(Methods in Molecular Biology 1399) Francis Martin, Stephane Uroz (Eds.) - Microbial Environmental Genomics (MEG) - Humana Press (2016)
(Methods in Molecular Biology 1399) Francis Martin, Stephane Uroz (Eds.) - Microbial Environmental Genomics (MEG) - Humana Press (2016)
Francis Martin
Stéphane Uroz Editors
Microbial
Environmental
Genomics
(MEG)
METHODS IN MOLECULAR BIOLOGY
Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK
Edited by
Francis Martin
UMR1136 INRA/University of Lorraine “Tree-Microbe Interactions” (IAM),
Labex ARBRE, Champenoux, France
Stéphane Uroz
UMR1136 INRA/University of Lorraine “Tree-Microbe Interactions” (IAM),
Labex ARBRE, Champenoux, France
UMR1138 INRA “Biogeochemistry of Forest Ecosystems” (BEF), Labex ARBRE, Champenoux, France
Editors
Francis Martin Stéphane Uroz
UMR1136 INRA/University of Lorraine UMR1136 INRA/University of Lorraine
“Tree-Microbe Interactions” (IAM) “Tree-Microbe Interactions” (IAM)
Labex ARBRE Labex ARBRE
Champenoux, France Champenoux, France
UMR1138 INRA “Biogeochemistry
of Forest Ecosystems” (BEF)
Labex ARBRE
Champenoux, France
v
vi Preface
Fig. 1 Conceptual questioning in microbial environmental genomics. (a) The different challenging questioning
in microbial environmental genomics. (b) The conceptual framework that needs to be integrated in models
and for bioinformatics analyses (MG-RAST). Chapter 17 presents a method to analyze both
taxonomic and functional diversity using ancient DNA. We envision that this book will serve
as a primary research reference for researchers and research managers in environmental
microbiology working in the expanding field of molecular ecology and environmental
genomics. The level of presentation is technically advanced with a strong emphasis on
describing cutting-edge protocols in light of the possible future directions for research.
Acknowledgments
References
1. Averill C, Turner BL, Finzi AC (2014) 5. Zhou J, He Z, Yang Y, Deng Y, Tringe SG,
Mycorrhiza-mediated competition between Alvarez-Cohen L (2015) High-throughput
plants and decomposers drives soil carbon stor- metagenomic technologies for complex micro-
age. Nature 505:543–545 bial community analysis: open and closed for-
2. Bardgett RD, van der Putten WH (2014) mats. mBio 6:e02288-14
Belowground biodiversity and ecosystem func- 6. Segata N, Boernigen D, Tickle TL, Morgan XC,
tioning. Nature 515:505–511 Garrett WS, Huttenhower C (2013)
3. Reid A, Greene SE (2012) How microbes can help Computational meta’omics for microbial com-
feed the world. Report on an American Academy munity studies. Mol Syst Biol 9(1)
of Microbiology Colloquium, Washington, DC 7. Treseder KK, Balser TC, Bradford MA, Brodie
4. Chaparro JM, Sheflin AM, Manter DK, Vivanco EL, Dubinsky EA, Eviner VT et al (2012)
JM (2012) Manipulating the soil microbiome Integrating microbial ecology into ecosystem
to increase soil health and plant fertility. Biol models: challenges and priorities. Biogeochemistry
Fertil Soils 48:489–499 109:7–18
Contents
Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix
vii
viii Contents
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 317
Contributors
ix
x Contributors
Abstract
Archaea constitute one of the three recognized phylogenetic groups of organisms living on the planet, and
the latest to be discovered. Most Archaea resist cultivation and are studied using molecular methods.
High-throughput amplicon sequencing and metagenomic approaches have been key in uncovering hith-
erto unknown archaeal diversity, their metabolic potential, and have even provided an insight into genomes
of a number of uncultivated members of this group. Here, we summarize protocols describing sampling,
molecular, metagenomic, and metatranscriptomic analyses as well as bioinformatics approaches that have
proved useful for the study of archaea in natural samples.
Key words Archaeal communities, Metagenomic DNA, Small insert-size library, Large insert-size
library, Single-cell genomics, Bioinformatic analysis
1 Introduction
Francis Martin and Stéphane Uroz (eds.), Microbial Environmental Genomics (MEG), Methods in Molecular Biology, vol. 1399,
DOI 10.1007/978-1-4939-3369-3_1, © Springer Science+Business Media New York 2016
1
2
Outgroup:
1 27 bacterial species
1 1
Sulfolobus tokodaii str. 7
Sulfolobus acidocaldarius DSM 639 Crenarchaeota
1 Sulfolobus solfataricus P2
0.98 Acidianus hospitalis W1
1 Metallosphaera yellowstonensis MK1
1 1
Metallosphaera sedula DSM 5348
1 Staphylothermus hellenicus DSM 12710
1
(’TACK super-phylum’)
1
Thermosphaera aggregans DSM 11486
Desulfococcus kamchatkensis 1221n
Proteoarchaeota
1
Ignicoccus hospitalis KIN4/l
1 1
Pyrolobus fumarii 1A
1
Hyperthermus butylicus DSM 5456
1
Acidolobus saccharovorans 345-15
Aeropyrum pernix K1
1
Pyrococcus abyssi GE5
Pyrococcus yayanosii CH1
1 Thermococcus gammatolerans EJ3
1 Thermococcus barophilus MP Thermococcales
1
Thermococcus litoralis DSM 5473
Methanopyrus kandleri AV19
Methanothermus fervidus DSM 2088
1 1 Methanothermobacter thermautotrophicus Delta H
1 1 Methanobacterium sp. AL-21 Methanobacteriales
1 Methanobrevibacter smithii ATCC 35061
1 1
Methanosphaera stadtmanae DSM 3091
1
Methanocaldococcus infernus ME
Methanocaldococcus jannaschii DSM 2661
1 Methanotorris igneus Kol 5 Methanococcales
1 Methanococcus aeolicus Nankai 3
1 1
Methanococcus vannielii SB
Uncultured marine group II euryarchaeote
1 Aciduliprofundum boonei T469
1 1
Ferroplasma acidarmanus fer1
1
Picrophilus torridus DSM 9790
1
Thermoplasma acidophilum DSM 1728 Thermoplasmatales
Thermoplasma volcanium GSS21
1 Ferroglobus placidus DSM 10642
1 Archaeoglobus profundus DSM 5631
1 Archaeoglobus veneficus SNP6 Archaeoglobales
1
Archaeoglobus fulgidus DSM 4304
1
Methanosaeta thermophila PT
1 Methanosaeta harundinacea 6Ac
1 Methanosarcina mazei Go1 Methanosarcinales
1
Euryarchaeota
1
Methanosalsum zhilinae DSM 4017
Methanococcoides burtonii DSM 6242
1 Methanocorpusculum labreanum Z
1 1
Methanospirillum hungatei JF-1
1
Methanoculleus marisnigri JR1 Methanomicrobiales
1
Methanoplanus limicola DSM 2279
1 Methanosphaerula palustris E1-9c
0.2 Methanocella arvoryzae MRE50
1 Methanocella paludicola SANAE Methanocellales
1
1 Methanocella conradii HZ254
Haloadaptatus paucihalophilus DX253
1 Naatronomonas pharaonis DSM 2160
1 Natrialba magadii ATCC 43099 Halobacteriales
1 Halorhabdus utahensis DSM 12940
1 Halorubrum lacusprofundi ATCC 49239
1
Halogeometricum borinquense DSM 11551
Fig. 1 Rooted Bayesian phylogenetic tree of Archaea. The tree was built using a concatenation of 38 genes (9540 sites) conserved between Bacteria and Archaea
identified by Petitjean et al. [56]. The names of high-ranking archaeal taxa are color coded. Posterior probabilities are given at nodes
“Deciphering Archaeal Communities” Omics Tools in the Study of Archaeal Communities 3
2 Materials
3 Methods
3.1.1 Water Samples 1. Collect between 50 and 300 L of water using the CTD incor-
porated in an array of Niskin bottles or using a pump and
appropriate pre-cleaned containers (see Note 3).
3.1.2 Soil and Sediment 1. Sample the soil (~500 g) under sterile conditions. Collect trip-
Samples licate samples from soil surface and sieve them through a
2 mm mesh to remove large particles and plant material. Note
that at least 0.25 g will be required for DNA extraction. Place
the samples into individual sterile pre-cleaned containers (see
Note 3) and keep them on ice until arrival in the laboratory.
2. Use grab sampler or other sediment sampling tool to collect
sediment samples in triplicate.
3. Upon collection, subsample the sediment samples, homoge-
nize them, and transfer them to the appropriate pre-cleaned
sample containers. Transport the samples on dry ice.
Supplement the hot spring sediment samples with equal vol-
ume of sucrose lysis buffer (SLB) immediately upon sampling.
For SLB preparation see Subheading 2.
3.2 Sample 1. Sequentially filter the water samples through 5 μm and 0.22-
Processing μm pore size filters using filter holders and peristaltic pumping
and Preservation system until clogging. At least triplicate filters should be pro-
duced (see Note 4).
3.2.1 Processing
and Preservation of Water 2. Conserve Sterivex™ filters in Lysis buffer (see Subheading 2) at
Samples for Metagenomic −20 °C until DNA extraction. If water is filtered through
Studies mixed cellulose ester filters, store the filters in 50 mL conical
centrifugation tubes at −80 °C until DNA extraction.
10 Lejla Pašić et al.
3.2.2 Processing 1. Process the soil samples within the 24 h from sampling—
and Preservation of Soil sampling itself disturbs the soil and can alter the composi-
and Sediment Samples tion of microbial community.
for Metagenomic Studies 2. Upon arrival to the laboratory store the sediment samples at
−80 °C until DNA extraction.
3.2.3 Processing 1. Allow the filtration (see Subheading 3.2.1, step 1) to proceed
and Preservation of Water for 10 min then fill the Sterivex™ filter with 2 mL of RNAlater
Samples and freeze in liquid nitrogen (see Note 5).
for Metatranscriptomic 2. Produce at least triplicate filters and store at −80 °C until RNA
Studies extraction.
3.2.4 Processing 1. Ground the soil samples in liquid nitrogen using a mortar and
and Preservation of Soil pestle until a fine powder is obtained. Suspend this powder in
and Sediment Samples equal volume of RNAlater. Keep at −80 °C until RNA extrac-
for Metatranscriptomic tion (preferably within 24 h).
Studies 2. Supplement the sediment samples with equal volume of
RNAlater and keep at −80 °C until RNA extraction.
3.3 Nucleic Acid Environmental nucleic acids of sufficient yield, purity, and integrity
Purification are the crucial starting material in metagenomic studies. The below
protocols aim to extract high yields of DNA and RNA while mini-
mizing shearing DNA using mechanical lysis which is presumed to
introduce minimal bias.
Working with RNA requires an RNase-free working environ-
ment. To achieve this, dedicate a separate laboratory area, pipet-
tors, and materials. Use only RNase-free reagents and plastic tubes.
“Deciphering Archaeal Communities” Omics Tools in the Study of Archaeal Communities 11
Wear gloves at all times and treat the gloves, the utensils, and
working surfaces with RNase ZAP. Pipet at a 45° angle with open
tubes facing away from you and use PCR hood. When working
with low biomass samples, scale up the volume of sample used for
isolation (e.g., from ~0.5 g to 25 g). To ensure the absence of
aerosolized contaminants include extraction blanks and confirm
the absence of DNA and RNA contaminants by no visible amplifi-
cation of 16S rRNA from extraction blanks after 35 cycles of PCR
(see Note 6).
3.3.1 DNA Purification The protocol assumes that the sample was filtered through
from Water Samples Sterivex™ filters, and the quantities should be adjusted if cut mixed
cellulose ester filters are used for the filtration of the sample.
1. To the filters add 1.8 mL of SLB lysis buffer (see Subheading 2)
and 50 μL of lysozyme (final concentration 1 mg/mL). Add
200 μL of acid-washed beads (150–212 μm) and incubate at
37 °C for 45 min in slight movement.
2. Add 50 μL of proteinase K (final concentration 0.2 mg/mL)
and 210 μL of 10 % SDS (final concentration 1 % (w/v)).
Incubate at 55 °C for 1 h in slight movement. Allow the glass
beads to settle on the bottom of the tube.
3. Recuperate lysate from the filter and transfer it to a 15 mL
conical centrifugal tube. To remove remaining material, add
1 mL of Lysis buffer to the Sterivex™ filter, incubate at 55 °C
for 15 min, and transfer the lysate to a fresh 15 mL conical
centrifugal tube.
4. Extract twice with equal volume (3 mL) of
phenol:chloroform:isoamyl alcohol (25:24:1; pH 8.0). Add
3 mL of phenol:chloroform:isoamyl alcohol, vortex 1 min, and
centrifuge 5 min at 5000 × g. Transfer the aqueous phase to a
new tube and repeat the extraction and the centrifugation.
Extract once with equal volume of chloroform:isoamyl alcohol
(24:1). Transfer the aqueous phase to a new tube. Make sure
no organic phase is transferred.
5. Concentrate DNA on a 30 kDa Amicon Ultra filter, by spin-
ning it down to a volume of 200 μL.
6. Add 1 mL of TE buffer and spin down to a volume of
200 μL. Repeat this three times before collecting the DNA. The
DNA can be stored at −20 °C.
7. Alternatively, precipitate the DNA by adding to the aqueous
phase 0.1 V (300 μL) of 3 M sodium acetate pH 5.5 (see
Subheading 2) and 2 V (6 mL) of 100 % ethanol. Allow the
precipitation to proceed for at least 2 h at −20 °C. To collect
the DNA, centrifuge at 20,800 × g for 20 min at 4 °C.
8. Wash the pellet twice with 1 mL of 80 % ethanol, air-dry, and
resuspend in 100 μL of TE buffer.
12 Lejla Pašić et al.
3.3.2 DNA Purification 1. Wash the sediment sample (0.25 g to 1 g) at room temperature
from Soil and Sediment for 1 h with gentle shaking in 2 mL of 3 % NaCl. This will
Samples remove extracellular DNA. If working with soil samples use
0.25 g to 1 g of sample and start with step 5.
2. Centrifuge the sample for 10 min at 3000 × g and room tem-
perature and remove the supernatant.
3. To 1 g of washed sample add phosphate buffered saline (PBS)
(see Subheading 2) to a final volume of 0.5 mL. This will mini-
mize the effect of sample pH on DNA yields obtained.
4. Subject the sample to six to six freeze/thaw cycles in liquid
nitrogen to facilitate cell lysis of archaeal cells and increase
DNA yield.
5. Perform DNA purification using Mo Bio PowerSoil™ DNA
extraction Kit [24].
6. Determine the concentration of isolated DNA (see Notes 7
and 8).
3.3.3 RNA Purification 1. To isolate RNA from the RNA preservation buffer in which
from Water Samples the filter was stored:
Transfer the buffer into a 15 mL conical centrifuge tube.
Add 1/10 V of 3 M potassium acetate (pH 5.5) (see
Subheading 2) and 1 V of isopropanol. Vigorously vortex the
tube for 2 min. Incubate the tube at room temperature for 2 h
with slight movement.
Centrifuge the sample for 30 min at 4 °C and 12,000 × g and
remove the supernatant.
To the pellet, add 1 mL of ice-cold 70 % ethanol.
Centrifuge the tube for 10 min at 4 °C and 12,000 × g and
remove the supernatant.
Repeat steps 4 and 5.
Air-dry the sample and resuspend the dried pellet in 600 μL of
Resuspension buffer (see Subheading 2). Transfer 200 μL ali-
quots into three separate tubes.
Isolate RNA using RNeasy Mini Kit according to the manufac-
turer’s instructions.
2. To isolate RNA from the filter:
Add 600 μL of Resuspension buffer to the filter (Sterivex™ or
mixed cellulose filter that was cut in small pieces).
Incubate 10 min at room temperature. Vortex the sample 10 s
every 2 min. Transfer 200 μL aliquots into separate tubes.
“Deciphering Archaeal Communities” Omics Tools in the Study of Archaeal Communities 13
3.3.4 RNA Purification 1. Extract the RNA from up to 2 g of soil (or up to 5 g of sedi-
from Soil and Sediment ment) using PowerSoil™ Total RNA Isolation Kit [27] (see
Samples Notes 8–11). Include the extraction blanks.
2. Remove the DNA from RNA samples using DNAse I treat-
ment (see Subheading 3.3.3, steps 12 and 13).
3. Purify RNA by using RNeasy Mini Kit [25].
4. Confirm the absence of DNA and RNA contaminants by no
visible amplification of 16S rRNA from extraction blanks after
35 cycles of PCR (see Note 6).
5. Proceed with steps 15–19 of Subheading 3.3.3.
14 Lejla Pašić et al.
3.4.1 Small (≤10 kb) 1. Determine the size and the quantity of isolated environmental
Insert-Size Shotgun DNA (see Note 12) by running an aliquot (1–2 μL) of it on a
Libraries 1 % agarose gel in 1× TBE buffer on a pulse field gel electro-
phoresis under following conditions: temperature 14 °C, volt-
age 6 V/cm, initial switch time 0.1 s, final switch time 2 s,
angle 120°, length of a run 11 h.
2. If more than 50 % of isolated environmental DNA fragments is
of desired insert size, proceed with Subheading 3.4.1, step 5.
3. Shear the DNA by passing it though 200 μL pipette tips. Place
2–10 μg of DNA diluted to 100 μL with TE buffer into a clean
microcentrifuge tube. Aspire and expel the DNA up to 200
times (see Note 13).
4. Examine 1–2 μL of sheared insert DNA on an agarose gel as
described in step 1.
5. To generate end-repaired insert DNA add the following
reagents on ice to a final volume of 80 μL (included in End-It™
DNA End-Repair Kit as well as in CopyControl™ Fosmid
Library Production Kit with pCC1Fos Vector): 8 μL 10× End-
Repair Buffer, 8 μL 2.5 mM dNTP Mix, 8 μL 10 mM ATP,
sheared insert DNA (up to 20 μg), 4 μL End-Repair Enzyme
Mix, sterile water.
6. Incubate at room temperature for 1 h.
7. Inactivate the enzyme mix at 70 °C for 10 min.
8. Fractionate the blunt-ended DNA in the absence of any DNA
stain using pulse field gel electrophoresis on a 1 % Agarose
Low melt gel prepared with 1× TBE buffer. Prepare the gel
with wide combs and use DNA size markers at both outside
lanes of the gel.
9. Upon electrophoresis, cut off the outer lanes of the gel that
contain the DNA size marker and stain them.
10. Visualize the DNA size markers with UV light and mark the
position of the desired fragment size on both ladders with ster-
ile scalpel or pipette tip.
11. Assemble the gel and cut out the gel slice containing insert
DNA of desired size. Transfer the gel slice to a tared tube.
12. Extract the DNA from the slice by using QIAquick Gel
Extraction Kit [26].
“Deciphering Archaeal Communities” Omics Tools in the Study of Archaeal Communities 15
3.4.2 Large (10–40 kb) 1. Prepare the large insert-size shotgun library by using
Insert-Size Shotgun CopyControl™ Fosmid Library Production Kit [29] (see Note
Libraries 15).
2. To evaluate the quality of the library, select a subsample of
insert-positive clones and grow them in LB medium with
12.5 mg/mL chloramphenicol overnight at 37 °C and
250 rpm.
3. To induce high copy number of fosmids in the cells, inoculate
500 μL of overnight cultures from step 2 into individual flasks
that contain 5 mL of LB medium with 12.5 mg/mL chloram-
phenicol and 5 μL of the 1000× CopyControl™ Induction
Solution (included in CopyControl™ Fosmid Library
Production Kit). Incubate for 5 h at 37 °C and 250 rpm.
4. Use standard techniques to extract, digest, and visualize fos-
mid DNA.
5. Store positive clones by picking them with sterile toothpicks
and transferring them to separate wells of 96- of 384-well
plates as a culture in LB medium with 12.5 mg/mL chloram-
phenicol supplemented with 15 % glycerol at −80 °C.
8. Retain the CDS that match orphan RefSeq genes if they (1)
match a COG functional category; (2) contain any known
motif in CDD databases provided their BLASTP and RPS-
BLAST e values remain below the 1e−05 threshold. Switch the
accepted annotation to that of the relevant match.
9. Remove small (<100 aa) CDS that match orphan Refseq genes
and look for significant matches in RefSeq, COG, and CDD
databases (with similar e value thresholds as above). Validate
these as genes if they do not overlap any other gene having
high similarity in searched databases.
10. Identify tRNAs using tRNA-scanSE [41] (http://lowelab.
ucsc.edu/tRNAscan-SE/).
11. Identify ribosomal RNA genes with rRNA_hmm_fs/
hmmsearch 3.0 [42] (http://hmmer.janelia.org/software).
3.8 Phylogenetic 1. Filter the metagenomic dataset for sequences of interest (e.g.,
and Phylogenomic using BLAST) and transfer them into a local database. Name
Analysis this database “query database.”
3.8.1 Phylogenetic 2. Search publicly available bacterial and archaeal genomes (use
Analysis of Metagenomic one genome sequence per species) for sequences that are
Sequences homologous to those of interest and gather them into a sepa-
rate local database. Name this database “reference database.”
3. Align the sequences in “reference database” using MUSCLE
[43] (http://www.drive5.com/muscle/downloads.html) or
ClustalOmega [44] (http://www.clustal.org/omega/).
4. Detect the conserved positions in the “reference database”
alignment using BMGE [45] (https://wiki.gacrc.uga.edu/
wiki/BMGE) with default parameters and the BLOSUM62
substitution matrix.
5. Manually verify the trimmed “reference database” alignment
using the program NET of the MUST package [46] (http://
megasun.bch.umontreal.ca/Software/HPLab/must/must.
html).
6. Use Prottest [47] (https://code.google.com/p/prottest3/)
to select the best-fit models of amino acid replacement to be
used in phylogenetic reconstruction.
7. Reconstruct maximum likelihood phylogenetic trees with
RaxML v.7.2.4 [48] (http://sco.h-its.org/exelixis/software.
html) using trimmed “reference database” alignment and the
selected model. Estimate tree robustness using the Rapid
Bootstrapping method as implemented in RaxML.
