NEET 2023 Question Paper G1
NEET 2023 Question Paper G1
G1
Corporate Office : Aakash Tower, 8, Pusa Road, New Delhi-110005 | Ph.: 011-47623456
NEET (UG)-2023
Important Instructions :
1. The test is of 3 hours 20 minutes duration and the Test Booklet contains 200 multiple choice questions (four
options with a single correct answer) from Physics, Chemistry and Biology (Botany and Zoology).
50 questions in each subject are divided into two sections (A and B) as per details given below:
(a) Section A shall consist of 35 (Thirty-five) Questions in each subject (Question Nos. – 1 to 35, 51 to 85,
101 to 135 and 151 to 185). All Questions are compulsory.
(b) Section B shall consist of 15 (Fifteen) questions in each subject (Question Nos. – 36 to 50, 86 to 100,
136 to 150 and 186 to 200). In section B, a candidate needs to attempt any 10 (Ten) questions out of
15 (Fifteen) in each subject.
Candidates are advised to read all 15 questions in each subject of Section-B before they start attempting
the question paper. In the event of a candidate attempting more than ten questions, the first ten questions
answered by the candidate shall be evaluated.
2. Each question carries 4 marks. For each correct response, the candidate will get 4 marks. For each incorrect
response, 1 mark will be deducted from the total scores. The maximum marks are 720.
3. Use Blue / Black Ball point Pen only for writing particulars on this page / marking responses on Answer
Sheet.
4. Rough work is to be done in the space provided for this purpose in the Test Booklet only.
5. On completion of the test, the candidate must handover the Answer Sheet (ORIGINAL and OFFICE Copy)
to the Invigilator before leaving the Room/Hall. The candidates are allowed to take away this Test Booklet
with them.
6. The CODE for this Booklet is G1.
7. The candidates should ensure that the Answer Sheet is not folded. Do not make any stray marks on the
Answer Sheet. Do not write your Roll No. anywhere else except in the specified space in the Test
Booklet/Answer Sheet. Use of white fluid for correction is NOT permissible on the Answer Sheet.
8. Each candidate must show on-demand his/her Admit Card to the Invigilator.
9. No candidate, without special permission of the Centre Superintendent or Invigilator, would leave his/her seat.
10. Use of Electronic/Manual Calculator is prohibited.
11. The candidates are governed by all Rules and Regulations of the examination with regard to their conduct in
the Examination Room/Hall. All cases of unfair means will be dealt with as per Rules and Regulations of this
examination.
12. No part of the Test Booklet and Answer Sheet shall be detached under any circumstances.
13. The candidates will write the Correct Test Booklet Code as given in the Test Booklet / Answer Sheet in the
Attendance Sheet.
-1-
NEET (UG)-2023 (Code-G1)
PHYSICS
SECTION-A
1. A bullet is fired from a gun at the speed of 280 m s–1 in the direction 30° above the horizontal. The maximum
height attained by the bullet is (g = 9.8 m s–2, sin30° = 0.5)
(1) 3000 m (2) 2800 m
(3) 2000 m (4) 1000 m
Answer (4)
2. An electric dipole is placed at an angle of 30° with an electric field of intensity 2 × 105 N C–1. It experiences a
torque equal to 4 N m. Calculate the magnitude of charge on the dipole, if the dipole length is 2 cm.
(1) 2 mC (2) 8 mC
(3) 6 mC (4) 4 mC
Answer (1)
3. The amount of energy required to form a soap bubble of radius 2 cm from a soap solution is nearly (surface
tension of soap solution = 0.03 N m–1)
(1) 50.1 × 10–4 J (2) 30.16 × 10–4 J
(3) 5.06 × 10–4 J (4) 3.01 × 10–4 J
Answer (4)
4. Let a wire be suspended from the ceiling (rigid support) and stretched by a weight W attached at its free end.
The longitudinal stress at any point of cross-sectional area A of the wire is
(1) Zero (2) 2W/A
(3) W/A (4) W/2A
Answer (3)
5. Light travels a distance x in time t1 in air and 10x in time t2 in another denser medium. What is the critical angle
for this medium?
10 t1 t
(1) sin−1 (2) sin−1 2
t2 t1
10t 2 t
(3) sin−1 (4) sin−1 1
t1 10 t 2
Answer (1)
6. For Young’s double slit experiment, two statements are given below:
Statement I : If screen is moved away from the plane of slits, angular separation of the fringes remains
constant.
Statement II : If the monochromatic source is replaced by another monochromatic source of larger
wavelength, the angular separation of fringes decreases.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is false but Statement II is true.
(2) Both Statement I and Statement II are true.
(3) Both Statement I and Statement II are false.
(4) Statement I is true but Statement II is false.
Answer (4)
-2-
NEET (UG)-2023 (Code-G1)
7. Two bodies of mass m and 9m are placed at a distance R. The gravitational potential on the line joining the
bodies where the gravitational field equals zero, will be (G = gravitational constant)
20 Gm 8 Gm
(1) − (2) −
R R
12 Gm 16 Gm
(3) − (4) −
R R
Answer (4)
8. The temperature of a gas is –50°C. To what temperature the gas should be heated so that the rms speed is
increased by 3 times?
