Probiotics & Antimicro. Prot.

DOI 10.1007/s12602-017-9296-4

Lactobacillus salivarius NK02: a Potent Probiotic for Clinical

Application in Mouthwash
Neda Sajedinejad 1,2,3 & Mojgan Paknejad 1 & Behzad Houshmand 4 & Hakimeh Sharafi 2 &
Reza Jelodar 3 & Hossein Shahbani Zahiri 2 & Kambiz Akbari Noghabi 2

# Springer Science+Business Media New York 2017

Abstract A specific strain of naturally occurring oral gingival index (GI) and bleeding on probing (BOP) compared
lactobacilli was isolated and identified based on morphologi- with that of SRP + placebo for the probiotic group. The rate of
cal, biochemical, and 16S rRNA gene sequencing. The phy- decrease in pocket depth was displayed in the group with SRP
logenetic affiliation of the isolate confirmed that the NK02 + probiotic treatment equal to 1/2 mm, and probing pocket
strain had close association with the Lactobacillus salivarius. depth (PPD) value was decreased in the probiotic bacteria
An effective mouthwash was developed for treatment of peri- treatment group that can explain the decrease in inflammation
odontitis and suppression of the indicator bacterium in gingiva. Our findings suggest that probiotic mouthwash is
Aggregatibacter actinomycetemcomitans which is an obvious healthy for daily use as an alternative for maintaining dental
pathogen of periodontal disease. The mouthwash containing and periodontal health.
L. salivarius NK02 was tested at a dose level of 108 (colony
forming units (CFU) ml−1), monitoring over a period of Keywords Probiotic . Lactobacillus salivarius NK02 .
4 weeks. The study was a randomized double-blind placebo Aggregatibacter actinomycetemcomitans . Periodontal
control trial, and the patients were treated in two groups of diseases
control and test by using scaling and root planing (SRP) +
placebo and scaling and root planing (SRP) + probiotic, re-
spectively. It appeared that the probiotic mouthwash was able Introduction
to inhibit the bacterial growth on both saliva and sub-gingival
crevice and exhibited antibacterial activity against The use of probiotics in the medical field is growing as more
A. actinomycetemcomitans. The results also showed that evidence accumulates supporting their benefits. Given that pro-
SRP+ probiotic treatment led to a significant decrease of biotic bacteria impact human health, applying probiotics to pre-
vent or treat a wide range of diseases has appeared to be a
promising new therapy [1–3]. However, the act of choosing
Neda Sajedinejad and Mojgan Paknejad equally contributed.
microorganisms for use as probiotic treatments should follow
careful consideration procedure. Application of probiotics for
* Kambiz Akbari Noghabi
[email protected]
oral health care has received much greater attention during the
past few years; however, most of the efforts are currently focus-
1
Faculty of Dentistry, Tehran University of Medical Sciences,
ing on adopting gastrointestinal probiotic bacterium [4].
Tehran, Iran Periodontal diseases are one of the most common diseases in
2
Division of Environmental & Industrial Biotechnology, National
human societies. Unbalanced oral microbial flora is an important
Institute of Genetic Engineering and Biotechnology (NIGEB), risk for human body against these diseases. Various pathogens
P.O. Box 14155-6343, Tehran, Iran are involved in causing periodontal disease. These pathogens
3
Faculty of Dentistry, Zanjan University of Medical Sciences, mostly live in biofilm in human mouth and aggravate their path-
Zanjan, Iran ogenic activity there [5]. In fact, periodontitis is mostly related to
4
Faculty of Dentistry, Shahid Beheshti University of Medical disproportionate microflora resulting in overgrowth of periodon-
Sciences, Tehran, Iran tal pathogens such as Porphyromonas gingivalis, Prevotella
 Probiotics & Antimicro. Prot.

