes is that people think that they are
safer to use than tobacco products and/or that their use may help them to quit smoking.
Electronic cigarettes
An electronic cigarette (e-cigarette) is a battery-powered device that changes a liquid (e-liquid) into an
aerosol that is then inhaled into the person’s lungs (Fig. 17.10). With a conventional cigarette, smoke from
burning tobacco is inhaled into the lungs, whereas the aerosol inhaled from an e-cigarette is a vapour in
which liquefied nicotine or other chemicals are dissolved.
It is illegal to sell e-cigarettes and accessories to minors under the age of 18, to buy e-cigarettes and
FIGURE 17.10 The
components of an Vapour
e-cigarette nicotine inhaled
simulating smoke
Rechargeable
Nicotine cartridge
battery
stores liquid nicotine
and propylene glycol
solution
Atomisation
chamber
heats and vaporises
liquid solution
LED light
578 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
17_bio_InFocus12_2e_sb_08851_txt.indd 578 08/08/18 7:47 pm
accessories for minors under the age of 18, or to smoke e-cigarettes in cars with children under the age of
16 present. It is also illegal to sell liquid nicotine, including e-liquids containing nicotine.
How safe it is to use e-cigarettes is unknown at present, as there is little information available. Many
e-liquids that claim to be free of nicotine have been found on analysis to contain varying amounts of nicotine.
Nicotine has many short- and long-term deleterious effects on the body, and if liquid nicotine is ingested it
can cause poisoning. The effects on the body of the other chemicals in the e-liquid are as yet unclear.
Some manufacturers of e-cigarettes claim that they can help a person quit smoking, but this has not
been demonstrated scientifically. Health authorities have not approved e-cigarettes as an aid to quitting
smoking or as a nicotine replacement therapy.
INVESTIGATION 17.1
A secondary-source investigation and evaluation of an educational
program and public health campaign
INTRODUCTION
In this investigation you will research information and evaluate a current educational program/campaign
designed to help prevent a non-infectious disease/disorder. In this
investigation,
AIM revise and
use the same
To investigate and evaluate a current non-infectious disease prevention method involving an educational evaluation
program and public health campaign techniques you
used in the
previous chapter.
METHOD
1 Working collaboratively, research a current educational program/campaign aimed at preventing a non-
infectious disease.
Critical and
2 Address the following areas: creative thinking
• Identify the program/campaign.
• Identify the disease/disorder that it is designed to prevent. Literacy
• Outline the strategies that are used to try to change the behaviour of individuals in the population.
Information and
• Include any other relevant information about the program/campaign. communication
3 Statistics on the incidence, prevalence and mortality rate of the disease/disorder you are investigating. technology
capability
These statistics should be sourced for time periods both prior to and after the introduction of the program/
campaign. Personal and
social capability
4 Use this and any other relevant information to evaluate the effectiveness of your chosen program/
campaign in preventing the non-infectious disease/disorder it targeted.
5 Refer to page 571 to see the six key criteria for a successful public health campaign. How does your chosen Use the QUIT
campaign measure up against these criteria? campaign
(discussed in the
6 Present your information in a manner that makes the data and your evaluation clear and easy to understand. previous section)
for examples
RESULTS of the types of
Address all areas indicated in the Method steps above, in a manner that you think most clearly conveys data/statistics
that can be
information about the disease/disorder, the program that has been implemented to prevent it, and your sourced.
evaluation of the effectiveness of the program in preventing this disease.
9780170408851 CHAPTER 17 » PREVENTION 579
17_bio_InFocus12_2e_sb_08851_txt.indd 579 08/08/18 7:47 pm
DISCUSSION
1 Outline why educational programs/campaigns are necessary.
2 Discuss how data can be used to evaluate the effectiveness of a campaign.
CONCLUSION
Write a few summary sentences to address the aim of this investigation.
KEY CONCEPTS
● Data from epidemiological studies can be used to evaluate the effectiveness of strategies such
as education programs and public health campaigns.
● Comparison of data related to incidence, prevalence and mortality rates before and after the
implementation of strategies can be used to evaluate their effectiveness.
● Implementation of strategies to reduce the prevalence of smoking in Australia have been
effective in reducing the incidence and mortality rates of lung cancer.
CHECK YOUR
UNDERSTANDING 1 Define ‘evaluate’.
2 Outline how data can be used to evaluate the effectiveness of strategies introduced to prevent non-
17.1b infectious disease.
3 Describe the trend in the prevalence of smoking in Australia since 1990.
4 a Compare the trends in lung cancer mortality rates for males and females in Australia from 2006 to 2015.
b Link these trends to the trends shown for smoking prevalence.
5 Discuss whether the strategies implemented to reduce the prevalence of smoking have been effective.
6 Analyse the QUIT campaign and categorise each strategy under the six key criteria for a successful public
health campaign listed on page 571. Evaluate the campaign using these criteria.
17.2 Genetic engineering
The ability to manipulate genes has enabled us to devise a number of ways to prevent certain non-
Refer to the infectious diseases/disorders. Genetic engineering techniques used in processes such as pre-implantation
discussion of
inheritance patterns genetic testing (PGT) can prevent genetic disease, while the use of transgenic crops as food sources has
in Chapter 6. the potential to prevent some types of nutritional disease. Genetic engineering techniques are used
to produce vaccines such as Gardasil®, to prevent human papilloma virus (HPV) infection, which in
turn prevents cervical cancer. Genetic engineering often brings with it debate on the ethics of its use
Genetic engineering (see Chapter 8), which needs to be balanced with its effectiveness in the prevention of disease.
was discussed in
Chapters 8 and 9.
Pre-implantation genetic testing
A young couple's first child was born without any problems but they soon learned that their baby son
was profoundly deaf. With genetic testing it was discovered that their baby was homozygous recessive
for a mutation of a gene that is involved in the proper functioning of the cochlea.
Genetic counselling followed, and the couple were informed that any future children had a 25%
chance of being homozygous recessive for this mutated gene and therefore of being deaf.
580 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
17_bio_InFocus12_2e_sb_08851_txt.indd 580 08/08/18 7:47 pm
For the next birth, the couple decided they would undergo pre-implantation genetic testing (PGT).
This began with a cycle of IVF (in vitro fertilisation), where eggs were harvested and collected. The eggs
were then fertilised by direct injection of the sperm, and the embryos were grown for three days. One cell
from each embryo was then removed (Fig. 17.11) and tested for the mutated gene. Embryos that were
free of the gene or were carriers were retained, while the other embryos were either destroyed or used for
research.
Science Photo Library/Pascal Goetgheluck
FIGURE 17.11
Removal of a cell from
an embryo for pre-
implantation genetic
testing
On day 5, one of the retained embryos was implanted, while the rest were frozen for later use. The
pregnancy developed normally and the baby was born with normal hearing. Through the use of PGT,
the chance of the couple’s offspring being born deaf was eliminated.
Genetic diseases/disorders can be caused by hereditary factors. If parents are aware or become aware
that one or both possess an allele for a certain genetic disease/disorder (as the couple above did), they
may undergo genetic counselling to determine the percentage chance of any offspring inheriting the
condition. The parents then have a number of options available to them. Process of PGT
The couple decided that the chances of a child being born deaf was too great when conceived naturally Watch the video to
see an outline of
and didn’t want to take that chance. They thought about not having any more children, to prevent the process of PGT
any occurrence of this disorder, but they wanted to expand their family. and some of the
issues associated
This couple, after much research and discussion, decided to have children using the reproductive with its use.
technology technique known as IVF (in vitro fertilisation), combined with PGT. This process allows
couples at risk to ensure that their children are born free of the disease without having to go through the
process of testing the foetus and then having to make the difficult decision about whether to go ahead
with the pregnancy or terminate it if the disease/disorder is present.
Pre-implantation testing involves the fertilisation of the mother’s egg with the father’s sperm in an
external laboratory setting (IVF), the removal of a single cell from an eight-cell embryo, and the use a
genetic engineering technique known as array comparative genomic hybridisation (aCGH) to test the WS
cell for the presence of the known genetic condition (Fig. 17.12). This technique can also determine
Prevention of a
whether the embryo is a carrier of the condition or free of any copies of the mutated allele. Embryos can genetic disease by
pre-implantation
also be tested for chromosomal abnormalities. Embryos that are free of the genetic disease/condition or genetic testing
are carriers are retained for implantation. In this way, the genetic disease/disorder is prevented in any
offspring of the couple.
A wide range of single-gene disorders can be tested for, including cystic fibrosis, Huntington
disease, thalassaemia and muscular dystrophy. This method, which combines the use of a reproductive Ethical issues
technology (IVF) and genetic engineering to test the cells of the embryo (PGT), is 100% effective in involved with
the use of these
preventing the disease. technologies are
There are many ethical issues associated with the use of reproductive and genetic engineering addressed in
Chapters 8 and 9.
technologies.
9780170408851 CHAPTER 17 » PREVENTION 581
17_bio_InFocus12_2e_sb_08851_txt.indd 581 08/08/18 7:47 pm
FIGURE 17.12 The
process of pre-
implantation genetic Egg
! Sperm
testing (PGT)
Embryo at 8-cell stage
Remove one
cell on day 3
Test DNA or Test results
chromosomes
Healthy genetic Unhealthy genetic
conditions conditions
Embryo implanted Embryo
on day 4 discarded
Transgenic species Using genetic engineering to prevent nutritional diseases
were discussed in
Chapter 9,
Populations in developing countries often experience diseases/disorders caused by vitamin deficiencies,
pp. 295–8. because of a poor diet. Researchers have been investigating the use of transgenic crops to incorporate
vitamins into their staple foods. If successful, this would prevent the disorders/conditions caused by lack
of a particular vitamin.
Refer to page 268
for more information One example of this is the research carried out to produce what is known as ‘golden rice’. This is rice
on golden rice. that has been genetically engineered to include a gene from maize and a gene from a soil bacterium. This
allows the rice to produce beta-carotene, which is then used by the body to produce vitamin A. The beta-
carotene gives the rice its characteristic yellow colour (Fig. 17.13).
A deficiency of vitamin A in the diet can lead to blindness and a compromised immune system. In
Golden rice Africa and Asia it is estimated that approximately a quarter to half a million children suffer from blindness
Watch the video caused by vitamin A deficiency. In addition to this, two million people die each year of diseases they
to understand
the development would otherwise have survived, because of
of golden rice to
their weakened immune system.
REUTERS/Erik De Castro
counteract vitamin
A deficiency, and the Golden rice has been under
debate about its use.
development for many years and has
suffered setbacks, due to a smaller yield
WS being produced compared to normal rice
and opposition to genetically modified
Prevention of a
nutritional disease foods from organisations such as
by genetic Greenpeace. The Bill and Melinda Gates
engineering:
golden rice Foundation is supporting the final testing
of golden rice and it was released in
Bangladesh in 2018.
If successful, golden rice will prevent
FIGURE 17.13 Golden rice is yellow and is here compared to
Refer to Chapter 5, normal rice. The yellow colour comes from the insertion of a gene diseases and disorders caused by lack of
page 185 for to produce beta-carotene, which is used by the body to produce vitamin A.
information about vitamin A.
SNPs, haplotypes
and GWAS.
Genetic engineering as a screening tool for disease susceptibility
Genetic engineering techniques are being used to generate information about non-infectious disease that
is proving to be very valuable in promoting efficient disease prevention and management strategies. Both
Extension activity mapping of the human genome (through the Human Genome Project) and Genome Wide Association
Understanding
cardiovascular disease Studies (see Chapter 5) have contributed to a better understanding of the genetic basis of non-infectious
through genome-wide disease. The use of genetic engineering to identify one or more gene mutations (and combinations of
association studies
582 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
17_bio_InFocus12_2e_sb_08851_txt.indd 582 08/08/18 7:47 pm
these) in people with the disease allows the prediction of a predisposition or susceptibility to disease,
essential for disease prevention.
Genetic studies have also led to improved screening, diagnosis and early intervention, essential to Genetic research in
prevent non-infectious disease. Strategies to change behaviour, as well as planning and policies, can be non-communicable
disease in selected
put in place to try to prevent incidence of the disease. Arab countries
Genetic engineering to produce vaccines to prevent some cancers
Infection by the human papilloma virus (HPV) is linked to the majority of cases of cervical cancer and
some anal, throat and other cancers. Genetic engineering techniques are used to produce vaccines
such as Gardasil® and Cervarix®, which are effective in preventing infection by HPV. When administered
before the age at which sexual activity begins, these vaccines are nearly 100% effective in preventing
cervical and other associated cancers.
Newspix/Fiona Hamilton
FIGURE 17.14 The
HPV vaccine prevents
cancer by preventing
infection by the human
papilloma virus.
INVESTIGATION 17.2
A secondary-source investigation into prevention of non-infectious
disease using genetic engineering
INTRODUCTION
In this investigation you will research information, summarise it and use it in a Socratic seminar or debate
about the use of genetic engineering techniques to prevent non-infectious disease/disorders, and the ethical
issues that need to be taken into consideration.
AIM Critical and creative
thinking
• To research further information about the use of genetic engineering to prevent non-infectious disease/
disorders
• To evaluate the effectiveness of these methods in the prevention of non-infectious disease/disorders Ethical
understanding
• To use researched information to participate in a Socratic seminar or debate to discuss the benefits and
risks of the use of genetic engineering to prevent disease, and the ethical issues involved Information and
communication
METHOD technology
capability
Working in teams, research a variety of reliable secondary sources to further investigate information about
genetic engineering used to prevent non-infectious disease/disorders, to enable participation in a Socratic
seminar (see weblink) or debate. In this seminar or debate, the benefits and risks associated with the use of Literacy
genetic engineering methods to prevent disease will be discussed, including ethical considerations that need
to be taken into account.
9780170408851 CHAPTER 17 » PREVENTION 583
17_bio_InFocus12_2e_sb_08851_txt.indd 583 09/08/18 9:14 am
Information to be researched should include:
Personal and social 1 further information about PGT, including:
capability
• the numerous types of diseases that can be tested for
• whether gender selection is possible
• the costs involved
• whether there is any harm to the embryo
• the fate of rejected embryos
How to run • who PGT is suitable for
a Socratic
seminar • the benefits and risks
• any ethical considerations that need to be taken into account
2 further information about the prevention of nutritional disease by the creation and growth of transgenic
crops that include essential nutrients, including:
• an update on the progress/use of golden rice
Socratic
seminar II • further examples of the use of transgenic crops to prevent nutritional diseases. One suggestion is the
research being carried out, particularly by the CSIRO, to genetically engineer canola plants to produce
omega-3 long-chain fatty acids
• details about the transgenic crop, to describe how and why it is produced
• for each example, an evaluation of the ability of these transgenic crops to prevent particular nutritional
diseases
• issues associated with the use of transgenic species in agriculture, including the benefits/risks, whether
they are ‘safe’ to eat and their effects on ‘wild’ populations
• any ethical considerations that need to be taken into account
3 two other examples of the use of genetic engineering to prevent non-infectious diseases/disorders.
Include the types of diseases they prevent, the methods used, ethical considerations and an evaluation of
their effectiveness in preventing these diseases.
RESULTS
1 PGT:
a Address all points listed in the Method section for PGT.
b Create and complete a table like the one below, identifying the benefits and risks associated with the
use of PGT.
BENEFITS RISKS
c Outline any ethical issues involved with the use of PGT.
2 Transgenic crops to prevent nutritional diseases:
a Address all points listed in the Method section for transgenic crops. Use a table like the one below to
collate your information for each example.
EVALUATION OF ITS
EFFECTIVENESS
EXAMPLE OF TRANSGENIC IN PREVENTING
CROP OUTLINE OF FEATURES WHERE/WHY IT IS USED NUTRITIONAL DISEASE
b Create a table like the one you used in Question 1b, identifying the benefits and risks associated with
the use of transgenic crops.
c Outline the ethical issues involved with the use of transgenic crops.
3 Use tables similar to those given above, to summarise information about other examples of the use of
genetic engineering to prevent non-infectious diseases/disorders, an evaluation of their effectiveness
in preventing the particular disease/disorder, the benefits and risks of the process and any ethical issues
associated with the use of the process.
584 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
17_bio_InFocus12_2e_sb_08851_txt.indd 584 08/08/18 7:47 pm
DISCUSSION
Prepare a written discussion of the use of genetic engineering methods to prevent non-infectious disease/
disorders. Your discussion should include the following:
• an outline of examples of the use of genetic engineering, along with an evaluation of their effectiveness in
preventing disease
• a description of the benefits and risks associated with the use of each of the genetic engineering methods
outlined
• an analysis of the ethical considerations associated with the use of genetic engineering methods to
prevent non-infectious disease/disorders.
This written answer can be used where appropriate in the class Socratic seminar/debate.
CONCLUSION
Write a few summary sentences to address the aims of this investigation.
KEY CONCEPTS
● Genetic engineering can be used to prevent non-infectious disease/disorders but there are
ethical issues associated with its use that need to be addressed.
● PGT involves testing 3-day-old embryos for specific gene mutations associated with a known
disease/disorder before implantation.
● Transgenic crops are being developed to prevent nutritional disease.
● GWAS can be used to detect a predisposition to non-infectious disease with a genetic basis.
Planning and policies can be put in place to try to prevent incidence of the disease.
CHECK YOUR
1 Define ‘genetic engineering’. UNDERSTANDING
2 Outline the process of pre-implantation genetic testing (PGT) and the role it plays in preventing non-
infectious disease. 17.2
3 How can transgenic crops be used to prevent nutritional disease?
4 Outline the ethical issues associated with the use of genetic engineering techniques to prevent disease.
People who have long-term infections of hepatitis B virus have a much greater risk of developing
liver cancer. Administering the vaccine to prevent infection by the hepatitis B virus will lower the risk of
developing liver cancer, for some people.
WS
Developing strategies to prevent a non-infectious disease outbreak
Prevention of an
environmental
Many types of diseases have caused concern regarding the health and wellbeing of the population of disease by public
health campaigns:
Australia and other countries, at various times. Public health authorities use epidemiological studies skin cancer
to monitor trends, in order to provide evidence of emerging patterns that indicate that a disease (such
as lung cancer or melanoma) is becoming more prevalent in a population. This data can identify
populations and geographic areas or locations at high risk. Planning and policies are then put in place to
WS
try to prevent further incidence of this disease. As a result of these formal initiatives, practical strategies
are developed and put into place in the community to prevent, as much as possible, further increase in Prevention of
the incidence of the disease. non-infectious
diseases
The strategies put in place depend on the characteristics of the specific disease but
would include some form of education programs and campaigns. These programs would be
distributed over many forms of media to raise awareness about the particular disease/disorder,
its characteristics, its effects on the individual (both short- and long-term) and suggestions to
9780170408851 CHAPTER 17 » PREVENTION 585
17_bio_InFocus12_2e_sb_08851_txt.indd 585 08/08/18 7:48 pm
prevent the development of the disease. Suggestions about ways to
This information is reproduced with permission from Cancer Australia
lessen the effects of the disease/disorder and advice about support
services available would also be included in these campaigns.
Social media platforms such as Facebook, Twitter and Instagram are
important ways in which information can influence many members of
the population. These platforms can be used not only to disseminate the
information but also in an interactive way, with real-time conversations in
which questions can be answered.
Public health organisations can identify public health influencers,
such as bloggers, who drive conversations about health topics. They
can then develop a relationship with them so the influencers can drive
conversations and get others to take notice of the topic. Celebrities who
take up the cause are influencers who can have a dramatic effect. For
example, the World Heart Foundation celebrates World Heart Day on 29
September each year. Last year, it encouraged people around the world to
take ‘Healthy Heart Selfies’ and post them with hashtags on social media
sites. Queen Latifah and her mother joined the cause, influenced by the
American Heart Association, and posted a video about their experiences
FIGURE 17.15 One of the many Cancer Australia on YouTube and encouraged others to do the same. The involvement of
posts on the social media platform Twitter this celebrity influencer had a massive effect on this campaign.
Legislation is often put in place by governments to protect the
population by reducing exposure of the population to causative factors
of the disease.
INVESTIGATION 17.3
A secondary-source and first-hand investigation to develop
strategies to prevent a non-infectious disease outbreak
Critical and INTRODUCTION
creative thinking
Preventing disease of any kind is much more desirable than treating/managing the disease. In this
Information investigation, you and your team have been tasked with developing a series of strategies to prevent a non-
and technology infectious disease outbreak. You will use information from this text and your own researched information.
communication
capability The non-infectious disease can be one of your choosing, or it can be a fictional scenario. You can further
develop strategies that are already in place, or develop a set of strategies for a disease that has limited
Literacy
strategies in place. This will culminate in a display of your strategies, either to the class or to the school
population in general.
Here are some suggestions:
Personal
and social • The prevalence of type 2 diabetes has increased markedly in the past ten years or more.
capability
• Iodine deficiency is a nutritional disease that has become more prevalent in the Australian population.
• Many lifestyle diseases are easily preventable.
A fictional scenario you could use is described here, or you could make up your own.
In a rural community, the pesticides used on local farms have been distributed by wind to nearby townships,
causing symptoms such as headaches, rashes, sore throats and stinging eyes in residents. Long-term exposure has
been shown to cause severe and long-lasting symptoms, such as inflamed liver, difficulty breathing and inability to
concentrate.
586 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
17_bio_InFocus12_2e_sb_08851_txt.indd 586 09/08/18 9:16 am
AIM
To develop strategies to prevent a non-infectious disease outbreak
METHOD
1 Working collaboratively, choose a non-infectious disease.
2 Research information from a wide variety of reliable sources about this disease, including: cause, symptoms,
prevention.
3 Research data about the incidence, prevalence and mortality rate of the disease, to justify the
implementation of strategies and to identify whether any groups/locations are more at risk than others
(target groups).
4 Use this information to brainstorm ideas about strategies that could be implemented to prevent further
incidence of the disease.
These strategies should:
• be directed towards the target group(s)
• have a multifaceted approach that not only educates the public about the cause of the disease and
the effects on the body but also provides guidance on preventative measures and support services
available.
The strategies could include, but are not limited to, the following (use your imagination to come up with
new and interesting strategies):
• catchy phrases, posters, advertising campaigns for print, radio and TV
• a ‘day’ to raise awareness
• images of the effects of the disease
• changes in legislation that could be implemented to assist in prevention.
5 Design and document a plan that includes the following information:
• the disease
• cause, symptoms, methods of prevention
• data to support the need for intervention strategies for prevention
• identification of target groups
• an overview of the variety of strategies that are to be developed
• an explanation of how each strategy will assist in the prevention of your chosen disease
• the expected outcome of the implementation of the strategies.
6 Further develop the strategies that have been outlined in the plan – for example, design and produce a
poster, make a video, prepare a multimedia presentation, develop an attention-grabbing approach.
7 When you have finished developing your strategies, put together a portfolio of your strategies and display
them, either in the classroom for peer review or for the school population in general.
8 Reference your sources in an acceptable format.
RESULTS
1 Present your results as a documented plan that includes all areas listed in the Method section.
2 Prepare a portfolio of strategies and put them on display.
DISCUSSION
1 Discuss the importance of disease prevention.
2 Why is it important to have a variety of strategies when trying to prevent a specific disease?
3 Explain how each of your strategies assists in the prevention of your chosen disease.
4 Discuss the role of epidemiology in developing these strategies.
CONCLUSION
Write a few summary sentences to address the aim of this investigation.
9780170408851 CHAPTER 17 » PREVENTION 587
17_bio_InFocus12_2e_sb_08851_txt.indd 587 08/08/18 7:48 pm
17 CHAPTER SUMMARY
Prevention: How can non-infectious diseases be prevented?
PREVENTION
Prevention
• Reduces suffering of individual, improves quality of life
and overall health and wellbeing
• Reduces financial burden on individual and health system
• Reduces lifestyle diseases by changing people’s
behaviour
EDUCATIONAL/PUBLIC HEALTH PROGRAMS
Epidemiological studies Prevalent diseases, groups at risk
Strategies for changing behaviours Educational/public health programs
(prevention) Educational/public National days, online resources, advertising campaigns to educate, posters, social
health programs, genetic engineering, media and influencers, apps, tailoring delivery of message, screening those at
government legislation risk, national helplines, support programs, foundations.
al commitm
Politic ent
Examples: QUIT; Diabetes Helpline; Slip, Slop, Slap, Seek, Slide; Alcohol. Think again
Te
n
tio
chn
ica
ica
un
lp
ac
m
ka
m
Co
ge
Evidence base
M
an
ag
s
ip
em
sh
en
er
t
tn
r
Pa
LEGISLATION
Flavoured
mineral water
Legislation aims to minimise the effects of risk factors in Tax of 40 c per 100 g of sugar
1.25 L
Drink
the population – tobacco, alcohol, unhealthy diet, lack Sports drink Energy
of physical activity – by: Soft drink 600 mL Fruit drink drink
375 mL Soft 6 × 200 mL 250 mL
• prohibiting advertising and sponsorship drink
2L
• increasing tax (levy) on risk factor
• restricting time and place for use of risk factor
Sugar content
• enforcing clear labelling of food. 37.5 g 200 g 36 g 120 g 87.5 g 27.5 g
Tax 15 c 80 c 14 c 48 c 35 c 11 c
588 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
17_bio_InFocus12_2e_sb_08851_txt.indd 588 08/08/18 7:48 pm
EVALUATION
Evaluate effectiveness of educational programs and campaigns – compare incidence and prevalence data before and after
implementation of programs.
For example, QUIT campaign:
• decrease in smoking prevalence with implementation of strategies
• incidence and mortality rates of lung cancer – will eventually decrease for both males and females.
Prevalence of smoking
30
28 27.7
Age-standardised daily smoking prevalence (%)
26
24 23.7
Commencement of
Tobacco Advertising 22.3
22 Prohibition Act (1993)
21.3
20 Commencement of
bans on smoking in 19.1
restaurants (1994)
18 Graphic health warnings
Commencement of
applied to packaging on
first National Tobacco
most tobacco products (2006) 16.3
16 Campaign (1997)
25% tobacco excise
Commencement of increase (2010) 14.7
14 bans on point-of-sale
Commencement of tobacco plain
tobacco advertising (1998)
packaging and updated and
expanded health warnings (2012)
12 Annual staged 12.5%
tobacco excise increases
(2013–2020)
10
1990 1995 2001 2004–05 2007–08 2011–12 2014–15
Year
GENETIC ENGINEERING
Prevents:
• some genetic diseases, e.g. using pre-implantation testing and array comparative genomic hybridisation (aCGH)
• some cancers, e.g. production of vaccine to prevent cervical cancer
• some nutritional diseases, using transgenic species, e.g. golden rice.
Egg
! Sperm
Embryo at 8-cell stage
Remove one
cell on day 3
Test DNA or Test results
chromosomes
Healthy genetic Unhealthy genetic
conditions conditions
Embryo implanted Embryo
on day 4 discarded
Developing strategies to prevent a non-infectious disease outbreak
Epidemiological studies
Populations and geographic areas at risk
Planning and policies
Strategies in place
Prevention
9780170408851 CHAPTER 17 » PREVENTION 589
17_bio_InFocus12_2e_sb_08851_txt.indd 589 08/08/18 7:49 pm
17 CHAPTER REVIEW QUESTIONS Qz
Review quiz
1 Discuss the benefits of disease prevention. 4 Exposure to silica dust increases the likelihood of
developing lung cancer. Silica dust is made up of grains
2 a Why are many non-infectious diseases/disorders
that are smaller than sand; it is formed when stone,
considered preventable?
rock, gravel, clay, bricks, concrete and tiles are cut.
b Outline methods that could be used to change the Tradespeople, home renovators, miners and other workers
behaviour of individuals in order to prevent lifestyle are at risk if this dust is inhaled.
diseases/disorders.
Methods that involve raising awareness of the dangers of
3 Foetal alcohol spectrum disorder is a lifelong condition silica dust in training modules, as well as advertisements
related to brain damage caused by foetal exposure suggesting that PPE (personal protective equipment)
to alcohol. Affected people may or may not have be worn when cutting materials containing silica, have
distinct facial features but all are characterised by been developed. Outline how the effectiveness of these
cognitive, behavioural, health and learning difficulties. methods of prevention could be evaluated.