8. Separately, align the “query database” using ClustalOmega.
9. Place the aligned “query database” sequences onto the
obtained reference tree using RaxML Evolutionary
“Deciphering Archaeal Communities” Omics Tools in the Study of Archaeal Communities 21
MG-RAST http://metagenomics.anl.gov/
ShotgunFunctionalizeR http://shotgun.math.chalmers.se/
STAMP http://kiwi.cs.dal.ca/Software/STAMP
UniFrac http://bmf.colorado.edu/unifrac/
4 Notes
Acknowledgements
References
1. Woese CR, Kandler O, Wheelis ML (1990) 13. Quaiser A, Ochsenreiter T, Klenk HP, Kletzin
Towards a natural system of organisms: proposal A, Treusch AH, Meurer G, Eck J, Sensen CW,
for the domains Archaea, Bacteria, and Eucarya. Schleper C (2002) First insight into the
Proc Natl Acad Sci U S A 87:4576–4579 genome of an uncultivated crenarchaeote from
2. Rothschild LJ, Mancinelli RL (2001) Life in soil. Environ Microbiol 4:603–611
extreme environments. Nature 409:1092–1101 14. Schleper C, Jurgens G, Jonuscheit M (2005)
3. López-García P (2005) Extremophiles. In: Genomic studies of uncultivated archaea. Nat
Gargaud M, Barbier B, Martin H, Reisse Rev Microbiol 3:479–488
J (eds) Lectures in astrobiology. Springer- 15. Nicol GW, Schleper C (2006) Ammonia-
Verlag, Heidelberg, pp 657–679 oxidising Crenarchaeota: important players in the
4. Valentine DL (2007) Adaptations to energy nitrogen cycle? Trends Microbiol 14:207–212
stress dictate the ecology and evolution of the 16. Pester M, Schleper C, Wagner M (2011) The
Archaea. Nat Rev Microbiol 5:316–323 Thaumarchaeota: an emerging view of their
5. Pace NR (1997) A molecular view of microbial phylogeny and ecophysiology. Curr Opin
diversity and the biosphere. Science 276: Microbiol 14:300–306
734–740 17. Iverson V, Morris RM, Frazar CD, Berthiaume
6. Delong EF (1998) Everything in moderation: CT, Morales RL, Armbrust EV (2012)
archaea as ‘non-extremophiles’. Curr Opin Untangling genomes from metagenomes:
Genet Dev 8:649–654 revealing an uncultured class of marine
Euryarchaeota. Science 335:587–590
7. Delong EF (1992) Archaea in coastal marine
environments. Proc Natl Acad Sci U S A 18. Deschamps P, Zivanovic Y, Moreira D,
89:5685–5689 Rodriguez-Valera F, Lopez-Garcia P (2014)
Pangenome evidence for extensive interdo-
8. Fuhrman JA, McCallum K, Davis AA (1992) main horizontal transfer affecting lineage core
Novel major archaebacterial group from and shell genes in uncultured planktonic
marine plankton. Nature 356:148–149 thaumarchaeota and euryarchaeota. Genome
9. Fuhrman JA, Davis AA (1997) Widespread Biol Evol 6:1549–1563
Archaea and novel Bacteria from the deep sea 19. Martin-Cuadrado AB, Garcia-Heredia I,
as shown by 16S rRNA gene sequences. Mar Molto AG, Lopez-Ubeda R, Kimes N, Lopez-
Ecol Prog Ser 150:275–285 Garcia P, Moreira D, Rodriguez-Valera F
10. López-García P, Moreira D, López-López A, (2015) A new class of marine Euryarchaeota
Rodríguez-Valera F (2001) A novel group II from the Mediterranean deep chloro-
haloarchaeal-related lineage is widely distrib- phyll maximum. ISME J 9(7):1619–1634.
uted in deep oceanic regions. Environ doi:10.1038/ismej.2014.249
Microbiol 3:72–78 20. Cuadros-Orellana S, Martin-Cuadrado AB,
11. Brochier-Armanet C, Boussau B, Gribaldo S, Legault B, D’Auria G, Zhaxybayeva O, Papke
Forterre P (2008) Mesophilic Crenarchaeota: RT, Rodriguez-Valera F (2007) Genomic plas-
proposal for a third archaeal phylum, the ticity in prokaryotes: the case of the square
Thaumarchaeota. Nat Rev Microbiol 6:245–252 haloarchaeon. ISME J 1:235–245
12. Guy L, Ettema TJ (2011) The archaeal 21. Rinke C, Schwientek P, Sczyrba A, Ivanova
‘TACK’ superphylum and the origin of eukary- NN, Anderson IJ, Cheng JF, Darling A,
otes. Trends Microbiol 19:580–587 Malfatti S, Swan BK, Gies EA, Dodsworth JA,
“Deciphering Archaeal Communities” Omics Tools in the Study of Archaeal Communities 27
Hedlund BP, Tsiamis G, Sievert SM, Liu WT, 32. GS FLX Titanium Rapid Library preparation kit.
Eisen JA, Hallam SJ, Kyrpides NC, http://lifescience.roche.com/shop/products/
Stepanauskas R, Rubin EM, Hugenholtz P, gs-flx-titanium-rapid-library-preparation-kit
Woyke T (2013) Insights into the phylogeny 33. Nextera® XT DNA sample preparation kit.
and coding potential of microbial dark matter. http://support.illumina.com/sequencing/
Nature 499:431–437 sequencing_kits/nextera_xt_dna_kit.html
22. Hugoni M, Taib N, Debroas D, Domaizon I, 34. Teeling H, Waldmann J, Lombardot T, Bauer
Jouan Dufournel I, Bronner G, Salter I, M, Glockner FO (2004) TETRA: a web-
Agogue H, Mary I, Galand PE (2013) service and a stand-alone program for the anal-
Structure of the rare archaeal biosphere and ysis and comparison of tetranucleotide usage
seasonal dynamics of active ecotypes in surface patterns in DNA sequences. BMC
coastal waters. Proc Natl Acad Sci U S A Bioinformatics 5:163
110:6004–6009 35. Saeed AI, Sharov V, White J, Li J, Liang W,
23. Martin-Cuadrado AB, Rodriguez-Valera F, Bhagabati N, Braisted J, Klapa M, Currier T,
Moreira D, Alba JC, Ivars-Martinez E, Henn Thiagarajan M, Sturn A, Snuffin M, Rezantsev
MR, Talla E, Lopez-Garcia P (2008) Hindsight A, Popov D, Ryltsov A, Kostukovuch E,
in the relative abundance, metabolic potential Borisovsky I, Liu Z, Vinsavich A, Trush V,
and genome dynamics of uncultivated marine Quackenbush J (2003) TM4: a free, open-
archaea from comparative metagenomic analy- source system for microarray data manage-
ses of bathypelagic plankton of different oce- ment and analysis. Biotechniques 34:374–378
anic regions. ISME J 2:865–886 36. Lê S, Josse J, Husson F (2008) FactoMineR:
24. PowerSoil®DNA isolation kit instruction man- an R package for multivariate analysis. J Stat
ual. www.mobio.com/images/custom/file/ Softw 25:1
protocol/12888.pdf 37. Delcher A, Harmon D, Kasif S, White O,
25. RNeasy mini handbook. http://www.qiagen. Salzberg S (1999) Improved microbial gene
com/si/resources/resourcedetail?id=14e7cf6e- identification with GLIMMER. Nucleic Acids
521a-4cf7-8cbc-bf9f6fa33e24&lang=en Res 27:4636–4641
26. QIAquick spin handbook. http://www.qia- 38. Hyatt D, LoCascio PF, Hauser LJ, Uberbacher
gen.com/si/products/catalog/sample- EC (2012) Gene and translation initiation site
technologies/dna-sample-technologies/ prediction in metagenomic sequences.
dna-cleanup/qiaquick-pcr-purification- Bioinformatics 28:2223–2230
kit/#resources 39. Altschul SF, Madden TL, Schäffer AA, Zhang
27. RNA PowerSoil® Total RNA isolation kit J, Zhang Z, Miller W, Lipman DJ (1997)
instruction manual. http://www.mobio.com/ Gapped BLAST and PSI-BLAST: a new gen-
images/custom/file/protocol/12866-25.pdf eration of protein database search programs.
28. pGEM®-T easy vector system technical man- Nucleic Acids Res 25:3389–3402
ual. http://www.promega.com/~/media/ 40. Marchler-Bauer A, Anderson JB, Derbyshire
files/resources/protocols/technical%20man- MK, DeWeese-Scott C, Gonzales NR, Gwadz
uals/0/pgem-t%20and%20pgem-t%20 M, Hao L, He S, Hurwitz DI, Jackson JD, Ke
easy%20vector%20systems%20protocol.pdf Z, Krylov D, Lanczycki CJ, Liebert CA, Liu C,
29. Protocol for CopyControl™ Fosmid library Lu F, Lu S, Marchler GH, Mullokadov M,
production kit with pCC1Fos vector. http:// Song JS, Thanki N, Yamashita RA, Yin JJ,
www.epibio.com/docs/default-source/pro- Zhang D, Bryant SH (2005) CDD: a con-
tocols/copycontrol-fosmid-librar y- served domain database for protein classifica-
p r o d u c t i o n - k i t - w i t h - p c c 1 f o s - v e c t o r. tion. Nucleic Acids Res 33:D192–D196
pdf?sfvrsn=6 41. Lowe TM, Eddy SR (1997) tRNAscan-SE: a
30. Blainey PC, Mosier AC, Potanina A, Francis program for improved detection of transfer
CA, Quake SR (2011) Genome of a low- RNA genes in genomic sequence. Nucleic
salinity ammonia-oxidizing archaeon deter- Acids Res 25:955–964
mined by single-cell and metagenomic analysis. 42. Huang Y, Gilna P, Li W (2009) Identification
PLoS One 6, e16626 of ribosomal RNA genes in metagenomic frag-
31. Luo C, Tsementzi D, Kyrpides N, Read T, ments. Bioinformatics 25:1338–1340
Konstantinidis KT (2012) Direct comparisons 43. Edgar RC (2004) MUSCLE: a multiple
of Illumina vs. Roche 454 sequencing tech- sequence alignment method with reduced
nologies on the same microbial community time and space complexity. BMC Bioinformatics
DNA sample. PLoS One 7, e30087 5:113
28 Lejla Pašić et al.
44. Sievers F, Wilm A, Dineen D, Gibson TJ, 51. Ronquist F, Teslenko M, van der Mark P,
Karplus K, Li W, Lopez R, McWilliam H, Azres DL, Darling A, Höhna S, Larget B, Liu
Remmert M, Söding J, Thompson JD, Higgins L, Suchard MA, Huelsenbeck JP (2012)
D (2011) Fast, scalable generation of high- MrBazes 3.2: efficient Bayesian phylogenetic
quality protein multiple sequence alignments inference and model choice across a large
using Clustal Omega. Mol Syst Biol 7:539 model space. Syst Biol 61:539–542
45. Criscuolo A, Gribaldo S (2010) BMGE (Block 52. Repli-G single cell kit. http://www.qiagen.
Mapping and Gathering with Entropy): a new com/si/resources/resourcedetail?id=38faca1c-
software for selection of phylogenetic informa- 64b0-4281-aab3-aa8324bbd181&lang=en
tive regions from multiple sequence align- 53. Rinke C, Lee J, Nath N, Goudeau D, Thompson
ments. BMC Evol Biol 10:210 B, Poulton N, Dmitrieff E, Malmstrom R,
46. Philippe H (1993) MUST, a computer pack- Stepanauskas R, Woyke T (2014) Obtaining
age of management utilities for sequences and genomes from uncultivated environmental
trees. Nucleic Acids Res 21:5264–5272 microorganisms using FACS-based single-cell
47. Darriba D, Taboada GL, Doallo R, Posada D genomics. Nat Protoc 9:1038–1048
(2011) ProtTest3: fast selection of best-fit 54. Luo H, Tolar BB, Swan BK, Zhang CL,
models of protein evolution. Bioinformatics Stepanauskas R, Moran MA, Hollibaugh JT
27:1164–1165 (2014) Single-cell genomics shedding light on
48. Stamatakis A (2006) RAxML-VI-HPC: maxi- marine Thaumarchaeota diversification. ISME
mum likelihood-based phylogenetic analyses J 8:732–736
with thousands of taxa and mixed models. 55. Morono Y, Terada T, Hoshino T, Inagaki F
Bioinformatics 22:2688–2690 (2014) Hot-alkaline DNA extraction method
49. Berger SA, Krompass D, Stamatakis A (2011) for deep-subseafloor archaeal communities.
Performance, accuracy, and web server for Appl Environ Microbiol 80:1985–1994
evolutionary placement of short sequence 56. Petitjean C, Deschamps P, López-Garcia P,
reads under maximum likelihood. Syst Biol Moreira D, Brochier-Armanet C (2015)
60:291–302 Extending the conserved phylogenetic core of
50. Katoh K, Standley DM (2013) MAFFT mul- Archaea disentangles the evolution of the third
tiple sequence alignment software version 7: domain of life. Mol Biol Evol 32(5):1242–
improvements in performance and usability. 1254. doi:10.1093/molbev/msv015 (advanced
Mol Biol Evol 30:772–780 access publication)
Chapter 2
Abstract
The study of the so-called unculturable bacteria is still considered a challenging task. However, given
recent improvements in the sensitivity of culture-free approaches, the identification and characterization of
such microbes in complex biological samples is now possible. In this chapter we report how endobacteria
thriving inside arbuscular mycorrhizal fungi (AMF), which are themselves obligate biotrophs of plants, can
be studied using a combination of in vitro culture, molecular biology, and microscopy techniques.
1 Introduction
Francis Martin and Stéphane Uroz (eds.), Microbial Environmental Genomics (MEG), Methods in Molecular Biology, vol. 1399,
DOI 10.1007/978-1-4939-3369-3_2, © Springer Science+Business Media New York 2016
29
30 Alessandro Desirò et al.
2 Materials
2.1 Biological The fungal material employed in the experiments described in the
Materials Biological Materials and Growing Media sections (see Subheadings 2.1
and Growing Media and 3.1) consists of monoxenic inocula of the AMFG. margarita
BEG34, purchased from specialized companies and/or in-house prop-
agated following the in pot culture technique (see Subheading 3.1.1).
2.1.5 In Vitro Fungal 1. Cichorium intybus (chicory) transformed root cultures (see
Propagation under Root Note 2).
Organ Culture (ROC) 2. Surface-sterilized AMF spores.
Conditions
3. Minimal (M) Medium [21]: 3 mM MgSO4 7H2O, 0.79 mM
KNO3, 0.87 mM KCl, 1.22 mM Ca(NO3)2 4H2O, 35.0 μM
KH2PO4, 21.7 μM Na Fe EDTA, 4.5 μM KI, 30.3 μM MnCl2
4H2O, 9.2 μM ZnSO4 7H2O, 24.0 μM H3BO3, 0.5 μM CuSO4
5H2O, 0.01 μM Na2MoO4 2H2O, 40 μM glycine, 0.3 μM
Thiamin HCl, 0.5 μM Pyridoxin HCl, 4 μM Nicotinic Acid, 277
μM Myo-inositol, 10 g/L Sucrose, Phytagel 4 g/L, pH 5.5.
2.3.2 PCR 1. PCR reagents: 10 μM of suitable primers (see Table 1), 2.5
mM of each dNTP, 5× Phusion® HF Buffer, Phusion® DNA
Polymerase (2 U/μL) (Thermo Fisher Scientific, Waltham,
MA, USA), ultrapure water.
Table 1
34
Expected
Target gene Primer pair Primer sequence (5′–3′) amplicon size References
Bacterial target (Ca Gg) 16S rRNA gene CaCgADf AGATTGAACGCTGGCGGCAT 1460 bp Desirò et al. [9]
CaGgADr ATGCGTCCTACCGTGGCCATC
16S rRNA gene CaGgAD7f CACTCTAAGGAGACTGCCAGTGAC 121 bp
CaGgAD6r AGGTTGGCATCCCTCTGTACAG
23S rRNA gene GlomGIGf GGGTCCATTGCGGATTACTTC 587 bp Bianciotto et al. [13]
Alessandro Desirò et al.
GlomGIGr GGGACCAGGACTTCCATCCCCC
23S rRNA gene GlomGIGf GGGTCCATTGCGGATTACTTC 106 bp Bianciotto et al. [13]
GIGrA GTTGTTGCCCTCTTGACACC Lumini et al. [7]
Bacterial target (Mre) 16S rRNA gene 109F ACGGGTGAGTAATRCTTATCT (109F-1) 1040–1090 bp Naumann et al. [5]
2:1 mixture of ACGAGTGAGTAATGCTTATCT (109F-2)
1184R GACGACCAGACGTCATCCTY (1184R-1)
2:1:1 mixture of GACGACCAAACTTGATCCTC (1184R-2)
16S rRNA gene CMsADlf GATGATCAGACGTCATCCTC (1184R-3) 81–107 bp Desirò et al. [9]
CMsAD2r GAKGAAGGTCTAYGGATTGTAAACTT
CTGGCACRTAGTTAGTCGTG
Fungal target 18S rRNA gene AML1 ATCAACTTTCGATGGTAGGATAGA 800 bp Lee et al. [23]
AML2 GAACCCAAACACTTTGGTTTC
ITS region ITS1F CTTGGTCATTTAGAGGAAGTAA 520–610 bp Gardes and Bruns [24]
ITS4 TCCTCCGCTTATTGATATGC White et al. [25]
EF1-α Efgigf CGTTCCAATATCTGGTTGGCATGGTG 289 bp Salvioli et al. [14]
Efgig2r GGTAAGACCAACTGGGGCGAATG
EF1-α Efgig2f TGAACCTCCAACCAGACCAACTG 130 bp
Efgigr GGTTTCAACACGACCTACAGGGAC
rpoB rpoBf TCGCAGCTGTCGCAGTTCAT 536 bp
rpoBr CGCTGCATGTTCGAGCCCAT
rpoB RpoBRTf CGCGGCAAAGTCACGGATAC 109 bp
RpoBRTr ATCGGTGAGTGCGCCATCCTC
The Endobacteria Thriving in Arbuscular Mycorrhizal Fungi 35
2.3.4 Real-Time qPCR 1. 48-well StepOne™ Real-time PCR system and StepOne™ soft-
ware (Life Technologies, Carlsbad, CA, USA) or similar Real-
time PCR equipment.
2. Qubit® 2.0 fluorometer (Life Technologies, Carlsbad, CA,
USA).
3. PCR reagents: 3 μM of each suitable primers (see Table 1), 2×
Power SYBR® Green PCR Master Mix (Life Technologies,
Carlsbad, CA, USA), ultrapure water.
2.4 Fluorescent In 1. Sterile 1× and 10× phosphate buffered saline (PBS), pH 7.2.
Situ Hybridization 2. Fixative solution: 4 % paraformaldehyde [26]. Heat up 45 mL
(FISH) of ultrapure water at 55–58 °C (avoid exceeding 60 °C). Add
2 g of paraformaldehyde and stir with a magnet. If necessary,
add a few drops of NaOH 10 N while stirring continuously
until powder dissolves. Add 5 mL of 10× PBS. Cool on ice.
Adjust pH to 7.2–7.4 with HCl. Filter the solution with 0.45
μm filter. Store the solution a few days at 4 °C, or 2–3 weeks
at −20 °C. Avoid repeated freeze-thaw cycles.
3. Microscope slides with eight individual wells (well Ø 6 mm)
and large cover slides.
4. Low melting point agarose.
5. 50 %, 75 %, and 100 % ethanol.
6. Coplin jars.
7. Hybridization oven.
8. Proteinase K: prepare a 1 mg/mL stock solution in ultrapure
water. Aliquot and store at −20 °C. Prepare a 10 μg/mL work-
ing solution in ultrapure water.
9. RNase A (40 μg/μL).
10. Tween 20.
11. Suitable labeled oligonucleotide probes (see Table 2). Probes
are 5′-end labeled with fluorochromes like fluorescein isothio-
cyanate (FITC) or cyanine dies (Cy3 or Cy5). Resuspend in
ultrapure water the probes to obtain a 500 ng/μL probe
36 Alessandro Desirò et al.
Table 2
List of the oligonucleotide probes used in FISH experiments
stocks. Aliquot and store the stocks in the dark at −20 °C. Dilute
probe stocks at the working concentration of 50–70 ng/μL
with ultrapure water and aliquot in individual tubes (50 μL per
tube). Avoid repeated freeze-thaw cycles. Store in the dark at
−20 °C.
12. Sterile 20× saline-sodium citrate (SSC) buffer (3 M NaCl and
0.3 M sodium citrate, pH 7). Aliquot and store at −20 °C.
13. 100 % formamide. Aliquot and store at −20 °C (see Note 3).
14. 50X Denhardt’s solution: dissolve the Denhardt’s powder in
ultrapure water according to the manufacture’s instruction.
Store at −20 °C for up to 2 years. Prepare 25× working solu-
tion. Aliquot and store at −20 °C.
15. Antifade mounting medium: 1,4-Diazabicyclo[2.2.2]octane
(DABCO) solution (25 mg/mL). Dissolve 250 mg DABCO
in 10 mL 1× PBS. Add 90 mL Glycerol. Adjust pH to 8.6 with
HCl or NaOH. Store the solution at 4 °C.
16. Leica TCS-SP2 confocal microscope (Leica Microsystems,
Wetzlar, Germany).
2.5 Bacterial 1. 0.9 % NaCl in ultrapure water (w/v). Autoclave for 20 min at
Enrichment 120 °C.
2. Sterile plastic pestles from 1.5 mL tubes.
3. Sterile 3 μm cellulose nitrate filters.
4. Sterile syringes and syringe filter holders.
5. RQ1 RNase-Free DNase (1 U/μL) (Promega, Fitchburg, WI,
USA).
The Endobacteria Thriving in Arbuscular Mycorrhizal Fungi 37
3 Methods
3.1 Biological The in pot culture is the recommended method for G. margarita
Materials routine propagation and for the obtainment of large amounts of
and Growing Media spores, since it represents a “nearly natural” method to obtain
AMF material under controlled conditions.
3.1.1 Pot Cultures
1. Place the oven-sterilized quartz sand in 0.9 L pots.
2. Soak the sand with the modified low phosphate Long Ashton
solution and let it drain. Inoculate 100 G. margarita spores
under the sand surface by pipetting.
3. Spread 80–100 T. repens seeds on the sand surface and cover
them with a thin sand layer.
4. Put the pots in a climatic chamber with a photoperiod of 16 h
and a temperature of 23 °C during the day and 21 °C during
the night. Keep the pots in culture for at least 3 months.
5. During the entire culturing period, fertilize the pots once a
week with the modified low phosphate Long Ashton solution.
Irrigate the pots with water whenever needed.
6. After 3 months of cultivation, collect the newly formed spores
from the sand soil by putting a 100 mL aliquot of substrate in
a beaker and adding water. Shake the beaker so that spores are
temporarily kept in suspension and immediately pour the water
in a 100 μm aperture sieve. Recover the sieve content in a large
glass Petri dish by washing it with water. Manually collect the
spores under a stereomicroscope by pipetting with a P1000
pipette or by individually collecting them with laboratory
tweezers (see Note 4).
3.1.2 Spore Sterilization The entire procedure should be performed under a biological hood.
1. Prepare a sterilization solution containing 3 % chloramine T
and 0.03 % Streptomycin sulfate in ultrapure water. Shake well
until the powders are completely dissolved. Typically, 50 mL of
solution is prepared to sterilize up to 2000 AMF spores.
2. Place the collected spores in a tube and remove the residual
water. Add the sterilization solution and shake the tube.
Typically, 1.5 mL of sterilization solution is used for 100 spores
(see Note 5).
3. Place the tube horizontally, so that spores are not pelleted at
the bottom, and wait 10 min.
4. Remove the sterilization solution by pipetting and add the
same volume of ultrapure water; shake well and wait 5 min.
5. Remove the water by pipetting and add the same volume of
sterilization solution. Shake well, place the tube horizontally,
and incubate 10 min.