(1) 223 K (2) 669°C
(3) 3295°C (4) 3097 K
Answer (3)
9. In a series LCR circuit, the inductance L is 10 mH, capacitance C is 1 µF and resistance R is 100 Ω. The
frequency at which resonance occurs is
(1) 1.59 kHz (2) 15.9 rad/s
(3) 15.9 kHz (4) 1.59 rad/s
Answer (1)
10. A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent.
The force that acts on the player while turning is
(1) Along south-west (2) Along eastward
(3) Along northward (4) Along north-east
Answer (4)
11. The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage
supply are
(1) Random errors (2) Instrumental errors
(3) Personal errors (4) Least count errors
Answer (1)
12. The ratio of radius of gyration of a solid sphere of mass M and radius R about its own axis to the radius of
gyration of the thin hollow sphere of same mass and radius about its axis is
(1) 5:2 (2) 3:5
(3) 5:3 (4) 2:5
Answer (2*)
13.
∫ E ⋅ dS =
If 0 over a surface, then
s
-3-
NEET (UG)-2023 (Code-G1)
14. A Carnot engine has an efficiency of 50% when its source is at a temperature 327°C. The temperature of the
sink is
(1) 200°C
(2) 27°C
(3) 15°C
(4) 100°C
Answer (2)
15. A 12 V, 60 W lamp is connected to the secondary of a step-down transformer, whose primary is connected to
ac mains of 220 V. Assuming the transformer to be ideal, what is the current in the primary winding?
(1) 0.37 A
(2) 0.27 A
(3) 2.7 A
(4) 3.7 A
Answer (2)
16. Given below are two statements:
Statement I: Photovoltaic devices can convert optical radiation into electricity.
Statement II: Zener diode is designed to operate under reverse bias in breakdown region.
In the light of the above statements, choose the most appropriate answer from the options given below.
(1) Statement I is incorrect but Statement II is correct
(2) Both Statement I and Statement II are correct
(3) Both Statement I and Statement II are incorrect
(4) Statement I is correct but Statement II is incorrect
Answer (2)
17. If the galvanometer G does not show any deflection in the circuit shown, the value of R is given by
18. The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the
same length is
(1) 3:1 (2) 1:2
(3) 2:1 (4) 1:3
Answer (3)
-4-
NEET (UG)-2023 (Code-G1)
19. The angular acceleration of a body, moving along the circumference of a circle, is
(1) Along the axis of rotation (2) Along the radius, away from centre
(3) Along the radius towards the centre (4) Along the tangent to its position
Answer (1)
20. The minimum wavelength of X-rays produced by an electron accelerated through a potential difference of
V volts is proportional to
(1) V2 (2) V
1 1
(3) (4)
V V
Answer (3)
21. The work functions of Caesium (Cs), Potassium (K) and Sodium (Na) are 2.14 eV, 2.30 eV and 2.75 eV
respectively. If incident electromagnetic radiation has an incident energy of 2.20 eV, which of these
photosensitive surfaces may emit photoelectrons?
(1) Na only (2) Cs only
(3) Both Na and K (4) K only
Answer (2)
22. The net magnetic flux through any closed surface is
(1) Negative
(2) Zero
(3) Positive
(4) Infinity
Answer (2)
23. A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a
load resistance. Which of these components remove the ac ripple from the rectified output?
(1) Load resistance
(2) A centre-tapped transformer
(3) p-n junction diodes
(4) Capacitor
Answer (4)
24. An ac source is connected to a capacitor C. Due to decrease in its operating frequency
Answer (4)
25. In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at
a frequency of 2.0 × 1010 Hz and amplitude 48 V m–1. Then the amplitude of oscillating magnetic field is
(Speed of light in free space = 3 × 108 m s–1)
(1) 1.6 × 10–6 T (2) 1.6 × 10–9 T
(3) 1.6 × 10–8 T (4) 1.6 × 10–7 T
Answer (4)
-5-
NEET (UG)-2023 (Code-G1)
26. Resistance of a carbon resistor determined from colour codes is (22000 ± 5%) Ω. The colour of third band
must be
(1) Yellow (2) Red
(3) Green (4) Orange
Answer (4)
27. A vehicle travels half the distance with speed v and the remaining distance with speed 2v. Its average speed
is
3v v
(1) (2)
4 3
2v 4v
(3) (4)
3 3
Answer (4)
28. The potential energy of a long spring when stretched by 2 cm is U. If the spring is stretched by 8 cm, potential
energy stored in it will be
(1) 16 U (2) 2U
(3) 4U (4) 8U
Answer (1)
29. In hydrogen spectrum, the shortest wavelength in the Balmer series is λ. The shortest wavelength in the
Bracket series is
(1) 16λ
(2) 2λ
(3) 4λ
(4) 9λ
Answer (3)
30. The equivalent capacitance of the system shown in the following circuit is
(1) 9 µF (2) 2 µF
(3) 3 µF (4) 6 µF
Answer (2)
31. A metal wire has mass (0.4 ± 0.002) g, radius (0.3 ± 0.001) mm and length (5 ± 0.02) cm. The maximum
possible percentage error in the measurement of density will nearly be
(1) 1.4% (2) 1.2%
(3) 1.3% (4) 1.6%
Answer (4)
-6-
NEET (UG)-2023 (Code-G1)
32. The venturi-meter works on
(1) The principle of perpendicular axes
(2) Huygen’s principle
(3) Bernoulli’s principle
(4) The principle of parallel axes
Answer (3)
33. The half life of a radioactive substance is 20 minutes. In how much time, the activity of substance drops to
th
1
of its initial value?