These difficulties are often characterised by lack of
5 Assess the use of genetic engineering methods such
concentration, inability to follow cause-and-effect
as PGT and transgenic crops in the prevention of
reasoning, impulsivity and language difficulties.
non-infectious disease/disorders. Include the ethical
Develop three strategies that could be put in place considerations that should be taken into account.
to raise awareness of this condition and prevent its
occurrence.
590 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
17_bio_InFocus12_2e_sb_08851_txt.indd 590 08/08/18 7:49 pm
18 Technologies and disorders
INQUIRY Students:
QUESTION • explain a range of causes of disorders by investigating the structures and functions of the relevant organs,
How can technologies for example:
– hearing loss
be used to assist
– visual disorders
people who experience – loss of kidney function CCT
disorders? CCT
• investigate technologies that are used to assist with the effects of a disorder, including but not
limited to: (ACSBL100) ICT L
– hearing loss: cochlear implants, bone conduction implants, hearing aids ICT PS
– visual disorders: spectacles, laser surgery ICT PS
– loss of kidney function: dialysis PS
• evaluate the effectiveness of a technology that is used to manage and assist with the effects of a
disorder (ACSBL100) EU L
Biology Stage 6 Syllabus © NSW Education Standards Authority for and on behalf of the Crown in right of the State of New South Wales, 2017
Shutterstock.com/Andrey_Popov
9780170408851 591
18_bio_InFocus12_2e_sb_08851_txt.indd 591 08/08/18 7:52 pm
The human body is a complex integration of many systems that coordinate to form a functioning
organism. It is astounding that so many complex ‘parts’ can all function properly, both separately and
together as a whole. It is not surprising that at times certain parts may fail to function as required, leading
to disorders. The characteristics of these disorders can usually be explained in relation to errors in the
structure and/or functioning of a particular organ.
Progress in scientific research has led to the development of technologies that can be used to diagnose
and correct many of these disorders, improving the quality of life of those who in earlier times would have
been severely hindered by them.
Alamy Stock Photo/Phanie
Getty Images/Photo Josse/Leemage
FIGURE 18.1 Then and now: technology to diagnose and treat eye disorders has advanced remarkably since
the early days of medicine.
18.1 The ear
The ear is a sense organ that provides a major communication pathway between the external environment
and the body.
Semicircular
Stirrup
canals
Pinna Anvil Bone
Hammer
Sound
waves Auditory
nerve
Auditory Cochlea
canal
Eardrum
(tympanic Round
membrane) window
Oval window
(where stirrup
attaches)
FIGURE 18.2 The structure of the outer, middle and inner ear
592 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
18_bio_InFocus12_2e_sb_08851_txt.indd 592 09/08/18 9:42 am
Structure and function of the ear
Our ability to hear properly relies on the complex structure and functioning of the ear, the auditory nerve
and the brain.
The ear has evolved to transfer energy in different forms from the external environment to the
brain. Sound waves (sound energy) are directed into the outer ear canal by the pinna and set up
vibrations (kinetic energy) of identical frequency in the eardrum (tympanic membrane) (Fig. 18.2).
The vibrations are transferred to tiny bones in the middle ear called the ossicles – the hammer
(malleus), anvil (incus) and stirrup (stapes). These bones amplify and transfer kinetic energy to the
oval window, which is the membrane that separates the middle ear from the fluid-filled inner ear.
Vibrations pass from the oval window into the upper canal of the cochlea and then through the lower
canal to the round window, which acts as a valve, relieving built-up pressure from the wave set up in
the perilymph of the cochlea.
The fluid-filled cochlea is composed of three canals: upper, lower and middle (Fig. 18.3a). The middle
canal contains the receptor cells in the Organ of Corti. The Organ of Corti sits on top of the basilar
membrane and has an upper tectorial membrane and lower basilar membrane (Fig. 18.3b). Between these
two membranes are hair cells, the receptor cells of the ear.
When a wave moves through the fluid-filled canals of the cochlea from the oval window, it pushes up
on the basilar membrane (Fig. 18.4). This causes bending of the hair cells against the tectorial membrane,
Pathway of
which is the stimulus that transforms the kinetic energy of the wave into the electrical energy of the sound through
the ear
nerve impulse sent along the auditory nerve to the brain.
Susumu Nishinaga/Science Photo Library
John Bavosi/Science Photo Library
Hair cells (cilia)
Basilar
Tectorial membrane
membrane
(red line)
Basilar
membrane
(blue line)
Nerve cells
FIGURE 18.3 The inner ear consists of fluid-filled FIGURE 18.4 An SEM of hair cells within the cochlea
passages made up of three canals: vestibular membrane, showing the cilia, which bend with sound triggering a
tectorial membrane and basilar membrane neurochemical response that generates nerve impulses.
9780170408851 CHAPTER 18 » TECHNOLOGIES AND DISORDERS 593
18_bio_InFocus12_2e_sb_08851_txt.indd 593 08/08/18 7:53 pm
Sounds of different pitches are detected by hair cells at different regions of the organ of Corti (Fig. 18.5).
High-pitched sounds stimulate hair cells closest to the oval window (base), while low-pitched sounds
stimulate hair cells at the other end of the cochlea (apex). There is a finite number of hair cells, and if they
are damaged, frequencies corresponding to the damaged cells will not be heard.
FIGURE 18.5 3000 Hz
Vibrations of different
frequencies stimulate
500 Hz Low-pitched
hair cells at different High-pitched
positions along the sounds
sounds
cochlea. 60 Hz
20 000 Hz 2000 Hz
Apex 4000 Hz
Base
(region of stapes)
1000 Hz
6000 Hz
Hearing loss
Hearing loss can occur for various reasons, and the type of hearing loss depends on the particular area
of the ear that has not been formed properly, has been damaged or is not functioning in the correct way.
There are two main types of hearing loss:
◗ conductive hearing loss
◗ sensorineural hearing loss (Fig. 18.6).
FIGURE 18.6 Inner ear
Incorrect transfer
Middle ear
of vibrations in the
outer and middle ear
causes conductive
hearing loss. Damage
to the structures of
the inner ear causes
sensorineural hearing
loss.
Outer ear
Conductive Sensorineural
Conductive hearing loss
Conductive hearing loss is caused by a problem with the mechanical conduction of vibrations
through the outer and middle ear. There are numerous causes of this type of hearing loss, including
malformation of the structures in these regions of the ear, a perforated eardrum, infections in the
outer/middle ear, damage to the ossicles due to trauma such as exposure to sudden loud noises ( for
example, explosions or head trauma), and hardening of the stapes bone. All these factors inhibit the
594 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
18_bio_InFocus12_2e_sb_08851_txt.indd 594 13/08/18 6:04 PM
movement of vibrations through the outer and middle ear. It is the loudness of the sound that is usually
affected in this type of hearing loss.
Sensorineural hearing loss
Sensorineural hearing loss is caused by damage to, or malformation of, the inner ear, including parts
of the cochlea, the hair cells or the auditory nerve. The damage is usually permanent, as is the hearing
loss, which affects the loudness and clarity of sound. The most common cause of sensorineural hearing
loss is excessive noise exposure, while other causes include heredity, birth defects, infections, tumours,
medication and ageing.
Damage to the inner ear (including the receptor hair cells) prevents the kinetic energy of the vibrations
being transformed into electrical impulses to be sent to the brain for interpretation.
INVESTIGATION 18.1
A first-hand and secondary-source investigation to study the
structure and function of the ear
Information and
INTRODUCTION communication
technology
In this investigation you will use physical and digital models to study the structure and function of the ear. You capability
will also measure the loudness of sounds and determine the upper limit of loudness before damage occurs to
the structures of the ear. Explanations of the causes of hearing loss will also be investigated. Literacy
AIM
To investigate the structure and functioning of the ear and explain causes of hearing loss
MATERIALS
Model of human ear WS
Sound meter
Structure of
METHOD the ear
1 Using the supplied model, identify the parts of the ear shown in Figure 18.2.
2 Label a diagram of the ear (see worksheet Diagram of the ear).
3 Research using the Internet to find a 3D interactive model of the ear. Describe your findings when
manipulating the 3D models of the ear. Sound
transduction in
4 Construct a table to summarise the parts of the ear, and the structure and function of each part. the human ear
5 Interact with the weblink or similar to demonstrate that sounds of different frequencies are detected at
different areas along the cochlea.
6 Research a variety of sources to determine the region(s) of the brain responsible for the processing of
WS
information from the ear. Record this information on the worksheet Structures in the brain responsible for
auditory processing. Structures
7 Use a sound meter to record decibels of some common sounds. Research a variety of reliable sources to in the brain
responsible
determine the decibel level of loud sounds such as a siren, cicadas, a plane taking off, fireworks, a 12-gauge for auditory
shotgun firing, a rock concert. As part of this research, determine the upper level of loudness before processing
damage occurs to structures within the ear.
Summarise your findings in a table, beginning with the softest sound and ending with the loudest.
8 Use a variety of reliable sources to research different causes of hearing loss, and explain the cause of each
type of hearing loss in terms of the structure and/or functioning of the different parts of the ear. Present
your findings in a format agreed to with your teacher.
9780170408851 CHAPTER 18 » TECHNOLOGIES AND DISORDERS 595
18_bio_InFocus12_2e_sb_08851_txt.indd 595 08/08/18 7:53 pm
DISCUSSION
1 Draw a flow chart to trace the pathway of sound waves through the structures of the ear.
2 How did using models of different types increase your understanding of the structure and function of the
ear?
3 Discuss the importance of wearing protective devices when being exposed to loud noises.
4 Assess the relevance, reliability, accuracy and validity of your data sources.
CONCLUSION
Write summary sentences to address the aim of this investigation.
KEY CONCEPTS
● Problems with the structures and functioning of the ear can cause hearing loss.
● The pathway of the sound wave through the ear can be summarised as:
Pinna → external auditory canal → tympanic membrane → hammer, anvil, stirrup
→ oval window → cochlea → round window
● The organ of Corti contains hair cells that are the receptors in the ear.
● Bending of the hair cells when a pressure wave pushes on the basilar membrane stimulates the
formation of electrical impulses.
● Electrical impulses are transferred to the brain by the auditory nerve.
● Hair cells at the base of the cochlea detect the highest-pitched sounds, while hair cells at the
apex of the cochlea detect the lowest-pitched sounds.
● Conductive hearing loss occurs when vibrations cannot be transferred effectively through the
outer and middle ear.
● Sensorineural hearing loss occurs when the inner ear is damaged or malformed.
CHECK YOUR
UNDERSTANDING 1 Draw a schematic diagram of the structures that make up the ear. On this diagram, label the outer, middle
and inner ear regions, and the individual structures within these, and draw arrows to indicate the pathway
18.1a of sound waves through the ear.
2 Outline the function of the round window.
3 Which region(s) of the ear are:
a air filled
b fluid filled?
4 a Identify the receptors in the ear.
b Where are these receptors located?
c What is their function?
d Describe how they are stimulated to produce electrical impulses.
5 Draw a diagram to represent where different frequencies of sounds are detected in the cochlea.
6 Identify the two types of hearing loss and their respective causes.
7 Outline the impact of damage to:
a the hair cells that are responsible for detecting vibrations of a high frequency.
b the eardrum or the ossicles.
8 Outline the effect of prolonged exposure to loud noise.
596 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
18_bio_InFocus12_2e_sb_08851_txt.indd 596 08/08/18 7:53 pm
Technologies to assist with the effects of hearing loss
Hearing loss affects the quality of life and survival of many individuals. Scientific research into technology
Hearing loss
that can be used to assist those suffering from hearing loss has led to the development of many ways to and hearing
aids
counter its effects. The specific technology used to assist with the effects of hearing loss depends on the
cause of the hearing loss.
Conductive hearing loss can be assisted with the use of hearing aids and bone conduction implants,
while sensorineural hearing loss can be assisted with the use of both hearing aids and cochlear implants.
Hearing aids are used to magnify the sound vibrations to better enable their transmission to the Bone
conduction
middle ear and then the inner ear. implants
A bone conduction implant has a microphone that detects the sound and transforms it into Summarise the
process of bone
vibrations, which are then passed via the implant to the bone above the ear. These vibrations are conduction
implants to assist in
directed through the bone to the cochlea, where they are processed as normal. These implants hearing loss.
bypass the malformed or damaged outer and middle ear and transfer the vibrations directly to
the inner ear.
A cochlear implant uses an external speech processor and transmitter coil. Internally, a receiver
is attached to an electrode array implanted in the cochlea. The microphone of the speech processor Cochlear
detects sound, which is converted into a digital signal that is sent to the transmitter, then to the receiver. implants
Watch the
The digital signals are converted to electrical signals, which are then sent to the electrode array in the animation and draw
cochlea, where nerve endings are stimulated. These signals are then sent to the brain for processing. a flowchart to show
the steps involved
in hearing using a
cochlear implant.
INVESTIGATION 18.2
A secondary-source investigation into technologies to assist with
the effects of hearing loss
INTRODUCTION
In this investigation you will research information about technologies that assist with hearing loss: hearing aids, Information and
communication
bone conduction implants and cochlear implants. technology
capability
AIM
To investigate technologies that assist with hearing loss Personal and
social capability
METHOD
1 Work in pairs or groups to research information from a variety of reliable sources about the following
technologies that assist with the effects of hearing loss: hearing aids, bone conduction implants and
cochlear implants.
2 For each type of technology:
a find information about the type of hearing loss the technology can assist with, including suitable candidates
b provide a description of the technology, where it is positioned and how it assists with hearing loss
c provide a labelled diagram of the technology and digital references/videos to explain its use
d describe the benefits of the technology
e describe the limitations of the technology.
3 Information about each type of technology should be presented in a manner of your choosing and be
presented to the class for peer review.
9780170408851 CHAPTER 18 » TECHNOLOGIES AND DISORDERS 597
18_bio_InFocus12_2e_sb_08851_txt.indd 597 08/08/18 7:53 pm
DISCUSSION
1 Discuss the impact of the technologies available to assist with hearing loss on:
a the lives of people who have hearing loss
b the burden of hearing loss on the health system
c the families of those suffering from hearing loss.
2 Assess the relevance, reliability, validity and accuracy of the information you have collected.
3 Suggest other characteristics of the technologies that could have been researched.
CONCLUSION
Write a few summary sentences related to the aim of this investigation.
KEY CONCEPTS
● In cases of conductive hearing loss, hearing can be assisted by the use of hearing aids and bone
conduction implants.
● Hearing aids magnify the sound waves to assist their passage through the outer and middle ear
to reach the inner ear.
● Bone conduction implants bypass the outer and middle ear by sending the vibrations through
the bone above the ear straight to the inner ear.
● Hearing aids and cochlear implants assist hearing in cases of sensorineural hearing loss.
● Cochlear implants involve the conversion of sound into electrical impulses that stimulate an
electrode array implanted in the cochlea, which in turn stimulates electrochemical impulses in
the auditory nerve.
CHECK YOUR
UNDERSTANDING 1 a Identify two technologies that assist with sending vibrations to the inner ear when there are problems
with the outer and/or middle ear.
18.1b b Explain how each of these technologies functions.
c What are the advantages and disadvantages associated with the use of each of these technologies?
2 a Outline the conditions under which a cochlear implant is used to assist a person who has hearing loss.
b Draw a labelled diagram to show the components of cochlear implant technology and describe
how it works.
c Discuss the advantages and disadvantages of cochlear implants.
18.2 The eye
The eye is a complex structure that contains receptors, called photoreceptors, that receive light energy
from the external environment and convert it to nerve impulses (electrical energy), which are sent via the
optic nerve to the brain, where they are interpreted as images.
Structure and function of the eye
The eye is composed of three layers (Fig. 18.7).
◗ The sclera forms the opaque, tough protective coat that surrounds the majority of the eye, with the
front section forming the transparent, curved cornea.
◗ The middle layer of the eye is the choroid layer and contains most of the blood vessels. The posterior
of the choroid layer is black, to make the eye ‘light tight’ and reduce scattering or reflection of light in
the eye. The forward section of the choroid layer forms the ciliary body, the lens and the iris.
598 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
18_bio_InFocus12_2e_sb_08851_txt.indd 598 08/08/18 7:53 pm
◗ The inner layer of the eye is made up of the Suspensory ligaments
retina. Three Sclera
coats Choroid Ciliary body
Light receptors are located on the retina, which of the
eyeball Retina Upper eyelid
covers the rear portion of the eye. In order to form
clear, focused images, these light rays must be Conjunctiva
refracted (bent) so that a sharp focus is formed Iris
on the retina (Fig. 18.8). The structures within the Cornea
eye that the light passes through allow the correct
Macula
degree of refraction to occur when all parts are Pupil
Fovea
functioning correctly.
Blind
The reflected light from an object in the spot
Lens
environment passes into the eye through the
cornea. The curvature of the cornea refracts
or bends the incoming light. It then passes
Optic
through fluid called the aqueous humour, nerve
situated between the cornea and the lens. Aqueous
This liquid further refracts the light to a small humor
degree. The light travels through the pupil –
Vitreous chamber
the area in the centre of the eyeball that appears with vitreous humor
black. The pupil is a ‘hole’ that can be made larger
FIGURE 18.7 Structure of the mammalian eye
or smaller by a ring of muscle called the iris (the
coloured part of the eye). When the light intensity
is high, the iris expands to make the pupil smaller,
thus restricting the amount of light entering the Rays of light
Accommodation
eye. The opposite occurs when the light is dim, to is described in
more detail on
allow more light into the eye. pages 601–2.
The light moves through the pupil and through
the lens, a highly elastic transparent biconvex Cornea
Aqueous Retina
structure enclosed within the lens capsule. The humour Vitreous Rods and cones
Lens
curvature of the lens is changed by the ciliary humour are discussed in
more detail on
muscle, so the lens can refract the incoming light FIGURE 18.8 Refraction of light rays as they pass pages 605–6.
to form a focused image on the retina. This allows through the eye to form a sharp focus on the retina
focused vision of objects at different distances. The
process by which the lens changes curvature is called accommodation.
Once the refracted light passes through the lens, it moves through the vitreous humour to the retina.
The vitreous humour is a jelly-like clear fluid that also refracts the light and helps to maintain the shape
of the eyeball.
The retina covers the posterior two-thirds of the eyeball and is extremely thin and delicate. It contains
several layers of nerve cells, including two types of photoreceptor cells, rods and cones, that are situated Structure and
function of the
closest to the back of the eye. The rod and cone cells are stimulated by light focused on the retinal eye
surface, and transform this light energy into electrical nerve impulses that are sent via the optic nerve to Summarise the
structure and
the brain. functioning of
A small section of the retina, the fovea (Fig. 18.7), is the area of greatest visual acuity (the ability to see the eye
a clear and precise image). This area is a depression in the macula and is directly opposite the incoming
light. It contains many densely packed cone cells but no rod cells.
The area at the back of the eye, where the nerve fibres leave the eye and converge to form the optic
WS
nerve, is called the blind spot. Light that falls here is not detected, as there are no photoreceptors. Instead,
the brain fills in the missing parts, so you see a whole image. Find your
blind spot
9780170408851 CHAPTER 18 » TECHNOLOGIES AND DISORDERS 599
18_bio_InFocus12_2e_sb_08851_txt.indd 599 08/08/18 7:53 pm
INVESTIGATION 18.3
A first-hand investigation to observe the structure of the eye
INTRODUCTION
In this investigation, the structure of the eye will be investigated by dissection and the use of models, both
digital and physical. If an actual dissection is not performed, there are a number of online interactive, virtual
Virtual eye
dissection dissections that can be used (see weblink).
AIM
To investigate the structure of the eye and relate the structures to their functions
RISK ASSESSMENT
!
RISK WHAT ARE THE WHAT RISK DOES THIS
ASSESSMENT HAZARDS? HAZARD POSE? HOW CAN YOU SAFELY MANAGE THIS RISK?
Scalpel/scissors Sharp edges can cause cuts Use scalpel/scissors with care, hold by the handle and keep fingers
away from sharp edge of scalpel/scissors.
Use of animal Poisoning if ingested or enters Wear gloves at all times. Wash hands at conclusion of investigation.
material through skin Dispose of waste material in an acceptable fashion.
What other risks are associated with your investigation, and how can you manage them?
MATERIALS
• sheep/cow/pig eyeball
• scalpel
• forceps
• scissors
• gloves
• dissecting tray
• newspaper
• model of eye
• image of eye with structures labelled
• digital model of eye
• blindfold
METHOD
1 Work with a partner. One student is to put on the blindfold and be guided by the other student as they
try to navigate their way around the classroom, hallway or school grounds. Roles should be swapped to
give each student the opportunity to experience activities without the benefit of sight.
2 Observe the different structures of the eye using the models and diagrams supplied.
3 Research a variety of reliable sources to determine the region of the brain that receives information for
processing from the optic nerve, and shade this area on a diagram of the brain from Investigation 18.1.
4 Obtain the equipment for dissection of the eyeball, or follow an online virtual dissection.
5 Identify the external structures of the eyeball.
6 Cut off all the fat and muscle attached to the eyeball, taking care not to cut off the optic nerve protruding
from the back.
7 Roll the eyeball between your hands for 3–5 minutes to loosen the tough sclera.
600 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
18_bio_InFocus12_2e_sb_08851_txt.indd 600 08/08/18 7:53 pm
8 Using forceps, pinch an area of the sclera about halfway Cut along this line
between the front and back of the eye. Using the scissors,
cut through the sclera in the pinched area.
9 Place the scissors into this small hole with the tips Cornea
pointing upwards and cut around the eyeball to separate
Optic
the front half from the back half (Fig. 18.9). nerve
10 Peel the front half of the sclera away and hold it up to the
light. Observe the iris and the ‘hole’ that is the pupil.
11 Using your hands and fingers, gently peel the back of the
eye away from the vitreous humour without ‘bursting’ it. Sclera
12 Gently pry the lens away from the vitreous humour and
FIGURE 18.9 External structure of the
place it on the newspaper. What do you see? eyeball, showing the dissection line
13 Observe the layers within the inside of the back section
of the eye, noting any distinctive features and the place
where the optic nerve leaves the eye.
14 The retina is a delicate beige or grey layer that is very thin and may be hanging off the edges of the optic
nerve. The choroid layer is the thin black layer below the retina. The choroid layer of a cow eye consists of
a coloured layer that is not present in human eyes.
RESULTS
1 Describe what it was like to negotiate the classroom/hallways/school grounds without the ability to see. WS
2 Label the structures indicated on the worksheet Diagram of the eye.
Diagram of
3 On the brain diagram from Investigation 18.1 (page 595), shade the areas where the messages from the eye the eye
are processed.
4 Draw a labelled diagram of the external structure of the eyeball.
5 Describe the structure of the sclera, the iris and the pupil.
6 Draw a labelled diagram of the vitreous humour with the lens attached.
7 Describe the structure of the lens and what you noticed when you placed the lens onto the newsprint.
8 Outline the structures you observed on the back portion of the eye: the retina, the choroid layer and the
optic nerve.
DISCUSSION
1 Prepare a table to summarise the different structures that are part of the eye, including a description of
each structure and its function.
2 Describe how the dissection, use of models and being blindfolded increased your understanding of the
structure and function of the eye.
CONCLUSION
Write summary sentences to address the aim of this investigation
9780170408851 CHAPTER 18 » TECHNOLOGIES AND DISORDERS 601
18_bio_InFocus12_2e_sb_08851_txt.indd 601 08/08/18 7:53 pm
Accommodation
In order to form a sharply focused image, on the retina, of objects at any distance, the lens must change
its curvature to refract the light by the correct amount. Light entering the eye from close objects needs to
be refracted more than light coming from distant objects. The greater the curvature of the lens, the more
the light passing through it is refracted (greater refractive power).
Because the lens of the eye has elasticity, its curvature can be changed by the actions of the ciliary
muscles and suspensory ligaments. When the eye views distant objects, the ciliary muscles relax,
drawing the sclera back, which holds the suspensory ligaments taut (Fig. 18.10a). This has the effect of
lengthening the lens, decreasing the curvature and reducing the refraction of the light.
To focus a clear image of a close object on the retina, the curvature of the lens must be increased, to
increase the refractive power of the lens. This is achieved by the ciliary muscles contracting, which draws
the sclera forward and releases the tension on the suspensory ligaments (Fig. 18.10b). This allows the lens
to become rounder, increasing the curvature, and refracting the light to a greater degree.
a
Distant vision
Elongated
lens
Elongated lens, only
slightly convex
Inverted Distant object Taut suspensory ligaments
image
Relaxed ciliary muscle
b
Near vision
Rounded, highly
convex lens
Rounded, highly convex lens
for refraction of light rays
Slackened suspensory
Inverted Close object ligaments
image
Ciliary muscle contracts
towards lens
FIGURE 18.10 Accommodation by the lens, for a distant and b near vision
602 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
18_bio_InFocus12_2e_sb_08851_txt.indd 602 08/08/18 7:53 pm
INVESTIGATION 18.4
A first-hand investigation to model the process of accommodation
INTRODUCTION
Models are useful because they can make a concept simpler and assist in the understanding of more difficult
concepts. In this investigation, the process of accommodation will be modelled to assist in the understanding
of how lenses of different convexities can focus images from different distances.
RISK ASSESSMENT
WHAT ARE THE WHAT RISK DOES THIS !
HAZARDS? HAZARD POSE? HOW CAN YOU SAFELY MANAGE THIS RISK? RISK
ASSESSMENT
Glass lenses Sharp edges can cause cuts Use lenses with care. Don't drop them or they will break and create
sharp edges
Candles/matches Burns to the skin Use candles and matches with care and keep body parts away from
burning flames
What other risks are associated with your investigation, and how can you manage them?
MATERIALS
• lens holder
• metre rule
• clipboard
• blank paper
• candle
• matches
• biconvex lenses of different convexities
METHOD
1 Set up the equipment as shown in Figure 18.11.
2 Keep distance A the same at all times.
Biconvex lens
3 Identify what the parts of the model
Blank paper in lens holder Candle
correspond to in the actual process of
accommodation.
4 Place one of the lenses in the lens holder
and move the candle slowly either
towards or away from the lens until a
clear image of the flame is focused on
the blank paper.
5 Measure distance B.
Distance A Distance B
6 Replace the lens with a lens of a different
convexity and note whether the flame is
FIGURE 18.11 Equipment used to model the process of
still in sharp focus. accommodation
7 Again move the candle until it is in sharp
focus and measure distance B.
8 Repeat steps 6 and 7 with a third lens, of a different convexity.
9780170408851 CHAPTER 18 » TECHNOLOGIES AND DISORDERS 603
18_bio_InFocus12_2e_sb_08851_txt.indd 603 08/08/18 7:53 pm
RESULTS
1 Copy and complete the following table.
LENS CONVEXITY DISTANCE B* (cm)
Most convex
Mid convexity
Least convex
*distance of candle from the lens
2 Present the results obtained above in a different form.
3 Copy and complete the table below to identify what the parts of the model represent in the actual process
of accommodation
ACTUAL PROCESS OF ACCOMMODATION PART OF THE MODEL
Distance between the lens and the retina
Glass lenses of different convexity
Candle
Distance between candle and lens
DISCUSSION
1 In the model used, identify the:
a independent variable
b dependent variable
c controlled variables.
2 How did the distance between the candle and the lens vary in relation to the convexity of the lens used?
3 Outline how the results of this investigation demonstrated the process of accommodation.
4 Discuss the validity of this model.
5 a Outline the limitations of this model of accommodation.
b Suggest improvements that could be made to this investigation.
6 How was your understanding of the process of accommodation assisted by this investigation?
CONCLUSION
Write a few summary sentences to address the aim of this investigation.
KEY CONCEPTS
● The pathway of light through the eye is summarised as:
Cornea → aqueous humour → pupil → lens → vitreous humour → retina
● A focused image is formed on the retina by the refraction of incoming light rays by the cornea,
the aqueous humour, the lens and the vitreous humour.
● Light enters the eye through the pupil. The iris controls the size of the pupil, which in turn
controls the amount of light entering the eye.
● The process by which the lens changes its curvature to focus on objects at different distances is
called accommodation.