38 Alessandro Desirò et al.
3.1.3 Lotus japonicus The procedure should be performed under a chemical hood and
Seeds Sterilization wearing suitable gloves until step 4, since sulfuric acid is toxic and
and Germination corrosive.
1. Extract L. japonicus seeds from pods and place them in a plastic
tube (see Note 6).
2. Add sulfuric acid to the tube so that seeds are completely
soaked.
3. Mix well by vortexing and leave the seeds soaked for 3 min.
4. Eliminate the sulfuric acid by pipetting and rinse the seeds with
sterile water for 10 min.
5. Repeat step 4 twice.
6. Under a biological hood, take individual seeds with flame-
sterilized tweezers and place them on water agar plates. Put
approx. 5 seeds per plate.
7. Incubate plates containing the surface-sterilized seeds in the
dark at 22 °C for 4 days, then put them in the light at the same
temperature until the cotyledons become green (see Note 7).
3.1.5 In Vitro Fungal Root organ cultures can be used to monoxenically produce in vitro
Propagation under Root G. margarita BEG34 spores and mycelium (see Note 9).
Organ Culture (ROC)
1. Propagate clones of root-inducing T-DNA-transformed roots
Conditions
previously established by subculturing them every 4 weeks on
minimal (M) medium in round Petri dishes (9 cm diameter).
Keep the dishes in the dark at 26 °C.
2. Using flame-sterilized tweezers, transfer a 4–5 cm long T-DNA
transformed root fragment in the center of a round Petri dish
(9 cm diameter) containing M medium. Gently sink the root
explant below the medium surface with tweezers to avoid
desiccation.
3. Transfer about ten surface-sterilized G. margarita spores in
the plate, all around the transformed root explant.
4. Carefully seal the dishes with Parafilm and incubate them in
the dark at 26 °C.
5. A new spore generation is produced within 1.5–2 months as a
result of mycorrhizal colonization. To keep the spores sterile,
collect them under a biological hood using flame-sterilized
tweezers.
40 Alessandro Desirò et al.
3.2 Morphological In order to preserve fungal structures and organelles, as well as the
Analyses small endobacteria, single spores were processed by using
cryo-methods, that is, high-pressure and freeze-substitution prep-
3.2.1 Transmission
aration. Subsequently, spore samples were infiltrated with Epon/
Electron Microscopy
Araldite resin and then embedded in resin blocks. For details on
the cryo-preparation and the subsequent resin infiltration and
polymerization refer to [9]. In this section, we provide details on
the processing of the samples for transmission electron microscopy
starting from the sectioning of the resin blocks.
1. Pre-warm the hot plate to about 50 °C.
2. After embedding, the resin blocks are sectioned by using an
ultramicrotome. Cut the blocks into semithin sections (1 μm)
with a glass knife.
3. Place the sections on a microscope slide. Stain the sections
with 1 % toluidine blue (w/v). Let the microscope slide dry on
the hot plate (about 50 °C). Observe the stained sections
under a light microscope for the orientation of the sample
within the block. Select a small area of the section for ultrathin
sections.
4. Cut the selected area of the block into ultrathin sections (70
nm) with a diamond knife. Treat ultrathin sections as floating
sections until the end of the counterstaining step.
5. Prepare a humid chamber to prevent the sections from drying
out. Place a wet paper towel inside a covered Petri dish (Ø 9 cm).
Place the spot plate on the paper towel.
6. Fill the spot plate well with 500 μL of uranyl acetate solution.
Lay down the sections on the solution for 20 min. Cover the
Petri dish and put it on the hot plate (about 50 °C). Place a
piece of aluminum foil on the cover of the dish to keep the
samples in the dark during the staining.
7. Rinse twice the sections in water for 10 min.
8. Fill the spot plate well with 500 μL of lead citrate solution. Lay
down the sections on the solution for 2–3 min. In order to
prevent excessive lead citrate precipitation by exposure to
CO2, add NaOH pellets (~10 g) near the spot plate. Cover the
Petri dish during the staining.
9. Rinse twice the sections in water for 10 min.
10. Mount the sections on a 200- or 300-mesh copper grids.
11. Observe under a transmission electron microscope (see Fig. 1a, b).
Fig. 1 Transmission electron and confocal microscopy of Gigaspora margarita (a, c, d) and Rhizophagus clarus
(b) spores. Ultrastructure of (a) the rod-shaped Candidatus Glomeribacter gigasporarum and (b) the coccoid
Mollicutes-related endobacterium as seen under a transmission electron microscope. (c) Crushed G. margarita
spore (sp) after staining with SYTO 9®: the cytoplasm spreads over the slide forming a halo rich in endobacteria
(arrowheads). Fungal nuclei (empty arrowhead) are trapped inside the cytoplasm. (d) FISH on a crushed spore
of G. margarita: the double labeling with the CaGg-specific probe CaGgAD1f (blue) and the Mre-specific probe
BLOsADf2 (red) confirms the simultaneous presence of the two endobacterial types in the same AMF spore;
bacteria are seen as rod-shaped or coccoid fluorescent spots (arrowheads). Fungal cytoplasm (fc). Scale bars,
(a) 0.13 µm; (b) 0.12 µm; (c) 150 µm; (d) 13 µm
42 Alessandro Desirò et al.
Spore Processing 1. Transfer surface-sterilized spores (one to three spores per slide)
on a microscope slide (see Note 10).
2. Add a 40–100 μL drop (depending on the size and number of
spores) of SYTO 9® directly on the spores.
3. Add a large cover slide covering the entire microscope slide.
Slightly press the cover slide down until you crash the spores.
4. Incubate the microscope slide for 5 min in the dark.
5. Observe under a confocal microscope (see Note 11) (see Fig. 1c).
3.3 Molecular In order to avoid contaminations, carry out all steps under a bio-
Analyses logical hood (unless indicated otherwise). Prior to use, clean all the
instruments (i.e., micropipettes, tube racks, centrifuge, etc.). Use
sterile filter tips.
3.3.1 DNA Extraction 1. Prepare a fresh aliquot of extraction buffer with 10× PCR
buffer:ultrapure water (1:1 dilution).
Rapid DNA Extraction
2. Place 1–10 surface-sterilized spores in 1.5 mL tube.
3. Crush the spore in a volume of 30 μL (single spore), 50 μL
(pool of five spores), or 70 μL (pool of ten spores) of freshly
prepared extraction buffer.
4. Incubate crashed spores at 95 °C for 15 min.
5. Centrifuge the crude extract at 16,000 × g for 10 min.
6. Collect the supernatant and store at −20 °C.
3.3.3 Real-Time qPCR Real-time qPCR is widely used for cultivation-independent detec-
tion and quantification of microorganisms. The estimation of the
starting target quantities based on the amplification threshold cycle
in each sample allows microbes (or nuclei for multinucleate organ-
isms) to be quantified when single-copy genes are considered. The
present application of qPCR can be used to quantify the abun-
dance of endobacteria in a fungal sample, to determine the bacte-
rial–fungal ratio (number of endobacteria vs. number of fungal
nuclei detected), and to relatively quantify different endobacterial
populations when simultaneously present in a fungal sample (see
Note 14). In order to avoid contaminations carry out all steps
under a biological hood. Use sterile filter tips.
1. Obtain plasmids containing the target DNA sequences.
Quantify plasmids with the Qubit® 2.0 fluorometer and esti-
mate the copy number/μL based upon the molecular weight
of the template. Generate serial plasmid dilutions so that a
106 to 101plasmid copies are present in 1 μL of sample solu-
tion (see Note 15).
The Endobacteria Thriving in Arbuscular Mycorrhizal Fungi 45
22 24 26 28 30 32 22 24 26 28 30 32
Fungus CaGg
22 24 26 28 30 32 22 24 26 28 30 32
Fungus CaGg
Fig. 2 Agarose gel electrophoresis patterns of the PCR amplification targeting the 18S rRNA gene of G. mar-
garita (left) and the 16S rRNA gene of CaGg (right). The fungal and bacterial detection was carried out using
the primer pairs AML1-AML2 [23] and GlomGIGf-GlomGIGr [13], respectively (see Subheading 3.3.2). After a
rapid DNA extraction (see Subheading 3.3.1), the samples in the upper part of the gel were subjected to bacte-
rial enrichment prior to amplification (see Subheading 3.5), whereas the ones in the lower part of the gel were
directly amplified. Six subsamples for each assay were prepared. Each subsample was amplified with a differ-
ent number of cycles (22, 24, 26, 28, 30, 32, respectively). As expected, the greater was the cycle number, the
higher was the amount of amplicons obtained. Interestingly, any fungal amplification was observed from the
samples enriched in endobacteria, suggesting a limited or absent carryover of fungal nuclei. These results
confirmed the efficiency of the bacterial enrichment procedure here described
4 Notes
4. If the spores still look very dirty (i.e., several residues are
attached to the spore surface), a mild sonication can be
added prior to performing the sterilization (for not more
than 30–40 s).
5. Depending on the spore amount being surface-sterilized, the
suitable tube should be chosen. As an example, use 1.5 mL
tubes to sterilize individual batches of 100 spores each, and 50
mL tubes when groups of 1000 spores are treated together.
6. Depending on the seed amount being surface-sterilized, the
suitable plastic tube should be chosen. As an example, use 2
mL tubes to sterilize individual batches of 20 seeds each, and
15 mL tubes when up to 100 seeds are treated together.
7. After 4 days of germination in the dark, check whether the
germination occurred and, if so, place the Petri dishes in the
light, otherwise wait 2–3 days more. The seedlings are ready
to be transplanted when cotyledons become green. From that
moment, they can be kept in the Petri dish prior to use for at
most 1 week.
8. The sandwich, composed by two cellulose nitrate membrane
containing the L. japonicus seedling and the G. margarita
spores, should be handled with extreme care; it should be
placed in the Magenta box so that approximately 2/3 of its
height is embedded in the sand.
9. The mycorrhizal efficiency is fast reducing in subsequent ROC
cycles for this specific AMF isolate. Furthermore, the popula-
tion of Candidatus Glomeribacter gigasporarum is dramati-
cally reduced in successive spore generations obtained with
this cultivation method, and this effect is further amplified
when single spore inocula are employed [7]. Thus, it is recom-
mended not to perform more than one ROC cycle to monox-
enically produce G. margarita BEG34, unless the aim of the
experiment is to obtain a cured line of the fungus, which is
devoid of endobacteria [7].
10. When transferring the spores on a microscope slide, remove
with a micropipette or absorb with blotting paper the remain-
ing liquid (i.e., PBS, ethanol-PBS mixture, water).
11. FITC and SYTO 9® fluorescence is excited at 488 nm and
imaged with an emission window at 500–540 nm. Cy3 fluo-
rescence is excited at 546 nm and imaged at 550–600 nm.
Cy5 fluorescence is excited at 633 nm and imaged at
640–700 nm.
12. If the primer pair 109F-1184R [5] does not succeed, use a
semi-nested PCR approach. Carry out a first PCR with 109F
and 1387R [28]: cycling conditions were the same mentioned
for 109F-1184R but with 55 s of extension in the cycles. Then
apply a semi-nested PCR using the reverse primer 1184R:
50 Alessandro Desirò et al.
Acknowledgements
The authors wish to thank Mara Novero and Maria Teresa Della
Beffa for having provided details on fungal culture conditions.
Research in PB laboratory has been funded by the University of
Turin (Local project 60 %).
References
Mollicutes-related endobacteria thrive inside Medicago truncatula for the study of nitrogen-
liverwort-associated arbuscular mycorrhizal fixing and endomycorrhizal symbiotic associa-
fungi. Environ Microbiol 15:822–836 tions. Mol Plant Microbe Interact 14:695–700
16. Partida-Martinez LP, Hertweck C (2005) 23. Lee J, Lee S, Young JPW (2008) Improved
Pathogenic fungus harbours endosymbiotic PCR primers for the detection and identifica-
bacteria for toxin production. Nature tion of arbuscular mycorrhizal fungi. FEMS
437:884–888 Microbiol Ecol 65:339–349
17. Sato Y, Narisawa K, Tsuruta K, Umezu M, 24. Gardes M, Bruns TD (1993) ITS primers with
Nishizawa T, Tanaka K, Yamaguchi K, enhanced specificity for basidiomycetes-appli-
Komatsuzaki M, Ohta H (2010) Detection of cation to the identification of mycorrhizae and
betaproteobacteria inside the mycelium of the rusts. Mol Ecol 2:113–11
fungus Mortierella elongata. Microbes Environ 25. White TJ, Bruns T, Lee S, Taylor JW (1990)
25:321–324 Amplification and direct sequencing of fungal
18. Desirò A, Faccio A, Kaech A, Bidartondo MI, ribosomal RNA genes for phylogenetics. In:
Bonfante P (2015) Endogone, one of the old- Innis MA, Gelfand DH, Sninsky JJ, White TJ
est plant-associated fungi, host unique (eds) PCR protocols. Academic Press, San
Mollicutes-related endobacteria. New Phytol Diego, pp. 315–322
205:1464–1472 26. Amann RI, Binder BJ, Olson RJ, Chisholm
19. Hewitt EJ (1966) Sand and water culture SW, Devereux R, Stahl DA (1990) Combination
methods used in the study of plant nutrition, of 16S rRNA-targeted oligonucleotide probes
2nd edn. Commonwealth Agricultural Bureau: with flow cytometry for analyzing mixed
The Eastern Press, London microbial populations. Appl Environ Microbiol
20. Fontaine J, Grandgmougin-Ferjani A, Glorian 56:1919–1925
V, Durand R (2004) 24-Methyl/methylene 27. Koga R, Tsuchida T, Fukatsu T (2003)
sterols increase in monoxenic roots after colo- Changing partners in an obligate symbiosis: a
nization by arbuscular mycorrhizal fungi. New facultative endosymbiont can compensate for
Phytol 163:159–167 loss of the essential endosymbiont Buchnera in
21. Bécard G, Fortin JA (1988) Early events of an aphid. Proc R Soc B 270:2543–2550
vesicular-arbuscular mycorrhiza formation on 28. Marchesi JR, Sato T, Weightman AJ, Martin
Ri T-DNA transformed roots. New Phytol TA, Fry JC, Hiom SJ, Wade WG (1998) Design
108:211–218 and evaluation of useful bacterium-specific
22. Boisson-Dernier A, Chabaud M, Garcia F, PCR primers that amplify genes coding for bac-
Bécard G, Rosenberg C, Barker DG (2001) terial 16S rRNA. Appl Environ Microbiol
Agrobacterium rhizogenes-transformed roots of 64:2333
Chapter 3
Abstract
In 2008, the platform “GenoSol” (http://www.dijon.inra.fr/plateforme_genosol) was created at the
INRA (French National Institute for Agronomic Research) of Dijon. This platform was launched by sev-
eral soil microbial ecologist senior scientists to provide a logistics and technical structure dedicated to the
acquisition, conservation, characterization, and supply of genetic resources (DNA) of soils from very large-
scale samplings (several hundred to several thousand corresponding to large spatial and/or temporal
scales). Thanks to this structure metagenomic analysis of soil microbial communities has been standardized
as well as a reliable reference system for analysis of the microbial genetic resources of the collected soils
(more than 10,000 soil samples to date). This platform also illustrates the usefulness of existing soil archives
in providing a readily available source of ecological information that is relevant to microbial ecology, prob-
ably more than we can currently fathom.
1 Introduction
Francis Martin and Stéphane Uroz (eds.), Microbial Environmental Genomics (MEG), Methods in Molecular Biology, vol. 1399,
DOI 10.1007/978-1-4939-3369-3_3, © Springer Science+Business Media New York 2016
55
56 Samuel Dequiedt et al.
2 GenoSol Facilities
2.1 Soil The platform GenoSol is the first “microbiological” soil conserva-
Conservatory tory designed to manage, store, and make available soil microbial
genetic resources obtained from large-scale sampling such as soil
survey or network of experimental sites. Once received at the plat-
form, soils are freeze-dried at −40 °C and stored. The impact of
processing on subsequent variability of the molecular analyses has
been tested and optimized (S. Dequiedt, pers. comm.). A protocol
producing high-quality nucleic acids, compatible with the molecu-
lar characterization tools, is systematically applied to extract, purify,
and quantify the DNA from the stored soil samples and is currently
undergoing normalization (Association Française de Normalization,
International Standard Organization). The purified DNAs are
stored at −30 °C (INRA quality control). An automated, comput-
erized procedure ensures sample management and traceability. So
far, more than 10,000 soils and corresponding DNAs have been
referenced by the platform GenoSol. It is estimated that subse-
quently more than 1500 new soils will be processed each year.
These soils come from French national soil survey and experimen-
tal sites in majority but also a non-negligible part from interna-
tional collaborations in the five earth continents. Figure 1 presents
GenoSol Platform: A Logistic and Technical Platform for Conserving and Exploring… 57
Fig. 1 Mapping of French soils stored in Genosol conservatory originating from the French Soil Monitoring
Network (réseau de mesures de la qualité des sols: RMQS) and other experimental field sites managed by
research or technical institutes
2.2 Molecular Tools Microbial genetic resources of natural ecosystems are very difficult
Development to characterize, which can be explained by the different degrees of
accessibility of populations within a heterogeneous and structured
matrix but also by the difficulty of resolving an information repre-
senting 100,000–1,000,000 different species per gram/mL of
material. However, during the past 20 years, major advances in
molecular biology have allowed the development of “molecular
ecology approaches” to investigate the diversity of natural micro-
bial communities in situ. In this context, the GenoSol platform will
provide facilities and dedicated services to all researchers’ commu-
nity (Fig. 2). GenoSol platform will develop metagenomics
approach directly on the DNA extracted from environmental
58 Samuel Dequiedt et al.
2.3 Reference To develop a reliable reference system for analysis of the microbial
System and Database genetic resources of the collected soils, the platform GenoSol has
set up a database called “MicroSol” [9]. This database is designed
to allow interactions with other databases managed by the GenoSol
partners via computerized links. These external databases provide
information on soil physicochemical characteristics, climatic data,
plant cover, history of agricultural practices, and land use. This
network of databases is only accessible to partners and users of the
platform, and within the technical and legal frameworks laid down
in the GenoSol charter. The platform GenoSol also promotes the
selection and standardization of national and European procedures
and tools for assessing soil quality.
In an agroecological context which requires the development
of bioindicators for evaluating soil quality and the impact of agri-
cultural practices, the MicroSol database developed is an opera-
tional tool to develop and promote microbial indicators, but also
the associated standards essential for their interpretation. Indeed,
this database contains the results of molecular analyses of the abun-
dance and diversity of microbial communities acquired in a stan-
dardized methodological framework from samples covering the
entire France territory. One of the main outputs is the development
of statistical polynomial model allowing the prediction of optimum
soil microbial biomass and biodiversity according to environmental
parameters. This model is an innovative tool providing optimal
value of microbial biomass for a given pedoclimatic condition,
which must be compared with the corresponding measured data to
allow a robust diagnostic of soil quality and of the impact of land
use (Horrigue et al., in revision Ecological Indicators).
More recently, the Genosol platform was integrated in the
AnaEE-France (Analysis and Experimentation on Ecosystems)
research infrastructure services for experimental studies on soil
biodiversity and associated ecological functions. AnaEE-France is
the French node of a European research infrastructure dedicated
to experimental research on continental ecosystems. It gathers a set
of platforms selected for their originality, their quality, and their
access to the scientific community. The infrastructure offers clear
60 Samuel Dequiedt et al.
References
1.Balvanera P, Pfisterer AB, Buchmann N, He JS, the ISO Standard 11063 DNA extraction pro-
Nakashizuka T, Raffaelli D, Schmid B (2006) cedure to characterize soil bacterial and fungal
Quantifying the evidence for biodiversity effects community diversity and composition. Microb
on ecosystem functioning and services. Ecol Biotechnol 8:131–42
Lett 9:1146–1156 6. Terrat S, Dequiedt S, Horigue W, Lelievre M,
2.Maron PA, Mougel C, Ranjard L (2011) Soil Cruaud C, Saby N, Jolivet C, Arrouays D,
microbial diversity: spatial overview, driving fac- Maron PA, Ranjard L, Chemidlin Prévost-
tors and functional interest. C R Biol 334: Bouré N (2015) Improving soil bacterial taxa-
403–411 area relationships assessment using DNA
3.Terrat S, Christen R, Dequiedt S, Lelievre M, meta-barcoding. Heredity 114(5):468–75
Nowak V, Bachar D, Plassart P, Wincker P, 7. Chemidlin Prevost-Boure NC, Christen R,
Jolivet C, Bispo A, Lemanceau P, Maron PA, Dequiedt S, Mougel C, Lelievre M, Jolivet C,
Mougel C, Ranjard L (2012) Molecular bio- Ranjard L (2011) Validation and application of
mass and MetaTaxogenomic assessment of soil a PCR primer set to quantify fungal communi-
microbial communities as influenced by soil ties in the soil environment by real-time quanti-
DNA extraction procedure. J Microbial tative PCR. PLoS One 6(9), e24166
Biotechnol 5:135–141 8. Ranjard L, Dequiedt S, Chemidlin Prévost-
4.Plassart P, Terrat S, Griffiths R, Thomson B, Bouré N, Thioulouse J, Saby NPA, Lelievre M,
Dequiedt S, Lelievre M, Regnier T, Nowak V, Maron PA, Morin FER, Bispo A, Jolivet C,
Bailey M, Lemanceau P, Bispo A, Chabbi A, Arrouays D, Lemanceau P (2013) Turnover of
Maron P-A, Mougel C, Ranjard L (2012) soil bacterial diversity driven by wide-scale envi-
Evaluation of the ISO standard 11063 DNA ronmental heterogeneity. Nat Commun 4:134.
extraction procedure for assessing soil microbial doi:10.1038/ncomms2431
abundance and community structure. PLoS One 9. Morin FER, Dequiedt S, Koyao-Darinest V, Toutain
7, e44279 B, Terrat S, Lelièvre M, Nowak V, Faivre-Primot C,
5. Terrat S, Plassart P, Bourgeois E, Ferreira S, Lemanceau P, Maron PA, Ranjard L (2013)
Dequiedt S, Adele-Dit-De-Renseville N, MicroSol database, le Premier Système d’Information
Lemanceau P, Bispo A, Chabbi A, Maron PA, Environnemental sur la Microbiologie des Sols.
Ranjard L (2015) Meta-barcoded evaluation of Etud Gest Sols 20:27–38
Chapter 4
Abstract
Fungal species participate in vast numbers of processes in the landscape around us. However, their often
cryptic growth, inside various substrates and in highly diverse species assemblages, has been a major obsta-
cle to thorough analysis of fungal communities, hampering exhaustive description of the fungal kingdom.
Recent technological developments allowing rapid, high-throughput sequencing of mixed communities
from many samples at once are currently having a tremendous impact in fungal community ecology.
Universal DNA extraction followed by amplification and sequencing of fungal species-level barcodes such
as the nuclear internal transcribed spacer (ITS) region now enable identification and relative quantification
of fungal community members across well-replicated experimental settings.