16
(1) 80 minutes
(2) 20 minutes
(3) 40 minutes
(4) 60 minutes
Answer (1)
34. The magnetic energy stored in an inductor of inductance 4 µH carrying a current of 2 A is
(1) 8 µJ (2) 4 µJ
(3) 4 mJ (4) 8 mJ
Answer (1)
35. The magnitude and direction of the current in the following circuit is
SECTION-B
36. In the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all
layers are thin)?
37. Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains
stationary. The coefficient of static friction between the body and the floor is 0.15 (g = 10 m s–2).
(1) 50 m s–2 (2) 1.2 m s–2
(3) 150 m s–2 (4) 1.5 m s–2
Answer (4)
38. The net impedance of circuit (as shown in figure) will be
(1) 25 Ω (2) 10 2 Ω
(3) 15 Ω (4) 5 5Ω
Answer (4)
39. An electric dipole is placed as shown in the figure.
1
The electric potential (in 102 V) at point P due to the dipole is (∈0 = permittivity of free space and =K)
4π ∈0
8 3
(1) qK (2) qK
3 8
5 8
(3) qK (4) qK
8 5
Answer (2)
40. For the following logic circuit, the truth table is
A B Y A B Y
0 0 0 0 0 1
(1) 0 1 0 (2) 0 1 1
1 0 0 1 0 1
1 1 1 1 1 0
A B Y A B Y
0 0 0 0 0 1
(3) 0 1 1 (4) 0 1 0
1 0 1 1 0 1
1 1 1 1 1 0
Answer (3)
-8-
NEET (UG)-2023 (Code-G1)
41. 10 resistors, each of resistance R are connected in series to a battery of emf E and negligible internal
resistance. Then those are connected in parallel to the same battery, the current is increased n times. The
value of n is
(1) 1000 (2) 10
(3) 100 (4) 1
Answer (3)
42. The resistance of platinum wire at 0°C is 2 Ω and 6.8 Ω at 80°C. The temperature coefficient of resistance of
the wire is
(1) 3 × 10–1 °C–1 (2) 3 × 10–4 °C–1
(3) 3 × 10–3 °C–1 (4) 3 × 10–2 °C–1
Answer (4)
43. A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically
upwards with a velocity 4 m s–1. The ball strikes the water surface after 4 s. The height of bridge above water
surface is (Take g = 10 m s–2)
(1) 68 m (2) 56 m
(3) 60 m (4) 64 m
Answer (4)
44. A bullet from a gun is fired on a rectangular wooden block with velocity u. When bullet travels 24 cm through
u
the block along its length horizontally, velocity of bullet becomes . Then it further penetrates into the block
3
in the same direction before coming to rest exactly at the other end of the block. The total length of the block
is
(1) 30 cm (2) 27 cm
(3) 24 cm (4) 28 cm
Answer (2)
45. A satellite is orbiting just above the surface of the earth with period T. If d is the density of the earth and G is
3π
the universal constant of gravitation, the quantity represents
Gd
(1) T
(2) T
(3) T2
(4) T3
Answer (3)
46. Two thin lenses are of same focal lengths (f), but one is convex and the other one is concave. When they are
placed in contact with each other, the equivalent focal length of the combination will be
(1) Infinite
(2) Zero
f
(3)
4
f
(4)
2
Answer (1)
-9-
NEET (UG)-2023 (Code-G1)
47. A very long conducting wire is bent in a semi-circular shape from A to B as shown in figure. The magnetic field
at point P for steady current configuration is given by
µ0 i 2
(1) 1 − π pointed into the page
4R
µ0 i
(2) pointed into the page
4R
µ0 i
(3) pointed away from the page
4R
µ0 i 2
(4) 1 − π pointed away from page
4R
Answer (4)
48. The x-t graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the
particle at t = 2 s is
π2
(1) – m s –2
16
π2
(2) m s –2
8
π2
(3) – m s –2
8
π2
(4) m s –2
16
Answer (1)
49. A wire carrying a current I along the positive x-axis has length L. It is kept in a magnetic field
B (2iˆ + 3 ˆj – 4kˆ ) T . The magnitude of the magnetic force acting on the wire is
=
(1) 3 lL (2) 3 lL
(3) 5 lL (4) 5 lL
Answer (4)
50. The radius of inner most orbit of hydrogen atom is 5.3 × 10–11 m. What is the radius of third allowed orbit of
hydrogen atom?