● To focus on close objects, the light has to be refracted by a large amount, so the lens has the
greatest curvature. This is achieved when the ciliary muscles contract and move the sclera
forward, loosening the suspensory ligaments.
● To focus on distant objects, the lens must be relatively flat, as less refraction is required. This is
achieved when the ciliary muscles relax, drawing the sclera back and causing the suspensory
ligaments to become taut, pulling the lens into a long, flat shape.
604 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
18_bio_InFocus12_2e_sb_08851_txt.indd 604 08/08/18 7:53 pm
● The retina lines the back of the eye and contains the receptors, rods and cones, which detect
light rays and convert them into electrical impulses to be sent to the brain via the optic nerve.
● The fovea is an area on the retina directly opposite the incoming light that contains only cones
and is the region of greatest visual acuity.
● The tough outer sclera protects the eye and continues to form the clear, transparent cornea.
● The choroid layer is mostly black, to make the eye ‘light tight’.
CHECK YOUR
1 Draw a schematic diagram of the eye and label the components as shown in Figure 18.7. UNDERSTANDING
2 Outline the structures through which the light passes to be refracted to form a focused image on the
retina. 18.2a
3 Define ‘accommodation’.
4 Copy and complete the following table to summarise the process of accommodation
ACTION OF TENSION OF DIAGRAM OF ANTERIOR
MUSCLES OF SUSPENSORY PART OF EYE, SHOWING
TYPE OF VISION SHAPE OF LENS CILIARY BODY LIGAMENT SHAPE OF LENS
Distant vision
Near vision
5 a Summarise the procedure used to model the process of accommodation, identifying how the different
components of the model represent the structures present in the eye.
b Relate this model to the process of accommodation.
Photoreceptor cells: rods and cones
Rods and cones are the receptor cells of the eye. They are located in the retina, where they receive
focused light energy and convert it into electrochemical impulses that are sent to the brain for
interpretation as images.
In humans, each retina contains approximately 125 million rod cells and 6–7 million cone cells. Rods
are evenly distributed over most of the retina, but are absent from the fovea. Cones are distributed in
groups throughout the retina, but are lower in number on the periphery. They are most concentrated in
the fovea.
9780170408851 CHAPTER 18 » TECHNOLOGIES AND DISORDERS 605
18_bio_InFocus12_2e_sb_08851_txt.indd 605 08/08/18 7:53 pm
Both rods and cones have a similar structure, consisting of elongated cells that contain an outer
segment joined to an inner segment that leads to the conducting part of the cell. This part of the cell
comprises a cell body containing the nucleus, and an extension process called the foot, which conducts
the nerve impulses to the next layer of neurons in the retina.
Rods have a long, narrow rod-shaped outer segment, while cones have a shorter, thicker cone-shaped
outer segment (Fig. 18.12).
a b
light-sensitive part of cell
light-sensitive part of cell
Outer segment Outer segment
containing visual pigments containing visual pigments
Rod-shaped
Cone-shaped
Cilium Cilium
Inner segment Inner segment
Conducting part of cell
Conducting part of cell
Cell body
Cell body
Foot Foot
FIGURE 18.12 The structure of a a rod cell and b a cone cell
Both rods and cones contain chemical substances, called visual pigments, stacked in layers in
their outer segments. The role of these visual pigments is to absorb light energy and convert it into
electrochemical impulses for the brain to interpret.
Rods contain only one type of pigment, called rhodopsin, and cannot detect colour. They are extremely
sensitive to low levels of light and are responsible for night vision, detection of light and shadow contrasts
and movement, as well as peripheral vision.
Each cone contains one of three types of visual pigments, called iodopsins. Each type of iodopsin is
sensitive to a different wavelength of light: red, green or blue. Cones are responsible for colour vision,
and it is believed that all colours perceived by the eyes are a combination of the wavelengths detected
Photoreceptors by the different types of cones. Each iodopsin pigment has a wavelength for peak sensitivity, and can
also detect light on either side of these peaks, which overlaps with the other iodopsins. Therefore, light
of one particular wavelength may stimulate more than one type of cone. By comparing the rate at which
WS various receptors respond, as well as the overlap in colours detected, the brain is able to interpret these
Vocabulary of
signals as intermediate colours.
the eye
606 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
18_bio_InFocus12_2e_sb_08851_txt.indd 606 08/08/18 7:53 pm
The light-sensitive pigments, rhodopsin and iodopsin, have a similar chemical structure and each is
made up of two parts:
◗ a retinal (retinene) molecule that is derived from vitamin A
◗ a protein, called opsin.
The type of opsin present depends on whether the visual pigment is rhodopsin or iodopsin.
When rods and cones are exposed to light, it causes the retinal molecule to change its form (Fig.
18.13). This initiates a reaction that causes the light energy to be transformed into an electrochemical
impulse, which moves along the neurons to the brain. At the same time, the opsin and retinal molecule
dissociate and the receptor is ‘bleached’.
After a time, the two parts of the pigment re-join and are able to receive more light stimuli.
Light FIGURE 18.13
Excitation of
rhodopsin by light
Retinal Retinal and opsin
(inactivated) dissociate
Opsin Activated
retinal
Resting rhodopsin Excited rhodopsin
Visual disorders
The ability of the eye to function effectively to allow ‘normal’ vision depends on the individual components
of the eye having the correct structure and function.
Long- and short-sightedness
The most common types of visual disorders are myopia (short-sightedness) and hyperopia (long-sightedness).
A person who has myopia can see near objects clearly, but distant objects appear blurred. This occurs
because the focused image from a distant object falls in front of the retina, while the image from a near
object is focused onto the retina (Fig. 18.14a).
Myopia can have a number of causes:
◗ The shape of the eyeball may be too elongated.
◗ The refractive power of the cornea may be inadequate.
◗ The lens may not flatten enough when the ciliary muscles contract.
A person who has hyperopia can see distant objects clearly, but near objects are out of focus. This is
because the focused image would fall behind the retina (Fig. 18.14b).
Possible causes of hyperopia:
◗ The eyeball is too rounded – that is, too short from front to back.
◗ The lens is too flat and is unable to achieve the required convexity. This could be due to loss of
elasticity in old age.
◗ The refractive power of the cornea is too great for the shape of the eye.
9780170408851 CHAPTER 18 » TECHNOLOGIES AND DISORDERS 607
18_bio_InFocus12_2e_sb_08851_txt.indd 607 08/08/18 7:53 pm
a
Myopia (short-sightedness) Lens contracted, Myopia Eye can focus correctly on near objects, but when
too rounded a distant object is viewed the focal length is too short, so
Focal length the focused image falls in front of the retina.
too short Causes: Lens too rounded and/or eyeball too elongated
Image falls in Eyeball too
front of retina elongated
b
Hyperopia (long-sightedness) Lens cannot be contracted Hyperopia Eye can focus correctly on distant objects, but
sufficiently, too flat when a close object is viewed the focal length is too long,
Focal length
so the focused image would fall behind the retina.
too long
Causes: Lens too elongated and/or eyeball too rounded
Position of focused
image behind retina
Eyeball too
rounded
FIGURE 18.14 Two common visual disorders: a myopia (short-sightedness) and b hyperopia (long-sightedness)
Cataracts
A cataract is the clouding of the lens (Fig. 18.15), which reduces the transmission of the light through
the lens. This causes blurred vision of both near and far objects, and increased sensitivity to the glare of
bright sunlight.
a b
Science Photo Library/Eye of Science
Science Photo Library/Sue Ford
FIGURE 18.15 Cataracts cause visual disorders due to clouding of the lens: a a normal lens; b a lens with cataract
608 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
18_bio_InFocus12_2e_sb_08851_txt.indd 608 08/08/18 7:53 pm
Macular degeneration
Macular degeneration is a disease that causes degeneration of the cells beneath the retina, called the
retinal pigment epithelium. This disease is responsible for 50% of all cases of blindness and is the leading
cause of legal blindness in Australia. Central vision associated with the macula is affected (Fig. 18.16);
peripheral vision is unaffected. Macular degeneration affects the ability to read, recognise faces, drive
and carry out everyday tasks.
Degeneration of retinal pigment epithelial cells prevents light from being focused successfully on this
area, leading to a loss of vision. Early detection is essential to slow the progression of the disease. Many
optometrists now offer this check as part of a regular eye check. The risk of developing the disease can be
reduced with lifestyle changes, including not smoking, following a healthy, balanced diet, doing regular
exercise and reducing one’s exposure to UV light.
a b
Shutterstock.com/Tim Mainiero
Shutterstock.com/Terence Mendoza
Science Photo Library/Cordelia Molloy
Science Photo Library/Cordelia Molloy
FIGURE 18.16 a A healthy macula and resulting image; b macular degeneration and resulting image
9780170408851 CHAPTER 18 » TECHNOLOGIES AND DISORDERS 609
18_bio_InFocus12_2e_sb_08851_txt.indd 609 08/08/18 7:54 pm
KEY CONCEPTS
● Rods and cones are the receptor cells in the retina of the eye. The visual pigments present in
each of these cells change light energy into electrochemical impulses to be sent to the brain for
processing.
● Rods contain rhodopsin and are responsible for the detection of light and vision in low light.
● Each cone contains one of three iodopsin pigments (blue, green and red). Cones are responsible for
colour vision. The multitude of colours detected is due to the combination of each of the cones.
● All pigments are composed of retinal (a derivative of vitamin A) and an opsin (a protein). The
type of opsin depends on the type of pigment.
● The detection of light by the pigments stimulates the formation of an electrochemical impulse
and the splitting of the retinal and opsin. When the two parts of the molecule recombine, the
pigment is ready to receive more light energy.
● Rods are distributed all over the retina.
● Cones are in clumps, with fewer on the edges of the retina.
● Common visual disorders such as myopia and hyperopia are caused by refractive errors of the eye.
● Cataracts are caused by clouding of the lens.
● Macular degeneration is caused by degeneration of the cells in the layer beneath the retina.
CHECK YOUR
UNDERSTANDING 1 Copy and complete the following table to summarise the characteristics of photoreceptors in the eye.
PHOTO- STRUCTURE (DESCRIPTION COLOUR(S) TO
18.2b RECEPTOR CELL DISTRIBUTION AND DIAGRAM) PIGMENT FUNCTION WHICH SENSITIVE
Rods
Cones
2 Outline the process by which light energy is converted into electrochemical impulses.
3 a Define ‘myopia’ and ‘hyperopia’.
b Explain the cause of each of these refractive disorders of the eye. Draw diagrams to aid your
explanations.
4 Describe the cause of each of the following, in terms of the structure and function of the eye:
a cataracts
b macular degeneration.
Technologies to assist with visual disorders
Visual disorders such as myopia and hyperopia cause distinct disadvantages to sufferers if they are not
corrected. Myopic people have trouble seeing traffic signs, watching television or movies, recognising
others, and pursuing leisure activities, including many types of sport. People with hyperopia have
difficulty reading books, computer or phone screens, manipulating machinery and tools, and carrying
out any activity that involves close-up hand–eye coordination. Technologies to assist with these and
other visual defects are therefore an advantage to both the individual and society as a whole.
Spectacles
Spectacles (glasses) are frames that hold corrective lenses made of clear, hard plastic. The shape of the
lens used is determined by the visual disorder that needs correction.
Myopia can be corrected by wearing spectacles with concave lenses, which are thicker towards the
outside and thinner towards the centre. These lenses bend the light rays outwards, causing them to
diverge before they reach the eye. This extends the focal length of the light rays, allowing the focused
image of a distant object to fall on the retina instead of in front of it (Fig. 18.17a).
610 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
18_bio_InFocus12_2e_sb_08851_txt.indd 610 08/08/18 7:54 pm
a
Correction of myopia
Concave lenses in glasses for short-sightedness
Concave
Lengthening of lens
focal length
Light rays
Diverging light rays
Image now Eyeball
reaches retina
Correction of hyperopia
Convex lens in glasses for long-sightedness
Convex
Shortening of lens
focal length
Light rays
Converging light rays
Image now Eyeball
falls on retina
FIGURE 18.17 How corrective lenses work for a myopia and b hyperopia
Hyperopia can be remedied by wearing spectacles with convex lenses, which are thicker towards
the centre and thinner towards the edges. This type of lens bends incoming light rays inwards, causing
them to begin converging before they reach the eye, shortening the focal length and allowing the focused Myopia and
image of a near object to fall on the retina rather than behind it (Fig. 18.17b). hyperopia
Watch the video
and outline the
Contact lenses visual disorders
of myopia and
Contact lenses are an alternative for those who don’t want to wear spectacles all the time and either don’t hyperopia and
how they can be
want to undergo or are not suitable candidates for laser surgery. Contact lenses are based on similar corrected.
technology to spectacles in terms of the shape of the lens and the refraction of light. Although the basic
lens structure is convex or concave in shape, it is shaped to fit the curvature of the eyeball. Contact lenses
are much smaller than the lenses in spectacles and are worn directly in contact with the surface of the eye.
Cataract surgery Cataract
surgery
Intraocular lens implantation (IOL) corrects cataracts. The cloudy lens is removed from the lens capsule Watch these two
short videos and
and an artificial lens is inserted. To do this, the surgeon makes a very small incision in the eye and inserts prepare a summary
a device that delivers high-frequency sound that breaks up the cloudy lens. The small lens particles are of the different
types of cataracts
suctioned out and then an artificial lens is inserted into the lens capsule. and steps involved
in cataract surgery.
An emerging technology is the use of laser cataract surgery, in which a laser is used to break up the
lens and to more accurately place the artificial lens in the lens capsule.
9780170408851 CHAPTER 18 » TECHNOLOGIES AND DISORDERS 611
18_bio_InFocus12_2e_sb_08851_txt.indd 611 08/08/18 7:54 pm
INVESTIGATION 18.5
A secondary-source investigation of laser surgery in the correction
of visual disorders
Information and
communication INTRODUCTION
technology
capability Many visual disorders of the eye are caused by the inability of the eye to refract the incoming light by the
correct amount. Technologies that assist the eye in refracting light to form a focused image on the retina
Personal and are therefore invaluable. The use of spectacles has already been discussed. Another technology to correct
social capability refractive errors of the eye is laser surgery. In this type of surgery, lasers are used to change the curvature of
the cornea to enable the light entering the eye to be correctly refracted to form a focused image on the retina.
There are different types of laser surgery, the most commonly performed being LASIK surgery (laser-assisted
in situ keratomileusis).
AIM
To investigate the process of LASIK surgery to assist with the effects of myopia and hyperopia
METHOD
1 Working in pairs or in groups, use a variety of reliable sources to investigate the process of LASIK surgery to
correct myopia and hyperopia.
2 Areas to be researched are:
• suitable candidates
• reasons why people consider LASIK surgery
• medical issues that need to be considered
• the procedures involved in LASIK surgery to correct both myopia and hyperopia
• side-effects and complications
• long-term outlook
• benefits and risks of the procedure
• other pertinent information.
3 Diagrams or videos of the procedure should be included in your information.
4 Present your information in a manner of your choosing and reference your sources in an acceptable form.
5 Research the advantages and disadvantages of the use of spectacles and contact lenses.
6 Construct a table to summarise the advantages and disadvantages of the use of contact lenses, spectacles
and laser surgery to correct refractive errors in the eye.
RESULTS
1 Presentation of LASIK surgery as a means of assisting with visual disorders caused by refractive errors in the eye.
2 Presentation of a table summarising the advantages and disadvantages of the use of contact lenses,
spectacles and laser surgery to correct refractive errors in the eye.
3 Reference your sources in an acceptable form.
DISCUSSION
1 Describe the impact of this procedure on the affected individual.
2 Discuss the advantages and disadvantages of laser surgery compared with wearing contact lenses or spectacles.
3 Assess the relevance, reliability, validity and accuracy of the information you have collected.
4 Identify ways in which this investigation could have been improved.
CONCLUSION
Write summary sentences to address the aim of this investigation.
612 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
18_bio_InFocus12_2e_sb_08851_txt.indd 612 08/08/18 7:54 pm
The bionic eye
Bionic Vision Technologies is developing a bionic eye to restore vision to people with retinitis pigmentosa
(a disease where the rods and cone cells degenerate gradually) and age-related macular degeneration.
The bionic eye consists of a camera attached to a pair of glasses, which transmits high-frequency radio
signals to a microchip implanted in the eye (Fig. 18.18). Electrodes on the implanted chip convert these
signals into electrical impulses to stimulate cells in the retina to convert light rays into electrical impulses,
which are then sent to the brain via the optic nerve.
Image courtesy Bionic Vision Australia. Copyright Beth Croce, CMI.
Electrical signals sent from retina
4 via visual pathway to vision
Implanted electrode processing centres in the brain
1
Cameral captures image array stimulates retina
and transmits data to an
external body word
processing unit
2
Data processed and sent
to implanted system via
external wire
3
Implant receives wireless
signals from external
unit and sends them to
retinal implant via implanted wire
FIGURE 18.18 How the bionic eye works
KEY CONCEPTS
● Lenses are used in spectacles and contact lenses to correct the refractive errors of the eye.
● Concave lenses correct myopia, while convex lenses correct hyperopia.
● Laser surgery changes the convexity of the cornea to correct refractive errors and allow light
rays to be focused on the retina.
● Cataract and laser cataract surgery restore vision to cataract sufferers.
● The bionic eye could help to restore vision to those suffering from retinitis pigmentosa by
bypassing damaged rod and cone cells.
CHECK YOUR
1 Explain, with the use of a diagram, how spectacles can be used to correct: UNDERSTANDING
a myopia
b hyperopia.
18.2c
2 Describe another technology besides the use of lenses that can be used to correct refractive errors of the
eye.
3 Compare the processes of cataract surgery and laser cataract surgery.
4 Compare cochlear implants with the bionic eye.
9780170408851 CHAPTER 18 » TECHNOLOGIES AND DISORDERS 613
18_bio_InFocus12_2e_sb_08851_txt.indd 613 08/08/18 7:54 pm
18.3 The kidney
The kidneys are organs that form part of the excretory system. Their function is to remove nitrogenous wastes
from the bloodstream and maintain optimal levels of substances such as salt and water (osmoregulation).
Structure and function of the kidney
The kidney has three main functions: filtration, reabsorption and secretion. To carry out these functions,
the kidney has three main regions: the cortex, medulla and pelvis.
The functional unit of the kidney is the nephron (Fig. 18.19). Each kidney contains millions of these
microscopic units, extending from the cortex of the kidney and into the medulla. Each nephron consists
of a Bowman’s capsule, which is a spherical, two-sided, hollow, cuplike structure that contains a spherical
Structure and
function of the network of capillaries, called the glomerulus. The far side of the Bowman’s capsule leads into the tubules
kidney that make up the rest of the nephron. These tubules are the proximal tubule, the loop of Henle and the
distal tubule, which leads into the collecting duct.
a b Renal cortex Renal medulla
Kidneys
Renal artery
Renal vein
Ureter
Inferior Aorta
vena cava Bladder
Renal artery – carries
blood to kidney
Urethra Renal pelvis – funnels
urine into ureter
Renal vein – carries Ureter
blood away from kidney
d c
Proximal
Distal tubule Proximal tubule convoluted
Efferent arteriole
from glomerulus tubule
Distal
convoluted Bowman’s
Afferent arteriole tubule capsule
from renal artery
Bowman’s capsule
Glomerulus
Descending limb Renal
Ascending limb cortex
Branch of
renal vein Loop of
henle Collecting
duct
Renal
medulla
To
renal
pelvis
Collecting
duct
Loop of henle
FIGURE 18.19 a Excretory system of mammals; b macroscopic structure of mammalian kidney (longitudinal section);
c microscopic structure showing the distribution of tubules in the mammalian kidney; d nephron and associated capillaries
614 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
18_bio_InFocus12_2e_sb_08851_txt.indd 614 08/08/18 7:54 pm
Filtration
Under high pressure, blood travels from the heart via Glomerulus Bowman’s Glomerular
the aorta to the renal artery and into the kidney. The capillary capsule filtrate
renal artery branches into smaller and smaller vessels
until millions of capillaries are formed. Each capillary
enters a nephron, where it forms the glomerulus
inside the hollow of each Bowman’s capsule. Filtration
is based on the size of substances, so all substances Water
in the glomerular blood that are small enough Arteriole Amino
entering acid Glucose
will pass through the walls of the glomerulus into
the Bowman’s capsule. This includes nitrogenous
waste products and large volumes of water carrying Red blood
cells
Glucose
dissolved substances including amino acids, glucose Arteriole
leaving
and salts (ions).
Once inside the Bowman’s capsule, this fluid,
now known as the glomerular filtrate, continues its Urea
Protein
journey along the tubules that extend at the back
of the capsule (Fig. 18.20). Larger molecules, such as
proteins and blood cells, remain in the glomerular Blood Filtrate
blood.
Reabsorption FIGURE 18.20 Filtration of blood in the Bowman’s capsule
Reabsorption returns essential components that
have been filtered out of the blood back into the Bowman’s Distal tubule
bloodstream. Amino acids, glucose, varying quantities capsule
Proximal tubule
Glomerulus
of ions (such as sodium (Na+), potassium (K+), chloride
– +
(Cl ), calcium (Ca ) and hydrogen bicarbonate
(HCO3– ) and some vitamins are reabsorbed into
Total solute concentration (mOsm)
Na1 2
CI
the bloodstream (Fig. 18.21). The differing rates of 300 — H2O Collecting
reabsorption of particular ions depend on feedback tubules
from the body. All solutes that are reabsorbed from Loop of
the nephron move by active transport and facilitated Henle
Cortex
diffusion in both the proximal and the distal tubule
(Fig. 18.22). Na1 H2O
H2O
Glomerular filtrate also contains a relatively high 600 — CI2
concentration of dissolved urea and other wastes, Outer medulla
most of which are not reabsorbed.
As the solutes are reabsorbed, water follows by H2O Urea
the passive process of osmosis. In the ascending loop
of Henle and the collecting duct, a large number of H2O
Inner medulla
1200—
ions (mostly sodium) are actively pumped into the
tissues of the medulla. This causes the concentration
FIGURE 18.21 Reabsorption of water and various ions along the tubule. Blood
of water in these tissues to be much lower than in the vessels are not shown.
tubules. As a result, water moves from the descending
loop of Henle and the collecting duct into the tissues by the process of osmosis. The reabsorption of
water occurs in all parts of the tubules and collecting duct, except the ascending loop of Henle.
9780170408851 CHAPTER 18 » TECHNOLOGIES AND DISORDERS 615
18_bio_InFocus12_2e_sb_08851_txt.indd 615 08/08/18 7:54 pm
1 Proximal tubule 4 Distal tubule
NaCI nutrients H2O
HCO3– H2O NaCI HCO3–
K+
K+ H+
H+ NH3
Cortex
2 Descending 3 Thin segment
limb of loop of ascending
of henle limb
NaCI
H2O
Outer NaCI
Filtrate
medulla
H2O (water)
salts (NaCI, etc) 3 Thick segment 5 Collecting
HCO3– (bicarbonate ions) of ascending duct
H+ (hydrogen ions) limb
Urea
urea
glucose; amino acids NaCI H2O
some drugs Inner
medulla
Active transport
Passive transport
FIGURE 18.22 Reabsorption of ions and water from the tubules by active transport (ions) and passive
transport (water). Blood vessels are not shown.
Secretion
Secretion (or tubular secretion) is the third process that contributes to urine formation in the nephron.
Secretion involves the removal of toxic substances from the blood capillaries and tissues surrounding
the tubules and their active movement into the tubules for removal. This includes metabolic wastes
such as urea, uric acid, ammonia and hydrogen ions, along with drugs such as penicillin, saccharin and
morphine. Movement of urea and ammonia is mainly by means of diffusion, whereas all other secretion
involves active transport.
Hydrogen ions (H +), saccharin, and drugs such as penicillin and morphine, are secreted into the
proximal part of the nephron. Urea is secreted into the descending limb of the loop of Henle (the
ascending limb and distal tubules are impermeable to urea).
Hormonal regulation of osmoregulation in the kidney
The hormone aldosterone stimulates the reabsorption of salt in the loop of Henle, to regulate salt and
water balance in the kidney.
The hormone antidiuretic hormone (ADH or vasopressin) stimulates the reabsorption of water in the
Hormonal kidney.
control of
osmoregulation
in the kidney Removal
is dealt with in
more detail in The water, nitrogenous wastes and other wastes that remain in the collecting duct are known as urine.
Chapter 14 Urine collects in the pelvis of the kidney before moving through the ureters to the bladder, after which it
(pages 490–1).
is eliminated from the body through the urethra.
616 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
18_bio_InFocus12_2e_sb_08851_txt.indd 616 08/08/18 7:54 pm
INVESTIGATION 18.6
A first-hand investigation to identify the regions
of the mammalian kidney
INTRODUCTION
Shutterstock.com/Blamb
This investigation may be undertaken as a dissection, using fresh
kidneys, or as an interactive virtual dissection. Models of the
kidney, both physical and digital, can be used as well.
The kidneys lie on either side of the midline on the back wall
of the abdomen, in the region of the waist. In humans, each kidney
is bean-shaped, about 10.5–13 cm long, 6 cm wide and 3 cm thick.
Regions to be identified are shown in Figure 18.23.
AIM
To identify the regions of the mammalian kidney involved in the
excretion of wastes, and relate these structures to their functions
MATERIALS
• dissecting tray
• newspaper
• scalpel
• forceps
• probe
• scissors
• kidney
• gloves
FIGURE 18.23 Longitudinal section of the kidney, indicating the
• models of kidney different regions
• pins and label flags
RISK ASSESSMENT
Draw up a table that identifies three hazards associated with this investigation, the risk these hazards pose and
how these risks can be safely managed.
METHOD
1 Work in pairs or in groups of four. Lie the kidney on the dissecting tray.
External structure
2 Examine the external structure of the kidney, noting its surrounding fat (adipose tissue). Remove the fat,
leaving the vessels at the hilum intact. The hilum is the curved indentation of the kidney where the blood
vessels enter and leave the kidney and the ureter leaves the kidney.
3 Compare the size of the kidney that you have for dissection with the dimensions given for an average
human kidney.
4 Identify the vessels, distinguishing between the renal artery, renal vein and ureter if present.
5 Detach the renal capsule. Describe its appearance and function.
6 Draw a life-sized diagram of the external structure of the kidney.
Internal structure
7 Cut the kidney in longitudinal section, making an incision along the side opposite the hilum. Note the
opening to the ureter. Insert a probe through the hole and observe where it exits.
9780170408851 CHAPTER 18 » TECHNOLOGIES AND DISORDERS 617
18_bio_InFocus12_2e_sb_08851_txt.indd 617 08/08/18 7:54 pm
8 Identify the regions of the kidney: outer cortex, medulla and renal pelvis. Compare the colour and
appearance of the cortex and the medulla.
9 Insert a probe below the renal pyramids, slip the lower blade of the scissors into the gap and slit through
each pyramid to follow the path of the calyces. Urine from the collecting tubules drains into these calyces,
which carry the urine to the renal pelvis, ureters and bladder.
10 Draw a diagram of a longitudinal section through the kidney, showing the internal structure as seen in
the dissection. Annotate the diagram by writing the function of each structure labelled (a minimum of six
structures). Do not draw the textbook diagram.
11 Identify each of the following regions of the kidney, using toothpicks with coloured flags:
• red flag – the part of the kidney containing collecting tubules
• blue flag – the region of the kidney containing glomeruli and Bowman’s capsules
• yellow flag – the part of the kidney that carries urine from the collecting tubules.
DISCUSSION
1 In a table like the one below, list the parts of a nephron that you would expect to find in the cortex and the
parts you would expect to find in the medulla:
glomerulus, Bowman’s capsule, first convoluted tubule, loop of Henle, second convoluted tubule, collecting
tubule, blood capillaries
REGION OF KIDNEY PARTS OF NEPHRON
Cortex
Medulla
2 Give the correct biological term for each of the following two functions of the kidney:
a filter out wastes such as urea
b regulate the water and salt balance.
3 What adjective is used to describe anything associated with the kidney?
4 Compare the chemical composition of blood in the renal artery with that of the renal vein.
CONCLUSION
Write a few summary sentences to address the aim of this investigation.