Here, we present the sample preparation procedure presently used in our laboratory for fungal com-
munity analysis by high-throughput sequencing of amplified ITS2 markers. We focus on the procedure
optimized for studies of total fungal communities in humus-rich soils, wood, and litter. However, this
procedure can be applied to other sample types and markers. We focus on the laboratory-based part of
sample preparation, that is, the procedure from the point where samples enter the laboratory until ampli-
cons are submitted for sequencing. Our procedure comprises four main parts: (1) universal DNA extrac-
tion, (2) optimization of PCR conditions, (3) production of tagged ITS amplicons, and (4) preparation of
the multiplexed amplicon mix to be sequenced. The presented procedure is independent of the specific
high-throughput sequencing technology used, which makes it highly versatile.
Key words Meta-barcoding, High-throughput sequencing, ITS (internal transcribed spacer), DNA
extraction, Multiplexing
1 Introduction
Francis Martin and Stéphane Uroz (eds.), Microbial Environmental Genomics (MEG), Methods in Molecular Biology, vol. 1399,
DOI 10.1007/978-1-4939-3369-3_4, © Springer Science+Business Media New York 2016
61
62 Karina Engelbrecht Clemmensen et al.
Fig. 2 Diagram of the fungal rDNA gene cluster. Genes encoding 18S, 5.8S, and 28S ribosomal RNA subunits
(SSU = small subunit, LSU = large subunit) are separated by the internal transcribed spacer regions 1 (ITS1)
and 2 (ITS2) that are useful as a species-level barcode for most fungi. Primer sites used for obtaining ampli-
cons covering the majority of fungi are indicated by single-headed arrows above the diagram. The approxi-
mate size variation in amplicons of ITS2 (upper broken line) and the full ITS (lower broken line) are indicated
below the diagram
Sample Preparation for Fungal Community Analysis by High-Throughput Sequencing… 65
much less size variation than full ITS amplicons have proved to
give much better translation of DNA template relative abundances
into sequence read relative abundances, probably due to fewer
biases during both amplification and sequencing [11]. However, it
should be mentioned that most primers have mismatches for some
fungal groups (including the used primers), and that competition
for primers in amplifications of complex communities may be
strongly biased even by single mismatches between primer and
template [11, 13].
In order for the composition of sequences in the amplified
sample to resemble the template community as much as possible, it
is pivotal to optimize both the template concentration and the
number of PCR amplification cycles, preferably for each sample
individually. The DNA template should be diluted enough to over-
come any inhibition of the PCR reaction caused by too high con-
centrations of inhibitors in the extracts. However, the template
should not be diluted more than necessary, as larger amounts of
template decrease the impact of stochastic processes and give more
predictable and less biased PCR amplification [14]. The number of
PCR cycles should allow the reaction to reach (the middle of) the
phase of exponential increase of product, but not to enter the satu-
rated phase in which the community could be altered due to, e.g.
primer or dNTP limitation. Generally, PCR biases due to both ran-
dom drift and selection bias are minimized if the number of PCR
cycles is reduced. Optimal dilutions and cycle numbers can be
tested either with normal PCR or with quantitative real-time PCR
(Fig. 3). Here, we describe the procedure based on normal PCR
and visualization of PCR products by agarose gel electrophoresis.
Once the PCR conditions are settled, final amplicons are produced
with tagged primer combinations that are specific for each sample.
We have designed [15] 104 primer pairs in which both primers are
extended by a unique 10 bp tag (Fig. 4, Table 1). Tagging at both
ends allows us to later filter out sequences with unexpected tag
combinations caused by chimera formation or tag switching [16].
All tagged primer pairs were tested for amplification efficiency,
using qPCR, and primer combinations that clearly deviated from
the average were discarded.
Different sequencing platforms require different adaptors to
be added to templates in a sample before sequencing. These adap-
tor sequences can, potentially, be included in the ITS primers,
directly upstream the identification tag, which would give control
of the sequencing direction (sequencing starts at one of the adap-
tors). However, we have chosen to prepare our amplicons by prim-
ers fused with only the identification tags. This precludes the use of
excessively long fusion primers, which usually results in low ampli-
fication efficiency, higher risk of primer dimers (and multimers),
and often requires complex nested PCR approaches, leading to a
high potential for biases. The adaptors are instead added to our
66 Karina Engelbrecht Clemmensen et al.
Amplification Chart
2000
1800
PCR Base Line Subtracted Curve Fit RFU
1600
1400
1200
1000
800
600
400
224.85
200
0 5 10 15 20 25 30 35 40
Cycle
Fig. 3 Standards with different ITS copy numbers run in a quantitative real-time PCR (qPCR). Colored lines
show the increase in PCR product for each cycle (x-axis) for a series of triplicate standard samples differing in
ITS copy concentrations by a factor 10. The optimal number of cycles for producing amplicons for sequencing
can be determined by qPCR. The total number of ITS copies in a sample can also be determined by relating the
sample to a standard curve like this
Degenerate bases
5’ Sample tag 3’
extension
C A G C TA G A T T G T G A R T C A T C G A R T C T T T G
Binds to template
Ligation site Linker
(always C) (always T)
Fig. 4 Example of a sample tagged gITS7 primer [10]. The 19 bp long part that is complementary to the tem-
plate contains two degenerated positions (R = equal mix between G and A) that increases the generality of the
primer to cover a large fraction of all fungi (and also some other eukaryotes). The linker ensures that the bind-
ing part is restricted to 19 bp for all templates. We have developed a set of 104 primers that all differ in their
sample specific tags on at least three positions. The conserved C at the 5′ end facilitate non-biased ligation of
sequencing adaptors
(continued)
Table 1
68
(continued)
2 Materials
3 Methods
3.2 DNA Extraction 1. Weigh 50–500 mg powdered substrate into 2 mL screw cap
and Purification tubes; less material for organic samples, more for mineral soils
(see Note 8). Note down the exact amount extracted for each
3.2.1 DNA Extraction
sample (see Note 9). For every 23 samples, include an extrac-
Using the CTAB Method
tion blank (empty tube), which is treated as the samples in all
following steps. Add three 2-mm-diameter glass beads to each
tube (see Note 10) and close the lids.
2. Homogenize samples in the beadbeater machine set at low
speed for 10 s.
3. Add 1000 μL CTAB extraction buffer (see Note 11).
4. Run samples in the beadbeater machine once again. The CTAB
will froth like detergent.
5. Incubate for 60 min at 65 °C in a heating block and vortex
every 15 min.
6. Spin down particles in a table top centrifuge at 9600 × g for
5 min.
7. Transfer 500–800 μL of the upper phase to a new, marked
microcentrifuge tube using a pipette and filter tips (see
Note 12).
8. Add 500–800 μL chloroform (1× volume) and shake the sam-
ples vigorously by hand. All work with chloroform must be
carried out in a fume hood (see Note 13).
9. Centrifuge the mixture at 9600 × g for 5 min.
10. Transfer the upper phase (typically 400–600 μL, record
amount) to a new marked 1.5 mL tube. Take care not to
include any chloroform (lower phase) or interphase with the
transferred phase.
11. Repeat the chloroform extraction steps 8–10.
12. Mix the supernatant with 600–900 μL 2-propanol (1.5 × vol-
ume) and leave on ice for 30 min (see Note 14). At this stage
you may stop and store the samples at –20 °C.
13. Centrifuge at 16,500 × g for 10 min.
14. Discard the supernatant by gently decanting it into a beaker.
The DNA should now be in the pellet.
15. Wash the pellet with 70 % ethanol (500 μL). Centrifuge at
4100 × g for 5 min. Discard ethanol by decantation.
16. Optional: carefully remove remaining liquid with a pipette.
17. Let the pellet air dry by resting tubes upside down on a paper
towel for 30 min.
74 Karina Engelbrecht Clemmensen et al.
3.2.2 Optional: 19. Use one Wizard minicolumn for each sample. Remove and set
Purification with the Wizard aside the plunger from a 3 mL disposable syringe. Attach the
DNA Clean-Up System syringe barrel to the Luer-lock extension of each minicolumn
(Promega) (see Note 4).
20. Add 1 mL of Wizard DNA clean-up resin (see Note 15) to a
1.5 mL microcentrifuge tube. Add the DNA extract (see Note 16)
to the clean-up resin and mix by gently inverting several times.
21. Pipet the Wizard DNA clean-up resin containing the bound
DNA into the syringe barrel. Insert the syringe plunger slowly
and gently push the slurry into the minicolumn with the
syringe plunger. Discard the flow-through.
22. Detach the syringe from the minicolumn and remove the
plunger from the syringe. Reattach the syringe barrel to the
minicolumn. To wash the column, pipet 2 mL of 80 %
2-propanol into the syringe. Insert the plunger into the syringe
and gently push the solution through the minicolumn. Discard
the flow-through.
23. Remove the syringe barrel and transfer the minicolumn to a
1.5 mL microcentrifuge tube. Centrifuge the minicolumn for
2 min at 10,000 × g to dry the resin.
24. Transfer the minicolumn to a new microcentrifuge tube. Apply
50 μL of pre-warmed (65–70 °C) water to the minicolumn
and wait for 1 min. The DNA will remain intact on the mini-
column for up to 30 min. Centrifuge the minicolumn for 20 s
at 10,000 × g to elute the bound DNA fragment.
25. Remove and discard the minicolumn. The purified DNA may
be stored in the tube at 4 °C for short term or at –20 °C for
longer term. To avoid contamination of the DNA template,
subsample with care and as little as possible.
3.2.3 DNA Quantification 26. Blank measurement: Load your blank sample (1.5 μL water,
and Purity Check same as template DNA eluate) onto the lower pedestal, close
by NanoDrop the sample chamber, and press “Blank” on the screen. Confirm
that the blank has yielded a reproducible zero, by analyzing a
blank as though it was a sample (see Note 17).
27. Clean the instrument between each measurement by wiping the
sample from both the upper and lower pedestals using paper wipes.
28. Sample measurements: Load your sample (1.5 μL), and select
“Measure” on the measurement screen. DNA concentration
and purity can be assessed (see Note 18).
Sample Preparation for Fungal Community Analysis by High-Throughput Sequencing… 75
3.3 PCR Optimization 1. Choose DNA extracts representing different sample types, typ-
ically 4–6 DNA extracts at a time (see Note 19).
3.3.1 Test of Template
Concentrations and Cycle 2. Dilute the samples to 5, 0.5, and 0.05 ng/μL with water based
Numbers on the NanoDrop measurement (see Note 20).
Dilution formula : C1 ´ V1 = C2 ´ V2
Table 2
Overview table of ingredients in PCR mix
7. Add the templates (25 μL) using new pipette tips for each
sample.
8. Cap the tubes properly and spin down in a centrifuge.
9. Place tubes in the thermal cycler (PCR machine) and run the
samples at the following cycle conditions: 5 min at 94 °C, typi-
cally 20–35 cycles of 30 s at 94 °C, 30 s at 56 °C and 30 s
72 °C, and a final 7 min at 72 °C (see Note 22). Enter infor-
mation on reaction volume and desired maximum number of
cycles to run.
10. Pause the PCR machine when the desired test cycle numbers
are reached (for example 22, 25, 28, 31, and 35) and take out
an aliquot of 10 μL from each PCR reaction into a new tube
for each cycle number.
3.3.2 PCR Products 11. Set up electrophoresis cell, gel tray and combs to run all test
Visualized by Gel PCR products including blanks. Fill the electrophoresis cell
Electrophoresis with 1xSB buffer (see Note 23).
12. To prepare 220 mL 1 % agarose gel (see Note 24), weigh 2.2 g
of agarose into a 500 mL glass flask, and add 220 mL 1xSB
buffer to the flask. Add 4 μL Nancy-520 dye (see Note 25).
13. Melt the agarose in a microwave oven. Make sure there are no
bubbles or agarose crystals left.
14. Allow the melted agarose to cool to about 60 °C or cool
enough to handle with your hands. Seal the ends of the gel tray
and insert the combs, then pour the cooled agarose into the
tray and allow it to solidify for about 30 min. When the aga-
rose has solidified, carefully remove the combs and seals.
15. Load 3 μL of standard ladder in the wells closest to both sides
of each sample row of the gel. Then load 5 μL of your samples
into the wells. We usually load the gel in dry condition.
16. Place the tray with the gel in an electrophoresis cell and make
sure that it is covered by buffer. Run the gel at about 10 V/cm
for 20–30 min.
17. Stop the power supply, remove your gel and take a photo under
UV or blue light in a gel documentation system.
18. Evaluate test PCR results.
Test PCRs: If any of the blanks have obvious PCR products,
consider re-running the PCR, or even the DNA extraction. For
each sample, evaluate which dilution worked the best, i.e. which
gave strongest bands on the gel. Observe that if inhibitors are pres-
ent in the DNA template, more diluted (less concentrated) samples
may work better. Evaluate which cycle number worked the best;
chose as few cycles as possible still giving sufficient PCR product,
i.e. ideally weak to intermediate, but not very strong, bands on the
Sample Preparation for Fungal Community Analysis by High-Throughput Sequencing… 77
Fig. 5 The PCR products obtained with the gITS7–ITS4 primer combination separated on a 1 % agarose gel,
stained with Nancy dye and visualized under UV light. Each sample is run in technical triplicates
3.4 Production 1. Make new dilutions from the template as decided upon for
of Tagged ITS each sample type. At least enough diluted sample to run three
Amplicons PCR reactions, each with 25 μL diluted sample, is needed.
3.4.1 PCRs with Sample- 2. Group samples according to the number of PCR cycles they
Tagged ITS Primers should be subjected to. Assign a tagged primer mix to each
sample. Calculate how many PCR reactions to run, starting
with the PCR with fewest cycles. Run three technical PCR rep-
licates of each sample.
3. Prepare a master mix with sufficient mix for all samples plus a
few extra samples to allow for pipetting losses. Also include
extraction blanks and PCR negative controls (blanks) with
water added instead of DNA template; run at least one PCR
blank per 48 samples. Table 2 can be used to establish how
much of each ingredient is needed.
4. Take out the reagents from the freezer, defrost them and put
them on ice.
5. Pipette everything but the tagged primer mix and your tem-
plate DNA into a microcentrifuge tube. Vortex gently and
quickly spin down the mixture using a table top centrifuge.
6. Aliquot 20 μL master mix into each PCR tube.
7. Add 5 μL of the tagged primer mix to each PCR tube using
new pipette tips for each primer mix. Use different ITS tags for
each sample as well as for extraction and PCR blanks, but same
for the three PCR replicates of each sample. Make sure to
record which tagged primer mix is used for each sample.
8. Add your template (25 μL) using new pipette tips for each
sample. Prepare three technical PCR replicates of each.
9. Cap the tubes properly and spin down in a centrifuge.
78 Karina Engelbrecht Clemmensen et al.
10. Place tubes in the thermal cycler (PCR machine) and run the
samples at the following cycle conditions: 5 min at 94 °C, typi-
cally 20–30 cycles of 30 s at 94 °C, 30 s at 56 °C and 30 s
72 °C, and a final 7 min at 72 °C (see Note 22). Add informa-
tion on reaction volume and desired number of cycles to run.
Observe that when producing the final amplicons, all PCRs
should be run to the end of the program to ensure the highest
possible quality of the product.
11. Run 5 μL of the PCR products on an agarose gel (see
Subheading 3.3.2). Chose only good products for further pro-
cessing, ideally with weak to intermediate, but not very strong,
bands on the gel (Fig. 5). In cases where samples gave no or very
weak PCR products, these samples can be re-run at a higher
cycle number, or other template concentrations considered.
3.4.2 Clean PCR 12. Add 81 μL AMPure magnetic bead solution (1.8 × sample vol-
Products ume) to each PCR product of 45 μL (see Notes 27, 28).
with the AMPure Kit 13. Transfer the PCR-product/bead mix to a PCR-plate with
raised wells.
14. Incubate at room temperature for 3–5 min.
15. Place the plate on the magnetic plate. Incubate for 5–10 min.
16. Keeping the plate on the magnet, turn the plate upside-down
and try to get rid of the liquid. The plate can be gently hit
against a table with kitchen tissue paper to absorb the liquid.
17. Add 200 μL 70 % ethanol to each well and incubate for 30 s at
room temperature. Get rid of the liquid as in 16.
18. Repeat step 17. This time it is important to get rid of as much
liquid as possible. Hit the plate hard several times against the
table, until no drops appear on the kitchen-roll paper. Keep the
plate in the magnetic plate at all times.
19. Let the plate dry at 37 °C for about 60 min; it is important to get
rid of all ethanol. The magnetic plate is not necessary at this stage.
20. Remove the plate from the magnet. Add 60 μL elution buffer
to each well, cover with plastic foil, vortex and spin down.
21. Place the plate on the magnet before pipetting the superna-
tant. Alternatively, the magnetic beads can be pelleted by cen-
trifugation at 1900 × g for 10 s.
3.5 Amplicon Mixing 1. All reagents should be allowed to adjust to room temperature
and Sequencing (see Notes 25, 27, 29).
3.5.1 Quantification 2. Set up the number of 0.5 mL tubes you will need for standards
of Double-Stranded DNA and samples. The assay requires 2 standards.
with the Qubit dsDNA HS 3. Prepare the working solution by diluting the dsDNA HS
Assay Kit reagent (component A) 1:200 in dsDNA HS buffer (compo-
nent B) in a tube. Prepare 200 μL per sample/standard, plus
Sample Preparation for Fungal Community Analysis by High-Throughput Sequencing… 79
for one extra sample to account for pipetting losses. That is,
mix 199 μL of component B (× number of samples) with 1 μL
of component A (× number of samples).
4. Load 190 μL of the working solution into each of the tubes
used for standards.
5. Add 10 μL of each standard (C and D) to the appropriate tube
and mix by vortexing for 2–3 s. Careful pipetting is critical to
ensure that exactly 10 μL of each standard is added to 190 μL
of working solution.
6. Load 197 μL working solution into individual sample assay
tubes.
7. Add 3 μL of your samples to assay tubes containing the work-
ing solution and mix by vortexing for 2–3 s. The final volume
in each tube should be 200 μL.
8. Centrifuge the samples at 1000 × g for 10 s to get rid of air
bubbles.
9. Allow all tubes to incubate at room temperature for 2 min.
10. On the Home Screen of the Qubit Fluorometer, press “DNA,”
and then select “dsDNA High Sensitivity” as the assay type.
The Standards Screen is automatically displayed.
11. On the Standards Screen, press “Yes” to run a new
calibration.
12. Running a New Calibration: Insert the tube containing
Standard 1 in the Qubit Fluorometer, close the lid and press
“GO.” Also press “START” on the computer screen if using
complementary software to store recordings. The reading will
take approximately 3 s. Remove Standard 1. Repeat for
Standard 2.
13. Insert a sample tube into the Qubit Fluorometer, close the lid,
and press “GO.”
14. Upon the completion of the measurement, the result will be
displayed on the screen. The Qubit machine can do calcula-
tions to account for dilution in the assay directly after each
measurement. Alternatively, see calculation below.
15. Repeat sample readings until all samples have been measured.
3.5.2 Calculating 16. The Qubit Fluorometer (QF) gives values for the Qubit
the Concentration dsDNA HS assay in ng/mL. This value corresponds to the
of dsDNA in Each Sample concentration after samples were diluted into the assay tube.
To calculate the dsDNA concentration in your sample, use the
following equation:
3.5.3 Make an Equal Mix 17. Decide how much DNA (ng) you wish to pool from each sam-
of all Amplicons ple, aiming for the same amount from each sample (see Note
29). Typically, this would correspond to the total amount of
DNA in the sample with the lowest concentration. The DNA
amount required per DNA pool that is sent for sequencing
depends on the sequencing platform. Typically, at least 1 μg of
total dsDNA is needed for amplicon samples. Also account for
losses of DNA (typically one-third to half) in the final cleaning
of the DNA mix.
18. Calculate the volume needed from each sample to obtain the
decided amount of DNA in the mix. Typically, mix 50–100 ng
DNA from each of the PCR reactions. If some samples have
very little PCR product you may have to scale amounts of these
samples down relative to the rest of the samples, i.e. take fewer
ng of these samples, well-knowing that they may be under-
represented in the sequence data. Calculate the amount to be
pooled from each sample:
3.5.4 Clean Amplicon 19. The final amplicon mix is purified to remove leftovers from
Mix with Cycle-Pure Kit the PCR mix and smaller (unwanted) DNA fragments, such
(Omega) as primer dimers. Determine the volume of the amplicon
mix to be purified. The volume can be reduced by speedvac
or freeze-drying, but avoid drying out the sample com-
pletely. Pellet any remaining magnetic beads (from AMPure
step) by centrifugation. Place the tube against a magnet and
transfer the sample into a clean tube; avoid transferring
magnetic beads as much as possible. Add 6 volumes of
Cycle-Pure buffer CP; e.g., if your PCR mix is 100 μL, add
600 μL of buffer CP.
20. Vortex thoroughly to mix. Briefly centrifuge the tube to collect
any drops from the inside of the lid.
21. Place a Cycle-Pure minicolumn into the 2 mL collection tube.
22. Add the mixed sample from step 2 to the minicolumn and
centrifuge at 13,000 × g for 1 min at room temperature.
Discard the flow-through liquid and place the minicolumn
back into the same collection tube. The column can hold up to
700 μL at a time. If sample volume is larger than this, it can be
loaded onto the same column multiple times and the centrifu-
gation repeated.
Sample Preparation for Fungal Community Analysis by High-Throughput Sequencing… 81
3.5.5 PCR Product 28. Allow the Agilent gel-dye mix to equilibrate to room tempera-
Quantification and Quality ture for 30 min before use (see Notes 25, 30).
Control by Bioanalyzer 29. Put a new Agilent DNA chip on the chip priming station.
(Agilent Tech)
30. Pipette 9.0 μL gel-dye mix into the well marked with G .
31. Make sure that the plunger is positioned at 1 mL and then
close the chip priming station.
32. Press the plunger until it is held by the clip.
33. Wait for exactly 30 s, then release the clip.
34. Wait for 5 s and then slowly pull back the plunger to the 1 mL
position.
35. Open the chip priming station and pipette 9.0 μL gel-dye mix
into the wells marked G.
36. Pipette 5 μL of marker (green) into all 12 sample wells and the
ladder well. Do not leave any wells empty.
37. Pipette 1 μL of DNA ladder (yellow) into the well marked with
a ladder.
38. In each of the 12 sample wells, pipette 1 μL of sample (used
wells) or 1 μL of de-ionized water (unused wells).
39. Put the chip horizontally in the adapter and vortex for 1 min at
the indicated setting (2400 rpm).
40. Run the chip in the Bioanalyzer within 5 min. The result will
appear in the screen (Fig. 6).
82 Karina Engelbrecht Clemmensen et al.
Pool 2-skork
[FU]
100
2
80
60
40
1
3
20
Fig. 6 DNA size distribution profiles in a multiplexed ITS2 amplicon mix from 100 samples as analyzed by
Bioanalyzer. The amplicon mix is represented by a smear of sizes between 200 and 500 bp. The main peaks
around 300 and 400 bp probably represent ascomycetes and basidiomycetes, respectively. Two markers are
labeled by green (50 bp) and violet (10,380 bp) numbers or bands in the electropherogram (left) and in the
virtual gel image (right), respectively
41. An amplicon mix with sufficient DNA and of the expected size
distribution can be sent for sequencing, in either frozen or
freeze-dried condition.