(1) 4.77 Å (2) 0.53 Å
(3) 1.06 Å (4) 1.59 Å
Answer (1)
- 10 -
NEET (UG)-2023 (Code-G1)
CHEMISTRY
SECTION-A
51. Match List-I with List-II.
List-I List-II
(1) A-III, B-IV, C-I, D-II (2) A-II, B-IV, C-I, D-III
(3) A-IV, B-I, C-II, D-III (4) A-III, B-I, C-IV, D-II
Answer (4)
52. Given below are two statements : one is labelled as Assertion A and the other is labelled as
Reason R :
Assertion A : Metallic sodium dissolves in liquid ammonia giving a deep blue solution, which is
paramagnetic.
In the light of the above statements, choose the correct answer from the options given below :
(3) Both A and R are true but R is NOT the correct explanation of A
Answer (4)
is an example of ______.
Answer (4)
- 11 -
NEET (UG)-2023 (Code-G1)
54. Some tranquilizers are listed below. Which one from the following belongs to barbiturates?
Answer (1)
(1) (2)
(3) (4)
Answer (3)
[C] is ________
(1) (2)
(3) (4)
Answer (1)
- 12 -
NEET (UG)-2023 (Code-G1)
57. The stability of Cu2+ is more than Cu+ salts in aqueous solution due to
Answer (4)
58. The right option for the mass of CO2 produced by heating 20 g of 20% pure limestone is (Atomic mass of
Answer (3)
59. The conductivity of centimolar solution of KCl at 25°C is 0.0210 ohm–1 cm–1 and the resistance of the cell
containing the solution at 25°C is 60 ohm. The value of cell constant is
Answer (4)
60. Which amongst the following options are correct graphical representation of Boyle’s law?
(1) (2)
(3) (4)
Answer (3)
CH3
|
=
(1) H2C C – CH CH2
= =
(2) H2C CH
= – CH CH2
Cl
|
H2C C
(3) = = – CH CH2 H2C
(4) = CH – C ≡ CH
Answer (3)
- 13 -
NEET (UG)-2023 (Code-G1)
62. Which of the following reactions will NOT give primary amine as the product?
Br2 /KOH
(1) (i) LiAlH4
CH3 CONH2
(ii) H O⊕
→ Product (2) CH3 CONH2 → Product
3
Answer (4)
63. Given below are two statements : one is labelled as Assertion A and the other is labelled as
Reason R :
Assertion A : A reaction can have zero activation energy.
Reasons R : The minimum extra amount of energy absorbed by reactant molecules so that their energy
becomes equal to threshold value, is called activation energy.
In the light of the above statements, choose the correct answer from the options given below :
(1) A is false but R is true
(2) Both A and R are true and R is the correct explanation of A
(3) Both A and R are true and R is NOT the correct explanation of A
(4) A is true but R is false
Answer (3)
65. Amongst the given options which of the following molecules/ ion acts as a Lewis acid?
(1) OH– (2) NH3
(3) H2O (4) BF3
Answer (4)
66. Given below are two statements: one is labelled as Assertion A and the other is labelled as
Reason R
Assertion A : In equation ∆rG = –nFEcell’ value of ∆rG depends on n.
Reasons R : Ecell is an intensive property and ∆rG is an extensive property.
In the light of the above statements, choose the correct answer from the options given below
(1) A is false but R is true
(2) Both A and R are true and R is the correct explanation of A
(3) Both A and R are true and R is NOT the correct explanation of A
(4) A is true but R is false
Answer (3)
- 14 -
NEET (UG)-2023 (Code-G1)
67. The element expected to form largest ion to achieve the nearest noble gas configuration is
(1) Na (2) O
(3) F (4) N
Answer (4)
68. A compound is formed by two elements A and B. The element B forms cubic close packed structure and
atoms of A occupy 1/3 of tetrahedral voids. If the formula of the compound is AxBy, then the value of x + y
is in option
(1) 2 (2) 5
(3) 4 (4) 3
Answer (2)
69. Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R
Assertion A : Helium is used to dilute oxygen in diving apparatus.
Reason R : Helium has high solubility in O2.
In the light of the above statements, choose the correct answer from the options given below
(1) A is false but R is true
(2) Both A and R are true and R correct explanation of A
(3) Both A and R are true and R is NOT the correct explanation of A
(4) A is true but R is false
Answer (3)
- 15 -
NEET (UG)-2023 (Code-G1)
72. For a certain reaction, the rate = k[A]2[B], when the initial concentration of A is tripled keeping concentration
of B constant, the initial rate would
(1) Increase by a factor of three (2) Decrease by a factor of nine
(3) Increase by a factor of six (4) Increase by a factor of nine
Answer (4)
73. Amongst the following the total number of species NOT having eight electrons around central atom in its
outermost shell, is
NH3, AlCl3, BeCl2, CCl4, PCl5 :
(1) 1 (2) 3
(3) 2 (4) 4
Answer (2)
74. In Lassaigne’s extract of an organic compound, both nitrogen and sulphur are present, which gives blood
red colour with Fe3+ due to the formation of
(1) [Fe(SCN)]2+ (2) Fe4[Fe(CN)6]3⋅xH2O
(3) NaSCN (4) [Fe(CN)5NOS]4–
Answer (1)
77. Intermolecular forces are forces of attraction and repulsion between interacting particles that will include :
A. dipole - dipole forces
B. dipole - induced dipole forces
C. hydrogen bonding
D. covalent bonding
E. dispersion forces
Choose the most appropriate answer from the options given below :
(1) A, C, D, E are correct (2) B, C, D, E are correct
(3) A, B, C, D are correct (4) A, B, C, E are correct
Answer (4)
- 16 -
NEET (UG)-2023 (Code-G1)