intermedia, and A. actinomycetemcomitans, [6]. Among these 3. Mouthwash preparation for transferring probiotic bacteria
bacteria, A. actinomycetemcomitans (previously Actinobacillus to oral cavity
actinomycetemcomitans) is a true pathogen for the occurrence of 4. Evaluating effect of probiotics against periodontitis
periodontal diseases. This bacterium is one of the most impor-
tant factors affecting the initiation and progression of these dis-
eases due to its high level of virulence factors [7]. The treatment
of periodontal disease at very early stages depends upon omit- Materials and Methods
ting pathogens from the oral environment in different ways such
as scaling and root planing (SRP), antibiotic therapy, and surgi- Isolation and Identification of Lactobacilli Isolates
cal treatment. and Aggregatibacter actinomycetemcomitans
Although successful treatment of periodontitis will re-
sult in tooth surfaces free of plaque in a long-term perspec- For isolation of probiotic Lactobacillus strains from mouth
tive, it will not be able to maintain an environment which is saliva, 25 patients with moderate to severe chronic periodon-
free of plaque. Antibiotics are used as complementary ther- titis (according to radiographic and clinical findings con-
apies for treating periodontal disease that accompany some firmed by two periodontists) and 25 healthy volunteers were
disadvantageous effects, including changes in the bacterial selected.
flora of body, destruction of all strains of the bacterial Inclusion criteria for periodontal patients were as follows:
flora, antibiotic resistance, etc., while probiotic bacteria
are complementary therapeutic means that do not have dis- 1. Presence of bone loss due to periodontal infection
advantages of antibiotics. In fact, considering the effect of 2. Presence of periodontal pockets more than 5 mm
probiotic bacteria on pathogen bacteria in the body as well 3. Having complete health situation
as other useful properties that they have makes them a
good alternative for treatment of periodontal diseases [8, The patients were not included in the following cases:
9]. The ability of probiotics to stick to saliva-coated sur-
faces varies among different species. It has been reported 1. Patients suffering from systemic diseases (intolerance to
that Lactobacillus rhamnosus and L. paracasei strains lactose and immune deficiency diseases, etc.)
have durable binding activity. Haukioja et al. [10] have 2. Administration of immunosuppressive medicines by the
shown that probiotic lactobacilli (L. rhamnosus GG, patients
L. casei) may affect oral ecology by preventing adherence 3. Usage of antibiotics by the patients in the last 3 months
of other bacteria by altering the protein composition of the 4. Smoking
salivary pellicle. Eventually, once a species is firmly at- 5. Pregnant patients or breastfeeding mothers
tached to the oral biofilm structures, it could be anticipated 6. Using other probiotic products in the last 3 months
to disturb the development of the pathogenic character of 7. Patients undergone periodontal treatment in the last
the species based on antimicrobial activity, which indeed is 3 months
another evaluation principle for probiotic bacteria. It was
found that destruction and inflammation at periodontal After providing a verbal and written consent, sampling was
sites are closely associated with reduced level of certain done from unstimulated saliva of selected patients (after at
lactic acid-dependent bacteria such as streptococci and aer- least 2 h of not eating anything). Individual saliva samples
obic coryneforms [11]. Sookhee et al. [12] isolated 3790 were collected in sterile-capped plastic vials and transferred
strains of lactic acid bacteria from 130 individuals and to the laboratory immediately on an ice pack. One milliliter of
found that L. paracasei and L. rhamnosus had a high ca- collected saliva samples was dissolved in 9 ml sterile normal
pacity to control important oral pathogens including saline to obtain 10-fold serial dilution series. An appropriate
Streptococcus mutants and P. gingivalis. Here, we are the diluted solution (0.1 ml) was spread onto the MRS agar plates
first to mention the isolation and identification of an indig- (Merck, Germany) for isolation of lactobacilli. All plates were
enous probiotic strain of Lactobacillus salivarius with sig- incubated at 30 °C for 48–72 h under anaerobic conditions.
nificant capability to produce antibacterial compounds that After subsequent culture and sub-culture to obtain distinct
may be appropriate for application in managing periodon- colonies, the non-spore-forming cells with Gram-positive
tal diseases. This work was accomplished by the following: short rod-shaped and catalase-negative characteristics are gen-
erally considered as lactobacilli. These colonies were sub-
1. Isolation and testing of a selected probiotic strain from cultured into the MRS broth, and glycerol stocks (15% v/v)
oral cavity of the isolates were prepared for further studies.
2. Reviewing and testing the effects of probiotics against Aggregatibacter actinomycetemcomitans is an important
pathogens pathogen which is associated with periodontal disease. To
Probiotics & Antimicro. Prot.

isolate this bacterium, sub-gingival samples from patients Lactobacillus strain. Bile salt hydrolase is one of the most
with chronic periodontitis were collected and inoculated into important properties of probiotic bacteria. PCR primers were
a highly selective medium for A. actinomycetemcomitans used with the following sequences: 5′CGTATCCAAGTGCT
(AASM), and incubated at 37 °C for 48 h in a 5% CO2 incu- CATGGTTTAA3′ (nucleotide position 150,568 to 150,593 of
bator [13]. Several colonies (which seemed to be the bsh gene), 5′ATGTGTACTGCCATAACTTATCAATC
A. actinomycetemcomitans based on catalase production and TT3′ (bsh rev). The primers were designed to produce a
colony morphology on AASM plates) were sub-cultured to PCR product length of 919 bp. DNA amplifications were set
affirm the existence of A. actinomycetemcomitans. Pure cul- as follows: 4 min at 94 °C and 30 cycles of 30 s at 94 °C, 30 s
tures of each isolate were recognized on the basis of colony at 64 °C, and 1 min at 72 °C; the final extension step consisted
morphology, Gram staining, and catalase activity. of 10 min at 72 °C.

Strain Selection Based on Antibacterial Activity Tolerance to Acidic pH

Against A. actinomycetemcomitans
To evaluate the tolerance of the selected Lactobacillus strain
To evaluate the antibacterial activity of the 15 lactobacillus iso- to acidic pH, the isolate was grown in MRS broth at 37 °C
lates against A. actinomycetemcomitans, each fresh culture of the overnight. Then, 0.5-ml aliquots of cell suspension was with-
Lactobacillus isolates were individually streaked (on a straight drawn and adjusted to pH 2.0, 5.0, 7.0, and 9.0 with 1 M HCl
line) onto BHI (Brain Hearth Infusion) agar plate and incubated and 0.5 M NaOH, and incubated at 37 °C for 120 min (final
at 30 °C for 24 h. A. actinomycetemcomitans was then perpen- inoculum was around 5 × 105 CFU/ml). Samples were taken
dicularly streaked across the line of the isolates, and plates were every hour, and the viable number of bacterium was calculated
incubated anaerobically (as mentioned above) accordingly. The by pour plate counts of all samples using 10-fold serial dilu-
zone of inhibition close to lactobacillus isolates were measured tions prepared in 0.1% peptone water. Concurrently, bacterial
and considered as positive results. From all the lactobacilli iso- growth was examined by evaluating absorbance at 600 nm
lates examined, an isolate which showed a superior antibacterial with a spectrophotometer [16]. Survival of isolates was eval-
activity against A. actinomycetemcomitans was selected for fur- uated as the percentage of growth compared to the control.
ther examinations. Experiments were repeated twice in any case, This experiment was repeated twice with three independent
and each determination was performed in triplicate. replicates per experiment (in the same conditions). Values
were regarded as mean ± standard deviation.
Identification of the Selected Isolate
Bile Resistance
After obtaining axenic cultures of 15 lactobacilli isolates, an iso-
l at e ( w i th h i g he s t a nt i ba c t e ri a l a c t iv i ty a g a i ns t The ability of the selected Lactobacillus strain to grow in
A. actinomycetemcomitans) was selected and identified on the percent of 0.3, 0.5, and 1.0% of bile (w/v) was determined
basis of its biochemical characteristics accompanied by 16S ri- according to the method of Vinderola and Reinheimer [17].
bosomal RNA (rRNA) gene sequencing [14]. The single bands According to this method, Lactobacillus strain was inoculated
of PCR products demonstrating the size of about 540 bp were (2% v/v) into MRS with either 0.3, 0.5, or 1% (w/v) of bile and
purified using a PCR purification kit (Roche Applied Science, culture was incubated at 37 °C for 24 h. Thereafter, viable
Germany). Sequencing of the amplified fragment was performed counts of Lactobacillus strain were determined by pour plate
on an ABI PRISM 377 automated analyzer. 16S rRNA sequence counts and the growth rate of the bacterium was measured at
homology with other reference strains was examined using the A560 nm and compared to a control culture. The results were
Basic Local Alignment Search Tool (BLAST) version 2.2.12 expressed as the percentage of growth (A560 nm) in the pres-
provided by the National Center for Biotechnology Information ence of bile salts compared to the control (culture with 0% bile
(NCBI). Finally, the multiple sequence alignments were achieved considered as a control sample). This experiment was repeated
using Clustal W software and a consensus neighbor-joining tree twice with three independent replicates per experiment (in the
was constructed using the molecular evolutionary genetic analy- same conditions). Values signify mean ± standard deviation.
sis (MEGA) software 6.0 [15].
Antibacterial Activity
Probiotic Features of Isolated Lactobacilli
Detection of the selected Lactobacillus strain with antibacte-
Bile Salt Hydrolase Gene Analysis by PCR rial activity and evaluation of its effectiveness against some
indicator microorganisms were done by well diffusion assay.
PCR was done to screen the presence of the bsh gene respon- For the agar well diffusion assay, an overnight culture of the
sible for encoding bile salt hydrolase (BSH) by a selected indicator organisms including Staphylococcus aureus PTCC
 Probiotics & Antimicro. Prot.