4 Notes
14. This step can also be done at room temperature, which gives
less but cleaner DNA, or in the freezer, which gives more but
less clean DNA.
15. Thoroughly mix the Wizard DNA clean-up resin before
removing an aliquot. If crystals or aggregates are present, dis-
solve by warming the resin to 37 °C for 10 min. The resin itself
is insoluble. Cool to 25–30 °C before use.
16. The sample volume must be between 50 and 500 μL. If the
sample volume is less than 50 μL, bring the volume up to at
least 50 μL with water. If the sample volume is >500 μL, split
the sample into multiple purifications. The binding capacity of
1 mL of resin is approximately 20 μg of DNA.
17. The DNA concentration and purity in each extract is measured
spectrophotometrically by the NanoDrop machine using the
“DNA-50” software. DNA concentration in the final eluate
can be calculated from its absorption maximum at 260 nm
(A260) as an absorbance of A260 = 1 Absorbance Units (AU)
corresponds to 50 ng/μL double-stranded DNA. This calcula-
tion assumes the absence of any other compound that absorbs
UV light at 260 nm. Any contamination with, for example,
RNA, protein, or especially humic substances significantly con-
tributes to the total absorption at 260 nm and therefore leads
to an overestimation of the DNA concentration. This method
is therefore not recommended for exact concentration mea-
surements at <5 ng/μL. Confirm that the blanks yield a repro-
ducible zero by analyzing blanks as though they were samples;
the result should vary no more than 0.03 AU (±1.5 ng/μL)
from the stored blank value.
18. The ratio of absorbance at 260/280 and 260/230 nm is used
to assess the purity of DNA; 260/280 ratios of about 1.7–1.8
are accepted as pure for DNA. If the ratios are appreciably
lower, it may indicate the presence of protein, phenol or other
contaminants that absorb strongly at or near 230 or 280 nm.
Also note that extracts purified with the Wizard DNA clean-up
kit have substances that interfere with DNA absorbance at
260 nm, and therefore spectrophotometric methods cannot be
used for DNA quantification in Wizard cleaned samples.
Instead, PCR tests are run without prior DNA quantification
(see Note 20).
19. In order to minimize amplification bias—i.e. aiming to con-
serve the original relative abundances of ITS types, it is impor-
tant to optimize both the template concentration and the
number of PCR cycles for each sample (or sample type) indi-
vidually. The samples should be diluted to overcome any inhi-
bition of the PCR reaction, but not more, enabling the desired
amount of PCR product to be reached after as few PCR cycles
Sample Preparation for Fungal Community Analysis by High-Throughput Sequencing… 85
26. Not every PCR is successful. The quality of the DNA may be
poor, further purification of the DNA may be necessary, the
primers may not fit, the concentration of starting template or
any of the PCR ingredients may be non-optimal or cycle con-
ditions may be imperfect. Further, if the PCR product is of a
different size than expected, at least one of the primers may be
unspecific enough to amplify a different DNA region—eventu-
ally a different organism—than the targeted region/organism.
This may be caused by unspecific primers or by PCR settings,
e.g. to low annealing temperature.
27. To save time and resources, the technical PCR replicates may
be pooled either before the AMPure cleaning or the Qubit
analysis. However, such pooling makes the procedure more
sensitive to deviating PCR products, as the three technical rep-
licates will be pooled in equal proportion of PCR product vol-
ume (μL), but not necessarily in DNA amount (ng). Therefore,
it is important to inspect that all three technical replicates look
similar on the gel picture before such pooling. Also, the total
volume of pooled PCR product to be cleaned with AMPure
will be too large for one well in the PCR plate, with the bead
solution also added. The maximum volume to clean with
AMPure in one well is 70 μL giving a volume of 200 μL after
adding the bead solution. The volume of pooled technical
PCR replicates may be decreased by, e.g. freeze-drier or
speedvac.
28. The PCR products must be purified to get rid of salts, unincor-
porated dNTPs, and unused primers. The AMPure kit consists
of small magnetic beads that bind DNA. By using a magnet to
retain the beads (with the DNA), it is possible to wash the
DNA. Once the beads have been washed and dried, the DNA
can be eluted from the beads with water. A multi-pipette is
useful in this protocol. AMPure contains sodium azide, which
is toxic. Be careful and use gloves.
29. To use high-throughput sequencing technologies optimally to
cover amplicons from many samples simultaneously, multiplex-
ing of amplicons using sample-specific tags is done by pooling
of all the amplicons, to enable sequencing a single composite
sample. To obtain the most even pooling among samples, exact
quantification of DNA concentrations is essential. Since ampli-
cons consist of ITS sequences of different lengths, a true equi-
molar mix with same number of sequences pooled from all
samples would require analyses of size distributions and molar-
ity of all samples (e.g. by Bioanalyzer). However pooling same
amount (ng) of dsDNA from each sample, for mixed commu-
nities, normally gives reasonably similar coverage of all sam-
ples. For exact quantification of the PCR products, we use the
Qubit HS (high sensitivity) assay. This method is based on a
Sample Preparation for Fungal Community Analysis by High-Throughput Sequencing… 87
References
source of error in amplicon pyrosequencing 19. Abarenkov K, Nilsson RH, Larsson KH,
studies? Fungal Ecol 5:747–749 Alexander IJ, Eberhardt U, Erland S et al
17. Caporaso JG, Kuczynski J, Stombaugh J, (2010) The UNITE database for molecular
Bittinger K, Bushman FD, Costello EK et al identification of fungi - recent updates and
(2010) QIIME allows analysis of high- future perspectives. New Phytol 186:281–285
throughput community sequencing data. Nat 20. White TJ, Bruns TD, Lee S, Taylor JW, Innis
Methods 7:335–336 M, Gelfand D et al (1990) Amplification and
18. Schloss PD, Westcott SL, Ryabin T, Hall JR, direct sequencing of fungal ribosomal RNA
Hartmann M, Hollister EB et al (2009) genes for phylogenetics. In: Innis MA,
Introducing mothur: open-source, platform- Gellfand DH, Shinsky JJ, White TJ (eds)
independent, community-supported software PCR protocols. A guide to methods and
for describing and comparing microbial commu- applications. Academic, Orlando, USA,
nities. Appl Environ Microbiol 75:7537–7541 pp 315–322
Chapter 5
Abstract
Stable isotope probing (SIP) provides the opportunity to label decomposer microorganisms that build
their biomass on a specific substrate. In combination with high-throughput sequencing, SIP allows for the
identification of fungal community members involved in a particular decomposition process. Further
information can be gained through gene-targeted metagenomics and metatranscriptomics, opening the
possibility to describe the pool of genes catalyzing specific decomposition reactions in situ and to identify
the diversity of genes that are expressed. When combined with gene descriptions of fungal isolates from
the same environment, specific biochemical reactions involved in decomposition can be linked to individ-
ual fungal taxa. Here we describe the use of these methods to explore the cellulolytic fungal community in
forest litter and soil.
Key words Stable isotope probing, Microbial communities, Soil ecology, Organic matter decomposi-
tion, Metagenomics, Metatranscriptomics, Cellulose
1 Introduction
Francis Martin and Stéphane Uroz (eds.), Microbial Environmental Genomics (MEG), Methods in Molecular Biology, vol. 1399,
DOI 10.1007/978-1-4939-3369-3_5, © Springer Science+Business Media New York 2016
89
90 Tomáš Větrovský et al.
2 Materials
2.1 Stable Isotope 1. Sterile 160-mL serum bottles with airtight rubber stoppers.
Probing 2. 13
C-labeled Zea mays cellulose (97 atom% 13C; IsoLife,
Wageningen, the Netherlands) or other substrate with high
level of 13C enrichment (>90 %) (see Note 1).
3. N2 purged syringes, tubes with airtight rubber septa, and mass
spectrometer such as IsoPrime (GV Instruments, Manchester,
UK) for the analysis of respired 13C in CO2.
4. Fast DNA Spin Kit for Soil (MP Biomedicals, Solon, OH) and
a spectrophotometer or fluorimeter for DNA quantification
such as ND1000 (NanoDrop, Wilmington, DE) and Qubit
(Life Technologies, Carlsbad, CA).
5. ND1000 (NanoDrop, Wilmington, DE) and quantify dsDNA
using Qubit (Life Technologies, Carlsbad, CA).
6. CsTFA (Cesium Trifluoroacetate) solution: Mix 3.17 mL of
CsTFA with 1.93 mL nuclease-free water in 5.1 mL tube (see
Note 2). Unlabeled DNA will band around buoyant density
(BD) of 1.60 g/mL. Adjust BD of master mix to 1.61 (because
addition of sample will reduce the final BD).
7. For centrifugation, Beckman polyallomer quick-seal tubes
(13 × 51 mm, 5.1 mL) and L-100XP Optima Ultracentrifuge
with near vertical rotor such as the NVT 100 rotor (Beckman
Coulter, Brea, CA).
8. For fractionation of gradients after centrifugation:
Fractionator—Fraction Recovery System, Puncturing, for
Thin-Walled Tubes (Beckman Coulter, Brea, CA), ethanol,
nuclease-free water, and syringe pump such as NE-1000 (New
Era Pump Systems, Farmingdale, NY) and respective syringes.
Fungal Soil Organic Matter Degradation 91
2.2 Gene-Targeted 1. For DNA and RNA co-extraction and purification: RNA
Metagenomics and PowerSoil Total RNA Isolation Kit (MoBio Laboratories,
Metatranscriptomics Carlsbad, CA, USA), RNA PowerSoil DNA Elution Accessory
Kit (MoBio Laboratories), OneStep PCR Inhibitor Removal
Kit (Zymo Research, Irvine, CA, USA).
2. For reverse transcription of RNA: 200 U/μL Superscript III
Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA),
DNAse I (Sigma), Random hexamer primers (Sigma).
3. For specific amplification of partial sequence of fungal cbhI
exocellulase (GH 7 glycosyl hydrolase): 2.5 U/μL Pfu DNA
Polymerase (Fermentas, Thermo Fisher Scientific, Waltham,
MA), 2 U/μL DyNAZyme II DNA Polymerase (Finnzymes,
Thermo Fisher Scientific, Waltham, MA), PCR Nucleotide
Mix 10 mM (Finnzymes), 10 mg/mL Bovine Serum Albumin
solution, PCR-grade water.
4. 10 pmol PCR primers cbhIF (5′-ACC AAY TGC TAY ACI
RGY AA-3′) and cbhIR (5′-GCY TCC CAI ATR TCC ATC-
3′) [8] with sample-specific barcodes (short oligonucleotides
that extend the primers at the 5′-end).
5. For purification of PCR products: MinElute Kit (Qiagen,
Valencia, CA) or Agencourt AMPure XP beads (Beckman
Coulter, Brea, CA).
3 Methods
3.1 SIP to Identify 1. Collect soil or litter sample (see Note 3). Sieve soil through a
Cellulose-Utilizing 5-mm screen or cut litter it into small pieces. Incubate at 4 °C
Fungi for 1 month to stabilize substrates. Nutrients liberated as a
result of sample collection and homogenization are consumed
during this time.
92 Tomáš Větrovský et al.
13C-labelled substrate DNA extraction Separation by isopycnic centrifugation in CsTFA and fractionation
CONTROL
12C
1.2
labeled DNA in
1
SAMPLE CONTROL SAMPLE SAMPLE CONTROL
fractions using
0.8 qPCR
12C 12C
0.6
13C
13C 0.4
0.2
0
soil 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21
Massive parallel
Basidiomycota Ascomycota Glomeromycota Zygomycota Chytridiomycota
sequencing of amplicon Amplicon library preparation
library
Data processing and analysis Pool
13C
DNA
fractions
Pool
12C
DNA
fractions
Amplification
Fig. 1 Analysis of the members of fungal community involved in the decomposition of biopolymers using stable
isotope probing
3.2 Gene-Targeted 1. In the area of study, select several study sites to represent the
Metagenomics and ecosystem. To ensure a representative sample at each sampling
Meta-transcriptomics point, collect eight 5-cm-diameter soil cores around the cir-
to Identify cumference of a 4-m-diameter circle. In the field, separate the
Exocellulase litter horizon material and soil material up to the required
Producers depth, and treat them separately. Remove larger roots from soil
and sieve it through a 5-mm sterile mesh. Combine the eight
subsamples and mix well. Cut the litter material into 0.5 cm
pieces with sterile scissors. Combine the eight subsamples and
mix well.
2. Prepare at least four aliquots of sample material for DNA/
RNA co-extraction (0.5–3.0 g) in cryogenic vials. Freeze the
aliquots in liquid nitrogen immediately and store them on dry
ice. Upon arrival to the laboratory, store the samples frozen at
−80 °C for no more than 6 months.
3. Co-extract RNA and DNA from each aliquot of each sample
independently using the RNA PowerSoil Total RNA Isolation
Kit and the DNA Elution Accessory Kit combined with the
OneStep PCR Inhibitor Removal Kit (see Note 12, Fig. 2).
4. For RNA extraction, follow steps 1–8 of the RNA PowerSoil
Total RNA Isolation Kit instructions.
96 Tomáš Větrovský et al.
DNA/RNA
COEXTRACTION
DNA RNA
REVERSE
TRANSCRIPTION
TARGET AMPLIFICATION
DNA RNA
INTRON REMOVAL
CONSENSUS
CLUSTERING
CONSTRUCTION
PROTEIN
SEQUENCE
PREDICTION
IDENTIFICATION
METABOLIC TRANSCRIPTIONAL &
POTENTIAL ACTIVITY PHYLOGENETIC
ALIGNMENT
COMPARE
4 Notes
1. The ideal setup would be to use 13C litter from the dominant
plant species of the considered experimental site/plot; how-
ever the Zea mays cellulose is the most accessible substrate.
2. The amount of water to be added is theoretical. In practice, it
is better to add less then suggested, check the buoyant density
(BD), and add more water until the desired BD is reached.
Check BD by weighing 100 μL on an analytical balance with a
0.1 mg resolution or using refractometer.
3. The amount of soil or litter to be collected depends on the
number of intended replicates and sample moisture, e.g.: 500 g
of soil for three replicates.
4. Incubation temperature should preferably reflect the tempera-
ture in the study area. When other temperature is used, there
is a danger that selective growth of microorganisms with spe-
cific temperature optima occurs.
5. The times of sampling indicated here are optimal for the study
of cellulose utilization in C-rich acidic forest soils. When other
soils are studied or other substrates are used, it is advisable to
perform a pilot test to determine optimal sample collection
times. For the optimal results of SIP, the time of incubation
should be sufficient for the 13C-enrichment of microbial DNA
but not longer than necessary as cross-labeling with 13C may
occur if the DNA of those microbes that originally fed on cel-
lulose are used as food for other organisms (cross-feeders).
Please note that the relative rate of utilization is substrate-
dependent with the time of biomass labeling increasing with
the decreasing decomposability of the substrate.
6. Analyze the CO2 concentration and 12C/13C ratio in the stored
bottles within 7 days using suitable equipment such as the
Trace Gas system interfaced to an IsoPrime mass
spectrophotometer.
Fungal Soil Organic Matter Degradation 99
Acknowledgements
References
1. Berg B, Laskowski R (2006) Litter decomposi- are largely different and highly stratified dur-
tion: a guide to carbon and nutrient turnover. ing decomposition. ISME J 6:248–258
Academic, Amsterdam 8. Edwards IP, Upchurch RA, Zak DR (2008)
2. Clemmensen KE, Bahr A, Ovaskainen O, Isolation of fungal cellobiohydrolase I genes
Dahlberg A, Ekblad A, Wallander H, Stenlid J, from sporocarps and forest soils by PCR. Appl
Finlay RD, Wardle DA, Lindahl BD (2013) Environ Microbiol 74:3481–3489
Roots and associated fungi drive long-term 9. Štursová M, Žifčáková L, Leigh MB, Burgess
carbon sequestration in boreal forest. Science R, Baldrian P (2012) Cellulose utilization in
339:1615–1618 forest litter and soil: identification of bacterial
3. Baldrian P, Valášková V (2008) Degradation of and fungal decomposers. FEMS Microbiol
cellulose by basidiomycetous fungi. FEMS Ecol 80:735–746
Microbiol Rev 32:501–521 10. Šnajdr J, Dobiášová P, Větrovský T, Valášková
4. Berlemont R, Martiny AC (2013) Phylogenetic V, Alawi A, Boddy L, Baldrian P (2011)
distribution of potential cellulases in bacteria. Saprotrophic basidiomycete mycelia and their
Appl Environ Microbiol 79:1545–1554 interspecific interactions affect the spatial dis-
5. de Boer W, Folman LB, Summerbell RC, tribution of extracellular enzymes in soil.
Boddy L (2005) Living in a fungal world: FEMS Microbiol Ecol 78:80–90
impact of fungi on soil bacterial niche develop- 11. Větrovský T, Baldrian P (2013) Analysis of soil
ment. FEMS Microbiol Rev 29:795–811 fungal communities by amplicon pyrosequenc-
6. Baldrian P, López-Mondéjar R (2014) ing: current approaches to data analysis and
Microbial genomics, transcriptomics and pro- the introduction of the pipeline SEED. Biol
teomics: new discoveries in decomposition Fertil Soils 49:1027–1037
research using complementary methods. Appl 12. Lindahl BD, Nilsson RH, Tedersoo L,
Microbiol Biotechnol 98:1531–1537 Abarenkov K, Carlsen T, Kjøller R, Kõljalg U,
7. Baldrian P, Kolařík M, Štursová M, Kopecký J, Pennanen T, Rosendahl S, Stenlid J, Kauserud
Valášková V, Větrovský T, Žifčáková L, Šnajdr H (2013) Fungal community analysis by high-
J, Rídl J, Vlček Č, Voříšková J (2012) Active throughput sequencing of amplified markers—
and total microbial communities in forest soil a user’s guide. New Phytol 199:288–299
Chapter 6
Abstract
Arbuscular mycorrhizal fungi (AMF) are obligate symbionts of most land plants. They have great ecologi-
cal and economic importance as they can improve plant nutrition, plant water supply, soil structure, and
plant resistance to pathogens. We describe two approaches for the DNA-based characterization and iden-
tification of AMF, which both can be used for single fungal spores, soil, or roots samples and resolve closely
related AMF species: (a) Sanger sequencing of a 1.5 kb extended rDNA-barcode from clone libraries, e.g.,
to characterize AMF isolates, and (b) high throughput 454 GS-FLX+ pyrosequencing of a 0.8 kb rDNA
fragment, e.g., for in-field monitoring.
Key words 454 GS-FLX+ pyrosequencing, Arbuscular mycorrhizal fungi (AMF), DNA-based species
identification, Evolutionary placement algorithm (EPA), Extended DNA barcoding, Nuclear rDNA,
Phylogenetics
1 Introduction
Francis Martin and Stéphane Uroz (eds.), Microbial Environmental Genomics (MEG), Methods in Molecular Biology, vol. 1399,
DOI 10.1007/978-1-4939-3369-3_6, © Springer Science+Business Media New York 2016
101
102 Carolina Senés-Guerrero and Arthur Schüßler
LSUmBr LSUmAr
Fig. 1 Schematic representation of the nuclear ribosomal DNA regions studied (not to scale). Triangles indicate
the position of the priming sites; primer names are shown
2 Materials
2.3 PCR 1. Prepare primers and the AMF-specific mixture of primers (see
Amplification Table 1). First, prepare primer stocks by diluting your primers
to 100 μM. Prepare working solutions with a concentration of
10 μM for each primer. E.g. for the forward primer SSUmAf,
mix 10 μL of each primer SSUmAf1-2 with 80 μL of water.
For the reverse primer LSUmAr, mix 10 μL of each primer
LSUmAr1-4 with 60 μL of water.
2. Store primer stocks and working solutions at −20 °C.
3. 2× Phusion® High-Fidelity DNA polymerase Master Mix HF
(NEB, Frankfurt, Germany).
4. 20 mg/mL Bovine Serum Albumin (BSA) (NEB, Frankfurt,
Germany).
5. Thermal cycler.
2.3.1 454 Sequencing 1. Prepare the LSU primers. We use the forward primer LSUD1f
PCR Amplification and the reverse primer mixture LSUmBr (see Table 1). The
forward (fusion-) primer has to be synthesized together with
the 454 adaptor A and different MIDs (5′-adaptorA-MID-
LSUD1f-3′). The reverse primer is synthesized with the 454
adaptor B (5′-adaptorB-LSUmBr-3′). For details regarding
104 Carolina Senés-Guerrero and Arthur Schüßler
Table 1
Primers and primer mixtures
2.4 Cloning 1. Zero Blunt® TOPO® PCR Cloning Kit (Invitrogen, Darmstadt,
and Clone Analyses Germany) using TOP10 chemically competent cells, according
to the instructions of the supplier. However, we use only one
third of the volumes and amounts of salt and plasmid vector
and half of the chemically competent cells, to reduce costs.
2. Go Taq® DNA Polymerase (Promega, Mannheim, Germany)
or the Go Taq® Green Master Mix (see Note 3).
3. Prepare M13F (-20) and M13R primer stocks (see Table 1) of
100 μM and working solutions of 10 μM, each. Store at −20 °C.
Molecular Identification of AMF 105
2.8 454 Sequencing 1. Install the software Quantitative Insights Into Microbial
Bioinformatic Ecology (QIIME) [14] (http://qiime.org/).
Analyses 2. Familiarize with QIIME. There are tutorials and explanatory
documents found at the webpage.
3. Install the Graphical User Interface (GUI) of the RAxML
Workbench in Linux (http://sco.h-its.org/exelixis/web/
software/epa/index.html).
4. Install Archaeopteryx to visualize phylogenetic trees (https://
sites.google.com/site/cmzmasek/home/softwar e/
archaeopteryx).
3 Methods
When working with small amounts of DNA (0.2–2 μL) and using
nested PCR protocols, it is necessary to work in a contamination-
free environment. For example, use separate rooms for pre- and
post-PCR steps and never expose the samples to an environment
where, e.g., target DNA carrying plasmids were extracted or PCR
products handled; use only clean molecular biology grade water
and make sure that all solutions are prepared and kept uncontami-
nated; work under UV decontaminated sterile benches for initial
sample preparation and in strictly UV decontaminated PCR cabi-
nets; use clean pipettes and pipette tips that are only used for DNA
extraction and separate pipette sets for the first PCR and the nested
PCR, respectively, which are used only for this purpose and decon-
taminated from DNA regularly. An overview of the steps for the
molecular characterization and identification of AMF by using
Sanger- and/or 454 GS-FLX+ sequencing is shown in Fig. 2.