78. Select the correct statements from the following
A. Atoms of all elements are composed of two fundamental particles.
B. The mass of the electron is 9.10939 × 10–31 kg.
C. All the isotopes of a given element show same chemical properties:
D. Protons and electrons are collectively known as nucleons.
E. Dalton’s atomic theory, regarded the atom as an ultimate particles of matter
Choose the correct answer from the options given below
(1) B, C and E only (2) A, B and C only
(3) C, D and E only (4) A and E only
Answer (1)
79. Consider the following reaction and identify the product (P).
Product (P)
(1) (2)
Answer (2)
(1) (2)
(3) (4)
Answer (2)
- 17 -
NEET (UG)-2023 (Code-G1)
81. Taking stability as the factor, which one of the following represents correct relationship?
Answer (1)
Statement I : A unit formed by the attachment of a base to 1′ position of sugar is known as nucleoside.
Statement II : When nucleoside is linked to phosphorous acid at 5′ -position of sugar moiety, we get
nucleotide.
In the light of the above statements, choose the correct answer from the options given below :
Answer (4)
83. Weight (g) of two moles of the organic compound, which is obtained by heating sodium ethanoate with
(1) 18 (2) 16
(3) 32 (4) 30
Answer (3)
84. The relation between nm, (nm = the number of permissible values of magnetic quantum number (m)) for a
n –1
(1) nm = l + 2 (2) l= m
2
Answer (2)
85. The number of σ bonds, π bonds and lone pair of electrons in pyridine, respectively are:
Answer (4)
- 18 -
NEET (UG)-2023 (Code-G1)
SECTION-B
∆
3 – OH → major product
(1) (2)
(3) (4)
Answer (4)
87. Pumice stone is an example of
(1) Foam (2) Sol
(3) Gel (4) Solid sol
Answer (4)
88. Consider the following reaction :
(1)
(2)
(3)
(4)
Answer (4)
- 19 -
NEET (UG)-2023 (Code-G1)
89. The reaction that does NOT take place in a blast furnace between 900 K to 1500 K temperature range
during extraction of iron is :
(1) CaO + SiO2 → CaSiO3
Answer (4)
92. What fraction of one edge centred octahedral void lies in one unit cell of fcc?
1 1
(1) (2)
12 2
1 1
(3) (4)
3 4
Answer (4)
- 20 -
NEET (UG)-2023 (Code-G1)
93. Match List-I with List-II :
Answer (3)
94. Which amongst the following will be most readily dehydrated under acidic conditions?
(1) (2)
(3) (4)
Answer (3)
95. The equilibrium concentrations of the species in the reaction A + B C + D are 2, 3, 10 and 6 mol L–1,
Answer (4)
- 21 -
NEET (UG)-2023 (Code-G1)
97. Consider the following compounds/species:
i) LiAIH4 H2SO4
CH3CHO
ii) H O+
→ [A] →
∆
[B]
3
Answer (2)
100. On balancing the given redox reaction,
c
aCr2O72− + bSO32− (aq) + cH+ (aq) → 2aCr 3+ (aq) + bSO24− (aq) + H2O(l)
2
the coefficients a, b and c are found to be, respectively-
(1) 8, 1, 3 (2) 1, 3, 8
(3) 3, 8, 1 (4) 1, 8, 3
Answer (2)
- 22 -
NEET (UG)-2023 (Code-G1)
BOTANY
SECTION-A
101. Movement and accumulation of ions across a membrane against their concentration gradient can be
explained by
(1) Active Transport (2) Osmosis
(3) Facilitated Diffusion (4) Passive Transport
Answer (1)
102. Among ‘The Evil Quartet’, which one is considered the most important cause driving extinction of species?
(1) Co-extinctions
(2) Habitat loss and fragmentation
(3) Over exploitation for economic gain
(4) Alien species invasions
Answer (2)
105. In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This
phenomenon may be called as
(1) Senescence (2) Differentiation
(3) Dedifferentiation (4) Development
Answer (3)
106. Given below are two statements :
Statement I : Endarch and exarch are the terms often used for describing the position of secondary xylem
in the plant body.
Statement II : Exarch condition is the most common feature of the root system.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is incorrect but Statement II is true
(2) Both Statement I and Statement II are true
(3) Both Statement I and Statement II are false
(4) Statement I is correct but Statement II is false
Answer (1)
- 23 -
NEET (UG)-2023 (Code-G1)
107. Given below are two statements : One labelled as Assertion A and the other labelled as Reason R:
Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage.