1112, Bacillus subtilis PTCC 1715, B. cereus PTCC 1015, centrifugation, and the cells were suspended in phosphate
E. coli PTCC 1338, Salmonella typhimurium (wild type), buffer (0.1 M, pH 8.0) containing 0.3 and 0.1% (w/v) of bile
Klebsiella pneumonia PTCC 1290, Pseudomonas aeruginosa and pancreatin (Sigma-Aldrich), respectively. The cells were
PTCC 1310, and E. coli O-157 were engaged to spray on kept for a further 60 min at 34 °C and then counted by pour
Muller Hinton agar plates (approximately 106 cells ml−1 of plate counts. Washed cells were suspended in phosphate buff-
indicator strains were overlaid onto MHA agar plates) at er and subjected to the same conditions as treated samples
37 °C. Then, wells of 5 mm diameter were cut into agar plates were used as controls. Survival rate was calculated as percent-
(under sterile conditions) and 100 μl of the cell-free culture of age of the CFU ml−1 after 30, 60, 70, 80, and 90 min compared
the selected Lactobacillus strain (with OD = 1) was transferred to the CFU ml−1 at time 0. This experiment was repeated twice
into the formed wells in the agar plates, while MRS medium with three independent replicates per experiment (in the same
served as control. Inhibitory zone of the Lactobacillus strain conditions). Values denote mean ± standard deviation.
was checked after 24 h incubation at 37 °C.
Lysozyme Resistance
Screening for Bile Salt Hydrolytic Activity
Overnight culture of the isolate were pelleted by centrifuga-
For BSH activity, overnight cultures of the Lactobacillus iso- tion, washed twice with phosphate buffer (0.1 M, pH 7.0), and
late were spotted on MRS agar plates containing 0.37 g l−1 suspended in 2 ml of Ringer solution (Sigma-Aldrich). Then,
CaCl 2 and 0.5% sodium salt of glycodeoxycholic acid 10% of the bacterial suspension was inoculated in a sterile
(GDCA) (Sigma-Aldrich). Plates were anaerobically incubat- electrolyte solution consisting of SES (0.22 g l−1 CaCl2,
ed at 37 °C for 72 h. Visible halos around the punctures (a 6.2 g l−1 NaCl, 2.2 g l−1 KCl, 1.2 g l−1, and NaHCO3) in the
granular precipitate around the white colonies) indicate the presence of 100 mg l−1 of lysozyme (Sigma-Aldrich) [20].
positive BSH activity of the strain [18]. Negative control Bacterial suspension in SES without lysozyme was consid-
was the inocula of each strain in MRS without supplementa- ered as control. Samples were incubated at 37 °C, and colony
tion. This experiment was repeated twice with three indepen- count of samples was carried out after 30 and 120 min on
dent replicates per experiment (in the same conditions). Values MRS agar (48 h, 30 °C). Survival rate was calculated as per-
denote mean ± standard deviation. centage of the CFU ml−1 after 30 and 120 min compared to the
CFU ml−1 at time 0. This experiment was repeated twice with
Tolerance to NaCl three independent replicates per experiment (in the same con-
ditions). Values denote mean ± standard deviation.
NaCl tolerance of the selected Lactobacillus strain was deter-
mined by providing test tubes containing MRS broth with
different concentrations of NaCl (1–3–5%). After sterilization, Determination of Antibiotic Resistance
each test tube was inoculated with 1% (v/v) fresh overnight
culture of the Lactobacillus isolate and incubated at 37 °C for The selected Lactobacillus strain was tested for resistance to
24 h. After 24 h of incubation, growth was determined by different antibiotics including amoxicillin, ampicillin,
observing turbidity (optical density of the samples measured cefixime, azithromycin, tetracycline, gentamicin, chloram-
at a wavelength of 600 nm), compared with MRS without phenicol, and streptomycin. The test was performed using
NaCl as control. This experiment was repeated twice with the standard disc diffusion method [21]. The results were
three independent replicates per experiment (in the same con- expressed as sensitive (S) or resistant (R).
ditions). Values denote mean ± standard deviation.
Preparing Probiotic Mouthwash
Tolerance to Simulated Gastric Juice
The probiotic mouthwash product contained the selected spe-
Pellet of overnight culture of the selected Lactobacillus strain cies of interest with a possible functional role in maintaining a
was obtained by centrifugation, washed twice with phosphate healthy oral environment. The mouthwash product was sup-
buffer (0.1 M, pH 7.0), resuspended in SES (sterile electrolyte plied to study subjects as a dry powder in a 20-ml amber glass
solution), and immediately added to the same volume of bottle with a rubber stopper and crimp. Each bottle contained
Bgastric^ solution [0.6% (w/v) pepsin, 1% (w/v) NaCl]. Cell approx. 108 colony forming units (CFU) ml−1 of the selected
suspensions were immediately placed in a water bath (37 °C) Lactobacillus strain. The freeze-dried bacterium was blended
and gradually acidified, under gentle agitation, from pH 5.0 to with food grade maltodextrin as a bulking agent. The single-
2.2 in 90 min [19]. Cell counts on MRS agar were performed dose product containers were stored and sealed at room tem-
at times 0, 30, 60, 70, 80, and 90 min. After 90 min, an aliquot perature until use. The subjects were instructed to mix the
of each cell suspension was taken and pelleted by product with approx. 15 ml of bottled or tap water prior to
Probiotics & Antimicro. Prot.