Molecular Identification of AMF 107
Sample preparation
(2.1, 3.1, 3.2)
AMF species AMF species
extended DNA monitoring by
barcoding by Sanger DNA extraction 454 sequencing
sequencing (2.2, 3.3, 3.4)
Cloning 454-sequencing
(2.4, 3.8) (2.6, 2.8, 3.15.2)
RFLP De-multiplexing
(2.4, 3.11) (3.16.1)
Singletons and
non-AMF sequences
Sanger sequencing removal
(3.13) (3.16.1)
Aligning 454
sequences to
Sequence alignment Reference sequence
reference
(2.7, 3.14) alignment
sequences
(3.16.1)
Placing 454
sequences into a
Phylogenetic tree Reference
reference
(2.7, 3.14) phylogenetic tree
phylogenetic tree
(3.16.2)
Taxonomic
annotation of AMF
Fig. 2 Diagram of the steps for the molecular characterization and identification
of AMF by using Sanger- and/or 454 GS-FLX+ sequencing
108 Carolina Senés-Guerrero and Arthur Schüßler
3.1 Processing Root 1. Obtain the entire root system of the plant and wash with tap
Material water to remove adherent soil.
2. Cut root fragments by using a scalpel. To avoid contamina-
tions, flame the blade or change it before cutting a new sample.
Cut ten pieces of 0.5–1 cm length, depending on root thick-
ness (0.5 cm is sufficient for thick and well-colonized roots).
For weakly colonized roots, use 20 pieces of 1 cm. If a major
goal is to obtain highly representative samples for a root sys-
tem, the root material may be blended into small pieces and an
amount no larger than 500 mg of material corresponding to a
total of 5–20 cm root length can be taken, depending on thick-
ness and colonization level.
3. To store samples, put them in ethanol (>80 % end concentra-
tion, consider the dilution effect by the samples and replace
ethanol if there is too much dilution) in 2 mL microcentrifuge
tubes. If possible, place samples at −20 °C until DNA extraction
(see Note 5).
3.2 Processing Root 1. Wash the sample once with clean 100 % ethanol (see Note 6).
Material Stored Transfer the root fragments into a new 2 mL microcentrifuge
in Ethanol tube.
2. Dry at 60 °C in a clean environment (e.g., put open vials in a
sterile, closed plastic bag such as a “sunbag”; Sigma-Aldrich,
Munich, Germany). The time depends on root thickness and
the amount of root pieces. It is important that there is no
ethanol left in the samples.
3. Before DNA extraction, add 100 μL of water to the dried roots
for 1 min (see Note 7).
4. Remove excess water with a clean pipette and proceed with
DNA extraction.
3.3 DNA Extraction 1. Add the processed root material to a Lysing Matrix A tube
with the FastDNA® (in a contamination-free environment).
SPIN Kit for Soil 2. Add 978 μL of sodium phosphate buffer.
3. Add 122 μL of MT buffer.
4. Homogenize for 40 s at a speed setting of 6.0 using the
FastPrep® Instrument. If roots are not completely disrupted,
repeat the step. Then, while the instrument cools down, place
the samples on ice or keep them at 4 °C.
5. Centrifuge at 14,000 × g for 15 min to pellet debris (see Note 8).
6. Transfer the supernatant to a new 2 mL microcentrifuge tube.
Add 250 μL of protein precipitation solution (PPS) and mix by
inverting the tube 10 times.
7. Centrifuge for 5 min at 14,000 × g and transfer the supernatant
to a clean 15 mL tube.
Molecular Identification of AMF 109
3.4 DNA Extraction 1. Pre-cool the holders/adaptors of the tissue lyser by placing
with CTAB Method them in liquid N2.
2. Add a single tungsten carbide bead (3 mm, DNA free) to the
sample tube and freeze the tube with roots (water re-hydrated)
in liquid N2 for at least 30 s.
3. Disrupt the frozen samples, e.g., for 3 min at 30 Hz in a Tissue
Lyser II bead mill (Qiagen, Leipzig, Germany). Repeat this
step if needed until the result is a fine powder.
4. Add 1 mL of warm (60 °C) 2× CTAB buffer to the frozen fine
powder and homogenize by vortexing (see Note 10).
5. Incubate 30 min at 60 °C.
6. Add one volume (1 mL) of 24:1 chloroform/isoamylalcohol
and vortex.
7. Centrifuge for 5 min at 2500 × g and transfer the supernatant
(aqueous upper layer, should be approx. 800 μL) to a new
2 mL tube.
8. Add 2.5 μL of 10 mg/mL RNaseA and incubate at 37 °C for
30 min.
110 Carolina Senés-Guerrero and Arthur Schüßler
3.5 First PCR We use the 2× Phusion® High-Fidelity DNA polymerase Master
Mix HF (NEB, Frankfurt, Germany). With the Phusion DNA
polymerase relatively high melting temperatures and short elonga-
tion times are applied. If you intend to use Taq polymerase, several
modifications have to be made, please refer to publications where
this has been adopted. We, however, recommend using a proof-
reading polymerase with DNA-binding domain such as the
Phusion, as this reduces PCR errors and chimera formation.
1. Dependent on your sample number, you should prepare a master
mix for all samples, e.g., for 15 samples use 165 μL master mix
(15 times 15 μL plus 10 % as a buffer); calculate needed compo-
nents accordingly. For an individual 15 μL PCR reaction, mix
7.5 μL of 2× Phusion® Master Mix, 0.75 μL of each, 10 μM for-
ward and reverse primers (0.5 μM final concentration for each),
0.075 μL of 10 mg/mL BSA (final concentration of 50 μg/mL),
5.725 μL of water, and 0.2 μL of DNA (see Note 11).
3.7 PCR Conditions The following is an example of the thermal cycling conditions to
amplify an approx. 1.8 kb fragment. The annealing temperature in
the protocol is tested for the AMF-specific primers we use; when
using other primers you need to adjust the protocol accordingly.
Molecular Identification of AMF 111
3.8 Cloning 1. Work under sterile conditions and maintain the cloning vector
in a cold rack.
2. Set up the cloning reaction by adding 1 μL of PCR product
into a 200 μL tube.
3. Add 0.3 μL of each salt, water, and plasmid vector (provided
with the kit).
4. Spin the tubes and incubate at room temperature for 30 min.
5. From here onwards keep working under sterile conditions and
place reactions on ice or in a cold rack.
6. Place the cells on ice and let them thaw for 2 min. Divide the
50 μL aliquot of cells into two aliquots of 25 μL in a clean,
sterile 2 mL tube.
7. Add 2 μL of the cloning reaction, mix very gently by moving
the pipette tip, do not pipette up and down to resuspend
bacteria. Incubate for 10 min on ice.
8. Warm up a heat block to 42 °C and place your tubes for 30 s.
9. Place the tubes on ice.
10. Add 250 mL of SOC media (provided with the kit).
11. Incubate in a shaker for 1 h at 37 °C.
12. Plate 125 mL in each of two LB plates with kanamycin.
Distribute evenly to obtain clone colonies that are separated
one from another.
13. Incubate the plates overnight at 37 °C.
3.9 Analysis 1. Identify and mark the desired number of clones on your LB
for Positive Clones plates.
by Using PCR 2. For each clone to be analyzed prepare a 25 μL PCR reaction,
composed of 5 μL of the 5× Green GoTaq® Reaction Buffer
(included with the DNA GoTaq® Polymerase), 0.75 μL of
112 Carolina Senés-Guerrero and Arthur Schüßler
3.10 PCR Conditions 1. Maintain your tubes always at a cold temperature. Pre-heat the
to Analyze the Clones thermal cycler lid and place your tubes inside only when the
program is about to start.
2. Run an initial denaturation step for 5 min at 95 °C.
3. Run 35 cycles of 30 s of denaturation step at 95 °C, 30 s of
annealing step at 65 °C, and 1 min of elongation step at 72 °C.
4. Run a final elongation step of 10 min at 72 °C.
5. Check that a 1.5 kb fragment was amplified by electrophoresis
of a 1 % agarose gel in 1× TAE buffer.
3.11 Restriction 1. Prepare reactions for every positive clone using three restric-
Fragment Length tion enzymes (Rsa I, Hinf I, and Mbo I). The reactions have to
Polymorphism (RFLP) be done each in a separate 200 μL tube.
2. Add 3.9 μL of water, 1 μL of buffer, 0.1 μL of the enzyme, and
5 μL of the clone-check PCR product.
3. Spin and incubate for 1 h at 37 °C.
4. Run a 1.5 % agarose gel in 1× TAE buffer. The full amount
(10 μL) of the RFLP reaction should be analyzed on the gel.
5. Compare the RFLP patterns and select clones that differ
among each other. This is to obtain different sequence variants
from a sample.
6. Pick the clones that correspond to the different RFLP patterns
from the grid LB plate and grow each clone in a 15 mL tube
containing 2 mL of LB medium with kanamycin.
7. Incubate the tubes in a shaker at 37 °C overnight.
Molecular Identification of AMF 113
17. Insert the rack of tube strips on the spacers inside the manifold
base and reinstall the vacuum manifold as previously described.
18. Elute DNA by adding 100 μL of sterile distilled water to each
well of the binding strips. Incubate at room temperature for
3 min. Apply vacuum (−0.4 bar) for 1 min.
19. Remove the rack of tube strips, seal with cap strips, and store
at −20 °C.
9. Once you open your tree, select a lineage to root the tree.
When studying non-paraglomeralean AMF we normally use
members of the Paraglomerales as outgroup, as this order is
likely the most ancestral currently known lineage in the AM
fungi [15]. However, if you analyze only a certain family or
genus, you should use outgroups that are more closely related
to that ingroup.
10. We usually edit the text labels, fonts, line thickness, and the
distance bar in MS Power Point after exporting the tree file as
a vector graph (e.g., as an *.emf file) from FigTree.
3.15.1 454 Sequencing The first PCR is performed as described in Subheading 3.5. A
PCR Amplification 1.8 kb fragment is amplified and used as template for amplifying a
nested PCR product that will be pyrosequenced.
The protocol below is adjusted for the LSU primers used by
[12] to amplify a 0.8 kb LSU rRNA gene fragment; if using other
primers, the protocol needs to be adjusted accordingly.
1. Maintain your tubes always at cold temperature. Pre-heat the
thermal cycler lid and place your tubes inside only when the
program is about to start, to avoid unspecific reactions.
2. Run an initial denaturation step for 5 min at 99 °C.
3. Run 25 cycles of 10 s of denaturation step at 99 °C, 30 s of
annealing step at 63 °C, and 30 s of elongation step at
72 °C. The cycle numbers can be increased to 30 or 35 cycles,
if no product was visible after 25 cycles.
4. Run a final elongation step of 10 min at 72 °C.
5. Check that an approx. 0.8 kb fragment was amplified by elec-
trophoresis of a 1 % agarose gel in 1× TAE buffer.
3.16.2 Evolutionary 1. Before running EPA, make sure that the reference sequence
Placement Algorithm alignment does not contain undetermined values and sequences
for Affiliation of Sequences that are equal (see Note 17). There is an option in EPA to
and Their Annotation upload unaligned 454 sequences, but we prefer to align them
to AMF Species and check the alignment before submission.
2. Check that none of the sequences names is repeated, including
the “OTUs” (98 % similarity clusters) as identical names can-
not be processed by the software.
3. Upload your alignment with both, reference sequences and
the “OTUs” (98 % similarity clusters) along with the RAxML_
bestTree.result file to EPA (http://epa.h-its.org/raxml). The
reference sequence alignment has to correspond to the refer-
ence tree entirely, which means that corresponding sequence
names in the alignment and in the tree have to be identical and
every reference sequence present in the alignment has to be
found in the reference phylogenetic tree and vice versa. Any
deviation will lead to termination of the EPA analysis.
4. The EPA analysis results in several output files. Download
them in a separate folder. We take the RAxML_classification
and the original_Labeled tree files to generate a phyloXML file
by using the phyloXML converter in the GUI (graphical user
interface) of the RAxML Workbench in Linux. With this file
you can visualize your reference phylogenetic tree and the
branches in which the 454 sequences have been placed.
5. Open your phyloXML file in Archaeopteryx (https://sites.
google.com/site/cmzmasek/home/software/archaeopteryx).
6. Open the RAxML_classification file in Excel. This file contains
the names of your 454 sequences and the optimal reference
tree branch to which the 454 sequences were inserted. You will
see all the information together in a single column, split the
information into three columns, one that contains the name of
your sequence, one that contains the branch name, and one
that contains the weight value (see Note 18). Sort the column
of branch names alphabetically.
7. In Archaeopteryx find the branch name from the Excel docu-
ment. Once you located the branch name, you can make
a taxonomic annotation based on the location of the branch in
the phylogenetic tree.
Molecular Identification of AMF 119
4 Notes
Acknowledgements
1. De-multiplex.
For example, when sequencing a full 454-plate split into four
gaskets (physically separated compartments), we use the fol-
lowing command to de-multiplex the first gasket:
split_libraries.py -m Mapping1.txt -f 1.TCA.454Reads.fna -q
1.TCA.454Reads.qual -l 500 -o split_Library_Run1_Output/
-n 1000000
and this command to de-multiplex the second gasket:
split_libraries.py -m Mapping2.txt -f 2.TCA.454Reads.fna -q
2.TCA.454Reads.qual -l 500 -o split_Library_Run2_Output/
-n 2000000
Consider that the parameters (such as sequence length) can be
modified according to your needs; in the previous example we
set the minimum length of sequences to be implemented in the
clustering to 500 bp.
2. Combine your de-multiplexed sequences in a single file:
cat split_Library_Run1_Output/seqs.fna split_Library_Run2_
Output/seqs.fna > Combined_seqs.fna
3. Cluster your sequences.
First you have to prepare a text file containing the parameters
of the clustering. We use the following parameters and save the
text file as parameters.txt:
pick_otus:otu_picking_method uclust
pick_otus:similarity 0.98
pick_otus:enable_rev_strand_match True
We afterwards perform the clustering by using the following
command:
pick_de_novo_otus.py -i combined_seqs.fna -p parameters.txt
-o uclust_picked_otus/
122 Carolina Senés-Guerrero and Arthur Schüßler
4. Remove singletons.
After clustering, you obtain a biom table with your “OTUs”
(representative sequences of 98 % similarity clusters).
First remove the singletons (sequences represented only once)
from the table:
filter_otus_from_otu_table.py -i otu_table.biom -o otu_table_
no_singletons.biom -n2
Afterwards remove singletons from the fasta file:
filter_fasta.py -f combined_seqs.fasta -o biom_filtered_seqs.
fasta -b otu_table_no_singletons.biom
5. Remove non-AMF sequences.
The previously created file “biom_filtered_seqs.fasta” contains
your combined sequences without singletons. However, it still
contains non-AMF sequences which in most cases have to be
removed before further analysis.
To remove these sequences we use Blast2GO (https://www.
blast2go.com/b2ghome) which takes individual sequences
and finds similar sequences in NCBI.
The output of Blast2GO is an Excel-format file with the hits of
your query sequences. We normally order the hits alphabeti-
cally and simply manually delete the non-AMF rows from the
Excel table. After deleting the non-AMF rows, copy the
remaining names of sequences, which will be kept for further
analysis, and paste them into a text file. Name the text file as
seqs_to_keep.txt (or according to your naming system).
To remove the non-AMF sequences from the FASTA file write
in QIIME:
filter_fasta.py -f seqs_no_singletons.fasta -o seqs_no_cont.fasta
-s seqs_to_keep.txt
To remove the non-AMF sequences from the OTU table write:
filter_otus_from_otu_table.py -i otu_table_no_singletons.
biom -o otu_table_nosingletons_nocontaminants.biom -e
seqs_to_keep.txt --negate_ids_to_exclude
6. Convert the file otu_table_nosingletons_nocontaminants.
biom into a tabulator delimited table:
convert_biom.py -i otu_table_nosingletons_nocontaminants.
biom -o otu_table_nosingletons_nocontaminants.txt -b
This table contains information about the samples, AMF
“OTUs” (98 % similarity clusters), and read amounts.
References
1. Schüßler A, Walker C (2011) Evolution of the 2. Hempel S, Renker C, Buscot F (2007)
‘plant-symbiotic’ fungal phylum, Glomeromycota. Differences in the species composition of
In: Pöggeler S, Wöstemeyer J (eds) Evolution of arbuscular mycorrhizal fungi in spore, root and
fungi and fungal-like organisms, vol XIV, The soil communities in a grassland ecosystem.
Mycota. Springer, Berlin Heidelberg, pp 163–185 Environ Microbiol 9:1930–1938
Molecular Identification of AMF 123
3. Lee J, Lee S, Young JPW (2008) Improved gal communities: is there a universal solution?
PCR primers for the detection and identifica- Soil Biol Biochem 68:482–493
tion of arbuscular mycorrhizal fungi. FEMS 11. Senés-Guerrero C, Torres-Cortés G, Pfeiffer S
Microbiol Ecol 65:339–349 et al (2014) Potato-associated arbuscular
4. Redecker D (2000) Specific PCR primers to mycorrhizal fungal communities in the
identify arbuscular mycorrhizal fungi within Peruvian Andes. Mycorrhiza 24:405–417
colonized roots. Mycorrhiza 10:73–80 12. Senés-Guerrero C, Schüßler A (2015) A con-
5. Mummey DL, Rillig MC (2007) Evaluation served arbuscular mycorrhizal fungal core-spe-
of LSU rRNA-gene PCR primers for analysis of cies community structure in potato roots from
arbuscular mycorrhizal fungal communities the Andes. Fungal Divers (in press): online
via terminal restriction fragment length poly- first, DOI: 10.1007/s13225-015-0328-7
morphism analysis. J Microbiol Methods 70: 13. Katoh K, Misawa K, Kuma K, Miyata T
200–204 (2002) MAFFT: a novel method for rapid
6. Stockinger H, Krüger M, Schüßler A (2010) multiple sequence alignment based on fast
DNA barcoding of arbuscular mycorrhizal Fourier transform. Nucl Acids Res 30:
fungi. New Phytol 187:461–474 3059–3066
7. Krüger C, Walker C, Schüßler A (2014) 14. Caporaso JG, Kuczynski J, Stombaugh J et al
Scutellospora savannicola: redescription, epi- (2010) QIIME allows analysis of high-
typification, DNA barcoding and transfer to throughput community sequencing data. Nat
Dentiscutata. Mycol Prog 13:1165–1178 Methods 7:335–336
8. Stockinger H, Walker C, Schüßler A (2009) 15. Krüger M, Krüger C, Walker C et al (2012)
‘Glomus intraradices DAOM197198’, a model Phylogenetic reference data for systematics and
fungus in arbuscular mycorrhiza research, is phylotaxonomy of arbuscular mycorrhizal
not Glomus intraradices. New Phytol 183: fungi from phylum to species level. New Phytol
1176–1187 193:970–984
9. Krüger M, Stockinger H, Krüger C et al (2009) 16. Berger SA, Krompass D, Stamatakis A (2011)
DNA-based species level detection of Performance, accuracy, and web server for evo-
Glomeromycota: one PCR primer set for all lutionary placement of short sequence reads
arbuscular mycorrhizal fungi. New Phytol 183: under maximum-likelihood. Systematic Biol
212–223 60:291–302
10. Kohout P, Sudová R, Janoušková M et al 17. Berger SA, Stamatakis A (2011) Aligning short
(2014) Comparison of commonly used primer reads to reference alignments and trees.
sets for evaluating arbuscular mycorrhizal fun- Bioinformatics 27:2068–2075
Chapter 7
Abstract
While until recently the application of high-throughput sequencing approaches has mostly been restricted
to bacteria and fungi, these methods have now also become available to less often studied (eukaryotic)
groups, such as fauna and protists. Such approaches allow routine diversity screening for large numbers of
samples via DNA metabarcoding. Given the enormous taxonomic diversity within the eukaryote tree of
life, metabarcoding approaches targeting a single specific DNA region do not allow to discriminate mem-
bers of all eukaryote clades at high taxonomic resolution. Here, we report on protocols that enable study-
ing the diversity of soil eukaryotes and, at high taxonomic resolution, of individual faunal and protist
groups therein using a tiered approach: first, the use of a general eukaryotic primer set targeting a wide
range of eukaryotes provides a rough impression on the entire diversity of protists and faunal groups.
Second, more focused approaches enable deciphering subsets of soil eukaryotes in higher taxonomic detail.
We provide primers and protocols for two examples: soil microarthropods and cercozoan protists.
Key words 454 Metabarcoding, High-throughput sequencing, Soil metazoa, Soil protists, Soil
microarthropods, 18S rDNA, CO1
1 Introduction
Francis Martin and Stéphane Uroz (eds.), Microbial Environmental Genomics (MEG), Methods in Molecular Biology, vol. 1399,
DOI 10.1007/978-1-4939-3369-3_7, © Springer Science+Business Media New York 2016
125
126 G. Arjen de Groot et al.
Fig. 1 Microscopic photograph of multiple microathropod specimens (soil mites and springtails) extracted from
a soil sample. Photographer: Wim Dimmers
been given to nematodes [3, 4]. Most of the work that has been
done was based on conventional barcoding: sequencing individual
specimens for identification or phylogenetic purposes, and the
establishment of reference databases for that purpose. Now that
availability of such reference data is rising, community screening by
metabarcoding approaches is within reach also for soil fauna.
General metazoan barcodes targeting the mitochondrial encoded
cytochrome c oxidase I (CO1) region or the 18S ribosomal DNA
region of the majority of metazoan exist but miss part of the soil
faunal diversity (e.g., [5]) as the targeted regions are often too con-
served to differentiate taxa [6]. To catch the full diversity, different
faunal groups thus often need to be approached with different prim-
ers, targeting different genes and thus using distinct protocols.
Studying soil fauna, such as microarthropods (soil mites and
springtails; Fig. 1), is of academic as well as applied interest, as they
yield valuable indicator organisms for soil quality. Yet their use as bio-
indicators depends on a classification into functional groups [7], which
requires identification to family or even species level. Morphological
identification is tedious and time consuming, and a molecular alterna-
tive is therefore needed for high-throughput analyses.
Metabarcoding Approaches for Soil Eukaryotes, Fauna and Protists 127
Fig. 2 Light microscopic image of Cercomonas sp., a common cercozoan amoeboflagellate, with ingested
yeast (Saccharomyces cerevisiae). Scale bar: 10 μm. Pictures taken by Kenneth Dumack, assembled by Stefan
Geisen
Fig. 4 Schematic overview of metabarcoding strategy targeting the entity of soil eukaryotes (a) or individual
groups in more focused analyses such as mites (b) and cercozoan protists (c)
2 Materials
2.1 Soil DNA 1. Split soil core sampler (ø = 6 cm; length depending on the
Extraction desired sampling depth).
2.1.1 Soil DNA Extraction 2. PVC rings (1 per sample; 2.5 cm high, ø = 5.8 cm).
for Microarthropods or 3. Plastic bags for carrying.
Entire Eukaryotic 4. Hammer.
Communities
5. Sharp knife.
130 G. Arjen de Groot et al.
6. Cooling box.
7. Water and brush to clean sampler.
8. PowerMax® Soil DNA Isolation Kit (Mobio Inc.).
2.1.2 Soil DNA Extraction Materials for extraction of protist DNA follow the ISOm standard
for Protists protocol, as presented in Plassart et al. [17].