Reason R : Protonema develops directly from spores produced in capsule.
In the light of the above statements, choose the most appropriate answer from options given below:
(1) A is not correct but R is correct
(2) Both A and R are correct and R is the correct explanation of A
(3) Both A and R are correct but R is NOT the correct explanation of A
(4) A is correct but R is not correct
Answer (2)
109. Upon exposure to UV radiation, DNA stained with ethidium bromide will show
(1) Bright orange colour (2) Bright red colour
(3) Bright blue colour (4) Bright yellow colour
Answer (1)
110. The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?
(1) Diakinesis (2) Zygotene
(3) Pachytene (4) Diplotene
Answer (3)
111. Cellulose does not form blue colour with Iodine because
(1) It breaks down when iodine reacts with it
(2) It is a disaccharide
(3) It is a helical molecule
(4) It does not contain complex helices and hence cannot hold iodine molecules
Answer (4)
112. Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the
characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.
(1) Epiphyllous and Dithecous anthers
(2) Diadelphous and Dithecous anthers
(3) Polyadelphous and epipetalous stamens
(4) Monoadelphous and Monothecous anthers
Answer (2)
113. The thickness of ozone in a column of air in the atmosphere is measured in terms of :
(1) Kilobase (2) Dobson units
(3) Decibels (4) Decameter
Answer (2)
- 24 -
NEET (UG)-2023 (Code-G1)
114. Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : ATP is used at two steps in glycolysis.
Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in
conversion of fructose-6-phosphate into fructose-1, 6-diphosphate.
In the light of the above statements, choose the correct answer from the options given below :
(1) A is false but R is true.
(2) Both A and R are true and R is the correct explanation of A.
(3) Both A and R are true but R is NOT the correct explanation of A.
(4) A is true but R is false.
Answer (2)
115. How many ATP and NADPH2 are required for the synthesis of one molecule of Glucose during Calvin cycle?
(1) 18 ATP and 16 NADPH2
(2) 12 ATP and 12 NADPH2
(3) 18 ATP and 12 NADPH2
(4) 12 ATP and 16 NADPH2
Answer (3)
116. During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out
(1) Polysaccharides (2) RNA
(3) DNA (4) Histones
Answer (3)
117. Spraying of which of the following phytohormone on juvenile conifers helps hastening the maturity period,
that leads early seed production?
(1) Abscisic Acid
(2) Indole-3-butyric Acid
(3) Gibberellic Acid
(4) Zeatin
Answer (3)
118. In the equation GPP − R = NPP
GPP is Gross Primary Productivity
NPP is Net Primary Productivity
R here is ________.
(1) Reproductive allocation
(2) Photosynthetically active radiation
(3) Respiratory quotient
(4) Respiratory loss
Answer (4)
119. Axile placentation is observed in
(1) China rose, Petunia and Lemon
(2) Mustard, Cucumber and Primrose
(3) China rose, Beans and Lupin
(4) Tomato, Dianthus and Pea
Answer (1)
- 25 -
NEET (UG)-2023 (Code-G1)
120. Unequivocal proof that DNA is the genetic material was first proposed by
(1) Wilkins and Franklin
(2) Frederick Griffith
(3) Alfred Hershey and Martha Chase
(4) Avery, Macleoid and McCarthy
Answer (3)
122. Which micronutrient is required for splitting of water molecule during photosynthesis?
(1) Copper
(2) Manganese
(3) Molybdenum
(4) Magnesium
Answer (2)
Answer (3)
125. In gene gun method used to introduce alien DNA into host cells, microparticles of ________ metal are used.
(1) Silver
(2) Copper
(3) Zinc
(4) Tungsten or gold
Answer (4)
- 26 -
NEET (UG)-2023 (Code-G1)
127. Frequency of recombination between gene pairs on same chromosome as a measure of the distance
between genes to map their position on chromosome, was used for the first time by
(1) Henking
(2) Thomas Hunt Morgan
(3) Sutton and Boveri
(4) Alfred Sturtevant
Answer (4)
128. The historic Convention on Biological Diversity, ‘The Earth Summit’ was held in Rio de Janeiro in the year
(1) 2002
(2) 1985
(3) 1992
(4) 1986
Answer (3)
131. In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :
(1) Synergids, antipodals and Polar nuclei
(2) Synergids, Primary endosperm nucleus and zygote
(3) Antipodals, synergids, and primary endosperm nucleus
(4) Synergids, Zygote and Primary endosperm nucleus
Answer (4)
- 27 -
NEET (UG)-2023 (Code-G1)
132. What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
(1) Transcription of only snRNAs
(2) Transcription of rRNAs (28S, 18S and 5.8S)
(3) Transcription of tRNA, 5S rRNA and snRNA
(4) Transcription of precursor of mRNA
Answer (3)
133. Which hormone promotes internode/petiole elongation in deep water rice?
(1) 2, 4-D (2) GA3
(3) Kinetin (4) Ethylene
Answer (4)
134. Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : Late wood has fewer xylary elements with narrow vessels.
Reason R : Cambium is less active in winters.