application. The reconstituted mouthwash was then swished molar in each jaw was recorded. These parameters were eval-
for 30 s before being expectorated. uated by an expert (after calibration) out of the study via
Mouthwash and placebo were numbered by the manufac- Williams probe (Williams calibrated, Hu-Friedy, USA).
turer. Placebo mouthwash and the probiotic one were quite
similar in shape, nutrients, and taste; the only difference was Sampling and Clinical Examinations
the presence or absence of bacterial strain.
Participants were randomly allocated by a computer-
Clinical Trial Design generated list to receive one of the two treatments (SRP and
probiotic mouthwash or SRP and placebo). A balance block
This research was a randomized double-blind placebo control randomization was used to prepare the randomization tables in
to evaluate the effects of probiotic mouthwash and scaling and order to avoid unequal balance between the two treatment
root planing (SRP) on clinical and microbiological parameters groups. Allocation was implemented by a person not involved
of moderate to severe periodontitis. A total of 50 patients with in the study. To maintain randomization and blindness, testing
chronic periodontitis referred to the Department of and marking mouthwashes was done by a statistical consul-
Periodontology, and 50 periodontal healthy subjects were se- tant. After this stage, scaling and root planing was done for all
lected for this research. An informed consent form was ob- the patients via hand instruments (Gracey curettes, Hu-Friedy)
tained from all subjects. In addition, a written signed consent and ultrasonic scalars (Cavitron Select, Dentsply). Scaling and
document was obtained from each human subject. Healthy root planing were performed until the root surface felt smooth
subjects were included in this study as having no radiographic and clean. After that, oral hygiene instructions like brushing
or clinical signs of periodontal destruction. Each patient was techniques (Modified Stillman twice a day, flossing once a
examined by two periodontists to assure the accurate diagno- day, and interproximal brushing) were explained by a special-
sis. All participants were evaluated by full mouth probing. ist to the patients. Mouthwashes were given to patients, and
Diagnosis of moderate to severe periodontitis was made based they were asked to use it for 28 days. Twenty milliliters of
on the following criteria: mouthwash was used twice a day after brushing the teeth.
After washing by mouthwash, patients had to avoid eating
1. PPD ≥4 mm or drinking for 2 h.
2. CAL ≥3 mm After probiotic mouthwash treatment, the samples were
3. Bone loss ≥3 mm collected from whole saliva (non-irritation saliva) and sub-
gingival plaque from the deepest gingival pocket. These sam-
Patients with the following criteria were excluded: ples were collected with three paper points that inserted into
In case they had used antibiotics (in the past 3 months), had the deepest part of the pockets. The samples were transferred
a background of systemic diseases associated with chronic to the lab in sterile containers containing anaerobic transfer-
periodontitis, had received previous periodontal treatment (in ring medium (mineral salt-base semi-solid media with reduc-
the past 1 year), used probiotic products (in the past 3 months), tive agents designed as a holding medium for maintaining
have lactose tolerance, are smoking, and are using drugs. viability of microorganisms). One hundred microliters of the
Accordingly, a study followed 40 patients and 50 periodontal proper dilutions of these samples was plated, in triplicate, on
healthy subjects aged between 24 and 52 years including 45 AASM agar plates. All plates were incubated for 72 h at 37 °C
female and 45 male. After patients’ arrival to the clinic, peri- in a 5% CO2 incubator. Subsequently, the number of colony
odontal index and microbiological samples were taken. forming units was calculated. Finally, each patient’s clinical
Periodontal indices such as plaque index (PI) and O’Leary parameters were recorded at baseline and 14 and 28 days.
index (Full-Mouth Plaque Score (FMPS)) were expressed in
percent, and based on observation of plaque on four surfaces Statistics
of each tooth in a limited proportion to the whole surfaces of
every tooth, gingival index (GI) [22], periodontal disease in- All (continuous) variables were compared by ANCOVA in
dex (Ramfjord), bleeding on probing index (Ainamo and Bay) which the post-intervention values of indices were considered
were used [23]. Bleeding was observed for 10–15 s in the as dependent variables. The pre-intervention values and inter-
gingival pocket (probing number B1^ was given as scale of vention were considered as covariate and independent vari-
presence of bleeding and number B0^ was considered in case ables, respectively. Before conducting the ANCOVA, the nor-
there was no bleeding), and periodontal pocket depth (PPD) mality of data, Levene’s test of homogeneity of variance, and
measured from the free gingival margin to the base of the homogeneity of regression (slope) were checked. P values less
periodontal pocket with slight manual force (0.25 N) for six than 0.05 were considered as statistically significant.
points (mesio-buccal, mid-buccal, disto-buccal, mesio-lin- Statistical analysis was performed using IBM SPSS
gual, mid-lingual, and disto-lingual) from first molar to first Statistics (version 20).
 Probiotics & Antimicro. Prot.