3 Methods
3.1 Soil DNA Standard processing of 1 g of soil as common for microbes will not
Extraction result in a proper description of the community diversity, when
eukaryotes with body sizes that strongly exceed those of microbes
3.1.1 Soil DNA Extraction
such as the majority of soil fauna are targeted. Therefore, we advise
for Microarthropods or
the use of an alternative approach based on processing of larger
Entire Eukaryotic
volumes of soil.
Communities
1. Using a split soil corer (ISO 23611 2-4), take a total of ten
samples, evenly distributed along the outer edge of a circular
plot with a 1 m radius. Sampling depth depends on habitat
type and targeted community.
2. Seal the samples individually in plastic bags and transported to
the lab. Keep samples in a cool box during transport and store
at 4 °C. In the lab, each individual soil sample is homogenized
and a subsample of 10 g is taken for further processing.
3. Separate DNA extractions are performed for each of the ten
soil samples of 10 g obtained in step 2. The Power Max Soil
DNA Isolation Kit is used for this purpose, as this kit allows
the processing of up to 10 g of soil in a single DNA extraction
and includes a lysis step.
4. Obtained extracts may or may not be pooled in order to limit
the samples for amplicon sequencing (Subheading 3.2),
depending on the desire to test for heterogeneity within the
sampled plot.
3.1.2 Soil DNA Extraction Different soil DNA extraction protocols can be adopted to study
for Protists soil protists. Common DNA extraction methods used by microbi-
ologists can be applied as microbial protists are highly abundant in
tiny amounts of soil. We advise the use of the following strategy,
based on Plassart et al. [17]:
1. Take five individual soil cores (20 cm depth) per site, evenly
distributed along the outer edge of a circular plot with a 1 m
radius. Pool replicated soil cores to obtain a composite sample
for each site.
2. Sieve the composite soil samples to <4 mm.
3. Take an aliquot of 50 g from each sieved sample, and store at
−40 °C prior to DNA extraction.
4. For subsequent DNA extraction from the soil samples, follow
the modified ISO standard procedure (ISOm) as described in
132 G. Arjen de Groot et al.
3.3.1 Metabarcoding 1. Convert the raw output of the sequencer (sff-files) to fasta and
of All Eukaryotes at Low quality files using the using the sffinfo command of Mothur
Taxonomic Resolution v.1.22.2 [22].
2. Convert fasta and quality files into fastq file using the faqual-
2fastq.py script of Usearch v7.0.1001 [16].
3. Use the fastq_strip_barcode_relabel2.py script (available in
USearch package) to sort reads according to primer sequence,
label reads with their multiplex identifier (MID) tag and strip
134 G. Arjen de Groot et al.
4 Notes
Acknowledgements
References
1. Bálint M, Schmidt P-A, Sharma R et al (2014) 13. Geisen S, Tveit AT, Clark IM et al.
An Illumina metabarcoding pipeline for fungi. Metatranscriptomic census of active protists in
Ecol Evol 4(13):2642–2653 soils. ISME J 9(10):2178–2190
2. Buée M, Reich M, Murat C et al (2009) 454 14. Lejzerowicz F, Pawlowski J, Fraissinet-Tachet
Pyrosequencing analyses of forest soils reveal L et al (2010) Molecular evidence for wide-
an unexpectedly high fungal diversity. New spread occurrence of Foraminifera in soils.
Phytol 184(2):449–456 Environ Microbiol 12(9):2518–2526
3. Chen X, Daniell T, Neilson R et al (2010) A 15. Bates ST, Clemente JC, Flores GE et al (2013)
comparison of molecular methods for monitor- Global biogeography of highly diverse protistan
ing soil nematodes and their use as biological communities in soil. ISME J 7(3):652–659
indicators. Eur J Soil Biol 46(5):319–324 16. Urich T, Lanzén A, Qi J et al (2008)
4. Porazinska DL, Giblin-Davis RM, Faller L et al Simultaneous assessment of soil microbial com-
(2009) Evaluating high-throughput sequencing munity structure and function through analysis
as a method for metagenomic analysis of nema- of the meta-transcriptome. PLoS One 3(6),
tode diversity. Mol Ecol Res 9(6):1439–1450 e2527
5. Tang CQ, Leasi F, Obertegger U et al (2012) 17. Plassart P, Terrat S, Thomson B et al (2012)
The widely used small subunit 18S rDNA mol- Evaluation of the ISO standard 11063 DNA
ecule greatly underestimates true diversity in extraction procedure for assessing soil micro-
biodiversity surveys of the meiofauna. Proc bial abundance and community structure.
Natl Acad Sci U S A 109(40):16208–16212 PLoS One 7(9), e44279
6. Bass D, Richards T, Matthai L et al (2007) DNA 18. Euringer K, Lueders T (2008) An optimised
evidence for global dispersal and probable ende- PCR/T-RFLP fingerprinting approach for the
micity of protozoa. BMC Evol Biol 7(1):162 investigation of protistan communities in
7. Siepel H (1995) Applications of microarthro- groundwater environments. J Microbiol
pod life-history tactics in nature management Methods 75(2):262–268
and ecotoxicology. Biol Fert Soils 19(1):75–83 19. Bass D, Cavalier-Smith T (2004) Phylum-
8. Adl SM, Simpson AGB, Lane CE et al (2012) specific environmental DNA analysis reveals
The revised classification of eukaryotes. remarkably high global biodiversity of
J Eukaryot Microbiol 59(5):429–514 Cercozoa (Protozoa). Int J Syst Evol Microbiol
9. Foissner W (1999) Soil protozoa as bioindicators: 54(6):2393–2404
pros and cons, methods, diversity, representative 20. Edgar RC (2010) Search and clustering orders
examples. Agr Ecosyst Environ 74(1-3):95–112 of magnitude faster than BLAST. Bioinformatics
10. Darbyshire JF, Whitley RE, Graebes MP et al 26(19):2460–2461
(1974) A rapid micromethod for estimating 21. Edgar RC (2013) UPARSE: highly accurate
bacterial and protozoan populations in soil. OTU sequences from microbial amplicon
Rev Ecol Biol Sol 11:465–475 reads. Nat Methods 10(10):996–998
11. Geisen S, Bandow C, Römbke J et al (2014) 22. Schloss PD, Westcott SL, Ryabin T et al (2009)
Soil water availability strongly alters the commu- Introducing mothur: open-source, platform-
nity composition of soil protists. Pedobiologia independent, community-supported software
57(4-6):205–213 for describing and comparing microbial com-
12. Bass D, Howe AT, Mylnikov AP et al (2009) munities. Appl Environ Microbiol 75(23):
Phylogeny and classification of Cercomonadida 7537–7541
(Protozoa, Cercozoa): Cercomonas, Eocercomonas, 23. Altschul SF, Gish W, Miller W et al (1990)
Paracercomonas, and Cavernomonas gen. nov. Basic local alignment search tool. J Mol Biol
Protist 160(4):483–521 215(3):403–410
140 G. Arjen de Groot et al.
24. Guillou L, Bachar D, Audic S et al (2013) The sequencing-based solutions to biological prob-
Protist Ribosomal Reference database (PR2): a lems. Eukaryot Cell 9(9):1300–1310
catalog of unicellular eukaryote small sub-unit 39. Shokralla S, Spall JL, Gibson JF et al (2012)
rRNA sequences with curated taxonomy. Next-generation sequencing technologies for
Nucleic Acids Res 41(D1):D597–D604 environmental DNA research. Mol Ecol
25. Baldwin DS, Colloff MJ, Rees GN et al (2013) 21(8):1794–1805
Impacts of inundation and drought on eukary- 40. Geisen S, Kudryavtsev A, Bonkowski M et al
ote biodiversity in semi-arid floodplain soils. (2014) Discrepancy between species borders at
Mol Ecol 22(6):1746–1758 morphological and molecular levels in the genus
26. Wang Y, Tian RM, Gao ZM et al (2014) Cochliopodium (Amoebozoa, Himatismenida),
Optimal eukaryotic 18S and universal 16S/18S with the description of Cochliopodium plurinu-
ribosomal RNA primers and their application in cleolum n. sp. Protist 165(3):364–383
a study of symbiosis. PLoS One 9(3), e90053 41. Geisen S, Fiore-Donno AM, Walochnik J et al
27. Hugerth LW, Muller EEL, Hu YOO et al (2014) Acanthamoeba everywhere: high diver-
(2014) Systematic design of 18S rRNA gene sity of Acanthamoeba in soils. Parasitol Res
primers for determining eukaryotic diversity in 113(9):3151–3158
microbial consortia. PLoS One 9(4), e95567 42. Boenigk J, Ereshefsky M, Hoef-Emden K et al
28. Adl SM, Habura A, Eglit Y (2014) Amplification (2012) Concepts in protistology: species defi-
primers of SSU rDNA for soil protists. Soil Biol nitions and boundaries. Eur J Protistol
Biochem 69:328–342 48(2):96–102
29. Epstein S, López-García P (2008) “Missing” 43. Caron DA (2013) Towards a molecular taxon-
protists: a molecular prospective. Biodivers omy for protists: benefits, risks, and applica-
Conserv 17(2):261–276 tions in plankton ecology. J Eukaryot Microbiol
30. Stoeck T, Hayward B, Taylor GT et al (2006) 60(4):407–413
A multiple PCR-primer approach to access the 44. Quail M, Smith M, Coupland P et al (2012) A
microeukaryotic diversity in environmental tale of three next generation sequencing plat-
samples. Protist 157(1):31–43 forms: comparison of Ion Torrent, Pacific
31. Zhu F, Massana R, Not F et al (2005) Mapping Biosciences and Illumina MiSeq sequencers.
of picoeucaryotes in marine ecosystems with BMC Genomics 13(1):341
quantitative PCR of the 18S rRNA gene. 45. Behnke A, Engel M, Christen R et al (2011)
FEMS Microbiol Ecol 52(1):79–92 Depicting more accurate pictures of protistan
32. Gong J, Dong J, Liu X et al (2013) Extremely community complexity using pyrosequencing
high copy numbers and polymorphisms of the of hypervariable SSU rRNA gene regions.
rDNA operon estimated from single cell analy- Environ Microbiol 13(2):340–349
sis of oligotrich and peritrich ciliates. Protist 46. McMurdie PJ, Holmes S (2014) Waste not,
164(3):369–379 want not: why rarefying microbiome data is
33. Medinger R, Nolte V, Pandey RV et al (2010) inadmissible. PLoS Comput Biol 10(4),
Diversity in a hidden world: potential and limi- e1003531
tation of next generation sequencing for surveys 47. Benson DA, Karsch-Mizrachi I, Lipman DJ
of molecular diversity of eukaryotic microor- et al (2005) GenBank. Nucleic Acids Res
ganisms. Mol Ecol 19(Supplement s1):32–40 33(Database issue):D34–D38
34. Prosser J, Jansson JK, Liu WT (2010) Nucleic- 48. Pruesse E, Quast C, Knittel K et al (2007)
acid-based characterization of community struc- SILVA: a comprehensive online resource for
ture and function. Environ Mol Microbiol 63 quality checked and aligned ribosomal RNA
35. Schmidt P-A, Bálint M, Greshake B et al sequence data compatible with ARB. Nucleic
(2013) Illumina metabarcoding of a soil fungal Acids Res 35(21):7188–7196
community. Soil Biol Biochem 65:128–132 49. Coleman AW (2002) Microbial eukaryote spe-
36. von Wintzingerode F, Göbel UB, Stackebrandt cies. Science 297:337
E (1997) Determination of microbial diversity 50. Caron DA, Worden AZ, Countway PD et al
in environmental samples: pitfalls of PCR‐ (2008) Protists are microbes too: a perspective.
based rRNA analysis. FEMS Microbiol Rev ISME J 3(1):4–12
21(3):213–229 51. Quince C, Lanzén A, Curtis TP et al (2009)
37. Corsaro D, Venditti D (2011) More Accurate determination of microbial diversity
Acanthamoeba genotypes: limits to the use from 454 pyrosequencing data. Nat Methods
rDNA fragments to describe new genotypes. 6(9):639
Acta Protozool 50(1):49 52. Quince C, Lanzen A, Davenport R et al (2011)
38. Nowrousian M (2010) Next-generation sequenc- Removing noise from pyrosequenced ampli-
ing techniques for eukaryotic microorganisms: cons. BMC Bioinformatics 12(1):38
Chapter 8
Abstract
Truffles are ectomycorrhizal fungi harvested mainly in human managed agroforestry ecosystems. Truffle
production in truffle orchards faces two important bottlenecks or challenges: the initiation of the sexual
reproduction and the growth of the ascocarps during several months. The black Périgord truffle, Tuber
melanosporum, is a heterothallic species and the mating type genes (MAT1-1 and M1T1-2) have been
characterized. In this context, the unraveling of the T. melanosporum mating type strains distribution in
truffle orchards is a critical starting point to provide new insights into its sexual reproduction. The aim of
this chapter is to present the protocol used to characterize the T. melanosporum mating type present in a
truffle orchard from ascocarps, hazel mycorrhizal root tips, and/or soil samples, by polymerase chain reac-
tions using specific primers for those genes, but it can be adapted for other fungal species.
Key words Tuber melanosporum, Mating type genes, Polymerase chain reaction (PCR), Ascocarps,
Ectomycorrhiza, Soil, DNA
1 Introduction
Truffles are soil fungi that associate with the roots of certain species
of trees and shrubs to form a dual symbiotic organ called an ecto-
mycorrhiza. This ectomycorrhizal association is a mutualistic sym-
biosis occurring between fungi and the root of trees, wherein plants
provide sugar and fungi help the tree with its mineral and water
uptakes. When sporulating, truffles form a fleshy and scented struc-
ture called an ascocarp (i.e., truffle fructification), which attracts
animals and disperses spores following ascocarp ingestion. In
Europe, 32 species of truffles have been identified but few have
been successfully commercialized. The Perigord black truffle
(Tuber melanosporum) grows naturally in Southern Europe and in
contrasting climates such as the warmer climate of the Mediterranean
in southern Spain and Italy as well as in colder continental climates
in northeastern France. T. melanosporum is harvested in different
environments ranging from managed plantations to natural forests.
Francis Martin and Stéphane Uroz (eds.), Microbial Environmental Genomics (MEG), Methods in Molecular Biology, vol. 1399,
DOI 10.1007/978-1-4939-3369-3_8, © Springer Science+Business Media New York 2016
141
142 Herminia De la Varga and Claude Murat
2 Materials
Fig. 1 Mating type mapping under three trees (F10/F11/E10) in a truffle orchard
(modified from ref. 5). The positions of the genotyped ascocarps (dots) and ecto-
mycorrhizas (ECMs) (crosses) are indicated. Samples that displayed the MAT1-1
and MAT1-2 mating types are indicated in green and blue, respectively
3 Methods
3.1 Sampling 1. Collect the truffle and map their location, host species, and date.
3.1.1 Ascocarps 2. Clean truffles with tap water and soft brush to remove all soil
Samples attached to the surface.
3. With a sterile scalpel, remove the peridium and cut the truffle
in small pieces (0.5–1 cm).
4. Store the truffle pieces in microcentrifuge tubes at −20 °C for
molecular analyses.
3.1.2 Mycorrhizal 1. Retrieve tree fine roots carefully from the first 10–20 cm of soil
Samples layer, at a minimum distance of 30 cm from trunk trees. Map
their location, host species, and date.
2. Root pieces are washed in water, leaving the roots in water
bath to allow the remaining soil to go down.
3. Root samples are transferred to glass Petri dishes or containers
with clean water and observed under stereomicroscope and a
cold light microscope (KL200 led).
4. With the help of fine forceps single T. melanosporum ectomy-
corrhizal tips are selected. The mycorrhizae are identified by
morphotyping on the basis of color, mantle shape, and surface
texture [6, 7] (see Note 1).
5. Each single mycorrhiza is stored individually in microcentri-
fuge tubes at −20 °C for molecular analyses.
3.1.3 Soil Samples 1. Collect soil samples in the first 10–20 cm of soil layer, at a
minimum distance of 30 cm from trunk trees and map their
location, tree species, and date (see Note 2).
2. Classify soil samples in plastic bags or tubes.
3. Air-dry each soil sample at room temperature and then sieve it
through 1 mm mesh to eliminate plant debris, stones, and roots.
4. Keep soil samples at −20 °C until processing for molecular
analyses.
3.2 DNA Extractions Genomic DNA can be isolated from single mycorrhizal root tips
and ascocarps (100 mg) using any commercial kit, such as the
3.2.1 Ascocarps
Dneasy Plant Mini Kit (Qiagen SA, Courtaboeuf, France) follow-
and Mycorrhizal Samples
ing the manufacturer’s instructions, or faster ones such as the
REDExtract-N-Amp™ Plant PCR Kit (Sigma-Aldrich Co. LLC, St
Louis, MO, USA) (see Note 3).
3.2.2 Soil Samples Genomic DNA can be isolated from 0.25 or 0.5 g of soil using any
commercial kit, as the Power Soil® DNA isolation Kit (MoBio
Laboratories, Carlsbad, CA), following the manufacturer’s instruc-
tions, or the Fast DNA Spin kit for soil (MP Biomedicals, Illkirch,
France) with some modifications (see Note 4).
Identification and In Situ Distribution of a Fungal Gene Marker: The Mating Type… 145
Table 1
Thermal profiles (temperature, time, and cycle numbers) for the different primer pairs used and the
different samples
4 Notes
Acknowledgments
References
1. Murat C (2015) Forty years of inoculating 5. Murat C, Rubini A, Riccioni C et al (2013)
seedlings with truffle fungi: past and future per- Fine-scale spatial genetic structure of the black
spectives. Mycorrhiza 25:77–81. doi:10.1007/ truffle (Tuber melanosporum) investigated
s00572-014-0593-4 with neutral microsatellites and functional mat-
2. Olivier J, Savignac J, Sourzat P (2012) Truffe ing type genes. New Phytol 199:176–187.
et trufficulture. FANLAC Editions, Périgueux, doi:10.1111/nph.12264
France 6. Zambonelli A, Salomoni S, Pisi A (1993)
3. Martin F, Kohler A, Murat C et al (2010) Caratterizzazione anatomo-morfologica delle
Perigord black truffle genome uncovers evolu- micorrize di Tuber spp. su Quercus pubescens
tionary origins and mechanisms of symbiosis. Will. Micol Ital 3:73–90
Nature 464:1033–1038 7. Rauscher T, Agerer R, Chevalier G (1995)
4. Rubini A, Belfiori B, Riccioni C et al (2011) Ektomykorrhizen von Tuber melanosporum,
Isolation and characterization of MAT genes in Tuber mesentericum und Tuber rufum
the symbiotic ascomycete Tuber melanospo- (Tuberales) an Corylus avellana. Nova Hedwigia
rum. New Phytol 189:710–722 61:281–322
Identification and In Situ Distribution of a Fungal Gene Marker: The Mating Type… 149
Abstract
The use of stable-isotope probing (SIP) allows tracing specific labeled substrates into fungi leading to a
better understanding of their role in biogeochemical cycles and their relationship with their environment.
Stable-isotope probing combined with ribosomal RNA molecule, conserved in the three kingdoms of life,
and messenger RNA analysis permits the linkage of diversity and function. Here, we describe two methods
designed to investigate the interactions between plant and its associated mycorrhizal compartment by trac-
ing carbon flux from the host plant to its symbionts.
Key words Stable-isotope probing (SIP), RNA, qRT-PCR, Fungal plant symbiont, Carbon thirteen,
Carbon transfer
1 Introduction
Francis Martin and Stéphane Uroz (eds.), Microbial Environmental Genomics (MEG), Methods in Molecular Biology, vol. 1399,
DOI 10.1007/978-1-4939-3369-3_9, © Springer Science+Business Media New York 2016
151
Fig. 1 The consumption of a stable-isotope labeled substrate is reflected within
the cellular compounds
SIP-RNA 153
1.2 The Different SIP analyses have mostly used 13C-enriched compounds such as
SIP-RNA Applications methanol [2, 3], phenol [6] and trace molecules in soils such as
atrazine [7]. Virtually all organic molecules that can be enriched in
13
C when chemically synthesized or biologically produced in vitro
can be used within SIP-RNA-based study. SIP-RNA approaches
have been used to analyze interactions and behavior between plants
and root symbionts [8, 9]. In these two studies, after a 13CO2 pulse
labeling at atmospheric concentration, the carbon flux from the
host plant to its symbionts (i.e. through 13C-enriched photosyn-
thates) was estimated under the assumption that the more the sym-
biont receives photosynthates, the more it cooperates with its host
plant. The two strategies and related methodologies developed
and validated are provided below.
2 Material
13
2.2 Specific Material 1. C-labeled substrate: 13C-CO2/N2/O2 gas mix, ratio
of Method 1 0.033/78/21.967, 99 % 13C (CortecNet). In our conditions
approximately 2 m3 of gas was needed for one labeling
2.2.1 13C Labeling
experiment.
and Sampling
2. A hermetic box (W50 × L50 × h70 cm) connected to the gas
cylinder by a two-stage gas pressure regulator on one side
(high position) and with an opening on the opposite side (low
position) (Fig. 1) (see Note 2).
3. Triton X100.
12
5. CO2 in a pressurized cylinder.
6. Sieve.
3 Method
3.1 Method 1: The aim of this method is to identify potential symbionts in plant
Identification of Fungi roots by discriminating active fungi that received labeled plant
Interacting with Their photosynthates from other facultative transient endophytes.
Host Plant by SIP-RNA
3.1.1 13
C Labeling 1. Before labeling, take a control sample of your plants to check
the natural presence of 13C in roots and to check fractionation
in the isopycnic ultracentrifugation gradient (see below).
2. Place plants in the box and apply an air flush during 5 min then
decrease the air-flow at 25 pound per square inch (psi). After
1 h of labeling decrease air-flow at 15 psi for 4 h. If available,
an infrared gas analyzer can be used to accurately determine
the air-flow (≈5 L/min) and CO2 delivery by measuring the
CO2 concentration in the vent gas. Time duration of labeling
should be adapted for each experiment accordingly to the
incorporation rate of your system and your target (see Note 5).
3. Immediately after labeling take core samples. Roots are washed
in tap water, three times in 0.1 % Triton X100, and five times
in sterilized distilled water. For each plant, all the root system
is sampled that represents approximately the volume of half an
eppendorf tube (1.5 mL) or 200 mg. After the washing, roots
are frozen in liquid nitrogen and stored at −80 °C until used.
4. We recommend determining isotopic signature (δ13C) by iso-
topic ratio mass spectrometry in dried roots before to go fur-
ther. This analysis can also be used to determine the kinetic of
carbon incorporation and accurately choose sampling times.
3.1.2 RNA Extraction 1. Cleaned roots are grinded to powder either using liquid nitro-
and Quantification gen and micro pestles or using a bead beater. The material has
to keep frozen.
2. Extract total RNA from plant roots following the provider’s
instructions (RNeasy Plant Mini Kit, “Purification of total
RNA from plant cells and tissues and filamentous fungi” proto-
col) or use any other validated protocol. For one RNA extrac-
tion, approximately 30 mg (fresh weight) of roots are needed.