KEY CONCEPTS
● The main functions of the kidney are to excrete nitrogenous wastes and to balance the level of
water and salt in the blood.
● The kidney contains three main regions: the cortex, medulla and pelvis.
● The nephrons are the functional units of the kidney. Each kidney contains millions of nephrons.
● Nephrons contain the glomerulus, Bowman’s capsule, proximal tubule, loop of Henle, distal
tubule and collecting duct.
● Filtration occurs in the junction between the glomerulus and the Bowman’s capsule. All
substances that are small enough move into the tubule from the bloodstream.
● Reabsorption of all substances required by the body occurs along the tubules and in the
collecting duct.
● Secretion of additional wastes into the tubules occurs along the length of the nephron.
● Remaining wastes and water collect in the pelvis of the kidney to form urine and move via the
ureters to the bladder before elimination from the body via the urethra.
● Water and salt conservation in the kidney are stimulated by ADH and aldosterone respectively.
618 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
18_bio_InFocus12_2e_sb_08851_txt.indd 618 08/08/18 7:54 pm
CHECK YOUR
1 Identify: UNDERSTANDING
a the main functions of the kidney
b the main functional unit of the kidney.
18.3
2 Draw a diagram of:
a a cross-section of a kidney, with the following regions labelled: cortex, medulla, pelvis
b a nephron, with the following labelled: glomerulus, Bowman’s capsule, proximal tubule, loop of Henle,
distal tubule, collecting duct.
3 On the diagram of the nephron, identify and label the area where the following occurs:
a filtration
b reabsorption of essential components
c secretion of toxins
d active pumping of salts into the tissues followed by movement of water by osmosis.
Loss of kidney function
Loss of kidney function often occurs gradually, with minimal signs until kidney function is significantly
impaired. The causes are many and often involve damage to the individual filtering units, the nephrons.
If the nephrons are damaged they cannot carry out their filtering, reabsorption and secretion functions
properly. This leads to a failure to remove wastes effectively and an inability to balance water and salt
levels in the blood.
Symptoms of loss of kidney function include:
◗ nausea
◗ vomiting
◗ loss of appetite
◗ fatigue and weakness
◗ sleep problems
◗ changes in the volume of urine produced
◗ decreased mental sharpness
◗ muscle twitches and cramps
◗ swelling of feet and ankles
◗ persistent itching
◗ chest pain, if fluid builds up around the lining of the heart
◗ shortness of breath, if fluid builds up in the lungs
◗ high blood pressure (hypertension) that is difficult to control.
Some of the causes of kidney disease leading to reduced function are:
◗ diabetes type 1 and 2 – high levels of blood glucose cause the kidneys to filter more blood, which
causes stress on the nephrons. The nephrons eventually become damaged and larger molecules, such
as proteins, ‘leak’ into the tubules and cause blockages and further damage to the nephrons
◗ continued high blood pressure – the nephrons are damaged by the constant high force of the blood
being pushed through the walls of the blood vessels of the glomerulus into the Bowman’s capsule. This
causes permanent damage to the nephrons, again with large molecules ‘leaking out’ into the tubules,
causing blockages and further damage, which reduces the ability of the nephrons to function effectively
◗ recurrent kidney infections – this causes damage to the nephrons, and this damage as well as the
prolonged use of certain medications and drugs to treat the infections can reduce kidney function.
9780170408851 CHAPTER 18 » TECHNOLOGIES AND DISORDERS 619
18_bio_InFocus12_2e_sb_08851_txt.indd 619 08/08/18 7:54 pm
◗ kidney stones, tumours or anything that blocks the passage of urine – causes the urine to ‘back up’
into the kidney, which causes a build-up of pressure that, unless the blockage is removed, will cause
kidney damage leading to a complete shutdown.
Technology to assist with loss of kidney function
The kidneys are responsible for filtering our blood and removing metabolic wastes so that they are
excreted in the urine. The kidneys are also responsible for maintaining the balance of water and salts
in the blood. If a person suffers from kidney failure, there is no natural means by which these wastes
can be removed and their toxic effect will eventually lead to death.
The process of renal dialysis has been developed to carry out some of the functions of kidneys, so
that blood may be effectively filtered even when the kidneys are damaged (Fig. 18.24). There are two
types of renal dialysis: haemodialysis and peritoneal dialysis (Fig. 18.25).
Alamy Stock Photo/BSIP SA
FIGURE 18.24 A patient undergoing renal dialysis
The main function of a dialysis machine is to remove metabolic wastes that have built up in the
Dialysis
Draw a flow chart
person’s blood. The patient is connected to a dialysis machine, which pumps their blood through a system
of the process of of tubes (coiled to increase their surface area and therefore the rate of diffusion), which have artificial semi-
haemodialysis
permeable membranes. The tubes are submerged in dialysis fluid (dialysate), which flows in the opposite
direction to the blood in order to maintain a concentration gradient to maximise diffusion. Dialysate has the
same concentration as blood plasma, without the metabolic wastes. Because the concentration of metabolic
waste is higher in the blood than in the dialysing fluid, the waste materials move through the semi-permeable
membrane into the dialysing fluid by diffusion. Continual replacement of the dialysate is required.
Renal dialysis must be done for 3–4 hours, two or three times per week. As well as its time-consuming
nature, another disadvantage of the process is that only limited amounts of fluid/wastes can be removed
from the blood; other substances such as sodium phosphate and potassium ions do not diffuse quickly
enough and therefore may accumulate in the blood. It is therefore recommended that patients follow a
specific diet to prevent this, as renal dialysis is not effective in regulating the concentration of these ions
in the blood.
620 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
18_bio_InFocus12_2e_sb_08851_txt.indd 620 08/08/18 7:54 pm
a
From an artery
Blood
Blood pump Diffusion
To a vein of waste
products
such as
Bubble urea
trap
Diffusion of waste
Dialysis products across the
membrane dialysis membrane
Compressed Fresh Constant Used
CO2 and air dialysis temperature dialysis Dialysis
fluid bath fluid fluid
b Dialysate fluid
i ii iii
Abdominal cavity
Abdominal
cavity Bag is rolled up and
tucked around waist.
Bag is lowered and fluid
is allowed to flow out.
FIGURE 18.25 Renal dialysis: a haemodialysis; b peritoneal dialysis
INVESTIGATION 18.6
A secondary-source and first-hand investigation
to research renal dialysis
INTRODUCTION
Personal and
Dialysis is a technology that can assist the body to remove wastes when a person experiences a loss of kidney social capability
function. In this investigation you will describe the two types of dialysis and state when each may be used. You
will also discuss the advantages and disadvantages of dialysis and assess whether it is a long-term replacement
for normal kidney functioning. If possible, a visit to a renal dialysis unit will contribute to understanding the
issues associated with use of dialysis.
9780170408851 CHAPTER 18 » TECHNOLOGIES AND DISORDERS 621
18_bio_InFocus12_2e_sb_08851_txt.indd 621 08/08/18 7:54 pm
Your group should plan this investigation, deciding on the aim, the type of information to be researched
to address the points above, and how to present the information. Questions to be addressed in the discussion
should be composed and then answered.
If a visit to a renal dialysis unit can be organised, then questions to be posed to dialysis patients and nursing
staff that are sensitive to their situation should be prepared beforehand.
RESULTS
Present your results in a format agreed to with your teacher.
18.4 Effectiveness of technologies
Technologies aim to assist with the effects of a disorder and improve the quality of life of the sufferer.
Without technology, individuals would have to manage to the best of their ability to cope with the effects
of the disorder. Not only would these individuals be affected, but so too would their families or carers.
The burden on the health and welfare systems would be increased due to the continual support that
would have to be provided.
The effectiveness of the cochlear implant for those with sensorineural hearing loss is an example
of a highly effective technology. The cochlear implant gives individuals the ability to communicate
effectively with those around them, rather than, as previously happened, having to find other ways
of communicating. These involved the use of sign language, lip reading and often a reduced ability to
develop effective language skills, especially in those born profoundly deaf. This led to a reduced quality of
life and a limited ability to function at higher levels in the community.
With the advent of the cochlear implant, those born profoundly deaf now have the ability to develop
at a normal rate and show no signs of developmental delays in language, hearing and speech. Infants
as young as six months can have cochlear implants fitted and, with support and guidance, will develop
language and speaking skills normally. There is no need to attend special schools and they can be fully
integrated into society.
Older adults who have lost most of their residual hearing and have a cochlear implant are able, after
a period of adjustment and training, to hear the world around them again and experience an improved
quality of life. They are able to be more independent and to
contribute positively to both their family and society without
Science Photo Library/Sputnik
extra assistance.
The disadvantages associated with the use of cochlear
implants include:
◗ having to undergo an operation for the implantation of the
device
◗ post-operative side effects
◗ ongoing costs for updating
◗ programming and training required to teach the person to
interpret the sounds they hear
◗ a limited distance of hearing.
These disadvantages are far outweighed by the advantage
of being able to hear, develop speech normally and be a highly
FIGURE 18.26 A cochlear ear implant enables people to interact
fully with their environment.
functioning and contributing member of society with no real
disability.
622 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
18_bio_InFocus12_2e_sb_08851_txt.indd 622 08/08/18 7:54 pm
INVESTIGATION 18.7
A secondary-source investigation to evaluate the effectiveness
of a technology
INTRODUCTION
Many technologies that assist with the effects of a disorder have been studied. You will be required to judge
Ethical
the effectiveness of one of these technologies based on a set of criteria. understanding
1 Working in pairs or groups, develop an aim for this investigation.
2 Set out a method to be followed. To do this, decide what criteria you will use to make your judgement Literacy
about the effectiveness of your chosen technology.
Things such as the advantages and disadvantages of the use of the technology, along with what is involved
with the use of the technology and the effects on the individual if the technology is not used, are areas that
can be investigated.
3 Your results will contain the information you have gathered. Decide on an appropriate format for your
results.
4 The discussion will provide a judgement and the evidence that supports your judgement of the
effectiveness of the technology.
5 A conclusion will finalise your investigation.
KEY CONCEPTS
● Loss of kidney function can occur for numerous reasons, including diabetes, high blood
pressure, kidney infections and blockages.
● Most of these conditions cause damage to the fragile nephrons.
● Dialysis uses an ‘artificial kidney’ to remove urea from the blood when kidney function is
insufficient to do so.
● Dialysis can also balance the water and salt levels to some extent.
● There are two types of dialysis: haemodialysis and peritoneal dialysis.
● Renal dialysis patients undergo dialysis several times a week for extended periods.
● The effectiveness of a technology can be assessed on the basis of certain criteria.
CHECK YOUR
1 Explain how different causes of loss of kidney function affect the nephrons. UNDERSTANDING
2 Outline the concentration of substances in dialysate fluid compared to the blood of the patient, and
explain the significance of this concentration. 18.4
3 Outline the conditions under which dialysis is used and describe how it removes urea from the blood.
4 Describe the effects of dialysis on the lives of those who suffer from reduced kidney function.
5 List three criteria that could be used to assess whether a technology designed to assist with a disorder is
effective.
9780170408851 CHAPTER 18 » TECHNOLOGIES AND DISORDERS 623
18_bio_InFocus12_2e_sb_08851_txt.indd 623 08/08/18 7:54 pm
18 CHAPTER SUMMARY
Technologies and disorders: How can technologies be used to assist people who
experience disorders?
THE EAR
Outer ear Middle ear Inner ear
Pathway of sound
Semicircular
Stirrup
canals
External auditory canal
Pinna Anvil Bone
Hammer
Tympanic membrane
Sound
waves Auditory Ossicles
nerve
Oval window
Auditory Cochlea
canal
Cochlea
Eardrum
Round
(tympanic
window
Round window
membrane)
Oval window
(where stirrup
attaches)
Hearing loss
Middle ear Inner ear
Technology to assist those
with hearing loss
Outer ear Hearing aid (used for Bone conduction Cochlear implant
both conductive and implant (conductive (sensorineural
Conductive Sensorineural sensorineural hearing loss) hearing loss) hearing loss)
THE EYE
Suspensory ligaments
light-sensitive part of cell
light-sensitive part of cell
Outer segment
Photoreceptor cells: Outer segment containing visual pigments
Three
coats
Sclera
Ciliary body
Cone-shaped
containing visual pigments Choroid
rods and cones
Rod-shaped
of the
eyeball Retina Upper eyelid
Convert light into Rods
Conjunctiva
electrochemical Iris
Cilium
impulses Cilium
Macula Cornea
Rods – rhodopsin Inner segment
Cones
Fovea Pupil
pigments – detect Inner segment Blind
spot
light Lens
Cones – iodopsins – Optic
Conducting part of cell
colour vision Cell body nerve
Conducting part of cell
Aqueous
Rods humor
Cell body
Vitreous chamber
with vitreous humor
Foot
Foot
624 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
18_bio_InFocus12_2e_sb_08851_txt.indd 624 13/08/18 6:06 PM
Accommodation Technologies to assist those with visual disorders
Process by which the lens changes its curvature to focus
on objects at different distances
Near vision (myopia) Distant vision (hyperopia)
Spectacles, contact lenses
concave lenses for myopia,
convex lenses for hyperopia
Rounded, highly convex lens Elongated lens, only
for refraction of light rays slightly convex
Slackened suspensory
ligaments Taut suspensory ligaments LASIK surgery changes curvature
Ciliary muscle contracts Relaxed ciliary muscle of the cornea to correct refractive
towards lens
errors of eye
Visual disorders
• Hyperopia – can focus on distant objects, not close
• Myopia – can focus on close objects, not distant
• Cataracts – cloudy lens Cataract surgery (intraocular lens
• Macular degeneration – degeneration of cells beneath implantation) replaces cloudy lens
the retina with artificial lens
THE KIDNEY
The kidney nitrogenous waste from the bloodstream and carries out osmoregulation by filtration, reabsorption and secretion.
Functions
• Filtration • Reabsorption • Secretion
Wastes and water collect in pelvis of kidney to form urine.
Three main regions – cortex, medulla, pelvis Nephron – functional unit of kidney (millions in kidney)
Distal tubule Proximal tubule
Efferent arteriole
from glomerulus
Afferent arteriole
from renal artery
Bowman’s capsule
Glomerulus
Descending limb
Ascending limb
Branch of
renal vein Loop of
henle
Collecting
duct
Technology to assist with kidney disorder From an artery
Blood
Loss of kidney function To a vein
Blood pump Diffusion
of waste
products
Leads to failure to remove wastes and inability to balance Bubble
such as
urea
trap
water and salt levels in blood. Dialysis
Diffusion of waste
products across the
membrane dialysis membrane
Technology to assist those with loss of kidney function
Renal dialysis – carries out some of the functions of the kidney
Compressed Fresh Constant Used
CO2 and air dialysis temperature dialysis Dialysis
fluid bath fluid fluid
9780170408851 CHAPTER 18 » TECHNOLOGIES AND DISORDERS 625
18_bio_InFocus12_2e_sb_08851_txt.indd 625 08/08/18 7:55 pm
18 CHAPTER REVIEW QUESTIONS Qz
Review quiz
1 A newborn baby is not responding normally to the 6 Cataract surgery replaces the old clouded lens with a clear
sounds around him. On testing, it is found that he is lens that allows the light to pass through unhindered.
profoundly deaf. The cause of this deafness is genetic and Critically evaluate the consequences of cataract surgery
affects the hair cells in his cochlea. It is also found that his on the quality of life of an elderly person.
auditory nerve is functioning correctly.
7 Justify the directive, given by the supervisor on a building
Outline the technology that can be used to assist with site, that all workers must wear earplugs when machinery
this type of hearing disorder. In your answer, include the is being used.
advantages of early intervention.
8 Outline the special dietary requirements of patients
2 A football player received a knock to the back of his head undergoing dialysis, and explain why it is necessary to
and consequently had vision problems for a number of follow these strict dietary guidelines.
days. Explain why the football player developed visual
disturbance. 9 Evaluate the impact of undergoing dialysis on the lifestyle
of a patient who has lost kidney function.
3 a Explain, with the use of diagrams, why people tend to
hold their reading material further and further away 10 Explain why candidates for the ‘bionic eye’ are tested for a
from their eyes as they get older. functioning optic nerve.
b What is the name given to this disorder? 11 Compare the functioning of the kidney with the process
c Describe one technology that could be used to assist of dialysis.
with this disorder. 12 Explain how refractive errors in the eye cause visual
4 a Describe what is meant by ‘refraction of light’. disorders.
b Outline the structures in the eye through which light is 13 Prepare an answer to the inquiry question: ‘How can
refracted. technologies be used to assist people who experience
c Why is it important that light is refracted in the eye? disorders?’
5 Write a paragraph to compare the accommodation of the 14 Compare the functioning of a cochlear implant with that
eye for near vision and for distant vision. Include in your of a bionic eye.
description a comparison of the refractive power of the
lens, from rest to maximum accommodation.
626 CHAPTER EIGHT
MODULE 11 » CHEMISTRY
» NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
18_bio_InFocus12_2e_sb_08851_txt.indd 626 09/08/18 9:30 am
MODULE 8 : NON-INFECTIOUS
» END-OF-MODULE REVIEW
DISEASE AND DISORDERS
Answer the following questions.
1 a Define ‘homeostasis’. a Use the graph to compare the prevalence of obesity
b Describe how homeostasis maintains the internal in non-Indigenous Australians to Aboriginal and Torres
environment, using humans as an example. Refer to Strait Islander peoples in the respective age groups, for
negative feedback loops and examples such as the 2012–2013.
regulation of temperature and blood glucose levels to b Suggest reasons for the differences outlined in part a.
assist your description.
8 For an identified non-infectious disease caused by
2 Outline the adaptations that you would expect to find exposure to the environment, or a nutritional disease,
in an endothermic organism that lives in a hot, dry outline:
environment. Justify the adaptations you have identified. a the treatment/management
b future directions for further research.
3 A plant was found to have a covering of light hairs on its
small leaves, a lighter colour on the underneath surface of 9 a Outline an example of an epidemiological study.
the leaves and sunken stomata. Predict the environment
in which this plant would be found, and explain how b Comment on the reliability and validity of this study.
these adaptations assist it to survive successfully in this 10 Evaluate, using examples, the benefits of conducting an
environment. epidemiological study.
4 a Draw a labelled diagram of a motor neuron and 11 Outline one educational campaign designed to prevent a
indicate the direction of movement of a nerve non-infectious disease and evaluate its effectiveness.
impulse.
b Construct a table to distinguish between the structure 12 A poster was produced to educate primary school-
and function of the following types of neurons: aged children about the importance of a healthy diet
sensory, motor, interneuron. and exercise, to prevent them becoming overweight or
obese. What would the poster designers need to take into
5 How do the nervous and endocrine systems work account when deciding how to design the poster and
together in maintaining an organism’s internal what material to include in the poster?
environment? Use specific examples to illustrate your
answer. 13 a Outline one example of how genetic engineering can
be used to prevent a non-infectious disease.
6 Construct a table to summarise the cause and effects b Discuss any ethical issues associated with the use of
on the body of one non-infectious disease, from each of the genetic engineering technique outlined in a.
the following types: genetic disease, nutritional disease,
cancer, diseases caused by environmental exposure. 14 a Relate the structure and functioning of the eye to
the causes of the visual disorders of myopia and
7 The graph below shows the proportion of people in hyperopia. Use diagrams to aid your explanation.
Australia, aged 15 years and over, who were overweight or
obese, by Indigenous status and age, 2012–13. b Describe how different technologies can be used to
assist with these disorders.
Islander Health Performance Framework. 2014 Report.
Commons Attribution 3.0 Australia Licence.
Source: Australian Government Aboriginal and Torres Strait
Licensed from the Commonwealth of Australia under a Creative
100 Aboriginal and Torres Strait Islander peoples c Evaluate the effectiveness of these technologies
Non-Indigenous Australians against three chosen criteria.
77 80
80 75 73
66
71 15 Describe how cochlear implants can assist with
65
sensorineural hearing loss, and relate their functioning to
60 55 54
the normal functioning of the ear.
%
40 35 36
16 One of your acquaintances has a serious kidney disease
24 that has affected the nephrons and has to undergo
20 haemodialysis.
Create a pamphlet explaining how haemodialysis could
0 assist with the effects of this disease and how it differs
15–17 18–24 25–34 35–44 45–54 551
Age group (years) from the normal functioning of the kidney.
Proportion of people in Australia,15 years and over, who were 17 Explain the role of hormones in regulating kidney
overweight or obese, by Indigenous status and age, 2012–13
functioning.
9780170408851 CHAPTER 18 » TECHNOLOGIES AND DISORDERS 627
18_bio_InFocus12_2e_sb_08851_txt.indd 627 08/08/18 7:55 pm
▻ Investigate the use of gene therapy in the treatment of non-infectious disease and the associated
ethical and scientific debates.
▻ Design and construct a model, different from the one used in Investigation 18.4, to demonstrate the
process of accommodation in the mammalian eye.
▻ Research the use of cell therapy to genetically modify a patient’s immune cells to recognise and kill
cancer cells.
▻ Create a presentation that explains the reasons that cancer is so hard to study and cure.
▻ Discuss the use of cell lines in scientific research and the importance of correct identification of these
lines in ensuring the validity of scientific studies.
▻ Investigate the development and use of the different types of ‘bionic eye’ used to restore sight to
individuals who have visual disorders.
▻ Research the creation and uses of blood stem cells to treat and cure diseases.
▻ Compare the changes in the leading causes of death over the past 20 years in both developed
and developing regions of the world. Present your information in digital form, which could include
interactive graphs and maps.
▻ Design and produce a large classroom poster to summarise the adaptations exhibited by ectotherms
to allow them to function in an environment with widely fluctuating temperatures.
▻ Investigate a non-infectious disease that interests you, including the cause, symptoms, treatment,
occurrence in different regions of the world and any possible preventative measures. Create an
interactive web page or other form of digital media to present the information about this disease.
628 MODULE EIGHT » NON-INFECTIOUS DISEASE AND DISORDERS 9780170408851
18_bio_InFocus12_2e_sb_08851_txt.indd 628 09/08/18 10:31 am
GLOSSARY
A alimentary canal the hollow tube along anther the top part of a stamen, the male
which food passes from the mouth to the reproductive organ in a flower; produces
abscission when parts of plants naturally
anus, including the oesophagus, stomach pollen
detach, e.g. dead leaves, ripe fruit
and intestines anthropological genetics branch of science
abundance the number of individuals in a
allele variant of a gene that combines components of population
population
allele frequency a measure of how
genetics with historical, archaeological
accommodation the process by which and linguistic evidence to determine the
common an allele is in a population
the lens of the eye changes shape to focus pathways of human evolution
light on the retina from objects at different alternation of generations the alternation
of sexual and asexual reproduction as a antibiotics a group of substances that kill
distances
normal part of a plant’s life cycle; involves bacteria or slow their growth
accurate having the true value
a sexually reproducing, gamete-bearing antibody (immunoglobulin) a type of blood
action potential a change in the electrical generation alternating with an asexually protein produced by the immune system in
potential (membrane potential) of an axon reproducing spore-bearing generation response to a specific pathogen; its function
as an impulse (electrical signal) travels along is to neutralise the pathogen
ambient relating to the surrounding
the axon
environment (e.g. ambient temperature) anticodon three unpaired bases at one
active acquired immunity immunity end of tRNA that attach the tRNA to
amoeba a single-celled organism that
developed naturally or artificially through its complementary bases on the mRNA
can change its shape by extending and
a person being exposed to a live pathogen strand
retracting parts of its cell membrane
and developing a primary immune response
antigen a molecule capable of inducing an
(developing antibodies) amylase an enzyme in saliva that converts
glycogen and starch to simple sugars immune response
adaptation a characteristic (or genetic
antimicrobial agent a substance that
change) that an organism possesses that anaemia a condition caused by deficiency
of iron in the diet, resulting in pale skin, kills microorganisms or stops them from
increases the survival and reproductive
weakness, unusual tiredness, apathy, reproducing, e.g. antibiotics, antivirals,
chances of that organism in its environment
low resistance to cold temperatures and antifungals, antiprotozoals
adaptive immunity also known as the
difficulty breathing when exerting the body antiviral medication medication used to
third line of defence, involves the reactions
anaerobe (facultative anaerobe) able
control viral infections; it does not kill the
of lymphocytes to the presence of a
to live and reproduce in an atmosphere virus but inhibits its development
pathogen
containing no oxygen anvil (incus) the middle bone of the ossicles
adipose tissue fat tissue
analytical study the statistical analysis of
in the middle ear that is fused with, and
adrenal cortex the outer portion of the transmits sound vibrations to, the stirrup
data to test a specific hypothesis
adrenal gland
apomixis a form of asexual reproduction in
androgens male hormones that control
adrenal gland gland situated above the plants in which new plantlets are produced,
the development and functioning of
kidney and composed of two parts – the often on leaves, without fertilisation or the
the male sex organs and secondary sex
medulla and the cortex involvement of a seed
characteristics
adrenal medulla the inner region of the apoptosis programmed cell death
aneuploidy when one or more extra copies
adrenal gland
of an entire chromosome are made or an aqueous humour a clear, runny fluid
adult stem cell pre-specialised cell that entire chromosome is missing, leading to between the cornea and the lens of the eye
occurs in almost every type of tissue, and an abnormal number of chromosomes in array comparative genomic hybridisation
has lost the ability to divide by mitosis the cell (aCGH) a genetic engineering technique
aerobe only able to live and reproduce in an angiogenesis the development of new used to test a single cell taken from an
atmosphere that contains free oxygen blood vessels embryo
agent a pathogen that causes disease animal husbandry the science of breeding artificial insemination a technique
age-standardised rate an incidence and caring for farm animals whereby sperm are transferred from a
measure calculated as if the population had anorexia nervosa severe undernutrition
male to the vagina of a female without
a standard age structure characterised by psychological disorders, copulation to introduce desirable
excessive weight loss and a distorted body characteristics from one male to the
agriculture the science and practice of offspring of one or more females
farming plants and livestock image
artificial pollination the deliberate transfer
aldosterone hormone produced by anterior the front area of a structure
of pollen from the anther of a flower on
the adrenal cortex that increases the anthelmintic a class of antiparasitic drugs one plant to the stigma of a flower on the
reabsorption of sodium ions and decreases used to treat internal parasites such as same or another plant, to ensure desirable
the reabsorption of potassium ions in the flukes, roundworms and tapeworms characteristics are selected
kidney
630 9780170408851
20_bio_InFocus12_2e_sb_08851_glo.indd 630 23/07/18 3:48 PM
asbestosis disease caused by the inhalation B biological fitness the measure of an
of asbestos fibres causing an inflammatory individual’s reproductive success, calculated
bacteraemia the presence of bacteria in the
reaction in the lung tissue, leading to as the average contribution to the gene
blood
scarring and stiffening of lung tissue. This pool made by a certain genotype within a
makes the process of breathing much bacteriophage a virus that infects bacteria population and the relative likelihood that
harder, and decreases oxygen uptake into and reproduces inside them those variants of a gene will be represented
the blood bar graph also known as a column graph; in future generations
ascertainment bias a form of information a type of graph used when items have been biological mutagen a mutation agent in the
bias in which all members of the study grouped into unrelated categories; the form of a virus or bacterium or some other
group are not followed up to the same columns do not touch living organism
extent barrier an obstacle that prevents the entry bivalent a homologous pair of
asexually not involving the fusion of of a substance or object chromosomes aligned in early meiosis that
gametes basal plate a modified stem reduced to a form synapses or chiasmata for crossing
asexual reproduction reproduction short disc over
involving only one parent and no sex cells base substitution when one nucleotide bladder the storage organ for urine before it
or gametes, resulting in offspring that are base is replaced by a different base, which leaves the body
genetically identical to each other and to the may result in a different amino acid being bleached describes the state of opsin and
parent inserted into the polypeptide retinal molecules when they dissociate so
assimilation the conversion of simple basilar membrane a membrane below the that no further light stimuli can be detected
molecules into more complex molecules organ of Corti that pushes up onto the organ blind spot an area on the back of the eye
that then become part of the structure of of Corti when a sound wave moves through where all the nerve fibres leave the eye and
cells the perilymph converge to form the optic nerve
ataxia lack of muscle coordination, leading behavioural relating to the way an blood-brain barrier a semi-permeable
to difficulty in walking organism acts membrane that separates circulating
atherosclerosis ‘hardening of the arteries’, benefit anything that provides an advantage blood from the fluid that bathes the central
in which fatty deposits on the inner walls of nervous system
the arteries hinder blood flow benign tumour a non-cancerous tumour
whereby the cancer cells remain within the bone conduction implant an implanted
auditory nerve nerve that carries boundary of the tumour and do not spread microphone that converts sound into
electrochemical impulses from receptor to other body tissues vibrations in the skull that are transferred
cells in the cochlea to the brain directly to the inner ear by bone conduction,
beriberi disease resulting from prolonged bypassing the outer and middle ear; this
autoclave a chamber that uses heat and deficiency of vitamin B1 in the diet of
high pressure to sterilise equipment exposed technology is used to assist in conductive
children; results in retarded growth, hearing disorders
to potential pathogens weakened heart muscle, loss of appetite,
confusion, inflammation of the nerves, poor bottleneck effect genetic drift that occurs
autoimmune disease a disease in which
the body produces antibodies against its coordination, tingling and paralysis as a result of a natural disaster
own tissues bi-allelic describes a gene that has two Bowman’s capsule a spherical, hollow, cup-
autonomic the involuntary branch of the variants or two possible alleles within a like structure in the nephron of the kidney
nervous system population (e.g. T and t for height) that receives filtrate from the glomerulus
binary fission an asexual reproduction bradykinin a compound (peptide) released
autosomal dominant inheritance a
pattern of inheritance in which an affected process that involves the division of into the blood to cause smooth muscle to
individual has one copy of a mutant gene a eukaryotic cell into two, typical of contract and blood vessels to dilate
and one normal gene on a pair of autosomal unicellular organisms such as bacteria Bt cotton a transgenic insect-resistant plant
chromosomes and the mutant gene is bioactive compound a compound that has genetically engineered by Monsanto; the
expressed a biological effect plant produces a protein that is toxic to
autosomal recessive inheritance a
bollworm
biofilm a slimy layer formed by a group of
pattern of inheritance in which an affected microbes adhering to each other and to a budding an asexual reproductive process
individual must have two copies of a mutant surface where part of adult organism divides by
gene for it to be expressed mitosis and produces a small bud, which
bioinformatics the science of collecting separates from the parent and grows into a
axillary bud an embryonic shoot located in and analysing complex biological data
the axil of a leaf, which has the potential to new individual
such as genetic codes using software tools
form branches for understanding biological data; a mix bulimia nervosa a condition caused by
axon single, very long extension of the of science, statistics, computer science, psychological, environmental and cultural
cytoplasm of the cell body that conduct biology, mathematics and engineering factors where the sufferer is fixated on body
messages away from the cell body; axons image and demonstrates abnormal eating
biolistics the technique of mechanically behaviours, including binge eating followed
form the ‘white matter’ of the CNS delivering DNA on microscopic particles by self-induced purging
into target tissues and cells by ‘firing’ them
from a gene ‘gun’
9780170408851 GLOSSARY 631
20_bio_InFocus12_2e_sb_08851_glo.indd 631 21/07/18 12:01 PM
burden the number of individual parasites cerebrovascular disease atherosclerosis of chromosome a DNA molecule containing
carried by a host the cerebral arteries the genetic material that codes the inherited
bush medicine traditional medicine; checkpoint inhibitor a type of drug that
characteristics of an organism
the knowledge and skills used to apply blocks normal proteins on cancer cells and ciliary body a circular structure in the eye,
remedies, usually made from plants acts as a type of ‘off switch’ that helps keep the consisting of ciliary muscles and suspensory
T cells from attacking other cells in the body ligaments
C chemoreceptor a cell or organ that detects ciliate any single-celled organism with hair-
calyces cup-shaped cavities in the kidney the concentration of certain chemicals like structures on its surface for locomotion
through which urine from the collecting inside the body and food gathering
ducts flows before collecting in the pelvis chemotactic factor a chemical that causes cladode photosynthetic stem
campaign a range of strategies used to try chemotaxis cleavage the division of cells in the early
to reduce the incidence of disease chemotaxis the movement of substances or embryo, or in unicellular organisms and
capsid a protein shell that protects a virus cells in response to a chemical signal protists undergoing binary fission
carcinogenic cancer-causing chemotherapy the use of chemical cloaca a single common opening for the
carcinoma a cancer that forms in the
substances or pharmaceuticals to treat products from the digestive, reproductive
epithelial tissue, such as the skin or the disease and urinary tracts of all vertebrate classes
tissue that lines or covers the internal chiasmata the points at which the arms
except mammals
organs of a bivalent meet when chromatids wrap cloning making an exact or identical
cardiac arrest heart failure resulting
around each other during crossing over copy
in loss of heart function, breathing and chitin a fibrous substance that is the major clostridial bacteria a class of bacteria that
consciousness constituent of fungal cell walls are Gram-positive and spore forming, e.g.