Results selected strain still showed survival higher than 7 logs

CFU ml−1.
Selection of Best Lactobacilli Strain on the Basis L. salivarius NK02 demonstrated the ability to hydrolyze
of Antibacterial Activity sodium salt of glycodeoxycholic acid, as shown by halos and
granular precipitates around the colonies after growth in
Among 15 Lactobacillus strains examined in this study, a MRS-GDCA. The current results showed that the NK02 strain
strain with the highest antibacterial activity against was able to tolerate 1–5% of NaCl and the highest growth was
A. actinomycetemcomitans was selected among all the isolates achieved at 1% of NaCl (not shown here).
and identified by 16S rRNA gene sequencing. Morphological The effect of pH on the NK02 strain was tested, and the
and biochemical characteristics of the selected isolate showed number of viable cells and survival percentage at each pH
that the strain NK02 was a Gram-positive, catalase-negative, were determined. The bacterial survival and viability to pH
non-spore-forming rod. Results from 16S rRNA gene se- changes was evaluated, and results showed that the NK02
quencing identified our strain as L. salivarius with 100% sim- strain had a high survival rate at acidic pH (not shown). The
ilarity to L. salivarius DSPV 022SA. We tentatively labeled test strain showed antibacterial effects against different Gram-
our strain as L. salivarius NK02 and deposited it in GenBank positive, Gram-negative bacteria (Table 2). The results indi-
with the accession number JX129916.1 (Fig. 1). cated that the selected isolate was susceptible to most of the
antibiotics tested, while resistance to the antibiotics was ob-
served in some rare cases. It was also found that the NK02
Probiotic Features of the Selected Lactobacillus Strain strain was susceptible to the major classes of antibiotics used
in human clinical therapy. The NK02 strain was susceptible to
BSH activity and bile tolerance is one of the most critical amoxicillin, ampicillin, cefixime, azithromycin, tetracycline,
features for probiotic bacteria. To search for the presence of gentamicin, and chloramphenicol and resistant to streptomy-
bsh genes, associating with probiotic features, the selected cin (data not shown here).
strain was examined on the basis of species-specific PCR for
bsh gene. The results indicated that the NK02 strain produced
the expected size of amplicon for bsh gene (data not shown Bacterial and Clinical Parameters
here).
The overall resistance of the strain to lysozyme was Our results showed that the ANCOVA assumptions are met.
expressed in percentage of survival with the value of The Kolmogorov–Smirnov tests were not significant, and the
90.87% (after 120 min). The strain showed a capability to data are normally distributed. Levene’s test confirmed the hy-
grow in the presence of bile with a maximum value of pothesis of equality of the error variances between the two
79.87%. Regarding resistance of the NK02 strain in simulated groups (all p values were greater than 0.05 for both the pre-
gastric juice conditions (Table 1), results showed that no sig- and post-intervention values of all the variables). The homo-
nificant difference was observed within the first 60 min when geneity of regression slope assumption was not violated,
pH decreased from 5.0 to 2.5. L. salivarius NK02 did not where interactions between independent variables
show a significant decrease in number of cells after 70 min (intervention) and covariates (pre-intervention values) were
(pH 2.4) and 80 min (pH 2.3). At the end of the test, when the not significant (all p values >0.05). The baseline data and
simulated gastric juice reached pH of 2.2 (after 90 min), the the adjusted means were reported as follows:

Fig. 1 Phylogenetic tree of

Lactobacillus salivarius NK02.
Numbers at the nodes indicate the
bootstrap values on neighbor
joining analysis
Probiotics & Antimicro. Prot.

Table 1 Effect of simulated

gastric juice on selected Strains Population size (log mean CFU ml−1) at different times
Lactobacillus strain during
90 min of gastric transit (P value t0 t30 t60 t70 t80 t90
<0.05) pH 5.0 pH 3.8 pH 2.5 pH 2.4 pH 2.3 pH 2.2