In the light of the above statements, choose the correct answer from the options given below :
(1) A is false but R is true
(2) Both A and R are true and R is the correct explanation of A
(3) Both A and R are true but R is NOT the correct explanation of A
(4) A is true but R is false
Answer (2)
135. Large, colourful, fragrant flowers with nectar are seen in
(1) Wind pollinated plants (2) Insect pollinated plants
(3) Bird pollinated plants (4) Bat pollinated plants
Answer (2)
SECTION-B
136. Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : A flower is defined as modified shoot wherein the shoot apical meristem changes to floral
meristem.
Reason R : Internode of the shoot gets condensed to produce different floral appendages laterally at
successive node instead of leaves.
In the light of the above statements, choose the correct answer from the options given below :
(1) A is false but R is true
(2) Both A and R are true and R is the correct explanation of A
(3) Both A and R are true but R is NOT the correct explanation of A
(4) A is true but R is false
Answer (2)
- 28 -
NEET (UG)-2023 (Code-G1)
138. How many different proteins does the ribosome consist of?
(1) 20 (2) 80
(3) 60 (4) 40
Answer (2)
139. Given below are two statements : One labelled as Assertion A and the other labelled as Reason R :
Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air
currents.
Reason R : Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are
discharged and pollen tube is not formed.
In the light of the above statements, choose the correct answer from the options given below :
(1) A is false but R is true
(2) Both A and R are true and R is the correct explanation of A
(3) Both A and R are true but R is NOT the current explanation of A
(4) A is true but R is false
Answer (4)
140. Match List I with List II :
List I List II
A. Cohesion I. More attraction in liquid phase
B. Adhesion II. Mutual attraction among water molecules
C. Surface tension III. Water loss in liquid phase
D. Guttation IV. Attraction towards polar surfaces
Choose the correct answer from the options given below :
(1) A – II, B – I, C – IV, D – III (2) A – II, B – IV, C – I, D – III
(3) A – IV, B – III, C – II, D – I (4) A – III, B – I, C – IV, D – II
Answer (2)
141. Which one of the following statements is NOT correct?
(1) The amount of some toxic substances of industrial waste water increases in the organisms at
successive trophic levels
(2) The micro-organisms involved in biodegradation of organic matter in a sewage polluted water body
consume a lot of oxygen causing the death of aquatic organisms
(3) Algal blooms caused by excess of organic matter in water improve water quality and promote fisheries
(4) Water hyacinth grows abundantly in eutrophic water bodies and leads to an imbalance in the ecosystem
dynamics of the water body
Answer (3)
142. Which of the following statements are correct about Klinefelter’s Syndrome?
A. This disorder was first described by Langdon Down (1866).
B. Such an individual has overall masculine development. However, the feminine developement is also
expressed.
C. The affected individual is short statured.
D. Physical, psychomotor and mental development is retarded.
E. Such individuals are sterile.
Choose the correct answer from the options given below:
(1) A and E only (2) A and B only
(3) C and D only (4) B and E only
Answer (4)
- 29 -
NEET (UG)-2023 (Code-G1)
- 30 -
NEET (UG)-2023 (Code-G1)
List I List II
(Interaction) (Species A and B)
148. Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of
(1) Dinitrogenase (2) Succinic dehydrogenase
(3) Amylase (4) Lipase
Answer (2)
ZOOLOGY
SECTION-A
151. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex
and medulla.
Reason R: Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop
of Henle.
In the light of the above statements, choose the correct answer from the options given below:
(1) A is false but R is true.
(2) Both A and R are true and R is the correct explanation of A.
(3) Both A and R are true but R is NOT the correct explanation of A.
(4) A is true but R is false.
Answer (4)
- 32 -
NEET (UG)-2023 (Code-G1)
157. Which of the following are NOT considered as the part of endomembrane system?
A. Mitochondria
B. Endoplasmic reticulum
C. Chloroplasts
D. Golgi complex
E. Peroxisomes
Choose the most appropriate answer from the options given below:
(1) A, D and E only (2) B and D only
(3) A, C and E only (4) A and D only
Answer (3)
158. Which of the following statements are correct regarding female reproductive cycle?
A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle.
B. First menstrual cycle begins at puberty and is called menopause.
Answer (1)
- 33-
NEET (UG)-2023 (Code-G1)
159. Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its
early treatment?
Answer (3)
List I List II
(1) A-III, B-II, C-IV, D-I (2) A-II, B-III, C-IV, D-I
(3) A-II, B-III, C-I, D-IV (4) A-III, B-II, C-I, D-IV
Answer (2)
161. Given below are two statements: one is labelled as Assertion A and other is labelled as Reason R.
Assertion A : Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health
Care Programme.
In the light of the above statements, choose the correct answer from the options given below.
(3) Both A and R are true and R is NOT the correct explanation of A.
Answer (1)
Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is false but Statement II is true. (2) Both Statement I and Statement II are true.
(3) Both Statement I and Statement II are false. (4) Statement I is true but Statement II is false.