carrier an individual who is not affected by choroid the middle layer of the eye; the rear
tetanus
a defective allele, but may pass it on to his portion is black to reduce the scattering or clot a thick mass of coagulated liquid, often
or her children; an organism that is infected reflection of light in the eye blood; also called a thrombus
with a pathogen but shows no external chromatid one copy of a newly copied cochlea fluid-filled inner part of the ear;
signs chromosome that is still joined to the other contains receptors that convert sound
case-control study study based on a copy by a single centromere waves into electrical impulses
comparison of individuals or subjects where chromatin a complex of macromolecules cochlear implant hearing technology
one group has the disease and the other found in non-dividing cells, consisting of that converts sound waves into electrical
group (control group) does not DNA, protein and RNA impulses sent to an electrode array
cataract clouding of the lens in the eye, chromosomal deletion a mutation that
implanted in the cochlea, stimulating the
reducing the transmission of light arises when a section of DNA is removed nerve endings
cell body part of the nerve cell that contains and not replaced, leading to a decrease in coding DNA DNA that codes for products
the nucleus, cytoplasm and many organelles the number of genes on a chromosome such as proteins
cell cycle a repetitive sequence of cell chromosomal insertion (duplication) coding strand (antisense strand) the
division and enlargement, including mitosis a mutation that arises when a portion strand in a DNA molecule that is not used as
cell junction and intercellular ‘bridge’
of DNA is duplicated and inserted into a a template during transcription, but its base
formed by the plasma membranes of chromosome, increasing the number of genes sequence corresponds to the base sequence
adjacent cells, enabling contact between on the chromosome – its effect depends on of the mRNA transcript produced (but
the cells the size, location and number of repeats with thymine replaced by uracil); contains
chromosomal inversion a mutation where
codons
cell-mediated response an immune
the reverse order of a sequence of bases codominance a condition where both
response involving cytotoxic T cells that
eliminates intracellular pathogens arises in a chromosome, caused by a section alleles in a hybrid are expressed (neither
of DNA being removed, turned around allele is dominant or recessive)
cellulose a substance that makes up plant and then re-inserted into the chromosome codon a triplet or sequence of three bases
cell walls; a complex carbohydrate (usually during replication) on DNA or mRNA that codes for a single
central nervous system the brain and chromosomal mutation (chromosomal amino acid
spinal cord aberration) a large-scale change in genetic
cohort study a study of a group of
central nervous system cancer cancer material where either the overall structure individuals (cohort) over a period of time to
that originates in the brain or spinal cord of the chromosome is changed, or the entire see who develops a particular disease
number of chromosomes in a cell is altered
centromere the part of a chromosome collecting duct the last site of the tubules
that holds together newly formed sister chromosomal translocation a mutation
of the nephron; contains water, and
chromatids that arises when a section of DNA is nitrogenous and other wastes that remain
moved from one chromosome to a non- after the processes of filtration, reabsorption
cerebral haemorrhage leakage of blood
homologous chromosome (and may involve and secretion
into the brain tissue
gene fusion)
632 GLOSSARY 9780170408851
20_bio_InFocus12_2e_sb_08851_glo.indd 632 21/07/18 12:01 PM
colonisation resistance the means by control centre a region of the brain (e.g. the cytokines a group of proteins secreted by
which the normal intestinal bacteria hypothalamus) that maintains homeostasis certain cells of the immune system; play
protect themselves from colonisation by by receiving messages from receptors and a role in cell signalling by affecting nearby
pathogens sending messages to effectors to respond to cells
column graph see bar graph
and counteract a stimulus until the set point cytokinesis the process following mitosis,
is re-established during which the cytoplasm divides,
commensal relating to or showing
commensalism, whereby the organism controlled kept constant separating the daughter nuclei from one
benefits from another organism without controlled variable a variable that is kept
another
affecting it constant so it does not interfere with the
outcome of the experiment D
communicable disease a disease that can
be transferred from one organism to another convex lens lens that is thicker at the damage-associated molecular patterns
centre than at the edges; used to correct (DAMPs) molecules that are released
community hygiene measures taken when tissue is damaged and stimulate the
to prevent the build-up of pathogens in hyperopia
inflammatory response
a community, e.g. sewage and garbage cornea the transparent structure of the
disposal sclera that covers the iris, pupil and anterior daughter chromosome a chromatid that
chamber of the eye has separated from its sister chromatid
complement system a group of during cell division
plasma proteins in the blood that are coronary related to the heart
activated by antibodies or pathogens deforestation the clearing of a wide area of
corpus albicans a mass of fibrous tissue in trees
and enhance (complement) the the ovary formed by the degeneration of the
immune response corpus luteum if the egg is not fertilised deletion loss of genes from a chromosome
concave lens lens that is thinner at the dendrite an extension of the cytoplasm
corpus luteum the Latin term for ‘yellow
centre and thicker at the edges; used to body’, which refers to the large mass of of a nerve cell body; receives messages in
correct myopia vacuolated cells made up of lutein, in a the form of impulses from other axons and
concurrent happening at the same time follicle of the ovary conducts these nerve impulses towards the
cell body; form the ‘grey matter’ of the CNS
conductive hearing loss hearing loss due to cortex (renal) outer region of the kidney
a problem with the mechanical conduction dendritic cell an antigen-presenting cell of
corticosteroids (glucocorticoids) a class of the immune system
of vibrations from the outer and middle ear steroid hormones that are sometimes used
to the cochlea to treat inflammation dendron a single, elongated dendrite found
cones photoreceptors in the retina that in sensory neurons
corticosterone hormone that works with
detect colour cortisol to regulate the immune response dependent variable a variable that changes
confounding factor, confounding variable and suppress inflammatory reactions during an experiment as a result of the
variable that influences both the dependent experiment; it is the observed or measured
countercurrent exchange exchange of outcome that depends on other factors that
and independent variables heat from the warm blood in the arteries have been changed in the experiment
congenital present at birth ( flowing from the heart towards the
extremities) to the cooler blood in the veins depth study an investigation or an activity
conjunctiva the mucous membrane that completed by a student or students to
covers the front of the eye and lines the (coming back from the cold extremities),
warming this blood before it returns to the explore more deeply a topic from the Year 12
inside of the eyelids Biology course that they find interesting
heart
contact lenses corrective lenses used derived data data that is deduced from raw
instead of spectacles and worn directly in Cri du chat a rare genetic disorder that
results from the deletion of a specific section data by mathematical manipulation, such as
contact with the eye graphs, algebraic equations and geometric
of chromosome 5
continuity of species the ongoing survival constructions
of species as a result of characteristics cross-infection the transfer of pathogens
between people, animals and equipment dermatophyte fungal pathogen that lives on
being passed from parents to offspring in a the skin, nail or hair
continuous lineage crossing over (synapsis) the process
during which the arms of a bivalent wrap dermis the deeper layer of skin between the
continuous breeder an organism that epidermis and the subcutaneous tissue or
is sexually active all year and in which around each other
hypodermis
female fertility occurs in a repeating cycle culture patterns of human behaviour, such
throughout the year; humans are an as language, customs, beliefs and values descriptive study a study based on
example describing characteristics, trends and
cystic fibrosis an inherited disease patterns without making a causal link
continuous variation variation within caused by a mutation of the cystic fibrosis
a population where a trait is distributed transmembrane conductance regulator desiccation a state of extreme dryness
on a continuum and extends from one (CFTR) gene on chromosome 7 dialysate the fluid that passes through
extreme to another (rather than cystitis inflammation of the bladder’s
an artificial kidney that has the same
increasing in discrete units); an example internal lining concentration as blood plasma without the
is height metabolic wastes
9780170408851 GLOSSARY 633
20_bio_InFocus12_2e_sb_08851_glo.indd 633 21/07/18 12:01 PM
diarrhoea loose watery stools that are educational program program that endospore a tough structure surrounding
passed more frequently than usual educates the public about the effects of some bacteria that protects the bacterium
diploid having two sets of chromosomes,
a disease, risk factors and strategies to from environmental stresses during
or double the haploid number of prevent the disease dormant periods
chromosomes, within any cell effector muscle or gland that carries out a endothelium, endothelial cells the single
discontinuous variation variation within a
response layer of cells that line organs and cavities
population that falls into discrete categories; efficacy the degree to which a treatments
in the body, such as blood vessels, heart,
an example is ‘pigment or no pigment’ produces the desired result lymphatic vessels
endotherm an organism that maintains
disease any condition that impairs the electrochemical impulse the form in
normal functioning of a living thing which messages are transmitted through body temperature within a narrow range
nerves; made up of electrical impulses and of tolerance limits despite variations in the
distal tubule tubule in the kidney, after the ambient temperature
loop of Henle, where all required substances chemical messengers
endotoxin a toxin released by a bacterial cell
are reabsorbed into the bloodstream electromagnetic radiation a form of energy
that comes from the sun and is found all when it disintegrates
distribution where the population of a
around us, such as radio waves, microwaves enucleation removal of the nucleus of a cell
species is spread within an ecosystem
and gamma rays enzootic endemic in an animal population;
DNA deoxyribonucleic acid; the hereditary
electromagnetic spectrum (EM regularly infecting animals in a certain
material of an organism in the form
of a molecule that carries the genetic spectrum) the overall range of wavelengths region
instructions used in growth, development, of electromagnetic radiation enzyme a biological catalyst that increases
functioning and reproduction electronic cigarette (e-cigarette) a battery- the rate of a chemical reaction in the body
DNA mismatch repair the process of a
powered device that forms an aerosol that is epidemic the widespread occurrence of
repair enzyme recognising a mismatched inhaled into a person’s lungs an infectious disease in a community at a
base pair during DNA replication, then electroporation the use of an electrical particular time
excising the incorrect base and replacing it current to increase the permeability of the epidemiologist a person who studies
with the correct base nuclear membrane temporarily, to allow disease in a population (as opposed
DNA polymerase III an enzyme that adds
DNA to enter the nucleus to someone who studies disease in an
DNA nucleotides during DNA replication e-liquid liquid in an e-cigarette that is individual organism)
DNA profiling (DNA fingerprint analysis)
changed into an aerosol epidemiology the study of the distribution
a technique used to identify and compare embryonic diapause a delay in the and determinants of health-related states
individuals based on characteristics in their development of an embryo until conditions or events (including disease) and the
DNA are favourable, as a strategy to increase the application of this study to the control of
DNA primase an enzyme that catalyses the
chances of survival of the young diseases and other health problems
synthesis of RNA segments called primers embryonic stem cell cell separated from epidermis the outer layer of skin cells
DNA repair gene a gene involved in DNA
the embryo and cultured separately epigenetics changes in an organism caused
repair, for example by coding for proteins emesis vomiting by changes to gene expression rather than
that stop the cell cycle while other proteins empirical able to be verified by evidence
alteration of the genetic code itself
remove damaged regions of DNA and gained through observation and epithelial tissue, epithelium a thin tissue
replace them with the correct sequence experimentation that forms the outer surface of the body and
DNA sequencing the process of the inner lining of the digestive system and
endocrine gland gland that secretes
determining the exact nucleotide sequence hormones directly into the bloodstream other hollow structures
(order of bases A, T, G and C) of a gene on a epitope the part of an antigen that is
chromosome endocytosis the taking in of molecules by a
cell, by making a fold in the cell membrane recognised by the immune system
domain one of three main categories and forming a vacuole epizootic a disease of the animal (non-
(eukaryotes, bacteria, archaea) into which human) population
all living organisms are currently classified endogenous having an internal cause or
origin euploidy where there is a gain of one or
dominant describes a trait that is expressed more complete sets of chromosomes,
(appears) in a heterozygous individual endogenous pyrogen a molecule produced
by leukocytes in response to pathogens resulting in a chromosome number that is
dysphagia difficulty with swallowing that increases the set point for body an exact multiple of the haploid number
dysphonia inability to speak (or bark, in temperature, inducing a fever eutherian a placental mammal; the young
dogs) endometrium the lining of the uterus
complete their embryonic development
inside the uterus of the mother, following
E endoparasite a parasitic organism that lives internal fertilisation
within the host organism
ectoparasite a parasitic organism that lives evaporative cooling a means of cooling the
on the outside of the host organism body, whereby water evaporating from the
body removes heat
634 GLOSSARY 9780170408851
20_bio_InFocus12_2e_sb_08851_glo.indd 634 21/07/18 12:01 PM
exon a sequence of bases in DNA and fovea a depression in the macula of the eye genetic diversity the total of
in mature mRNA that is translated into that contains densely packed cones and is all the genetic characteristics in
proteins, once introns have been removed the area of greatest visual acuity the genetic make-up of a species
from the initial pre-mRNA transcript frameshift mutation a mutation in which genetic drift a change in allele frequency
exotic not native to a certain region the reading frame of mRNA is shifted, so due to random chance
experimental study a study in which
that triplets of bases that normally form genetic engineering the intentional
individuals are randomly allocated to groups codons are no longer grouped together, manipulation of genetic material to alter the
and the investigator decides which group is resulting in a gene being translated genetic makeup of an organism
to receive the intervention unnaturally from the position of the
mutation onwards genetic marker an identified sequence of
external fertilisation fertilisation (uniting DNA at a known site on a chromosome
fruit the fleshy part of a plant that contains
of the nuclei of a sperm and an egg) that genetic recombination genetic variation
occurs outside the body seeds and develops from the ovary
caused by crossing over and random
extracellular space the fluid that bathes G segregation in meiosis and recombination
the outside of cells of paternal and maternal genes within each
gamete special sex cell that carries genetic gamete
F information from both parents to the
offspring genetic stability the consistent passing
faecal egg count also called a worm test; on of genetic information from parent to
used to estimate the parasite burden in an gametogenesis the process in which offspring, with little or no change, over time,
animal by counting eggs per gram of dung gametes are produced in the reproductive in the sequence of genes in chromosomes or
organs of nucleotides in DNA
falsifiable able to be disproved
gastroenteritis inflammation of the genetic variability the tendency of
feedlot a form of primary industry where stomach and intestines; causes diarrhoea
cattle are fattened before slaughter individual genetic traits in a population to
and vomiting vary
fertilisation the process that occurs when gene the basic unit of heredity; each genetic variation differences in various
the haploid nucleus of the egg fuses with gene consists of a segment of DNA with
that of the sperm, forming a fertilised egg genetically determined traits or features
nucleotide bases in a specific sequence, and among members of a population
called a zygote forms part of a chromosome
genome the complete set of genetic
fibrin a fibrous protein involved in clotting gene cloning the process of producing material within a cell or that an organism
fibrous proteins proteins that form a long identical copies of a gene has in each of its cells
chain, are insoluble in water and a structural gene expression the conversion of genome-wide association study (GWAS) a
component of protoplasm in cells and of DNA into a product such as protein; the
tissues study that involves using computer software
genetic instructions given to a cell to to rapidly scan identified genetic markers
fidelity of replication the exact copying create its structure and ensure its correct across complete sets of DNA, or genomes,
of the sequence of bases in DNA during functioning of many people to find genetic variations
replication to ensure the accuracy of gene flow when new individuals enter a associated with a particular disease
heredity and gene expression population, or existing individuals leave, genomics the field of study concerned with
filtration a process in the kidney whereby which may result in a change in allele sequencing the nucleotides of complete sets
only substances that are small enough pass frequency of genes in organisms
through the walls of the capillaries of the gene mutation a mutation that affects only
glomerulus into the Bowman’s capsule, while genotype the combination of genes that an
a single gene organism has
larger molecules remain in the capillaries
gene pool all the alleles of all the genes in a genotyping the identification of genetic
firewall in computing, a system designed to breeding population
limit the spread of a computer virus variations in individuals
gene regulation the mechanism controlling genus a classification category between
flagellate any single-celled organism with a the ‘switching on’ and ‘switching off ’
whip-like tail, e.g. Euglena family and species
of genes to increase and decrease the
production of gene products (protein or germline cell a cell that gives rise to
follicle stimulating hormone (FSH) a
reproductive hormone that causes sperm RNA) gametes
production in men and follicle development in gene technology the manipulation of germline mutation (gametic mutation)
women, causing an egg to mature in an ovary; genetic material (DNA) to create products a mutation that occurs in the sexual
it also stimulates ovaries to secrete oestrogen for human use reproductive cells (germline cells) that give
fomite an object or material that is able
rise to gametes and can be passed to every
gene therapy the transfer of a normal cell in the offspring
to carry infective pathogens, e.g. surfaces, gene into an individual to correct a genetic
clothes, bedding disorder globular protein a protein, usually
founder effect genetic drift that occurs
spherical, compact and soluble in
genetic disease a disease caused by water; often transports proteins, such as
due to a few individuals in a population mutation of a gene or a chromosome
becoming geographically isolated from the haemoglobin in blood
original population
9780170408851 GLOSSARY 635
20_bio_InFocus12_2e_sb_08851_glo.indd 635 21/07/18 12:01 PM
glomerular filtrate the substance that haplotype network a diagrammatic homeostasis the maintenance by an
passes through the walls of the capillaries representation of the genetic diversity organism of a relatively constant internal
of the glomerulus in the kidney and moves within a group state, regardless of external changes in the
into the Bowman’s capsule Hardy–Weinberg principle a principle
environment
glomerulus a spherical network of based on the idea that the frequency of homologous pair a pair of chromosomes
capillaries inside the Bowman’s capsule of alleles in a population remains constant in a cell (two chromosomes and four
the kidney from one generation to the next if none of chromatids), with one chromosome
glucagon a hormone produced by alpha
the evolutionary influences (e.g. mutation, coming from each parent, where the two
cells in the pancreas; stimulates the sexual selection, genetic drift, gene flow) are chromosomes carry alleles for the same
production of glucose acting genes
healthy worker bias a form of selection homozygous having identical alleles of
goitre enlargement of the thyroid gland
resulting in a visible lump in the throat; bias in which participants in a study are a particular gene in a diploid cell, for any
caused by prolonged iodine deficiency generally healthier than those who do not particular hereditary characteristic (e.g. TT
participate or tt)
gonad a male or female reproductive organ
hearing aid a form of technology used to horizontal transmission viral spread
that produces gametes
magnify sound vibrations to better enable through individuals of the same generation
gonadotropic hormones (gonadoptropins) their transmission to the middle and
hormones produced in the hypothalamus hormone a chemical substance that acts as
inner ear a messenger in the body, coordinating many
and pituitary gland that stimulate the
gonads, or sex glands, to carry out their helicase an enzyme that causes the DNA different aspects of functioning, including
reproductive or endocrine functions helix to unwind and the strands to separate, metabolism and reproduction, so that
to allow for replication actions within the body are synchronised
Graafian follicle an enlarged, dominant
helminth a parasitic worm human papilloma virus (HPV) a virus
follicle that pushes to the surface of the
ovary and creates a bulge during the herd immunity a form of protection given to
linked to cervical and other cancers
follicular phase individuals in a population, both vaccinated humoral response an immune response
Gram-positive/negative classification of
and unvaccinated, against infectious involving the release of antibodies by
bacteria into two categories, based on the disease when a significant proportion of the plasma cells
way a sample looks under the microscope population has been vaccinated hydrocortisone (cortisol) a hormone that
when stained by the Gram stain technique; heredity the passing of characteristics or regulates how the body manages stress
the stain differentiates between the cell traits genetically from one generation to the and how it converts carbohydrates, fats
walls of certain bacteria next and proteins to energy; also plays a role
granuloma a ‘wall’ formed by immune cells hermaphrodite in animals, having both
in regulating cardiovascular function and
to separate a pathogen from body tissues male and female reproductive organs on the blood pressure
same individual, sometimes termed bisexual hyperopia an eye condition in which distant
granzymes chemicals that cause lethal
damage to bacteria; found in cytoplasmic heterozygous hybrid
objects are seen clearly, but near objects are
granules of certain lymphocytes out of focus; longsightedness
hibernation an extended period of inactivity
hypertension high blood pressure
in response to cold, where the body
H temperature does not drop below 30°C, but hyphae (sing. hypha) the branching
haemodialysis a process in which blood is the heart rate and oxygen consumption filaments that make up the mycelium of a
removed from the body and passed through drop considerably multicellular fungus, such as mould
an artificial kidney to remove urea and other hilum the curved indentation of the kidney hypodermis the tissue beneath the dermis
wastes where the blood vessels enter and leave the of the skin
hair cells receptor cells in the organ of kidney and the ureter leaves the kidney hypothalamus a region in the lower central
Corti, in the inner ear, that convert the histamine a nitrogenous compound part of the brain that is an important
kinetic energy of a sound wave into a nerve involved in allergic and inflammatory control centre for maintaining homeostasis
impulse when they are bent against the reactions; causes smooth muscle to contract
tectorial membrane by pressure from the hypothesis a tentative prediction or
and capillaries to dilate explanation of an observation, usually based
basilar membrane
histogram a graph similar to a column on an existing model or theory
hammer (malleus) the first of the three graph but which has columns that do
ossicles in the middle ear; touches the touch each other because they represent I
eardrum and transfers vibrations to the continuous numerical data
anvil immune system the organs and tissues that
histone a protein found in eukaryotic cell provide resistance to infection
haploid having one complete set of nuclei that packages and orders the DNA
chromosomes within a cell immunisation the process by which an
into structural units individual’s immune system is prepared to
haplotype a group of genes that are histopathology the study of changes in challenge a specific pathogen in advance
inherited together on a particular tissues caused by disease or injury of exposure, making a person immune to a
chromosome from one parent disease
636 GLOSSARY 9780170408851
20_bio_InFocus12_2e_sb_08851_glo.indd 636 21/07/18 12:01 PM
immunoglobulin any protein present in the interferon a signalling protein released in isoproteins proteins that have a similar
blood that functions as an antibody response to the presence of a pathogen, structure and/or function but are not
immunoglobulin A (IgA) an antibody found
particularly viruses identical; produced through the alternative
on the mucus membranes that protects interleukin a protein involved in the
splicing of mRNA
them against infection proliferation of lymphocytes during an
immune response K
immunotherapy treatment that uses
certain parts of the immune system to help internal fertilisation fertilisation (uniting kidney an organ containing millions of
protect against infection or disease of the nuclei of a sperm and an egg) that nephrons, responsible for the excretion of
occurs inside the body urea and osmoregulation; made up of three
inbreeding the breeding of closely related main regions: cortex, medulla and pelvis
organisms over many generations interneuron a neuron within the CNS that
transmits signals between sensory and Koch’s postulates criteria for establishing
incidence (of disease) the probability of a causative relationship between a
occurrence of a disease in a population at motor neurons
microorganism and a disease
any one time interoceptor a receptor that detects
internal stimuli related to homeostasis kwashiorkor a disease caused by a severe
inclusion bodies non-living particles lack of protein in the diet and resulting
inside a cell, commonly virus particles in interphase a stage of the cell cycle that in failure to grow, enlarged liver, hair
cytoplasm; used to diagnose some viral precedes mitosis, during which the cell changes, apathy, irritability and increased
infections prepares for division susceptibility to infectious diseases
incomplete dominance a condition in intervention study a study based on
which a gene is expressed as a blending of comparing individuals or subjects, where L
the characteristics of the two alleles present one group has received the intervention, lacrimation flow of tears
in a hybrid (neither allele is dominant or and the other group has not
recessive) lactogenic hormone hormone secreted by
interviewer bias a form of information bias the pituitary gland in females; acts on breast
incubation period the time that elapses in which the interviewer indirectly leads tissue to prepare for and maintain milk
between exposure of a person to a pathogen study participants to reply to questions in a production
and when symptoms first become apparent certain way
lagging strand the strand in a DNA
independent variable the variable that intraocular lens implantation (IOL) the molecule on which nucleotides are added
is controlled or manipulated by the removal of a cloudy lens and the insertion of in chunks, called Okazaki fragments, from
experimenter an artificial lens the replication fork backwards, and in which
induced mutation a mutation caused by a intravascular space the fluid inside blood replication is discontinuous, with fragments
mutagen (a chemical or biological agent or vessels being joined by ligase to form a continuous
some form of radiation that causes a change strand
intron a sequence of bases that is removed
in DNA structure) from pre-RNA after transcription, so a lameness difficulty walking due to injury to
infectious disease any disease caused by a continuous sequence of coding bases a leg or foot
pathogenic organism remains in mature RNA for polypeptide LASIK surgery a surgical technique that
inflammation a reaction to the presence
production; also the corresponding non- uses lasers to change the curvature of the
of an antigen, in which tissues become hot, coding nucleotide sequences in DNA cornea to correct myopia and hyperopia
red, swollen and painful in vitro fertilisation (IVF) a process in leading strand the strand in a DNA
influencers individuals or companies on
which an egg is fertilised by sperm outside molecule in which replication is continuous,
social media who can drive conversations the body and on which nucleotides are added in a
and influence others iodopsins the three different types of visual long chain, growing in the same direction as
pigments responsible for detecting colour; the replication fork opens up
information bias errors in recording
measurements or information; affects the each cone contains one iodopsin legislation laws made by parliament
validity of research results ion an electrically charged atom lens a biconvex, transparent, highly elastic
innate immunity the non-specific immune ionising radiation a harmful type of structure in the eye that changes shape to
system, including the first two lines of radiation, which has enough energy to break refract light
defence (e.g. physical barriers to entry, chemical bonds in molecules, including lens capsule a clear, membrane-like, elastic
phagocytes, inflammation) DNA structure that encloses the lens of the eye
inner segment part of a rod or cone iris a ring of muscle that forms the coloured lesion any abnormal change or damage to a
(receptor cell) in the eye that connects the part of the eye and controls the size of tissue or an organ
outer segment of the cell to the conducting the pupil to regulate the amount of light
part of the cell entering the eye leukaemia a cancer that forms in the bone
marrow and other blood-forming tissues
insulin hormone produced by beta cells that ischaemic heart disease atherosclerosis of