L. salivarius 9.40 ± 0.03 9.54 ± 0.04 9.50 ± 0.02 9.76 ± 0.05 9.55 ± 0.02 7.48 ± 0.07
NK02

Some baseline periodontal indices in the two groups are as probiotics is BSH activity, hydrolyzing the bile salts which it
follows: In the control group, plaque index, bleeding on prob- makes up at the first place, and it is one of the mechanisms
ing (BOP), probing pocket depth (PPD), gingival index (GI), through which the bacteria are protected against bile. This is a
and periodontal index were 58.6, 62.7, 2.55, 1.6, and 2.97, vitally important mechanism of probiotic bacteria especially
respectively, and for the test group they were 61.7, 62.3, lactobacilli [25, 26]. The current study showed that
2.67, 1.42, and 1.91, respectively (Fig. 2). After using mouth- L. salivarius NK02 is resistant to pH level of 2.5, and also it
washes, periodontal indices were changed. BOP and PPD and has an average resistance to bile exposure. In addition, the
gingival index were significantly decreased in the test group concentration of bile ranges from of 0.3 to 1%; however,
compared to the control group. Changes in PDI (periodontal Mathara et al. [27] used a 0.3% dose of this component in
disease index) and PI were not significantly different. their study before, as well (average level of resistance was
The colony counts of A. actinomycetemcomitans in saliva shown when more than 50% of the bacteria grew in the case
and sub-gingival crevice was as follows: control 6.77 and 7.08 compared to the control). Using similar doses of the NK02
test 6.62 and 7.15 (Table 3). After using the probiotic mouth- strain with the same characteristics in the GI tract, we showed
washes for a 28-day period, the reduced bacterial colony count more successful results (1.0 h incubation at pH 2.2 in the
of A. actinomycetemcomitans in the test group was significant presence of 0.3% bile) [28]. In the current study, we investi-
compared to that of the control group (Table 4). The whole gated the effects of a selected probiotic Lactobacillus strain
experimental setup is shown in Fig. 3. isolated from the mouth on some of the clinical and microbi-
ologic indices of periodontal disease. The study was a ran-
domized double-blind placebo-controlled trial, and the pa-
Discussion tients were treated in two groups of control and test by using
(SRP + placebo) and (SRP + probiotic), respectively. The
New horizons have appeared in the field of periodontal dis- periodontal and microbiologic indices were studied in patients
ease treatment thanks to probiotic bacteria especially during treatment. The results showed that SRP + probiotic
Lactobacillus species and Bifidobacteria. Presence of treatment led to a significant decrease of GI and BOP com-
probiotics in microflora of human mouth can guarantee more pared with that of SRP + placebo for the probiotic group. This
successful treatment of these diseases since it proves these result is consistent with Krass et al. [29]. They studied how
bacteria are consistent with the ecosystem of human mouth. Lactobacillus reuteri decreases gingivitis and plaque index
Bacteria are under a lot of stresses in human mouth, for and came into the conclusion that probiotic L. reuteri is sig-
example, lysozyme enzymes in human saliva first put these nificantly efficient in decreasing gingivitis and plaque index in
bacteria under stress, then in stomach these bacteria are ex- patients with moderate to severe gingivitis. In addition,
posed to pH levels of 1.5 to 3, after which they have to tolerate Vivekananda et al. [30] showed that probiotic-based mouth-
bile [24]. These bacteria spices must be resistant to a dose of wash (probiotic L. reuteri) is significantly efficient in decreas-
100 mg ml−1 of lysozyme as well. So, one special feature of ing BOP level, compared to just SRP (35% decrease in BOP

Table 2 Antimicrobial activity of selected Lactobacillus strain against some indicator microorganisms

Strains S. aureus B. subtilis B. cereus E. coli S. typhimurium K. pneumonia P. aeruginosa E. coli O-157
(PTCC 1112) (PTCC 1715) (PTCC1015) (PTCC 1338) (wild type) (PTCC 1290) (PTCC 1310) (PTCC)

L. salivarius ++ ++ ++ + + + + +
NK02

Antimicrobial activity detected as zones of inhibition with diameters of (−), no inhibition; (+), <10 mm; (++), 10–20 mm; (+++) >20 mm. All assays were
carried out by using agar well-diffusion assay test
 Probiotics & Antimicro. Prot.

Fig. 2 Linear models of changes in bleeding on probing (BOP), probing pocket depth (PPD), and gingival index (GI) during 28 days of study. They
show the amount of these indices on days 0, 14, and 28. Groups A and B represent placebo and treatment group, respectively

in day 42), which proves our findings, as well (48% decrease shown in the group with SRP + probiotic treatment (1/31 mm)
in BOP in the day 28). which was twice greater than that of SPR alone and probiotic
They also found that the use of probiotic mouthwash liquid treatment only. In our study, a decreased level of PPD for
led to a more meaningful decrease of PPD, compared with that SRP + probiotic was 1.2 mm which was similar to the results
of placebo. The highest rate of decrease in depth of pocket was of Vivekananda et al. [30], as well. In addition, Twetman et al.

Table 3 Baseline clinical and

microbiological findings (day 0) Sex Control (placebo) (n = 10) Case (probiotic) (n = 10)
(P value <0.05)
Female 7 (70%) 7 (70%)
Male 3 (30%) 3 (30%)
Age 45.5 ± 8.02 44.8 ± 13.8
Plaque index baseline 58.62 ± 9.89 61.7 ± 12.5
BOP baseline 62.07 ± 15.42 62.3 ± 17.4
Colony count of saliva (day 0) 6.77 ± 0.27 6.62 ± 0.34
Colony count of sub-gingival (day 0) 7.08 ± 0.13 7.15 ± 0.3
Pocket depth (day 0) 2.55 ± 0.88 2.67 ± 0.62
Gingival index (GI) (day 0) 1.6 ± 0.55 1.42 ± 0.63
Periodontal disease index (PDI) (day 0) 1.91 ± 0.48 2.97 ± 1.08
Probiotics & Antimicro. Prot.

Table 4 Clinical and

microbiological findings on day Day 14 Day 28
14 and 28 (P value <0.05)
Placebo Probiotic Placebo Probiotic
(n = 10) (n = 10) (n = 10) (n = 10)

Plaque index (PI) 45 ± 11.19 50.21 ± 9.6 42.9 ± 12.77 46.79 ± 10.08
BOP 60.2 ± 17.39 23.8 ± 8.04 64.3 ± 18.18 12.84 ± 5.96
Colony count of saliva 6.42 ± 0.32 5.84 ± 0.52 6.08 ± 0.43 4.48 ± 0.41
Colony count of crevice 6.71 ± 0.33 6.3 ± 0.27 6.5 ± 0.34 5.2 ± 0.41
Pocket depth (PD) 2.35 ± 0.65 1.82 ± 0.3 2.33 ± 0.82 1.56 ± 0.35
Gingival index (GI) 1.45 ± 0.42 0.54 ± 0.29 1.46 ± 0.59 0.38 ± 0.31
Periodontal disease index 1.6 ± 0.46 2.01 ± 1.29 1.79 ± 0.67 1.73 ± 1.23
(PDI)