Answer (2)
- 34 -
NEET (UG)-2023 (Code-G1)
- 35-
NEET (UG)-2023 (Code-G1)
167. Broad palm with single palm crease is visible in a person suffering from-
(1) Thalassemia
(2) Down’s syndrome
(3) Turner’s syndrome
(4) Klinefelter’s syndrome
Answer (2)
168. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of
endometrium.
In the light of the above statements, choose the correct answer from the options given below:
(3) Both A and R are true but R is NOT the correct explanation of A.
Answer (3)
Answer (1)
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is false but Statement II is true.
(2) Both Statement I and Statement II are true
(3) Both Statement I and Statement II are false.
(4) Statement I is true but Statement II is false.
Answer (1)
171. Which one of the following common sexually transmitted diseases is completely curable when detected early
and treated properly?
Answer (3)
- 36 -
NEET (UG)-2023 (Code-G1)
(1) A-I, B-II, C-III, D-IV (2) A-III, B-I, C-IV, D-II
(3) A-IV, B-III, C-II, D-I (4) A-II, B-IV, C-I, D-III
Answer (2)
175. Which one of the following symbols represents mating between relatives in human pedigree analysis?
(1) (2)
(3) (4)
Answer (3)
176. Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.
(1) Lemur, Anteater, Wolf (2) Tasmanian wolf, Bobcat, Marsupial mole
(3) Numbat, Spotted cuscus, Flying phalanger (4) Mole, Flying squirrel, Tasmanian tiger cat
Answer (3)
- 37-
NEET (UG)-2023 (Code-G1)
(3) A-I, B-II, C-IV, D-III (4) A-III, B-IV, C-I, D-II
Answer (2)
180. Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by
(1) Pyloric sphincter (2) Sphincter of Oddi
(3) Ileo-caecal valve (4) Gastro-oesophageal sphincter
Answer (3)
- 38 -
NEET (UG)-2023 (Code-G1)
B. Ball and Socket Joint II. Between adjacent vertebrae in vertebral column
(1) A-II, B-IV, C-III, D-I (2) A-III, B-I, C-II, D-IV
(3) A-II, B-IV, C-I, D-III (4) A-I, B-IV, C-III, D-II
Answer (3)
184. In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?
(1) Eosinophils (2) TH cells
(3) B-lymphocytes (4) Basophils
Answer (2)
- 39-
NEET (UG)-2023 (Code-G1)
SECTION-B
186. Select the correct statements with reference to chordates.
A. Presence of a mid-dorsal, solid and double nerve cord.
B. Presence of closed circulatory system.
C. Presence of paired pharyngeal gill slits.
D. Presence of dorsal heart
E. Triploblastic pseudocoelomate animals.
Choose the correct answer from the options given below:
(1) C, D and E only (2) A, C and D only
(3) B and C only (4) B, D and E only
Answer (3)
187. Which of the following statements are correct regarding skeletal muscle?
A. Muscle bundles are held together by collagenous connective tissue layer called fascicle.
B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions.
C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins.
D. M line is considered as functional unit of contraction called sarcomere.
Choose the most appropriate answer from the options given below:
(1) C and D only
(2) A, B and C only
(3) B and C only
(4) A, C and D only
Answer (3)
188. Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA
formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?
(1) 3’ ATCGATCGATCGATCGATCGATCGATCG 5’
(2) 5’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3’
(3) 3’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5’
(4) 5’ ATCGATCGATCGATCGATCGATCGATCG 3’
Answer (4)
189. Given below are two statements:
Statement I : During G0 phase of cell cycle, the cell is metabolically inactive.
Statement II : The centrosome undergoes duplication during S phase of interphase.
In the light of the above statements, choose the most appropriate answer from the options given below:
(1) Statement I is incorrect but Statement II is correct.
(2) Both Statement I and Statement II are correct
(3) Both Statement I and Statement II are incorrect.
(4) Statement I is correct but Statement II is incorrect.
Answer (1)
- 40 -
NEET (UG)-2023 (Code-G1)
190.
Which of the following are NOT under the control of thyroid hormone?
Answer (4)
A. Phallic gland
B. Urecose gland
C. Nephrocytes
D. Fat body
E. Collaterial glands
Answer (4)
List I List II
(1) A-III, B-IV, C-II, D-I (2) A-I, B-II, C-IV, D-III
(3) A-II, B-III, C-I, D-IV (4) A-II, B-I, C-IV, D-III
Answer (4)
- 41-
NEET (UG)-2023 (Code-G1)
193. Which of the following is characteristic feature of cockroach regarding sexual dimorphism?
(1) Presence of anal cerci
(2) Dark brown body colour and anal cerci
(3) Presence of anal styles
(4) Presence of sclerites
Answer (3)
Answer (3)
197. The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure,
rage, fear etc. are:
(1) Corpus callosum and thalamus
(2) Limbic system and hypothalamus
(3) Corpora quadrigemina and hippocampus
(4) Brain stem and epithalamus
Answer (2)
- 42 -
NEET (UG)-2023 (Code-G1)
(3) A-II, B-III, C-I, D-IV (4) A-II, B-IV, C-I, D-III
Answer (2)
- 43-