causes glucose in the blood to be removed the coronary arteries levy a tax imposed by the government
intellectual property a created work where islets of Langerhans groups of cells that Leydig cells cells in the seminiferous
the work’s creator has the sole right to make make up the endocrine portion of the tubules of the testes that make
a commercial profit from it pancreas testosterone
9780170408851 GLOSSARY 637
20_bio_InFocus12_2e_sb_08851_glo.indd 637 21/07/18 12:01 PM
lifestyle disease a disease that is a direct macula an area at the back of the eye, in the menopause the cessation of reproductive
result of the way in which individuals live centre of the retina, where incoming light is capacity in women, triggered by decreased
their lives received sensitivity of the ovaries to FSH and LH
ligand a protein that attaches (binds) major histocompatibility complex (MHC) menses the start of the menstrual cycle,
to a receptor protein that has a specific a set of cell surface proteins required to also known as the menstrual period; lasts
complementary site into which the recognise antigens; found in vertebrates about four days, during which time the
ligand fits malignant tumour an abnormal growth
endometrium breaks down and tears away,
ligase the enzyme that seals together the of cells (cancer) that is not confined by a accompanied by bleeding
two strands of newly replicated DNA boundary and spreads to other tissues in menstrual cycle a cycle of changes in
ligation the rejoining of pieces of DNA using
the body the uterus, required for preparation of the
the enzyme DNA ligase malnutrition an imbalance in the diet that
uterus for pregnancy
leads to undernutrition or overnutrition menstruation bleeding caused by the
limit of reading the smallest unit of
measurement on a measuring instrument management care and attention given to
breaking down and tearing away of the
an individual suffering from a disease endometrium during menses
line graph a type of graph used to show the
meristem tissue in plants that can divide to
relationship between continuous variables mange skin condition caused by mite
infestation form any other tissue
line of best fit a straight line that is fitted to
mesothelioma a form of cancer that occurs
a graph of data points mannan a plant polysaccharide that occurs
in some plant cell walls in the membrane surrounding the lungs
literature review a report and evaluation
messenger RNA (mRNA) an intermediate
of information from secondary sources on a marasmus a disease in which the sufferer
topic of interest is extremely underweight and has lost most molecule that carries a transcribed copy of
of their subcutaneous fat; they are very relevant instructions from the nucleus to
locus (pl. loci) a segment of DNA; the the ribosomes in the cytoplasm; it is single-
position of a gene on a chromosome weak and susceptible to infection, and if
untreated can die from starvation or heart stranded and not twisted into a helix
logbook the record of an experiment attack metastasis the spread of cancer cells from
or investigation kept by the scientist the primary site to another part of the body
performing the experiment; it is a legal marsupial a mammal whose young
record of the experiment and its results develop internally for a short time, then microbiology a branch of science dealing
continue their embryonic development in a with microorganisms
loop of Henle part of the tubule that is in parental pouch microbiome beneficial bacteria that inhabit
the medulla of the pelvis; plays a role in
osmoregulation maternal inherited from the mother the human body
(referring to, for example, chromosomes) micro-injection a process used to deliver
loss to follow up bias a form of information
bias in which not all subjects who began the mature mRNA the molecule that DNA into egg cells when creating transgenic
study are available at the end of the study results from the splicing of mRNA after species
transcription and the removal of introns micturition urination; release of urine from
luteinising hormone (LH) a reproductive
hormone that causes testosterone measurand the quantity being measured the bladder
production in men and development of the measurement bias a form of information misclassification bias a form of
corpus luteum after ovulation, as well as bias in which inaccurate measurements are information bias in which some subjects are
lactation, in women made already suffering from the condition but are
luteinising phase the phase after ovulation, medulla the middle region of the kidney
undiagnosed at the beginning of the study
when the burst follicle in the ovary enlarges mispairing the insertion of incorrect
meiosis a type of cell division that halves
and changes colour, building up a yellow the chromosome number and gives rise to nucleotides opposite a template strand of
protein called lutein gametes that transmit genetic material from DNA during replication
lymphocyte white blood cell involved in the one generation to the next during sexual missense mutation a point mutation that
adaptive immune response reproduction results in an amino acid change; the type
lymphoid tissue that is involved in the melanoma a potentially deadly form of
of replacing amino acid will determine the
defence against pathogens, e.g. spleen, skin cancer originating in the melanocytes functionality of the protein
thymus, lymph nodes (melanin-producing cells) mitochondrial DNA (mtDNA) a small,
lymphoma a form of cancer that originates memory T cell T lymphocyte capable of
circular DNA molecule found in the
in the lymphatic system and cells of the responding to a specific antigen long after respiratory organelles (mitochondria)
immune system primary exposure of cells; can be used to trace maternal
inheritance
lysis destruction of a cell wall or membrane menarche the commencement of ovarian
mitosis the part of the cell cycle during
and menstrual cycles during puberty
M which active nuclear division takes place,
meningitis an inflammation of the to ensure that replicated chromosomes
macrophage a large phagocyte found at the membranes (meninges) that cover the brain separate and are equally distributed to the
site of tissue inflammation and spinal cord daughter cells
638 GLOSSARY 9780170408851
20_bio_InFocus12_2e_sb_08851_glo.indd 638 21/07/18 12:01 PM
mitotic index the ratio of the number of mutation an unusual error in DNA non-nuclear DNA DNA that is located
cells in a population undergoing mitosis, to replication, involving incorrect base pairing, not in the nucleus but in organelles in
the total number of cells in a population which leads to a change in the DNA base eukayotic cells, such as the mitochondria
mobility migration within a population
sequence and chloroplasts
mycelium the main fungal body of nonsense mutation a mutation that
model a representation of a system or
phenomenon that explains the system multicellular fungi; formed from changes an amino acid to a stop codon, with
or phenomenon; may be mathematical hyphae a very noticeable effect on a protein as it
equations, a computer simulation, a physical mycosis a disease caused by a fungus
cuts it short; the resulting protein is usually
object, words or another form non-functional
myeloma a malignant tumour of the bone
notifiable describes a category of infectious
modern synthesis a combination of marrow
the concepts of Mendelian genetics and diseases that must be reported to
myopia when a person can see near authorities by law; examples are measles in
Darwinian evolutionary theory, in the objects clearly, but distant objects appear
modern understanding of evolution humans, foot and mouth disease in cattle
blurred; shortsightedness
nucleoid a dense region in the cytoplasm of
monoculture the cultivation of a single
species of crop in a given area N prokaryotic cells
nucleotides simple repeating units
monogenic describes a disease that is natural reservoir a population in which a
controlled by a single gene pathogen naturally lives comprising a simple sugar, a phosphate and
a nitrogenous base, which make up nucleic
monosomy the condition in which the total naturally occurring mutagen a mutagenic acids, and which may be linked together
number of chromosomes is one less than agent that is present at normal levels within to form single chains, as in RNA or double
the normal diploid number natural environments, that may cause strands, as in DNA
monotreme a mammal that lays eggs
mutations
rather than bearing live young; examples are negative feedback mechanism a body O
platypus and echidna system in which a response is initiated to obligate when an organism is restricted
morbidity the number of people affected by
counteract a stimulus and return internal to a particular environment or way of life;
a disease conditions to the set point, maintaining for example, an obligate anaerobe cannot
homeostasis survive in an oxygenated environment
mortality the number of people who die
from a disease nephron the functional unit of the kidney observational study study based on
that removes urea and balances salt and collecting qualitative data through
mortality rate the number of deaths due to water levels in the blood observation
a particular disease in a specific time period
(usually one year) neurotoxin a poison that acts on the occlusion blockage
nervous system
motor neuron a nerve cell that transfers oedema swelling caused by fluid retention
messages from the CNS (brain or spinal neutral mutation a change in DNA that
does not significantly affect the structure or oestradiol the main form of oestrogen
cord) to effectors such as muscles or glands
functioning of the protein product oestrogens the main group of female
mucous membrane a membrane that lines hormones; control the development and
an internal cavity in the body neutrophil the most common type of white
blood cell, involved in phagocytosis of functioning of the female reproductive
mucus plug a plug that fills and seals the pathogens and other small particles system and secondary sex characteristics
cervix during pregnancy oestrus the period of female fertility in
non-biological mutagen a naturally
multi-allelic describe a single-gene trait for occurring mutagen in the environment that animals, commonly referred to as the animal
which there are three or more alleles, such originates from non-living matter, such as being ‘in oestrus’, ‘in season’ or ‘on heat’
as in ABO blood groups metals off-label use the use of a pharmaceutical
multifactorial involving a number of causes non-coding DNA DNA that contains
for an unapproved application, age, dose
or factors sequences that are excised from RNA or route of administration in an animal or
and do not code for products such as plant
Multiregional hypothesis (MRE) the
theory, based mostly on fossil evidence, that proteins oncogene a type of gene that can cause
all human populations can be traced back to non-coding strand (sense strand)
uncontrolled production of cells (cancer)
when Homo erectus first left Africa, about 2 a strand of DNA that serves as a template and prevents cell death
million years ago during mRNA transcription; its sequence opportunistic affecting those who are
mutagen an environmental agent that of bases is the same as those of the immune suppressed
alters DNA, causing mutations anticodons on tRNA (but with thymine opsin a protein that is combined with
replaced by uracil) retinal to form a visual pigment
mutagenesis the process of inducing a
mutation non-disjunction incorrect separation of
opsonisation an immune process whereby
chromosomes during cell division an antigen is marked for destruction by
mutagenic mutation an error in DNA
replication arising as a result of the exposure non-infectious disease disease that immune cells (phagocytes)
of cells to environmental factors such as is not caused by a pathogen and is not
radiation or chemicals contagious
9780170408851 GLOSSARY 639
20_bio_InFocus12_2e_sb_08851_glo.indd 639 21/07/18 12:01 PM
optic nerve the nerve that carries messages oxytocin a hormone that promotes the perennating organ an underground organ
from the receptors in the retina of the eye to coordinated contraction of the smooth such as a root or stem that contains stored
the brain muscle of the uterus and the softening of food and buds which will grow if the organ
optometrist person who specialises in eye
the cervix, so a baby can be born is split, in a form of asexual reproduction,
health ensuring survival in adverse conditions
P perforin a protein released by killer cells in
organ of Corti a structure in the middle
canal of the cochlea containing receptors in pancreas an organ that includes an the immune system that perforate (punch
the form of hairs that convert vibrations into endocrine portion that releases the holes in) pathogens
electrical impulses hormones insulin and glucagon perilymph the fluid in the upper and lower
osmoreceptor a specialised cell in the parasitic describes an organism that canals of the cochlea
hypothalamus that detects changes in obtains its needs from another organism perinatal the time shortly before and after
osmotic pressure while offering no benefit in return birth
osmoregulation the maintenance of parathyroid gland a small gland embedded peripheral nervous system all the nerves
optimal levels of salt and water in the in the thyroid gland that releases throughout the body that are not part of the
bloodstream parathyroid hormone CNS
ossicles the set of small bones in the parathyroid hormone hormone secreted peritoneal dialysis a process in which
middle ear that magnify vibrations from by the parathyroid glands and responsible wastes in a person’s blood are filtered out
the eardrum and transfer these to the oval for increasing the amount of calcium in the through the peritoneum of the person’s
window blood when levels are too low abdomen
osteomalacia a disease in adults caused by parthenogenesis a form of asexual personal hygiene steps taken by a person
a lack of vitamin D, resulting in skeletal and reproduction involving a female parent only, to maintain cleanliness of their body
muscular problems resulting in young that are genetic clones of
their mother pesticide a substance used to kill pests; may
osteoporosis thinning of the bones be an insecticide (kills insects), fungicide
passive acquired immunity immunity that (kills fungi) or herbicide (kills weeds)
outer segment part of a rod or cone develops when antibodies are introduced
(receptor cell) in the eye that contains the into the body, without the person being Peyer’s patches lymphoid tissue found in
visual pigments exposed to a pathogen directly the gut
outlier a data point that is distant from the pasteurisation the process of heating phagocyte a type of white blood cell that
other data points in the sample a liquid to destroy any disease-causing engulfs and digests other small cells and
oval window a membrane that separates bacteria particles
the middle ear from the fluid-filled inner ear patent a licence issued to the inventor of phagocytosis the process by which a
(cochlea) a novel method or technology; prohibits phagocyte engulfs and destroys a foreign
ovarian cycle a series of changes in the others ( for a specific time) from making or particle
ovary of a female mammal, during which selling the invention phenotype the physical appearance of an
the follicle matures, the ovum is shed and paternal inherited from the father organism, as determined by its structure,
the corpus luteum develops (referring to, for example, chromosomes) behaviour and physiology
ovary the female reproductive organ where pathogen any organism that causes disease phenylalanine an amino acid found in
eggs are produced; in flowers, protects the in another some proteins
fertilised and developing ovules and grows phenylalanine hydroxylase an enzyme
to become a fruit pathogen-associated molecular patterns
(PAMPs) molecules associated with certain required for the first step in the breakdown
oviparous describes animals in which the pathogens that are recognised by the cells of of the amino acid phenylalanine
embryo develops inside an egg but outside the immune system phenylketonuria (PKU) a genetic
the female’s body disease caused by mutation of the gene
pathogenicity the ability of an organism to
ovo-viviparous describes animals in which cause disease on chromosome 12, which codes for the
the embryo develops within an egg inside enzyme phenylalanine hydroxylase (PAH)
the mother’s body, and hatches before being patient zero the initial patient in an
infectious disease outbreak pheromone chemical substance released
born alive by an organism such as an insect, that has
ovulation the release of an ovum (egg) by a pedigree chart a universally accepted an effect on another organism, including
mature follicle in an ovary graphical representation, in scientific sexual attraction
format, of the inheritance of a particular
ovule a plant structure inside the ovary genetic trait over a number of generations photophobia sensitivity to light
of a flower, containing an egg cell and photoreceptor a receptor cell in the eye
developing into a seed when fertilised peptide bond a chemical bond that
holds together the amino acids in a linear that is stimulated by light energy
oxidative burst the rapid release of reactive sequence or polypeptide chain phyllode photosynthetic leaf stalk
forms of oxygen (e.g. hydrogen peroxide)
from certain cells peptidoglycan the substance that forms physiological relating to the way an
the cell walls of many bacteria organism’s body functions
640 GLOSSARY 9780170408851
20_bio_InFocus12_2e_sb_08851_glo.indd 640 21/07/18 12:01 PM
pie graph a circular graph that shows polypeptide chain a long chain of nitrogen- probiotics microbes that are believed to
fractions of a whole; also known as a sector containing amino acids, of which proteins provide health benefits when ingested
graph are made up progesterone the most common
pinna the fleshy part of the outer ear; directs polysaccharide capsule an extra slime progestogen; the hormone that plays a
sound waves into the auditory canal layer on some bacterial cells that protects primary role in pregnancy and stimulates
pituitary gland an endocrine gland situated
them from the environment the secretion of milk in mammary glands
just below the hypothalamus that secretes population genetics the study of how the progestin synthetic form of progesterone
a number of hormones that regulate other gene pool of a population changes over time, progestogen a generic term for a group of
endocrine glands, including ovaries and leading to a species evolving female hormones that have a progestogenic
testes posterior back area of a structure effect, e.g. progesterone
placebo a treatment with no active
poultice a soft mass of material applied to prokaryotic describes a unicellular
property, usually a sugar pill the body to relieve soreness and swelling organism that lacks a membrane-bound
plaque a hard, calcified substance nucleus
precise what measurements are called
deposited on the walls of blood vessels that when they are close to each other prolactin a lactogenic hormone that acts
reduces the elasticity of the arteries and on breast tissue to prepare for and maintain
blood flow pre-implantation testing procedure used
to test a single cell taken from a three-day- milk production
plasmid a small ring of non-chromosomal old embryo for mutated genes prior to promoter a region of DNA that initiates
DNA that floats separately in the cytoplasm implantation transcription of a particular gene
of prokaryotic cells and replicates
independently of the chromosome premonition protection from severe prophylactically given to prevent infection
infection by a pathogen due to a chronic by a pathogen
platelet also called a thrombocyte; a cell low-grade infection by the same pathogen
that helps in the formation of a clot to stop prostaglandin a hormone secreted by
bleeding pre-mRNA mRNA transcribed from DNA, the wall of the uterus to initiate labour;
in eukaryotic cells, before further editing dilates blood vessels and inhibits platelet
plumule a young stem that grows from a takes place in the nucleus to produce aggregation
plant embryo and produces green leaves for mature mRNA
food production prosthetic group (cofactor) a non-protein
prenatal during pregnancy; before birth part of an enzyme to which conjugated
pluripotent in relation to stem cells, capable proteins are attached
of dividing and giving rise to any type of prevalence (of disease) the proportion of a
tissue particular population affected by a disease protease an enzyme that breaks down
at any one time proteins and peptides
point mutation a change to a single base
pair of DNA, affecting only a single gene prevalence/incidence bias a form of protein a large molecule made up of
selection bias in which only current cases polypeptide chains, formed by sequences
polarised describes the state of a are included in a study, excluding those who of amino acids linked together by peptide
membrane when the inside of the have died or recovered bonds, and which contains the chemical
membrane is negative relative to the outside elements nitrogen, carbon, hydrogen and
of the membrane prevention efforts to stop the occurrence of
disease oxygen
pollen a fine powdery substance
proteomics the large-scale study of sets
comprising pollen grains, produced by the primary data data that you have measured
or collected yourself of proteins produced in an organism or
anthers; contain the male gametes of seed biological system to establish how the
plants primary immune response the first proteins in a variety of cell types work
pollination the transfer of male gametes response of the immune system when together
(pollen) from the anthers of one plant to the exposed to a pathogen
proto-oncogene a gene that codes for
stigma of the same or another flower so that primary industry any industry that gathers proteins that stimulate cell growth and
fertilisation may occur raw materials for energy or consumer mitosis
polygenic describes a trait that is coded for products, e.g. mining, agriculture
proximal tubule tubule close to the
by two or more genes, with each gene having primary lymphoid tissue sites in the Bowman’s capsule in the kidney, through
its own set of alleles lymphatic system where lymphocytes which substances required by the body are
polymerase chain reaction (PCR) a develop, such as bone marrow reabsorbed into the bloodstream
technique used to make multiple copies of primary structure the basic structure of pseudoscience a belief that is mistakenly
a segment of DNA, in order to increase, or a protein, arranged as polymers of amino regarded as being based on scientific
amplify, the amount of DNA available in a acids in linear chains method
sample to be studied
primary tumour area in the body where the pupil the hole in the centre of the iris, where
polymorphism when individuals have initial malignant tumour develops light enters the eye
different phenotypes, usually arising as a
primer a short strand of RNA that attaches
result of mutation; when are different forms
to the DNA to allow synthesis to be initiated
of the same gene
during DNA replication
9780170408851 GLOSSARY 641
20_bio_InFocus12_2e_sb_08851_glo.indd 641 21/07/18 12:01 PM
purebreeding homozygous, such as in a recombinant DNA DNA that is made up of reproductive technology technology
pair of individuals with identical alleles for DNA from more than one genome (such as artificial pollination, artificial
a gene who will therefore always produce relaxin a hormone that aids the softening of
fertilisation and cloning) used to bring
offspring of the same phenotype for that the cervix during childbirth about reproduction or increase the breeding
gene success of an individual
reliable giving the same results within
pyrexia-fever when a person’s body research question the specific question
experimental uncertainty
temperature increases above its set point that a particular experiment or investigation
renal artery an artery carrying blood with a is designed to answer
pyrogen a substance that produces a fever high urea concentration into the kidney
when released into the blood reservoir any substance or tissue that is a
renal capsule a tough, fibrous, fatty layer source of pathogens that can cause further
Q surrounding the kidney infection
quarantine a public health measure renal dialysis a process in which response action taken by a tissue or organ
based on restricting the movement of technology is used to remove urea and to counteract a stimulus and return the
people, plants and/or animals through excess water from the body when kidney body system to the set point
ports of entry to a country, to prevent or function is insufficient to do this
restriction enzyme a type of enzyme made
limit the spread of pests and contagious renal pelvis an area in the centre of the by bacteria that can cut DNA molecules at
diseases kidney into which urine from the collecting specific places
quasi-experimental study an empirical ducts drains
retina a thin membrane covering the
study of cause and effect in a population, renal pyramids cone-shaped areas of tissue rear portion of the eye and containing
without random assignment of subjects in the medulla of the kidney, consisting of photoreceptors
quaternary protein structure the three- tubules that transport urine from the outer
part of the kidney to the calyces retinal (retinene) a molecule derived
dimensional structure of a protein made up from vitamin A that is one part of a visual
of two or more polypeptide chains ( folded renal vein vein carrying blood with a low pigment
or pleated) that are linked to create a concentration of urea out of the kidney to
complex but very specific shape return it to the heart retinitis pigmentosa a disease in which the
rods and cone cells in the eye degenerate
Replacement hypothesis (Out of Africa gradually
R
hypothesis, Eve hypothesis) the theory
radiation any transfer of energy that archaic Homo sapiens left Africa and a retrotransposon inserted viral RNA
through space from a source, such as second migration out of Africa happened reverse-transcribed back into DNA
electromagnetic radiation from the sun; (in about 100 000 years ago, and that modern retrovirus virus that contains RNA
treatment) the use of radiation to treat a humans of African origin conquered archaic rheotaxis a response to a stimulus in
disease groups and replaced them by interbreeding which the cell (or organism) swims into an
radicle a young root that grows from a with and out-competing them oncoming current
plant embryo to absorb water and soil replication fork the structure formed by the
rhizome an underground horizontal
nutrients partial separation of the DNA double helix modified stem that can split for asexual
random error an error that is unpredictable during DNA replication reproduction
and has an inconsistent effect on reproducibility the extent to which the
rhodopsin a visual pigment contained in
measurement within a study same result can be obtained, within the rod cells of the eye
rate of immunisation the proportion of uncertainty, when repeated measurements
are made ribosomal RNA (rRNA) molecule that
people within a population who have been
forms a structural part of ribosomes and is
vaccinated against a particular disease reproducible giving the same result, within made in the nucleolus of the cell
raw data original data taken directly from a uncertainty, when repeated measurements
are made ribosome a cell organelle responsible for
measurement system
protein synthesis (translation of mRNA into
reabsorption the process by which reproduction the ability of an organism to a polypeptide chain)
substances required by the body move from produce offspring, ensuring the continuity
of life rickets a disease in children caused by a
the tubules of the kidney back into the
lack of vitamin D in the diet and resulting in
capillaries by diffusion or active transport reproductive cloning a type of cloning defective calcification of bones, retardation
recall bias a form of information bias in capable of producing a whole organism of growth and deformities of the skeleton,
which subjects’ ability to recall information that is identical to the donor organism; also such as bowed legs
varies known as whole-organism cloning
RNA polymerase an enzyme that attaches
receptor a group of sensory cells within the reproductive success an organism’s ability to a DNA template strand and begins
body that detect a change in a particular to produce fertile offspring that survive assembling a complementary strand of RNA,
component of the internal environment to reproductive maturity and produce in a process known as transcription
offspring of their own, in this way replacing
recessive describes a trait that is hidden or the parent rod a photoreceptor (light-detecting) cell in
masked in a heterozygous individual the retina of the eye
642 GLOSSARY 9780170408851
20_bio_InFocus12_2e_sb_08851_glo.indd 642 21/07/18 12:01 PM
round window a membrane in the middle secondary structure the three-dimensional sex hormone a hormone that specifically
ear that vibrates in conjunction with the arrangement of polypeptide chains created affects the growth or functioning of the
oval window, allowing fluid in the cochlea by folding or pleating reproductive organs or the development of
to move, which then converts the vibration secondary tumour a tumour that develops
secondary sex characteristics
into a nervous signal that goes to the brain from cells that have travelled from a primary sex linkage when genes are located on the
runner a long, thin modified plant stem tumour to a different part of the body sex chromosomes and code for characteristics
that grows along the surface of the soil secretion part of the process of moving
other than the gender of individuals
and gives rise to new plantlets by asexual toxic substances (e.g. urea, creatinine) from sex-linked inheritance the inheritance
reproduction the blood capillaries into the urine; occurs in pattern for traits that are located on the
the renal tubules of the nephron genes of the sex chromosomes and therefore
S may be inherited in different ratios in males
sector graph see pie graph
sampling bias a form of selection bias in and females; appears more frequently in
which the choice of subjects for a study does seed a plant ovule containing an embryo, males (linked to the X chromosome) or in
not reflect the population being studied which is capable of developing into another males only (linked to the Y chromosome).
plant
saprophytic describes organisms that live sexual reproduction reproduction
on dead, decaying organic matter selection bias a form of bias that results involving two parents, who produce
in selection of data or subjects not being offspring that contain a mix of the parents’
sarcoma a cancer that forms in the random
connective tissue or muscle, such as bone or genes and therefore differ from each other
blood vessels selective breeding a form of artificial and from the parents
selection by humans deliberately selecting short tandem repeats (STR) short
scaffold the dense protein centre of the and mating organisms with specific
nucleoid of a prokaryotic cell around which sequences of DNA, consisting of 2 to 5 base
characteristics pairs, that are repeated
the circular DNA of the chromosome is
super-coiled. sense organ an organ with receptors silent mutation a mutation involving
concentrated in particular areas, such as the changes in the DNA sequence that do not
scatter plot a graphical representation of eye or the ear
the relationship between the individual data cause a change in amino acid and therefore
points of two variables sensorineural hearing loss a form of have no effect on the proteins formed
hearing loss resulting from damage to or single nucleotide polymorphism (SNP)
scientific method a systematic process malformation of the inner ear, including parts
of observation, experimentation, a variation (change in form) resulting from
of the cochlea, hair cells or auditory nerve a single different base (adenine, thymine,
measurement and analysis to either support
or disprove a hypothesis sensory neuron neuron that carries signals cytosine or guanine) present at a particular
from sensory cells in the peripheral nervous locus on DNA in the genome of at least one
sclera an opaque, tough protective coat system to the CNS per cent of the individuals in a population.