[31] showed that probiotic chewing gums have a positive shown between placebo and probiotic groups, in comparison
effect on depletion of gingival inflammation and inflammato- to our study in which there was a meaningful difference between
ry meditator rate in GGF of patients suffering from gingivitis the two groups. We used a new species of L. salivarius NK02
which was in line with our findings. which can have a different antimicrobial activity. The studies
In our study, PPD decreased in the probiotic bacteria treat- revealed great differences for antimicrobial activity of the
ment group which can explain the decrease of inflammation in lactobacilli group on periodontal pathogens of P. gingivalis
gingiva. Earlier, Shimauchi et al. [32] conducted a randomized and A. actinomycetemcomitans (unpublished data). Our study
double-blind placebo control study in which a meaningful im- showed that A. actinomycetemcomitans was the most prone bac-
provement of PPD and PI was shown for the probiotic group teria to probiotic NK02 strain in vitro. We studied the effects of
(L. salivarius WB21), but a meaningful difference was not L. salivarius NK02 on A. actinomycetemcomitans for the first

Fig. 3 Graphical illustration of the different steps of the screening and testing of probiotic Lactobacillus isolate (as mouthwash)
 Probiotics & Antimicro. Prot.

time and then examined the effects of this strain on periodontal Funding The current work was supported by the National Institute of
Genetic Engineering and Biotechnology (NIGEB), affiliated to the
indices of our patients under study. Unlike all the studies men-
Ministry of Science, Research & Technology (IMSRT), Iran.
tioned before, a meaningful difference in PI and PDI was not
shown for the two groups. One of the reasons for the lack of Competing Interests The authors declare that they have no competing
difference in PI is the personal differences of patients in follow- interests.
ing hygienic instructions and differences in mouth brushing
skills among the patients, and in some cases, patients forgot to Informed Consent The present study was conducted in full accordance
with the World Medical Association Declaration of Helsinki and a written
brush their teeth or wash their mouth with a mouthwash. Other
consent form signed by all the subjects or the parents in case the partic-
than this, may be the amount of plaque made on the teeth of ipants were under 18.
patients in the probiotic group was the same as in the placebo
group, but this plaque is safe with a reduced amount of patho-
genic bacteria in comparison to the control group. Actually, it is References
emphasized that the quantity of plaque was the same but the
quality of plaque was different, so as the amount of pathogenic- 1. Castiblanco GA, Yucel-Lindberg T, Roos S, Twetman S (2016)
ity of plaque was reduced. The current study showed a signifi- Effect of Lactobacillus reuteri on cell viability and PGE2 produc-
cant difference between GCF and saliva in tion in human gingival fibroblasts. Probiotics Antimicro Prot. doi:
10.1007/s12602-016-9246-6
A. actinomycetemcomitans pathogen reduction. It was previous-
2. Sharif MR, Haddad-Kashani H, Taghavi-Ardakani A, Kheirkhah
ly shown that one session of SRP treatment can deplete or omit a D, Tabatabaei F, Sharif A (2016) The effect of a yeast probiotic
certain form of sub-gingival periodontal pathogens and the mi- on acute diarrhea in children. Probiotics Antimicro Prot 8:211–214
crobial flora need 42 days to reach the baseline state afterwards 3. Gillian H, Lee M, McGrath C, Yiu CKY (2016) Evaluating the
impact of caries prevention and management by caries risk assess-
[33–35]. These studies showed the effect of SRP on sub-
ment guidelines on clinical practice in a dental teaching hospital.
gingival microbiota depletion of mobile bacteria and anaerobic BMC Oral Health 16:58
spirochetes, and enhancement of cocci and immobile bacteria. 4. Meurman JH (2005) Probiotics: do they have a role in oral medicine
Two RCT studies in Japan were designated to evaluate the ef- and dentistry? Eur J Oral Sci 113:188–196
fects of probiotic on periodontal, and the results were consistent 5. Newman MG, Takei H, Klokkevold PR, Carranza F (2015)
Carranza clinical periodontology. 12th edition, Elsevier
with our findings. The results showed that oral use of tablets rich 6. Kumar SK, Leys EJ, Bryk JM, Martinez FJ, Moeschberger ML,
in probiotic L. salivarius resulted in depletion of the number of Griffen AL (2006) Changes in periodontal health status are associ-
P. gingivalis in sub-gingival and saliva of healthy patients [36, ated with bacterial community shifts as assessed by quantitative
37]. 16S cloning and sequencing. J Clin Microbiol 44:3665–3673
7. Rylev M, Kilian M (2008) Prevalence and distribution of principal
periodontal pathogens worldwide. J Clin Periodontol 35:346–361
8. Reddy MS, Babu MN (2011) How beneficial is bacterial prophy-
Conclusions laxis to periodontal health? J Investig Clin Dent 2:95–101
9. Henderson B, Ward JM, Ready D (2010) Aggregatibacter
(Actinobacillus) actinomycetemcomitans: a triple A *
All of the effects of probiotics on periodontal health have not periodontopathogen. Periodontol 54:78–105
been determined completely in the present studies. Early data 10. Haukioja JH, Stamatova I (2007) Probiotics: contributions to oral
that have been collected from a variety of studies in this area health. Oral dis 13:443–451
have shown a number of positive effects of probiotics on 11. Koll-Klais P, Mandar R, Leibur E, Mikelsaar M (2005) Oral micro-
bial ecology in chronic periodontitis and periodontal health.
periodontal health; however, a higher number of long-term Microbial Ecol Health Dis 17:146–155
clinical trials are needed to validate that probiotics always 12. Sookhee S, Chulasiri M, Prachyabrued W (2001) Lactic acid bac-
have a positive influence on periodontal health. The current teria from healthy oral cavity of Thai volunteers: inhibition of oral
study confirms anti-bacterial effects of L. salivarius NK02 pathogens. J Appl Microbiol 90:172–179
13. Tsuzukibashi O, Takada K, Saito M, Kimura C, Yoshikawa T,
against A. actinomycetemcomitans, an important causative Makimura M, Hirasawa M (2008) A novel selective medium for iso-
agent of periodontitis. Accordingly, it is recommended as an lation of Aggregatibacter (Actinobacillus) actinomycetemcomitans. J
adjunctive treatment for SRP and preventive maintenance Periodontal Res 43:544–548
phases. To provide stronger evidences, however, more clinical 14. Heilig HGHJ, Zoetendal EG, Vaughan EE, Marteau P, Akkermans
ADL, de Vos WM (2002) Molecular diversity of Lactobacillus spp.
trial studies are recommended in a longer period of time. and other lactic acid bacteria in the human intestine as determined
by specific amplification of 16S ribosomal DNA. Appl Environ
Microbiol 68:114–123
Compliance with Ethical Standards 15. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013)
MEGA6: molecular evolutionary genetics analysis version 6.0.
Ethical Approval The study was autonomously reviewed and ap- Mol Biol Evol 30:2725–2729
proved by the ethics committee of Tehran University of Medical 16. Singhal K, Joshi H, Chaudhary BL (2010) Bile and acid tolerance
Sciences, the review board. Our clinical trial was registered in IRCT ability of probiotic Lactobacillus strains. J Global Pharma Tech 2:
and allocated a unique code as follows: IRCT201201258825N1. 17–25
Probiotics & Antimicro. Prot.

17. Vinderola CG, Reinheimer JA (2000) Enumeration of 28. Marteau P, Minekus M, Havenaar R, Huis In’t Veld JH (1997)
Lactobacillus casei in the presence of L. acidophilus, Survival of lactic acid bacteria in a dynamic model of the stomach
bifidobacteria and lactic starter bacteria in fermented dairy prod- and small intestine: validation and the effects of bile. J Dairy Sci 80:
ucts. Int Dairy J 4:271–275 1031–1037
18. Dashkevicz MP, Feighner SD (1989) Development of a differential 29. Krass P, Carlsson B, Dahl C, Paulsson A, Nilsson A, Sinkiewicz G
medium for bile salt hydrolase-active Lactobacillus spp. Appl (2006) Decreased gum bleeding and reduced gingivitis by probiotic
Environ Microbiol 55:11–16 Lactobacillus reuteri. Swed Dent J 30:55–60
19. Blanquet S, Zeijdner E, Beyssac E, Meunier JP, Denis S, Havenaar 30. Vivekananda MR, Vandana KL, Bhat KG (2010) Effect of probiotic
R, Alric M (2004) A dynamic artificial gastrointestinal system for Lactobacillus reuteri (Prodentis) in the management of periodontal
studying the behavior of orally administered drug dosage forms disease: a preliminary randomized clinical trial. J Oral Microbiol 2:
under various physiological conditions. Pharm res 21:585–591 5344. doi:10.3402/jom.v2i0.5344
20. Vizoso-Pinto MG, Franz CM, Schillinger U, Holzapfel WH (2006) 31. Twetman S, Derawi B, Keller M, Ekstrand K, Yucel-Lindberg T,
Lactobacillus spp. with in vitro probiotic properties from human Stecksen-Blicks C (2009) Short–term effect of chewing gums con-
faeces and traditional fermented products. Int J Food Microbiol taining Lactobacillus reuteri on the level of inflammatory mediators
109:205–214 in gingival crevicular fluid. Acta Odontol Scand 67:19–24
21. Clinical and Laboratory Standard Institute (CLSI) (2010). 32. Shimauchi H, Mayanagi G, Nakaya S (2008) Improvement of peri-
Performance Standards for Antimicrobial Susceptibility testing; odontal condition by probiotics with Lactobacillus salivarius
20th Informational Supplement CLSI document M100-S20-U. WB21: a randomized double blind placebo controlled study. J
Wayne, PA Clin Periodontol 10:897–905
22. Loe H, Silness J (1963) Periodontal disease in pregnancy I.
33. Amornchat C, Rassameemasmaung S, Sirpairojthikoon W,
Prevalence and severity. Acta Odontol Scand 21:533–551
Swasdison S (2003) Invasion of Porphyromonas gingivalis into hu-
23. Ainamo J, Bay I (1975) Problems and proposals for recording gin-
man gingival fibroblasts in vitro. J Int Acad Periodontol 5:98–105
givitis and plaque. Int Dent J 25:229–235
24. Corzo G, Gilliland SE (1999) Bile salt hydrolase activity of three 34. Socransky SS, Haffajee AD, Cuqini MA, Smith C, Kent RL Jr
strains of Lactobacillus acidophilus. J Dairy Sci 82:472–480 (1998) Microbial complexes in subgingival plaque. J Clinc
25. Candela M, Perna F, Carnevali P, Vitali B, Ciati R, Giochetti P, Periodontol 25:134–144
Rizzello F, Campieri MP (2008) Interaction of probiotic 35. Mousques T, Listgarten MA, Philips RW (1980) Effect of scaling
Lactobacillus and Bifidobacterium strains with human intestinal and root planing on the composition of the human subgingival
epithelial cells: adhesion properties, competition against microbial flora. J Periodontol res 15:144–151
enteropathogens and modulation of IL-8 production. Int J Food 36. Ishikawa H, Aiba Y, Nakanishi M, Oh-hashi Y, Koga Y (2003)
Microbiol 125:286–292 Suppression of periodontal pathogenic bacteria in the saliva of
26. De Smet I, Hoorde LV, Woestyne MV, Christiaens H, Verstraete W humans by the adminstration of Lactobacillus salivarius TI2711.
(1995) Significance of bile salt hydrolytic activities of lactobacilli. J J Jpn Soc Periodontol 45:105–112
Appl Bacteriol 29:292–301 37. Matsouka T, Sugano N, Takigawa S, Takane M, Yoshimura N, Ito
27. Mathara JM, Schillinger U, Kutima PM, Mbugua SK, Guigas C, K (2006) Effect of oral Lactobacillus salivarius TI 2711 (LS1)
Franz C, Holzapfel WH (2008) Functional properties of administration on periodontal pathogenic bacteria in subgingival
Lactobacillus plantarum strains isolated from Maasai traditional plaque. J Jpn Soc Periodontol 48:315–324
fermented milk products in Kenya. Curr Microbiol 56:315–321