that surrounds the eye
septicaemia also called blood poisoning; sister chromatids newly replicated
scurvy a disease caused by lack of vitamin when bacteria or their toxins enter the chromatids still joined by a single
C in the diet, resulting in poor wound bloodstream centromere
healing, joint pains, bleeding gums, bones
sequencing finding the exact nucleotide SI units International System units of
that do not grow or heal and spontaneous
haemorrhaging sequence of a certain length of DNA measurement; includes seven base units
from which other units are derived: metre
seasonal breeder a mammal whose serotonin a compound in platelets that
(length), kilogram (mass), second (time),
reproduction is limited to certain times of constricts blood vessels
kelvin (temperature), ampere (electric
the year, during breeding seasons, and who serotype a group or strain within a species current), candela (luminosity) and mole
mates only during periods of female fertility of microorganism, with the same cell (quantity of a substance)
secondary data data or information that surface antigens
skin the soft, outer covering of vertebrates
has been collected by someone other than set point the ideal or normal value for a
Socratic seminar a group discussion
you specific internal condition
format where students help each other to
secondary immune response the response sex chromosomes chromosomes that understand ideas, issues and values
of the immune system when it is exposed to carry genes that determine the sexual
somatic cell a body cell (non-reproductive
a pathogen on subsequent occasions characteristics of a person and influence
cell), containing two sets of chromosomes
secondary sex characteristics features whether the individual is female or male
somatic cell nuclear transfer (SCNT) a
that appear during puberty in humans and sex determination the way in which sex
at sexual maturity in other animals, as a type of reproductive cloning that involves
chromosomes separate during meiosis and
result of the production of sex hormones, three animals: egg donor, nucleus donor and
gamete formation and then recombine
but are not directly part of the reproductive surrogate
during fertilisation to determine whether
system; examples include deepening the offspring will be male or female somatic mutation change in a DNA
of the voice and hairiness in males and sequence that occurs in somatic (non-sexual)
development of mammary glands in cells and may affect only part of an organism
females. spermatogenesis production of sperm
9780170408851 GLOSSARY 643
20_bio_InFocus12_2e_sb_08851_glo.indd 643 21/07/18 12:01 PM
spontaneous generation the theory that suspensory ligaments ligaments in the thyroxin an iron-containing hormone
living organisms appear from inorganic eye that connect the ciliary muscles to the responsible for controlling metabolic rate
matter lens tolerance limits upper and lower levels
spontaneous mutation a natural error symptom a feature of a disease that is of specific conditions in the internal
arising randomly during DNA replication apparent to a patient environment of the body
sporangia (sing. sporangium) specialised synapse a small gap between the axon of torpor short-term hibernation where the
tips of hyphal threads that develop into one neuron and the dendrite of an adjacent body temperature drops below 30°C, and
microscopic spores neuron metabolism, heart rate and respiratory
spore a unicellular reproductive cell, the syndrome a group of symptoms that occur
rate decrease, accompanied by a reduced
product of sexual or asexual reproduction together and characterise a particular response to external stimuli
in fungi and some prokaryotes, mosses disease trait a particular physical feature or
and ferns; dispersed in large numbers and systematic error/bias a consistent,
characteristic of an organism
can develop into a new organism under repeated error; it may be caused by faulty transcription the process of making RNA
favourable conditions. measuring equipment or bias in the design from a DNA template by the enzyme RNA
sporozoa any protozoan that can form or conduct of a study polymerase
reproductive cells known as spores, e.g. systemic acquired resistance a whole- transcription factor a protein that controls
Plasmodium spp. plant response that occurs following which genes are transcribed
stem cell an unspecialised cell that is infection with a pathogen transduction a method of introducing
capable of dividing and becoming any type foreign DNA into a cell using a viral vector;
of specialised tissue T the virus is injected into the bloodstream or
sterilise to remove any living target cells cells that possess receptors for delivered by aerosol into the human subject
microorganisms from a substance or a specific hormone that influences the cells’ transfer RNA (tRNA) a small RNA molecule
object activity twisted into the shape of a clover leaf, each
sterile microbe-free; uncontaminated targeted therapies treatments that target ‘leaf ’ of which attaches to a specific amino
sticky end a section of single-stranded DNA specific areas acid at one end and has a triplet of bases
with exposed nucleotide bases at the end of tectorial membrane the upper membrane
(an anticodon) at the other end to recognise
a double-stranded molecule of the organ of Corti, against which the hair and pair with mRNA; a vehicle of amino acid
cells are pushed when a vibrational wave transport in protein synthesis
stigma the sticky tip of the female part of a
in the perilymph pushes against the basilar transgenic species a species whose
flower, where pollen is received
membrane genome includes DNA from another species
stimulus a change in a particular condition
in the internal environment of the body; tertiary structure the three-dimensional translation the synthesis of a polypeptide
provokes a reaction by a tissue or organ shape of a protein created by attraction sequence from mRNA, with the aid of tRNA,
between folded and pleated polypeptides on a ribosome
stirrup (stapes) – the last of the three
ossicles in the middle ear; passes vibrations test cross the breeding of an organism translocation a chromosomal abnormality
to the oval window that has a dominant trait with an organism resulting when a section of one
that shows the recessive form of the trait, chromosome joins to a chromosome in a
stocking density the number of grazing and analysis of the ratios of the offspring different homologous pair
animals per hectare of land at any one phenotypes, to determine whether the
time transpiration the evaporation of water in a
dominant organism is homozygous or plant through the stomata in a leaf
structural relating to the physical heterozygous for that trait.
characteristics of an organism transposon transposed DNA (also
testosterone an androgen (sex hormone) known as ‘jumping genes’ or transposable
succulent a plant with adaptations for secreted by cells in the testes; plays a elements); a DNA sequence that
surviving dry conditions, such as fleshy primary role in the production of sperm spontaneously moves from one location
stems or leaves that can swell and retain tetrad the four haploid daughter cells on the genome to another and disrupts
moisture resulting from the second part of meiosis, DNA functioning in its new location on the
sucker the modified root of a plant, which meiosis II, where the two haploid cells chromosome
gives rise to new plants created during meiosis I each divide again treatment administration of remedies
suppressor T cell T lymphocyte therapeutic contributing to the healing of (pharmaceutical, behavioural, surgical) to
responsible for blocking the action of other a disease an individual suffering from a disease
lymphocytes, to stop the immune response thermoreceptor receptor cell(s) that trisomy a genetic condition in which the
when the infection has been defeated detects changes in temperatures (stimulus) total number of chromosomes present is
surface marker a specific protein on thermoregulation regulation of body
one more than the normal diploid number
the cell membrane that identifies and temperature of chromosomes
characterises the cell as being at a particular tumour suppressor gene gene that codes
stage of specialisation thyroid gland a gland consisting of two
lobes on either side of the neck, which for proteins that slow down or stop cell
produces thyroxin growth and mitosis
644 GLOSSARY 9780170408851
20_bio_InFocus12_2e_sb_08851_glo.indd 644 21/07/18 12:01 PM
tympanic membrane the eardrum; vibrates variability the different forms of a gene viviparous describes animals in which
as sound waves enter through the auditory within a population; the total of all alleles the embryo develops inside the female
canal and transmits the vibrations to the present in the gene pool of a population parent’s body, obtaining nutrients through a
middle ear variation the differences in characteristics
placenta and is subsequently born alive
evident in individuals volunteer bias a form of selection bias in
U which volunteers who participate in the
vasoconstriction the process by which the
ultraviolet radiation that part of the blood vessels constrict (narrow), removing study have a vested interest in the condition
electromagnetic spectrum where blood from the skin surface to conserve heat being studied
wavelengths are shorter than those of visible
light, making it damaging to DNA vasodilation the process by which blood W
vessels dilate (expand), bringing blood closer
uncertainty an estimate of the range of to the skin and allowing heat to escape whole-organism cloning the production
values within which the ‘true value’ of a of an exact copy of a whole organism; also
measurement or derived quantity lies vector an insect that transmits pathogens called reproductive cloning
by biting; an example is an Anopheles
ureter tube that transfers urine from the mosquito transmitting Plasmodium, which
kidney to the bladder X
causes malaria
urethra tube that transfers urine from the xenotransplantation use of organs from
vegetative propagation a type of asexual other animals for transplantation into
bladder to exit the body reproduction in plants, in which new humans
urine liquid containing water and waste individuals arise from portions of the root,
material filtered from the blood in the stem, leaves or buds of adult individuals and xerophyte plant that lives in arid conditions
kidneys are genetically identical to the parent and has adaptations to balance the
opening of stomata for gas exchange with
vertical transmission viral spread from conservation of water
V parent to offspring
vaccination administration of a vaccine virulence factor molecule produced by a Z
vaccine a suspension that contains an pathogen that increases its effectiveness in zoonosis an infectious disease that can be
attenuated or killed pathogen or toxin invading the host and causing disease transmitted from animals to humans
that causes an immune response so that visual acuity the ability to see a clear and
immunity is conferred to the organism zygote fertilised egg
precise image
receiving the vaccine
vitreous humour a jelly-like, clear fluid
valid relating to results that are affected by between the lens and the retina; refracts
a single independent variable and hence any light and helps to maintain the shape of the
differences are due to that variable eyeball
9780170408851 GLOSSARY 645
20_bio_InFocus12_2e_sb_08851_glo.indd 645 21/07/18 12:01 PM
INDEX
Aboriginal people and aquaculture 261–2 animal husbandry 347 clostridial 319
Aboriginal protocols in medicine animal quarantine 442 immune response after primary
development 459–61 animal responses to pathogens 370–94 exposure 414–17
abundance 202 chemical defences against infection and plant diseases 348
accommodation 601–5 383–91, 394 bacteraemia 378
accuracy (depth studies) 16 components of immune system 372 bacterial disease transmission 318–19
acknowledgements 27 lines of defence 370–2 bacteriophages 328
action potential 481 microbiome 375–6 bananas, Panama disease of 349
active acquired immunity 442 physical barriers against infection bar graphs 23
active defences (plant responses to 376–9, 393 behavioural adaptations 493–4
pathogens) 266–7 physical responses to infection 380–3 benign tumours 520
adaptations in endotherms 493–7 role of lymphatic system 373–5 beriberi 517
adaptive immunity 371 animals, parental care in 39–42 bi-allelic 180
adaptive immune response 397–400, 417 animals, sexual reproduction 37–42 bias 557–8
adaptive immune system fertilisation, external/internal 37–9 bibliographies 27
chemical signalling 409 internal fertilisation and parental care binary fission 53–5
interaction of B and T cells 407–13 in animals 39–42 in bacteria 54
modelling 425–7 anorexia nervosa 518 in protists 54–5
adrenal cortex 491 anthers 44 bioactive compounds 460
adrenal glands 491 anthropological genetics 215 biodiversity and biotechnology 259,
adult stem cell 80 antibiotic production (classical 276–9, 303–4
agarose gel electrophoresis 266 technology) 263–4 bioethics 272–3
ageing and telomeres 87 antibiotic resistance 451 biofabrication 267
age-standardised rate 524 antibiotics 449–50 biofilm 319
agricultural production, causes and antibodies 397, 402–3 bioinformatics 144
effects of disease 344–54 anticodons 122 biolistics 294
Australia 345–6 antigens 372, 398 biological effects of pathogens on
plant diseases 347–50 antimicrobials 347, 447 individual plants 349–51
agricultural significance, animal diseases antisense 122 biological fitness 34
of 351–4 antiviral medications 448–9 biological mutagens 230–1
agriculture apomixis 50 biological recognition 141–2
and ancient biotechnology 261 artificial insemination 283–4, 286 biology
in Australia 344–5, 352 artificial manipulation of DNA 308–9 knowledge and understanding 6
and biotechnology 271–2 artificial pollination 284–6 nature of 2–6
and genetic technologies 299–300, asbestosis 514 as a scientific discipline 5
303–4 ascertainment bias 557 biomaterial production 267
reproduction manipulation in 72–3 asexual reproduction bionic eye 613–14
aldosterone 491 advantages of 50 biotechnology 258–79
alimentary canal 378 definition 34 ancient 259, 261–2
allele frequency 180 only one parent 48–60 and biodiversity 259, 276–9, 303–4
alleles 34, 127, 159, 255 in other organisms 52–6 classical 259, 263–4
frequency within a population 249–50 in plants 49–50 definition 259
multiple 177 assimilation 89 ethics 271–5
symbols used to represent alleles in sex- atherosclerosis 512 future 260–1
linked crosses 174 auditory nerve 592 future directions 275–6
amphibians 38–9 autoimmune diseases 314 gene 260
amylase 383 autosomal recessive inheritance 159–65 modern 259, 264–9
anaemia 517 Avery, Oswald 91 past 260
analytical studies 554–5 axon 479 present 260
ancient biotechnology 259, 261–2 and research benefits 275–6
androgens 62 B cells and adaptive immune system social implications 271–5
aneuploidy 240 407–8 uses of 270–1
animal diseases B lymphocytes 401 birds 40
of agricultural significance 351–4 bacteria birth, hormonal control of 70–1
farm animals, effects of infectious binary fission in 54 bivalent 152
353–4 classification of 317–19
646 9780170408851
21_bio_InFocus12_2e_sb_08851_indx.indd 646 23/07/18 3:23 PM
blood, infectious disease, changes in chromosomal abnormalities 509–12 cultural influences on biotechnology 306
422–4 chromosomal deletion 239 cyptosporidiosis 321–2
blood-brain barrier 378 chromosomal errors 246 cystic fibrosis 507–8
bony fish 38 chromosomal insertion (duplication) 239 cystitis 383
bottleneck effect 249 chromosomal inversion 240 cytokines 390–1, 393
bradykinin 385 chromosomal mutations 238–40 cytokinesis 82–3, 86
Bragg, Lawrence 91 chromosomal numbers (non-disjunction) cytotoxic T cells (Tc cells) 405
brain 487 246
bread making 262 chromosomal translocation 240 damage-associated molecular patterns
breast cancer genes 212–17 chromosome behaviour and genetic (DAMPS) 385
Bt cotton plants 295–6 variation 156–7 Darwin, Charles 159
budding 52–3 chromosome number 240 data
bulimia nervosa 518 chromosomes 79 analysis 21–4
bush medicines 460 sex 162 derived 21
classical biotechnology 259, 263–4 gathering 17–18
cancer 519–24 cloacas 40 primary 7
causes 521 cloning 287–92 raw 21
and genetic engineering 583 a contentious issue 291 recording 18
skin 522 effectiveness of 292 secondary 7
types of 521 and ethics 291 deforestation 346
carcinogenic 229 and genetic composition of a dendritic cells 385
carcinoma 521 population 291 dendrites 479
cardiac arrest 513 techniques 289–90 dendron 479
case-control studies 555 whole-organism cloning 287, 289–91 Dengue fever virus 419–20
cataract surgery 611–12 clostridial bacteria 319 dependent variables 16
cataracts 608 clot 382 depolarisation 482
cell body 479 coding DNA 115, 242–4 depth studies 6–12
cell communication 141–2 coding strand 122 definition 6
cell cycle 82–3 codominance 171, 174–6 hypothesis 8–9, 11–12
cell division 79–90 in animals 175–6 ideas for 28–9
DNA replication 81–2 codons 119 literature review 7, 9–12
cell junctions 378 cohort studies 555 questions 8–9, 11
cell-mediated immune response 397, column graphs 23 stages 8
404–7 commensal organisms 383 types of 7
cell signalling 141–2 communicating your work 28 why undertake? 7–8
central nervous system (CNS) 479, 487–8 community hygiene 437 depth studies, planning 12–24
cancers 521 complement system 388 accuracy 16, 19–20
centromere 84 conductive hearing loss 594–5 data analysis 21–4
cerebral haemorrhage 513 cones 605–6 data gathering 17–18
cerebrovascular disease 513 confounding factor 558 data recording 18
cheese making 262 congenital diseases 212 errors in measurement 19–20
chemical defences against infection conjunctiva 384 estimating uncertainties 20–1
382–91, 394 conservation biology applications 268–9 ethical considerations 15
complement system responses 388–9 conservation management and evaluation 17
cytokines 390–1, 393 population genetics 202 investigation 13, 15–21
fever 389, 393 contact lenses 611 logbooks 18
gastric (stomach) secretions 384 continuity of species 105–6 plan 13–14
inflammation 385 continuous breeders 61 precision 19–20
phagocytosis 386–8 continuous variation 177 reliability 16
saliva 383 controlled variables 16 result interpretation 24
sebum and sweat 383 cornea 384 risk assessment 14–15
tears 384 corticosterone 491 scientific tables 18
urine 383 countercurrent exchange 496 selecting equipment 14–15
chemical mutagens 229–30 cri du chat syndrome 511 validity 16–17
chemicals, exposure to 513–15 Crick, Francis 79, 90–7 variables 16
chemotactic factors 385 CRAAP test 10 dermis 377
chemotherapy 447 cross-fertilisation 155 descriptive studies 554
chromatids 84 cross-infection 347 diarrhoea 380
chromatin 83 cross-pollination 45 diploid 35
9780170408851 INDEX 647
21_bio_InFocus12_2e_sb_08851_indx.indd 647 23/07/18 3:23 PM
diseases DNA sequencing 194–7, 264, 266–7 epigenetics 129
in agricultural Australia 345–7, 352 Maxam-Gilbert method 195–6 epithelial tissues 376
autoimmune 314 next-generation technologies 197 epitopes 398
caused by environmental exposure Sanger method 194–5 equine influenza virus 334–5
512–15 DNA structure 90–7 equipment selection (depth studies)
caused by pathogens 314–39 Watson and Crick model 92–7 14–15
communicable 314 dominance 171 errors in epidemiological studies 557–8
definition 315 incomplete 171, 174–6 errors in measurement 19–20
genetic 507–12 dominant alleles 159 errors in mutation 103–4
historical understanding 340–2 down syndrome 510 ethical considerations
incidence and prevalence 454–7 depth studies 15
management 551 ear, the 592–8 DNA profiling 197–8
mortality rates 524–7 hearing loss 594–8 ethics
nutritional 515–19, 535, 582 structure and function 592–4 and biotechnology 271–5
treatment of 551–2 eating disorders 518 and cloning 291
see also infectious disease; non- Ebola virus (case study) 451–4 eukaryotic DNA 114–18
infectious disease; prevention of economic effects of diseases in plants 351 non-nuclear DNA 116–17
disease economic influences on biotechnology packaging 115–16
discontinuous variation 177 305 eutherians 41
distribution 202 ectoparasites 323 evaluating resources (literature review)
DNA electrochemical impulses 479 10–11
amplification 266 electromagnetic radiation 231 evaporative cooling 496
artificial manipulation of 308–9 electromagnetic (EM) spectrum 231 exons 115
coding 115, 242–4 electronic cigarettes 578–9 experimental studies 555
discovery of 90–2 electroporation 294 external fertilisation 37
effects of point mutations 236–7 embryonic stem cell 80 extracellular space 385
eukaryotic 114–18 embryo 61 eye, the 598–613
fingerprint analysis 197 embryonic diapause 41 bionic eye 613–14
instructs the formation of proteins emesis 380 structure and function 598–602
96–7 endocrine glands 488 technologies 610–13
junk 243–4 endocrine system 488–93 visual disorders 607–10
mismatch repair 103–4 endogenous pyrogens 385
mitochondrial 116 endometrium 65 faecal egg counts 323
non-chromosomal 114 endoparasites 322 falsifiable 2
non-coding 115, 242–4 endospore 319 farm animals, effects of infectious
non-nuclear 89, 116 endothelial cells 378 diseases in 353–4
and polypeptide synthesis 121 endotherms, adaptations in 493–7 feedlots 346
prokaryotic DNA 113–14, 117–18 end-products of metabolism 230–1 female reproductive system
recombining 266 enucleation 289 hormonal control 62–6
repair 103–4 environment menstrual cycle 63, 65–7
splicing 265–6 and disease transmission 434 ovarian cycle 63, 64
technologies 193–201 effects on gene expression and fertilisation and genetic variability 157–8
technology to analyse and visualise phenotype 130–6 fertilisation and genetic variation 245–6
266–7 environmental exposure , diseases caused fertilisation and new combinations of
technology to manipulate DNA 265–6 by 512–15 genotypes 155
whole-genome DNA sequencing 186 enzymes 140 fertilisation in animals, external/internal
DNA polymerase III 99 ensure exact replication of DNA 100 37–9
DNA primase 99 epidemiology 457, 541–67 amphibians 38–9
DNA profiling 197–9 benefits of studies 562–5 bony fish 38
ethical considerations 197–8 definition 542 comparison 42
DNA replication 97–105 errors in studies 557–8 staghorn coral 38
and cell division 81–2 evaluating a study 558–62 fertilisation, parental care in animals and
and enzymes 100 methods used in studies 554–62 internal 39–42
errors in mutation 103–4 patterns of non-infectious diseases birds 40
gene expression 104 542–50 mammals 40–1
importance of accuracy 103–5 Pima Indian population study 558 reptiles 39–40
outside the nucleus 89–90 treatment, management and future fermentation (classical technology) 263
process of 98–100 directions 551–4 fever 389, 393
DNA repair genes 519 epidermis 377 fibrin 382
648 INDEX 9780170408851
21_bio_InFocus12_2e_sb_08851_indx.indd 648 23/07/18 3:23 PM
fidelity of replication 103 genetic stability 105–6 healthy worker bias 557
firewall 376 genetic studies, frequency data in 183–4 heartworm 323
fleas 324 genetic technologies 281–309 helicase 98
flies 326 in agriculture 299–300, 303–4 helminths 323–4, 421
foetus 61 artificial manipulation of DNA 308–9 classification of 323
follicle stimulating hormone (FSH) 63 benefits 299–302 transmission of 323–4
food cloning 287–92 herd immunity 455
identifying microbes in 337–9 current 298–9 heredity 83
and infectious disease 438–41 industrial benefits 301 hermaphrodites 37
production (ancient technology) 262 medical benefits 300 heterozygous 159
footrot in sheep 345–6 recombinant DNA technologies 293–8 histamines 385
founder effect 249 reproductive technologies 282–6 histograms 23
frameshift mutations 236, 237–8 social, economic and cultural histones 93
frequency data in genetic studies 183–4 influences 305–7 histopathology 315
fungal disease transmission 320 genetic variability 179 homeostasis 470–504
fungal pathogens 321 and fertilisation 157–8 cooling the body 472–4
fungi 319–21, 347–8 genetic variation 105, 150–90 coordination of the mechanism 472
immune response after primary causes of 245–7 importance of 470
exposure 417–18 and frequencies of characteristics internal coordination systems 478–92
180–4 maintenance of 470–7
gametes 35, 241 genetically modified (GM) food 260 negative feedback loops 472–5
gametic mutations 241 genetically modified organisms (GMOs) negative feedback system 471
gametogenesis 61 264 nervous system 479–82
gastric (stomach) secretions 384 genetics receptors 478–9
gastroenteritis 384 anthropological 215 warming the body 474–5
Gay-Lussac, Joseph Louis 263 probability 164 water balance in plants 497–501
gene 127 problems, solving 163–5 Homo erectus 216
changing definition of a 128 terminology 160 Homo neanderthalensis 217
gene cloning 287–8 timeline of contributions by scientists homologous pair 152
gene expression 103, 113, 129 111 homozygous 159
environmental effects on 130–6 see also population genetics hormonal control
need for accurate replication 104 genome 127 breeding seasons 61–2
gene flow 249, 250 whole-genome DNA sequencing 186 female reproductive system 62–6
gene mutations 236 genome-wide association studies (GWAS) male reproductive cycle 66–7
gene pool 34, 179, 201 185–6 pregnancy and birth 68–71
gene probes 266 genomics 143, 268 hormones 488
gene regulation 113, 131 genotypes 155, 159–71, 186 and mammalian reproduction 62
during transcription process 132 germination 47 sex 61
post-transcription 132 germline mutations 241–2 and sexual reproduction in mammals
post-translation 132–3 germplasma 268 61–2
gene technology 260 giardiasis 321–2 horizontal transmission of disease 333
gene therapy 269, 294 glucagon 492 host factors and disease transmission 434
genes goitre 518 human evolution and population genetics
and phenotypic expression 128–36 gonadotropic hormones 63 215–19
to proteins 127–8 gonads 61 Human Gene Mutation Database
regulation for phenotypic expression granuloma 380 (HGMD) 212
131–3 granzymes 418–19 Human Genome Project (HGP) 193, 197
genetic change 298–9 graphs human migration theories 216–19
genetic composition of a population 291 column or bar 23 genetic evidence 216–17
genetic crosses 161 drawing and using 21–2 out of Africa 217–19
genetic drift 249 line 22 human papilloma virus (HPV) 583
genetic diseases 507–12 line of best fit 23–4 human population movement (HPM)
genetic diversity 179, 268 types of 22–3 436, 445
genetic engineering 260, 264, 295, 446–7, green technology 260 human quarantine 442
580–7 humoral response
genetic errors that threaten continuity of haploid 35 antibodies 402–3
species 106 haplotype network 205 B lymphocytes 401
genetic marker 185 haplotypes 185, 202 to pathogens in body fluid 400–4
genetic recombination 246 Hardy–Weinberg principle 252 hydrid vigor 261
9780170408851 INDEX 649
21_bio_InFocus12_2e_sb_08851_indx.indd 649 23/07/18 3:23 PM
hydrocortisone 491 saliva 383 analysing 166–7
hygiene and disease transmission 437–8 sebum and sweat 383 autosomal 163–4
hypertension 513 tears 384 patterns in population 220–1
hyphae 55 urine 383 sex-linked 171
hypodermis 377 infection, physical barriers against inheritance, autosomal recessive 161
hypothalamus 472, 487 376–9, 393 inheritance patterns 159–71
hypothesis mucous membranes 378 modelling 178
for depth studies 8–9, 11–12 mucus 378–9 modern genetics terminology 160
report writing 26 peristalsis 379 in a population 192–221
skin 377–8 innate immune responses 414
immune response sphincters 379 innate imune system 425–7
adaptive 397–400, 414 tight junctions 378 innate immunity 370
cell-mediated 404–7 infection, physical responses to 380–3 insects and plant diseases 348
Dengue fever virus 419–20 increased urination 380–1 insulin 492
innate 414 vomiting and diarrhoea 380 interferons 390
Plasmodium spp. in malaria infections wound healing 382 interlukin 390
421 infectious disease 314 internal fertilisation 37, 60
primary 399–400 Aboriginal protocols in medicine interneurons 480
secondary 399 development 459–61 interphase 82
Trichophyton rubrum (tinea) 418 and antibiotics 449–51 intervention studies 555–6
immune response after primary exposure antiviral medications 448–9 interviewer bias 557
to bacteria 414–17 changes in blood 422–4 intraocular lens implantation (IOL) 611
to fungi 417–18 clean food and water 438 introns 115
to macroparasites 421–2 controlling 457–9, 462–3 intravascular space 385
to protozoa 418–19 cultural control 459 ionising radiation 232–3
to viruses 418–19 Ebola visus 451–4 ions 481
immune system 364, 371–2 environmental management 451–4 iosproteins 125
interaction of B and T cells 407–13 and genetic engineering 446–7 ischaemic heart disease 513
modelling the innate and adaptive and hygiene 437–41 islets of Langerhans 492
425–7 incidence and prevalence 454–7
immune system, human 396–424 limiting spread 432–6 kidney, the 614–22
adaptive immune response 397–400, monitoring and control 432–3 filtration 615
417 and pesticides 445–6 loss of function 619–20
cell-mediated response to intracellular pharmaceuticals for controlling 447–51 reabsorption 615–16
pathogens 404–7 and population mobility 436, 445, removal 616
humoral response to pathogens in 455–7 secretion 616
body fluid 400–4 preventing spread 436–47, 462–3 structure and function 614–19
and pathogens 428–9 public health campaigns 445 technologies 620–1
immunisation 442, 455 secondary source investigation 536–7 klinefelter syndrome 511
immunity 395–429 quarantine 441–2, 451–4 koala populations 203–10
immunoglobulin A (lg A) 383 and vaccination 442–4 Koch, Robert 340–4
immunoglobulin 397 infectious disease, cause and transmission kuru 330–1
implantation 60, 61 312–62 kwashiorkor 517
in vitro fertilisation (IVF) 284 adaptations of pathogens 355–62
inbreeding 347 agricultural production 344–54 lacrimation 384
incomplete dominance 171, 174–6 Australian agriculture 345–7, 352 lactogenic hormone 63
independent variables 16 environmental factors 434 lagging strand 99
induced mutations 229, 236 farm animals 353–4 leading strand 99
industrial benefits and genetic factors 433–6 legislation (disease prevention) 571–2
technologies 301 host factors 434 leukaemia 521
industrial biotechnology 267 Louis Pasteur 340–4 leydig cells 66
infection, chemical defences against modes of transmission 332–4 lice 325
382–91, 392 pathogen factors 433–4 lifestyle diseases 512–13
complement system responses 388–9 Robert Koch 340–4 ligase 99
cytokines 390–1, 393 societal factors 436 ligation 293
fever 389, 393 variety caused by pathogens 314–40 limit of reading 20–1
gastric (stomach) secretions 384 inflammation 371, 385–6, 392 line graphs 22
inflammation 385, 392 information bias 557 linear lines of best fit 23–4
phagocytosis 386–8, 392 inheritance literature review 7
650 INDEX 9780170408851
21_bio_InFocus12_2e_sb_08851_indx.indd 650 23/07/18 3:23 PM
evaluating resources 10–11 meristem 80
mutagens 103, 228–35
writing a 9–12 mesothelioma 514
biological 230–1
locus 127 messenger RNA (mRNA) 120, 121
chemical 229–30
logbooks (depth studies) 18 mature 124
naturally occurring 230–1
long-sightedness 607–8 pre-mRNA 124
non-biological 230
loss to follow-up bias 557 metabolism, end-products of 230
physical 231–3
luteinising hormone (LH) 63 metastasis 521
mycelium 55
lymphatic system 373–5 microbes 231
mycoses 320
lymphoma 521 in food and water 337–9
myeloma 521
microbial contamination (Pasteur’s
macro-organisms (macroparasites) 322–4 experiments) 341–2
naturally occurring mutagens 230–1
macroparasites, immune response after microbiology 314
negative feedback loops 472–7
primary exposure 421–2 microbiome 375–6
nematodes and plant diseases 348
macrophages 385 micturition 383
nervous system 479–82
macular degeneration 609–10 Miescher, Friedrich 90
neurons 479–81
major histocompatibility complex (MHC) minerals, lack of 517–18
neutral mutations 237
molecules 404–7 miscalculation bias 557
neutrophils 385, 386–7
malaria infections 421, 456–7 mispairing 230
next-generation technologies (DNA
male reproductive cycle, hormonal missence mutations 237, 238
sequencing) 197
control of 66–7 mites 325
non-biological mutagens 230
malignant tumours 520 and plant diseases 348
non-chromosomal DNA 114
malnutrition 516 mitochondrial DNA (mtDNA) 116
non-coding DNA 115, 242–4
mammals 40–2 mitotic index 87
non-coding strand 122
mammals, sexual reproduction 60–71 mitosis 79–90, 152
non-disjunction 172, 509
female reproductive cycle 62–6 in an animal cell 85–6
non-infectious diseases 314, 505–39
fertilisation 61, 67 division of the nucleus 83–4
analysis of patterns of 542–50
hormones 61–2 role and importance of 80
cancer 519–22
male reproductive cycle 66–7 stages of 84–6
causes and effects 506–24
pregnancy and birth 60, 68–71 modern biotechnology 259, 264–9
definition 506
mannans 418 modern synthesis 159
environmental exposure 512–15
marasmus 517 monoclonal antibodies (MABs) 300
genetic diseases 507–12
marsupials 41 monoculture 347
and genetic engineering 583–4
maternal chromosomes 35 monocytes 387–8
incidence and prevalence 524–37
mature mRNA 124 monogenic disease 211
nutritional diseases 515–19
Maxam-Gilbert method (DNA monosomy 509
prevention 585–9
sequencing) 195–6 monotremes 40
secondary source investigation 536–7
measurement bias 557 mortality rates 524–7
non-nuclear DNA 89, 116
medical benefits and genetic technologies mosquitoes 326
in eukaryotes 116–17
300 motor neurons 480
nonsense mutations 237, 238
medical technology applications 269 mucus 378–9
Northern Australia Quarantine Strategy
medical uses of transgenic organisms mucus plag 378
(NAQS) 442
296–8 mucous membranes 376, 378
nucleic acids 95–6
medicine (classical technology) 263–4 multiple alleles 177
nucleoid 114
meiosis 35, 79–90, 152–5 multiregional hypothesis (MRE) 216
nucleotides 95
and genetic variation 153–4, 246 mutagenesis 229
pairing and bonding 92–3
role and importance of 80–1 mutagenic agents 229–33
single nucleotide polymorphisms (SNP)
melanoma 522, 525–34, 551–2 mutagenic mutations 103
184–7, 211
memory T cells 406–7 mutations 227–55
nucleus
menarche 64 chromosomal 238–40
replication of DNA outside the 89–90
Mendel, Gregor 159 in coding DNA 242–3
nutritional diseases 515–19, 535, 582
Mendel’s laws 161–2 definition 254
Mendel’s monohybrid cross 161 frameshift 236, 237–8
observational studies 554
Mendel’s ratios, deviations from 171–8 gene 236
oestrogens 62
meningitis 316 how they affect organisms 241–7
oestrus 61
meningococcal meningitis 316–19 induced 229, 236
Ohno, Susumo 125
menopause 64 in non-coding 243
oncongenes 519
menses 65 point 236–8
osteomalacia 517
menstruation 63 spontaneous 103, 236
osteoporosis 517
menstrual cycle 63, 65–7 types of 236–40
outlier 18, 23
9780170408851 INDEX 651
21_bio_InFocus12_2e_sb_08851_indx.indd 651 23/07/18 3:23 PM
ovarian cancer genes 212–17 Peyer’s patches 405 pollination by animals 45–6
ovarian cycle 63, 64 phagocytes 383, 386 pollination by wind 45
follicular phase 64 phagocytosis 386–7, 392 pollution prevention 267
luteinising phase 64 pharmaceuticals for controlling infectious polymerase chain reaction (PCR) 197, 287
ovary 44 diseases 447–51 polymorphisms 211
overnutrition 519–19 phenotype 128, 160 polymorphisms single nucleotide (SNP)
oviparous 39 environmental effects on 130–5 184–7, 211
ovule 44 and gene expression 129 polypeptide chain 128
oxidative burst 366 phenotypic expression polypeptide synthesis 119–28
oxytocin 70 genes and the environment 128–36 function and importance of 127–8
regulation of genes for 131–3 nucleic acids involved in 121–2
Panama disease of bananas 349 phenylalanine 509 process of 120–3
pancreas 492 phenylalanine hydroxylase )PAH) 509 population, allele frequency within a
parasitic arthropods 324–6 phenylketonuria (PKU) 508 249–50
parasitic helminths 323 pheromones 38 population, inheritance patterns 192–221
parathyroid gland 490–1 photophobia 316 flow chart 220–1
parathyroid hormone (PTH) 491 photoreceptor cells 605–7 population genetics 179–87, 201–11,
passive acquired immunity 443 physical mutagens 231–3 248–52
passive defences (plant responses to physical responses to infection 380–3, 393 and conservation management 202
pathogens) 265–7 phytoplasmas 348–9 and disease 211–14
chemical barriers 366 Pima Indian population study 558–60 and human evolution 215–19
physical barriers 365 pituitary gland 63, 489–90 inheritance patterns 220–1
Pasteur, Louis 263, 340–4 placebo 555 koala populations 203–10
pasteurisation 342 plant defences 364–70, 392–4 using large-scale to study 201–11
Pasteur’s swan-necked flask experiment active defences 366–7 Woolly mammoth extinction 202–3
343–4 passive defences 365–6 population mobility and infectious
paternal chromosomes 35 plant diseases diseases 436, 445, 455–7
pathogenicity 315 of agricultural significance 347–50 post-transcription gene regulation 132
pathogen recognition 366 biological effects of pathogens 349–51 post-translation gene regulation 132–3
pathogens 314 effects of infectious 349–51 pregnancy 60, 68–71
adaptations to facilitate their transfer social and economic effects of 351 pre-implantation genetic testing 580–2
355–60 plant quarantine 442 pre-mRNA 124
animal responses 370–94 plant responses to pathogens 364–70, prenatal transmission 333
biological effects on individual plants 392–4 prevalence/incidence bias 557
349–51 active defences 366–7 prevention of disease 569–89
celular 316–19 chemical barriers 366 educational programs and campaigns
classifying 316–27, 360–2 delayed active response (days) 367 570–80
and disease transmission 433–4 passive defences 365–6 genetic engineering 680–7
diversity of 398 pathogen recognition 366 legislation 571
effect of temperature on 390 physical barriers 365 non-infectious disease outbreaks 585–6
fungal 321 rapid active response (minutes to pre-implantation genetic testing 580–2
infectious diseases caused by 314–39 hours) 366–7 QUIT campaign 574–9
non-cellular 328–31 plant selective breeding 261, 264 primary data 7
plant responses 364–70, 392–4 plants, asexual reproduction 49–50 primary immune response 399
pyrogens chemical response to 389 vegetative propagation 49–50 primary lymphoid tissue 405
responses 392–4 plants, sexual reproduction in plants primary structure 138
Pauling, Linus 91 43–7 primary tumours 521
pedigree analysis 166–71 germination 47–8 primer 99
pedigree chart 166, 169–71 pollination, fertilisation and seed prions 330–1
penicillin 450 production 44–5 progesterone 62
peptide bonds 137 seed dispersal 46–7 progestin 62
peptidoglycan 317 plants, water balance in 497–501 prokaryotic DNA 113–14, 117–18
perennating organs 49 plasmids 114 packaging of 114
perforin 418 Plasmodium spp. in malaria infections prokaryotic organisms 317
perinatal transmission 333 421 prolactin 63
peripheral nervous system (PNS) 479 platelet 382 promoter 122
peristalsis 379 pluripotent 80, 129 pronto-oncongenes 519
personal hygiene 437 point mutations 236–8 prosthetic group 139
pesticides 445–6 pollen 44 cofactor 139
652 INDEX 9780170408851
21_bio_InFocus12_2e_sb_08851_indx.indd 652 23/07/18 3:23 PM
prostaglandins 70, 385 reproductive cloning 287 sex determination 171–4
protozoa, immune response after primary reproductive success 34 sex hormones 61
exposure 418–19 reproductive technologies 71, 268, 282–6, sex linkage 172–4
proteases 387 287 sex-linked crosses 174
proteins 128 artificial insemination 283–4 sexual reproduction 34
cell communication/signalling 141–2 artificial pollination 284–5 advantages 35
chemical structure of 137 in vitro fertilisation 284 in animals 37–42
DNA instructs the formation of 96–7 selective breeding 282–3 in mammals 60–71
function of 140–5 reptiles 39–40 meeting of two gametes 35–6
modifying 132–3 research question 9, 11 in plants 43–7
physical structure 138–9 restriction enzymes 293 short tandem repeats (STRs) 197
sensory 142–3 retroviruses 328 short-sightedness 607–8
storage 142 rheotaxis 67 silent mutations 237, 238
structural 140 rhizomes 50 single-gene abnormalities 507–9
structure of 137–9, 144–5 ribosomal RNA (rRNA) 121 single nucleotide polymorphisms (SNP)
transport 142 ribosomes 122 184–7, 211
proteomics 143, 268 rickets 517 limitations of data 186
protists, binary fission in 54 risk assessment and whole-genome DNA sequencing
protozoa 321–2 depth studies 14–15 186
classification 322 report writing 26 sister chromatids 84
transmission 321 RNA 95–6 skin (barrier against infection) 376, 377–8
psychological adaptations 495–7 modifying and processing 132 social effects of diseases in plants 351
public health campaigns 445 polymerase 122 social implications of biotechnology
Punnett square 163 and polypeptide synthesis 121–2 271–5
pure-breeding 161, 175 processing 124–5 social influences on biotechnology 305–7
pyrexia 389 rods 605–7 somatic cell nuclear transfer (SCNT)
pyrogens 389 runners (vegetative propagation) 49 289–91
somatic cells 35
quarantine 441–2, 451–4 saliva 383 somatic mutations 241
quasi-experimental studies 55 sampling bias 557 species
quaternary protein structure 139 Sanger, Fred 194 continuity of 105–7
questions Sanger method (DNA sequencing) 194–5 genetic errors that threaten continuity
for depth studies 8–9, 11 scaffold 114 of 106
research 9, 11 scatter plots 22 spectacles 610–11
QUIT campaign 574–9 science, models in 5 sperm production in the male 67
scientific discipline, biology as a 5 spermatogenesis 62
radiation 231–3 scientific method 3–4 sphincters 379
raw data 21 scientific problems, solving 6–12 spinal cord 487–8
recall bias 557 scientific tables 18 spontaneous generation 314
recessive alleles 159 scurvy 517 spontaneous mutations 103, 236
recombinant DNA (rDNA) 264 seasonal breeders 61 sporangia 55
recombinant DNA technologies 293–8 sebum 383 spores 55–6
delivering the gene 294 secondary data 7 staghorn coral 38
transgenic species 295–8 secondary sex characteristics 62 stem cells 80, 129
recombining DNA 266 secondary structure 138 sticky ends 293
red technology 260 secondary tumours 521 stigma 44
references 27 seed dispersal 46–7 stocking densities 346
relaxin 70 selective breeding 261, 264, 282–3 structural adaptations 494–5
reliability (depth studies) 16 selection bias 557 structural proteins 140
renal dialysis 620 self-fertilisation 155 suckers (vegetative propagation) 50
replacement hypothesis 216 self-pollination 45 surface markers 298
replication fork 99 sensorineural hearing loss 595 sweat 383
repolarisation 482 sensory neurons 480 symbols used to represent alleles in sex-
report writing 25–8 septicaemia 316 linked crosses 174
reproduction 34 sequencing, whole-genome DNA 186 synapses 481, 484
manipulation in agriculture 72–3 serotonin 385 synthetic biology 267
see also asexual reproduction; sexual serotypes 419 systematic errors 19, 557
reproduction sex chromosomes 62 systemic acquired resistance 367
9780170408851 INDEX 653
21_bio_InFocus12_2e_sb_08851_indx.indd 653 23/07/18 3:23 PM
T cells transposons 231 vomiting 380
and adaptive immune system 407–8 trisomy 509
cytotoxic 405 tumour suppressor genes 519 xerophytes 497
helper 406 tumours 520–1
memory 406–7 twins 129 Wallace, Alfred Russel 159
suppressor 406–7 water
target cells 489 ultraviolet (UV) radiation 231–2 identifying microbes in 337–9
tears 384 uncertainties, estimating 20–1 and infectious disease 438–41
technology undernutrition 517–18 water balance in plants 497–501
to analyse and visualise DNA 266–7 understanding, communicating your Watson, James 79, 90–7, 193
effectiveness 622–6 25–9 white blood cells 374–5
and the eye 610–13 urethra 383 white technology 260
and hearing loss 597–8 urination whole-genome DNA sequencing 186
and kidneys 620–1 increased 380–1 whole-organism cloning 287, 289–91
to manipulate DNA 265–6 tract infections 381–2 working safely (depth studies) 14–15
and visual disorders 610–13 urine (chemical defences against wound healing 382
telomeres and ageing 87 infection) 383 writing a literature review 9–12
tertiary structure 138 writing reports 25–8
test cross 165 vaccination 442–3 acknowledgements and references 27
testosterone 62 validity (depth studies) 16–17 aim 26
tetrad 81 variables in depth studies 16 appendix 28
thermoreceptors 472 vasoconstriction 474 background information 25
thermoregulation 493 vasodilation 472 conclusion 27
thyroid gland 490–1 vector transmission 334 discussion 27
ticks 324–5 vectors 322, 433 hypothesis 26
tight junctions 378 vegetative propagation 49–50 materials 26
tinea (athlete’s foot) 319–20, 418 Venter, Craig 267 methods 26
trait 127 vertical transmission of disease 333 results 27
transduction 294 virulence factors 314 risk assessment 26
transcription 122 viruses 328–9
gene regulation by modifying DNA immune response after primary xenotransplantation 298
131–2 exposure 418–19
process, gene regulation during 132 and plant diseases 348 yellow technology 260
transcription factors 129 visual disorders 607–10
transfer RNA (tRNA) 121 cataracts 608 zygote 35, 42, 60, 67
transgenic Bt cotton plants 295–6 long- and short-sightedness 607–8
transgenic organisms, medical uses of macular degeneration 609–10
296–8 technologies 610–13
transgenic species 264, 295–8 vitamins, lack of 517
translation 114, 122–4 viviparous 39
transpiration 497 volunteer bias 557
654 INDEX 9780170408851
21_bio_InFocus12_2e_sb_08851_indx.indd 654 23/07/18 3:23 PM
21_bio_InFocus12_2e_sb_08851_indx.indd 655 23/07/18 3:23 PM
21_bio_InFocus12_2e_sb_08851_indx.indd 656 23/07/18 3:23 PM
21_bio_InFocus12_2e_sb_08851_indx.indd 657 23/07/18 3:23 PM
21_bio_InFocus12_2e_sb_08851_indx.indd 658 23/07/18 3:23 PM
ANSWERS
TRY THESE YOURSELF
■ WORKED EXAMPLE 5.1
1 a all Bb; all black
b 3 Bb : 1 bb; 3 black, 1 white
c 1 Bb : 1 bb; ½ black, ½ white
2 a Bb
b B b
B BB Bb
b Bb bb
c 2/3 of the curly-winged flies would be heterozygous
■ WORKED EXAMPLE 5.2
1 b Skippy’s dad – Aa, Skippy’s mum – aa, Bouncer’s dad – AA or Aa, Bouncer’s mum – AA or Aa
Skippy – Aa, Bouncer – Aa, Joey 1 – aa, Joey 2 – Aa or AA
■ WORKED EXAMPLE 5.3
1 GENERATION 1 GENERATION 2 GENERATION 3
Genotype frequency of:
bb 5/6 = 0.83 3/6 = 0.50 1/6 = 0.17
BB 1/6 = 0.17 3/6 = 0.50 5/6 = 0.83
Phenotype frequency of:
White moths 5/6 = 0.83 3/6 = 0.50 1/6 = 0.17
Black moths 1/6 = 0.17 3/6 = 0.50 5/6 = 0.83
Allele frequency of:
B 2/12 = 0.17 6/12 = 0.5 10/12 = 0.83
b 10/12 = 0.83 6/12 = 0.5 2/12 = 0.17
Possible reasons for change White moths are more easily seen by predators and are more likely to be eaten;
the black moth has a selective advantage.
Hypothesis If a moth is black, then its rate of capture by predators will be less frequent.
2 FREQUENCY TYPE CALCULATIONS
Genotype frequency:
AO 2/5 = 0.40
BO 1/5 = 0.20
AB 1/5 = 0.20
OO 1/5 = 0.20
Phenotype frequency:
A 2/5 = 0.40
B 1/5 = 0.20
AB 1/5 = 0.20
O 1/5 = 0.20
Allele frequency:
A 3/10 = 0.30
B 2/10 = 0.20
O 5/10 = 0.50
9780170408851 629
19_bio_InFocus12_2e_sb_08851_ans.indd 629 08/08/18 6:43 pm
You might also like
- (Fitzpatrick, 2019) New Senior Mathematics Extension 1 (Year 11 and 12)89% (9)(Fitzpatrick, 2019) New Senior Mathematics Extension 1 (Year 11 and 12)457 pages
- New Senior Mathematics Extension 2 For Year 12 (2019)100% (7)New Senior Mathematics Extension 2 For Year 12 (2019)319 pages
- Ebin - Pub Nelson Community and Family Studies Preliminary Amp HSC 9780170449397 97801703479900% (4)Ebin - Pub Nelson Community and Family Studies Preliminary Amp HSC 9780170449397 9780170347990755 pages
- Oxford Science 9 Second Edition Victorian Curriculum100% (6)Oxford Science 9 Second Edition Victorian Curriculum244 pages
- Maths in Focus: Year 11 Mathematics Extension 1 3rd Edition Grove download pdf100% (5)Maths in Focus: Year 11 Mathematics Extension 1 3rd Edition Grove download pdf51 pages
- Glenda Chidrawi - Sarah Bradstock - Margaret Robson - Elizabeth Thrum - Stephanie Hollis - Sarah Jones - Biology in Focus Year 11-Cengage (2017) PDF88% (8)Glenda Chidrawi - Sarah Bradstock - Margaret Robson - Elizabeth Thrum - Stephanie Hollis - Sarah Jones - Biology in Focus Year 11-Cengage (2017) PDF440 pages
- Chemistry Year 11 - Units 1&2 - Jacaranda VCE E1 PDF100% (2)Chemistry Year 11 - Units 1&2 - Jacaranda VCE E1 PDF424 pages
- MOdule 5-PAST HSC QUESTIONS WITH ANSWERS PDF50% (2)MOdule 5-PAST HSC QUESTIONS WITH ANSWERS PDF52 pages
- Biology WA ATAR Units 3 & 4 Student Book With 1 X 26 Month NelsonNetBook Access Code100% (1)Biology WA ATAR Units 3 & 4 Student Book With 1 X 26 Month NelsonNetBook Access Code547 pages
- Nursery and Primary School Business Plan in Nigeria100% (3)Nursery and Primary School Business Plan in Nigeria9 pages
- Jacaranda Nature of Biology 1 VCE U12 (5th Ed)100% (3)Jacaranda Nature of Biology 1 VCE U12 (5th Ed)646 pages
- Dokumen - Pub Jacaranda Maths Quest 9 Australian Curriculum Third Edition 3 Third Edition 9780730346326100% (4)Dokumen - Pub Jacaranda Maths Quest 9 Australian Curriculum Third Edition 3 Third Edition 9780730346326835 pages
- Normanhurst Boys 2017 Year 9 Maths Yearly & Solutions100% (2)Normanhurst Boys 2017 Year 9 Maths Yearly & Solutions29 pages
- Cambridge University - Science - Full Textbook100% (5)Cambridge University - Science - Full Textbook608 pages
- Dokumen - Pub Jacaranda Maths Quest 10 Stage 5 NSW Ac Second Edition 2nbsped100% (1)Dokumen - Pub Jacaranda Maths Quest 10 Stage 5 NSW Ac Second Edition 2nbsped912 pages
- New Century Maths Year 10 5.2 Teaching ProgramNo ratings yetNew Century Maths Year 10 5.2 Teaching Program31 pages
- Year-12-Biology Excel Revision Cards PDFNo ratings yetYear-12-Biology Excel Revision Cards PDF109 pages
- Review Questions For PRC Lea As of 25dec2019No ratings yetReview Questions For PRC Lea As of 25dec20199 pages
- Jacaranda Maths Quest Units 1 2 Specialist Mathematics 11 for Queensland 1st Edition Catherine Smith 2024 Scribd Download100% (6)Jacaranda Maths Quest Units 1 2 Specialist Mathematics 11 for Queensland 1st Edition Catherine Smith 2024 Scribd Download55 pages
- New Fundamental Mathematics Advanced + Extension 1 HSC Courses (Terry H. Lee) (Z-Library)No ratings yetNew Fundamental Mathematics Advanced + Extension 1 HSC Courses (Terry H. Lee) (Z-Library)575 pages
- Psychology: Australian and New Zealand edition Douglas A. Bernstein download100% (2)Psychology: Australian and New Zealand edition Douglas A. Bernstein download51 pages
- 559273Physics In Focus Year 12 Student Book 2nd Edition 2nd Robert Farr download100% (2)559273Physics In Focus Year 12 Student Book 2nd Edition 2nd Robert Farr download89 pages
- Nelson Senior Maths For The Australian Curriculum Essentials 12 1st Edition Sue Thomson instant downloadNo ratings yetNelson Senior Maths For The Australian Curriculum Essentials 12 1st Edition Sue Thomson instant download58 pages
- Nelson Visual Communication Design Vce Units 14 Workbook 4th Edition Kristen Guthrie pdf downloadNo ratings yetNelson Visual Communication Design Vce Units 14 Workbook 4th Edition Kristen Guthrie pdf download80 pages
- (eBook PDF) Making the Most of Field Placement 4th Edition pdf download100% (3)(eBook PDF) Making the Most of Field Placement 4th Edition pdf download51 pages
- Instant Access to MKTG5 5th Edition Joe F. Hair - eBook PDF ebook Full Chapters100% (1)Instant Access to MKTG5 5th Edition Joe F. Hair - eBook PDF ebook Full Chapters44 pages
- Complete Download (eBook PDF) Making the Most of Field Placement 4th Edition PDF All Chapters100% (2)Complete Download (eBook PDF) Making the Most of Field Placement 4th Edition PDF All Chapters40 pages
- Australian Kelpie Training Guide Australian Kelpie Training Includes: Australian Kelpie Tricks, Socializing, Housetraining, Agility, Obedience, Behavioral Training, and MoreFrom EverandAustralian Kelpie Training Guide Australian Kelpie Training Includes: Australian Kelpie Tricks, Socializing, Housetraining, Agility, Obedience, Behavioral Training, and MoreNo ratings yet
- Foundation of Special and Inclusive EducationNo ratings yetFoundation of Special and Inclusive Education18 pages
- 1 Classroom Observation Assignment-Form 1 Instructional Project 4No ratings yet1 Classroom Observation Assignment-Form 1 Instructional Project 43 pages
- BSc Computer Science - Course Details (2019 Entry) _ the University of ManchesterNo ratings yetBSc Computer Science - Course Details (2019 Entry) _ the University of Manchester10 pages
- Communication: in Relation To The Distorted Relationships of HUMSS Teachers and Students in BNHS-SHS100% (4)Communication: in Relation To The Distorted Relationships of HUMSS Teachers and Students in BNHS-SHS7 pages
- Practical-Research-2 - Module-3 Week 7-8No ratings yetPractical-Research-2 - Module-3 Week 7-815 pages
- Lac Plan in Early Language Literacy and Numeracy (ELLN)100% (1)Lac Plan in Early Language Literacy and Numeracy (ELLN)10 pages
- A Gamification Technique Through The Method of A Lesson Study in Teaching ProbabilityNo ratings yetA Gamification Technique Through The Method of A Lesson Study in Teaching Probability8 pages
- Project Proposal: Faculty of Computer and Mathematical Science University Technology MaraNo ratings yetProject Proposal: Faculty of Computer and Mathematical Science University Technology Mara46 pages
- Educ 602 PHILOSOPHIES AND THEORIES OF EDUCATIONNo ratings yetEduc 602 PHILOSOPHIES AND THEORIES OF EDUCATION213 pages
- Grade 4 MATH: Philippine Normal UniversityNo ratings yetGrade 4 MATH: Philippine Normal University11 pages
- A Project Proposal The Expenditure of Modular Method of TeachingNo ratings yetA Project Proposal The Expenditure of Modular Method of Teaching3 pages
- Transdisciplinary Learning Approach For Teacher Education ProgramNo ratings yetTransdisciplinary Learning Approach For Teacher Education Program8 pages
- RPMS SY 2021-2022: Teacher Reflection Form (TRF)No ratings yetRPMS SY 2021-2022: Teacher Reflection Form (TRF)7 pages
- Systematic Approach To Teaching: 1. Establishing Learning ObjectivesNo ratings yetSystematic Approach To Teaching: 1. Establishing Learning Objectives7 pages
- HRD-F-057-Proposal-Impact of Mental Health and Stress Level of Teachers To Learning Resource DevelopmentNo ratings yetHRD-F-057-Proposal-Impact of Mental Health and Stress Level of Teachers To Learning Resource Development11 pages