Skip the DNA-digestion step if you want to analyze the fungal
community diversity from DNA and RNA (Fig. 1).
SIP-RNA 157
3.1.5 RNA Precipitation 1. Centrifuge the tubes for 20 min at maximum speed (20,000 × g)
(Work on Ice) at 0 °C using the labtop centrifuge. Note the position of your
tube to know the pellet location as it will not be visible. Carefully
remove the supernatant without touching the pellet side.
2. Wash the pellet with 180 μL of ice-cold isopropanol. Centrifuge
for 15 min at maximum speed (20,000 × g). Remove the super-
natant. Centrifuge at maximum speed for 5 min and remove
the last drops with a micropipette. Air dry at room tempera-
ture for maximum 5 min. Add 25 μL of ultrapure nuclease-free
water. Immediately proceed to the RT-PCR. Alternatively, do
not add water and store your dried pellets at −80 °C.
3.1.6 PCR and RT-PCR Run a PCR if you analyze the DNA fraction (mixture of 12C and
13
C DNA) using any validated protocol. For RT-PCR use 4 μL of
RNA in a final volume of 50 μL. Follow Titan-One tube manufac-
turer’s instructions (Roche) (see Note 11). Annealing temperature
for our primers is 58 °C for 1 min.
3.2 Method 2: The aim of this method is to assess which arbuscular mycorrhizal
Analysis of the Carbon (AM) fungus receives more carbon from the plant when several
Transfer Intensity fungi are competing for carbon resource within the same root sys-
from the Plant to Fungi tem. It involves the need of specific primers for each of the fungal
by SIP-RNA strains.
SIP-RNA 159
3.2.1 13
CO2 Labeling After sterilizing and germinating plant seeds, inoculate them with
several AM fungi competing for plant carbohydrate resources.
Time of growth will depend on the plant used. For our SIP experi-
ments [9], Medicago truncatula had to be grown for 10 weeks.
1. Acclimate the plants colonized by AM fungi into the labeling
chamber for 48 h before labeling.
2. During the night period before labeling and in accordance
with the 12CO2 respiration of the plant used in the experiment,
remove 12CO2 using a CO2 scrubber.
3. One hour before the start of the day period, inject 13CO2 using
a pressurized cylinder (99 atom % 13C, 1 atom % 12C; Isotec).
4. Introduce 13CO2 at the atmospheric concentration, day/night
period: 16/8 h, day/night temperature: 21 °C/17 °C, irradia-
tion at plant height: 700 μmol/m2/s, 80 % relative humidity.
These parameters should be adapted for each experiment
accordingly to the incorporation rate of the biological system.
5. Maintain the CO2 level in the chamber at 400 μL/L by inject-
ing 12CO2 from a pressurized cylinder. For 6 h, a total CO2 level
(12CO2 + 13CO2) of 400 μL/L CO2 should be maintained.
6. After 6 h, open and flush the labeling chamber with fresh air to
remove the labeled 13CO2.
12
7. Close the labeling chamber and maintain the CO2 level at
400 μL/L.
3.2.2 Root Harvesting 1. Harvest plants at the 6 h flushing period, at the 12 h and at the
24 h time point.
2. At each harvest, remove the aboveground plant parts.
3. Gently wash the root systems using sieves and distilled water.
4. Put roots onto towel paper to remove the water excess.
5. Homogenize, weigh, and place root aliquots in Eppendorf
tubes.
6. Freeze them with liquid nitrogen.
3.2.4 Fractionation Once the centrifuge is stopped, remove very carefully the vials
from the rotor. Do not shake them, minimize movement as much
as you can to not disturb the gradient.
1. Clean the flexible plastic tubing and syringe first with 96 %
ethanol and then with ultrapure nuclease-free water. Attach
the 10 mL syringe to the first end of the flexible plastic tubing
and a blue needle to the other end. Put the syringe filled with
ultrapure nuclease-free water in the fractionator (syringe pump,
Harvard Apparatus) (Fig. 3).
2. Fix the vial to the carrier.
3. Before putting the blue needle to the top of the vial, let the water
go through the plastic tubing until it drops from the needle to
avoid any air bubbles in the tube. Connect the upper needle
(blue) horizontally to the top of the vial. Then plug a green
needle vertically at the bottom in the middle of the vial (Fig. 3).
4. Start the fractionator (speed 120–320 μL/min, depending on
how experienced you are). This leads to a continuous flow of
fractions from the lower needle.
SIP-RNA 161
Ultra-
centrifugation
Vial
a Fraction
On
Speed Off Carrier
Fractionator
3.2.5 RNA Precipitation 1. Add 200 μL of ice-cold isopropanol to each 100 μL fractions
(Work on Ice) (this step is already done just after the fractionation).
2. Incubate at −20 °C for 30 min at least.
3. Centrifuge for 20 min at maximum speed at 20,000 × g at 4 °C.
4. Remove supernatant with pipette and add a further 150 μL of
ice-cold isopropanol.
5. Spin at 20,000 × g for 5 min at 4 °C and remove the superna-
tant with a pipette.
162 Amandine Lê Van et al.
3.2.8 Statistical Analyses Variation in host plant C allocation is calculated based on differ-
of Peak Fronts ences in peak front among the inoculated AM fungal species. Peak
front is the density (in mg/mL) of the heaviest RNA fraction of
each of the AM fungal species. Peak front in the heavier fractions
of the density gradient means a higher 13C enrichment, indicating
a preferential C allocation to that particular AM fungal species.
These peak front positions can be compared to each other. For this
particular application, the number of replicates should be above 10
to get enough statistical powerfulness.
1. Determine peak front for each sample:
To determine peak front differences among the AM fungal
species within each plant root sample, first measure the abun-
dance of each AM fungal species (targeted gene copy number)
SIP-RNA 163
Fig. 4 Peak front is the fraction where the Gaussian regression curves cut
through the detection limit of the qPCR assay
4 Notes (Table 1)
Table 1
Troubleshooting table
References
Abstract
Microbial communities are extremely abundant and diverse on earth surface and play key role in the eco-
system functioning. Thus, although next-generation sequencing (NGS) technologies have greatly
improved knowledge on microbial diversity, it is necessary to reduce the biological complexity to better
understand the microorganism functions. To achieve this goal, we describe a promising approach, based
on the solution hybrid selection (SHS) method for the selective enrichment in a target-specific biomarker
from metagenomic and metatranscriptomic samples. The success of this method strongly depends on the
determination of sensitive, specific, and explorative probes to assess the complete targeted gene repertoire.
Indeed, in this method, RNA probes were used to capture large DNA or RNA fragments harboring bio-
markers of interest that potentially allow to link structure and function of communities of interest.
Key words Solution hybrid selection, Metagenomics, Metatranscriptomics, Microbial diversity, RNA
probes, Next-generation sequencing
1 Introduction
Francis Martin and Stéphane Uroz (eds.), Microbial Environmental Genomics (MEG), Methods in Molecular Biology, vol. 1399,
DOI 10.1007/978-1-4939-3369-3_10, © Springer Science+Business Media New York 2016
167
168 Céline Ribière et al.
Environmental sample
DNA extraction
Metagenomic DNA
Library preparation
TruSeq DNA PCR-Free Sample Prep LT kit
Hybrid probes synthesis
Amplification
Equimolar mix of amplified hybrid probes GC-RICH PCR System, dNTPack
Gene capture
First cycle of hybridization
Size selection
Agencourt® AMPure® XP Reagent
Gene capture
Second cycle of hybridization
Proceed to the same steps as the 1st hybridization cycle with the
captured library
Sequencing
Illumina Plateform
2 Materials
2.2 Buffers All buffers and solutions could be prepared in laboratory under
and Solutions DNase/RNase-free conditions or purchased in general lab supplier.
Prepare all solutions using ultrapure water (prepared by purifying
deionized water to attain a sensitivity of 18 MΩ cm at 25 °C) and
molecular biology grade reagents. Prepare and store all solutions
and buffers at room temperature (unless indicated otherwise).
1. 100× Denhardt’s solution: 2 % bovine serum albumin (BSA)
(Fraction V), 2 % Ficoll 400, 2 % polyvinylpyrrolidone. Weigh
1 g BSA, 1 g Ficoll 400 and 1 g polyvinylpyrrolidone and
transfer to a 50 mL graduated cylinder. Add water to a volume
of 50 mL. Filter through a 0.2 μm syringe filter to sterilize.
Divide into aliquots of 2 mL, and store at −20 °C.
2. 0.5 M ethylenediaminetetraacetic acid (EDTA): pH 8.0. Weigh
46.53 g EDTA and transfer to a 250 mL graduated cylinder.
Add water to a volume of 150 mL. Mix and adjust pH with
Gene Capture by Hybridization 171
2.3 Oligonucleotides 1. Hybrid probes. Purchase hybrid probes at 100 μM. Adaptor
(Probes and Primers) sequences must be added to the 5′ and 3′ ends of the specific
capture probes. These hybrid probes consist of 5′-ATCGCA
CCAGCGTGT(X)CACTGCGGCTCCTCA-3′, with X indi-
cating the specific capture probe.
2. Primers for probe amplification. Purchase oligonucleotides at
100 μM, T7-A 5′-GGATTCTAATACGACTCACTATAGG
GATCGCACCAGCGTGT-3′ and B 5′-CGTGGATGAGGAG
CCGCAGTG-3′.
3. Primers for library amplification. Purchase oligonucleotides at
100 μM, TS-PCR Oligo 1 5′-AATGATACGGCGACCAC
CGAGA-3′ and TS-PCR Oligo 2 5′-CAAGCAGAAGACGGCA
TACGAG-3′.
3 Methods
3.1 Hybrid Probe 1. First step of hybrid probe synthesis consists in amplification of
Synthesis oligonucleotide to obtain double-stranded DNA (dsDNA).
Each amplification reaction should contain 5 μL of 10× high
fidelity buffer, 1 μL of dNTPs (10 mM), 2 μL of MgSO4
(50 mM), 1 μL of primer T7-A (10 μM), 1 μL of primer B
(10 μM), 0.2 μL of Platinum® Taq DNA polymerase high
fidelity, 38.8 μL of nuclease-free water and 1 μL of hybrid
probe diluted at 10 μM (see Note 4). Include a negative con-
trol with 1 μL of nuclease-free water instead of 1 μL of hybrid
probe. Use a thermal cycler with the following conditions:
2 min at 94 °C then 35 cycles of 30 s at 94 °C, 30 s at 58 °C
and 20 s at 68 °C and a final elongation step at 68 °C for 5 min.
2. Check the probe amplification by electrophoresis on a 2 % aga-
rose-TBE gel containing 0.5× syber safe (or comparable nucleic
acid stain). Deposit 5 μL of amplified product (with loading
buffer) (see Note 5). One lane is reserved for 100 bp DNA
ladder. The gel is run in TBE buffer at 100 V for 45 min. The
DNA is visualized on a UV transilluminator.
3. If one band at the expected size is observed, proceed to the
purification of the remaining 45 μL of amplified products using
the MinElute PCR Purification Kit, following the manufac-
turer’s instructions. If two amplification bands are observed,
deposit the remaining PCR product (i.e. 45 μL), excise with a
clean razor blade or scalpel the band corresponding to the size
of hybrid probes and proceed to their purification using the
MinElute Gel Extraction Kit, following the manufacturer’s
instructions. The purified product is eluted in 15 μL of
nuclease-free water (Fig. 2).
4. Evaluate the concentration of purified amplified hybrid probes
with Nanodrop spectrophotometer.
5. For RNA synthesis, mix all hybrid probes in an equimolar
amount taking into account the degeneracy of each probe.
Each probe combination must be present in the same molecu-
lar amount (see Note 6). Validate the concentration of hybrid
probe mix with Nanodrop spectrophotometer. Take 150 ng of
hybrid probe mix, evaporate to dryness with a speed vacuum
and resuspend in 4.75 μL of nuclease-free water. If the 150 ng
174 Céline Ribière et al.
3.2 Library The library is prepared for 550 bp insert using the TruSeq DNA
Preparation (550 bp PCR-Free Sample Prep LT kit by Illumina following the manufac-
Insert) turer’s instructions.
3.4 Gene Capture 1. Transfer 2.5 μg of sheared salmon sperm DNA and 500 ng of
by Hybridization purified amplified library into a 0.2 mL PCR tube (see Note 10).
Evaporate to dryness with a speed vacuum and resuspend in
7 μL of nuclease-free water.
2. Thaw an aliquot of 2× hybridization buffer, prewarmed it at
65 °C and transfer 20 μL into a 0.2 mL PCR tube (see Note 11).
Gene Capture by Hybridization 177
library (i.e. two columns per library (125 μL)). The purified
product is eluted in 50 μL of nuclease-free water.
18. Select the DNA fragment size with the Agencourt® AMPure®
XP Reagent as indicated in step 4 of Subheading 3.3.
19. Evaluate the concentration of purified amplified captured
library with Nanodrop spectrophotometer.
20. Proceed to a second cycle of hybridization by repeating the
steps 1–15 with the purified amplified capture products
obtained previously (see Notes 14 and 15).
21. Amplify the captured library using the GC-RICH PCR System,
dNTPack. Make ten PCR reactions per library and proceed in
the same way as the step 2 of Subheading 3.3 but realize 25
amplification cycles instead of 20 in the thermal conditions.
22. Purify the amplified captured library using the QIAquick PCR
Purification Kit following the manufacturer’s instructions.
Realize one column for two amplification reactions from a
same library (i.e. five columns per library). The purified prod-
uct is eluted in 50 μL of nuclease-free water.
23. Select the DNA fragment size with the Agencourt® AMPure®
XP Reagent as indicated in step 4 of Subheading 3.3.
24. Evaluate the concentration of purified amplified captured
library with Nanodrop spectrophotometer. Assess its quality
on an Agilent DNA 7500 or 12000 chip, according to the
manufacturer’s instructions (Fig. 5).
Fig. 5 Quality of captured library (prepared for 650 bp insert) assess on an Agilent
Bioanalyzer 12000 DNA chip. The electrophoregram shows a peak focused on
770 bp for the case of library prepared for 650 bp insert with 120 bp Illumina
adaptor. With a library prepared for 550 bp, the same profile will be observed but
with a peak focused on 670 bp
180 Céline Ribière et al.
4 Notes
References
1. Schloss PD, Handelsman J (2006) Toward a generation sequencing-based diversity studies.
census of bacteria in soil. PLoS Comput Biol. Nucleic Acids Res. doi:10.1093/nar/gks808
doi:10.1371/journal.pcbi.0020092 6. Allen EE, Banfield JF (2005) Community
2. Vieites JM, Guazzaroni M-E, Beloqui A et al genomics in microbial ecology and evolution.
(2009) Metagenomics approaches in systems Nat Rev Microbiol 3:489–498
microbiology. FEMS Microbiol Rev 33:236–255 7. Hong S, Bunge J, Leslin C et al (2009)
3. Shokralla S, Spall JL, Gibson JF, Hajibabaei M Polymerase chain reaction primers miss half of
(2012) Next-generation sequencing technolo- rRNA microbial diversity. ISME J 3:1365–1373
gies for environmental DNA research. Mol 8. Denonfoux J, Parisot N, Dugat-Bony E et al
Ecol 21:1794–1805 (2013) Gene capture coupled to high-
4. Desai N, Antonopoulos D, Gilbert JA et al throughput sequencing as a strategy for tar-
(2012) From genomics to metagenomics. Curr geted metagenome exploration. DNA Res
Opin Biotechnol 23:72–76 20:185–196
5. Klindworth A, Pruesse E, Schweer T et al 9. Bragalini C, Ribière C, Parisot N et al (2014)
(2013) Evaluation of general 16S ribosomal Solution hybrid selection capture for the recov-
RNA gene PCR primers for classical and next- ery of functional full-length eukaryotic cDNAs
182 Céline Ribière et al.
Abstract
Functional gene arrays, like the GeoChip, allow for the study of tens of thousands of genes in a single assay.
The GeoChip array (5.0) contains probes for genes involved in geochemical cycling (N, C, S, and P), metal
homeostasis, stress response, organic contaminant degradation, antibiotic resistance, secondary metabolism,
and virulence factors as well as genes specific for fungi, protists, and viruses. Here, we briefly describe
GeoChip design strategies (gene selection and probe design) and discuss minimum quantity and quality
requirements for nucleic acids. We then provide detailed protocols for amplification, labeling, and
hybridization of samples to the GeoChip.
Key words GeoChip, Functional gene array, Microbial communities, Microbial ecology, Hybridization,
Fluorescent labeling, Whole community genome amplification
1 Introduction
Francis Martin and Stéphane Uroz (eds.), Microbial Environmental Genomics (MEG), Methods in Molecular Biology, vol. 1399,
DOI 10.1007/978-1-4939-3369-3_11, © Springer Science+Business Media New York 2016
183
184 Joy D. Van Nostrand et al.
Fig. 1 Overview of the GeoChip protocol. Samples from the environment of inter-
est are collected and DNA is extracted. If the yield of DNA is insufficient, whole
community genome amplification can be performed to increase the quantity of
DNA. The DNA is then labeled with a cyanine dye and hybridized to the GeoChip.
Any unhybridized DNA is then washed off and the array is imaged
Hybridization of Environmental Microbial Community Nucleic Acids by GeoChip 185
2 Materials
2.2 Buffers 1. 2.4 mM spermidine. Weight out 1.66 g spermidine and make
and Solutions up to 100 mL with water.
2. Hybridization buffer: Part of the Oligo aCGH hybridization
kit, large, catalog number 5188-5380 (Agilent).
3. Blocking agent: Add 1350 μL water to the 10× aCGH Blocking
Agent (Part of the Oligo aCGH hybridization kit, large,
catalog number 5188-5380) (Agilent). Incubate at room
temperature for at least 6 h before using.
4. Wash Buffers: Oligo aCGH/ChIP-on-Chip Wash Buffer kit
(catalog number 5188-5226, contains Wash Buffers 1 and 2)
(Agilent).
3 Methods
3.1 Amplification The GeoChip requires 1 μg DNA for hybridization. While many
samples, such as soil, can easily meet this criterion, sites with low
microbial abundance or that have restrictions on the amount of
sample that can be taken, may not yield enough DNA. In these
cases, WCGA can be used to increase the amount of DNA avail-
able. WCGA uses a modification of the Templiphi 500 amplifica-
tion kit (phi 29 DNA polymerase) [15]. The amplification buffer is
supplemented with single-stranded DNA binding protein (SSB)
and spermidine and a larger amount of enzyme to increase sensitiv-
ity and representative amplification. The SSB and spermidine likely
assist with DNA replication and bind inhibitors [17, 18]. Using
1–100 ng DNA provides a sensitive (10 fg detection limit) and
representative amplification (<0.5 % of amplified genes showed
>2-fold different from unamplified) [15].
This amplification reaction is very sensitive and will amplify any
contaminating DNA. As such, all steps should be performed in a
PCR hood. Zhang et al. [19] have outlined additional steps that
should be followed to minimize contamination. These include UV
irradiation of the hood and all items to be used in the protocol
(i.e., tips, tubes, pipettors, tube racks, ice and ice bucket, etc.).
Negative controls should always be run alongside the samples.
1. Add 10 μL sample buffer to a 0.2 mL PCR tube (see Note 1).
2. Add DNA (preferably 100 ng) (see Notes 2 and 3).
3. Mix DNA and buffer thoroughly and incubate at room
temperature (RT) for 10 min.
4. While DNA and buffer are incubating, prepare Templiphi
premix in a 1.7 mL tube (see Note 1). [For each reaction:
10 μL of reaction buffer, 0.6 μL enzyme mixture (both supplied
in the Templiphi kit), 1.25 μL of 5 μg/μL SSB (USB;
Cleveland, OH), and 1 μL of 2.4 mM spermidine stock.]
188 Joy D. Van Nostrand et al.
3.2 Labeling DNA for microarray hybridization is generally labeled using fluo-
rescent dyes such as cyanine dyes. The DNA can be labeled directly
(dyes are directly integrated into the target DNA) or indirectly
(targets are labeled after hybridization). A direct labeling approach
is detailed here. Either amplified or unamplified DNA can be used.
1. Combine 5.5 μL random primers (3 μL/μL) and 1 μg target
DNA in a 0.2 mL PCR tube and bring to 35 μL with nuclease-
free water (see Note 5).
2. Mix well and incubate at 99.9 °C for 5 min, then immediately
chill on ice.
3. In a separate 1.7 mL microcentrifuge tube, prepare a master
mix. [For each sample: 6 μL nuclease-free water, 5 μL 10×
reaction buffer (included with enzyme), 2.5 μL 5 mM dNTP
mix (2.5 mM dTTP), 1 μL klenow (40 U/μL), and 0.5 μL
CyDye (25 nM, Cy3-dUTP)] (see Notes 5 and 6).
4. Add 15 μL of the master mix to primer/target DNA tube and
mix well.
5. Incubate the reaction at 37 °C for 6 h, heat-inactivate the
enzyme at 95 °C for 3 min and then cool to 4 °C.
6. Purify the labeled DNA with a Qiagen QIAquick Kit as described
by the manufacturer.
7. Elute the DNA using 100 μL H2O and check the CyDye
incorporation using NanoDrop (see Note 7).
8. Dry the labeled DNA using a Speed Vac at Vacuum Level 5.1
for 2 h at 45 °C.
3.3 Hybridization There are currently two versions of GeoChip 5.0. The smaller array
has ~60,000 probes (60K) and is more for general microbial
ecology studies (~60K probes) and was designed to cover the core
biogeochemical cycles (C, N, S, and P) as well as degradation genes
for the more common contaminants (such as BTEX) and metals
and antibiotic resistance genes as long as they changed the metal or
antibiotic (oxidation, reduction, degradation) and not just acted as
Hybridization of Environmental Microbial Community Nucleic Acids by GeoChip 189
3.3.1 Sample 1. Prepare hybridization buffer (see Note 8). (Per sample: 27.5 μL
Preparation 2 × HI-RPM hybridization buffer, 5.5 μL blocking agent,
2.4 μL Cot-1 DNA, 1.1 μL universal standard [13], and 5.5 μL
formamide.)
2. Add 13 μL nuclease-free water to the labeled DNA.
3. Add 42 μL of the hybridization buffer to the DNA and mix
well by pipetting up and down and then spin to collect liquid
in the bottom of the tube.
4. Heat samples at 95 °C for 3 min, then immediately transfer
samples to 37 °C and incubate for another 30 min (see Note 9).
5. Centrifuge samples for 1 min at 6000 × g to collect the sample
in the bottom of the tube.
3.3.2 Array Assembly 1. Place a new gasket slide (gasket side up) into the Agilent
SureHyb chamber. Make sure the slide is aligned properly and
is flush with the chamber base.
2. Slowly pipette 48 μL of the sample into a gasket well, avoiding
touching the slide and making sure the liquid does not touch
the gasket (see Note 10). Repeat with next sample until all
gasket wells have been filled.
3. Place the microarray onto the gasket slide, making sure the
active side (the text Agilent is printed on the active side) is down
and that the array slide is properly aligned with the gasket slide.
4. Place the chamber cover on the slides, slide the clamp into
place, and then firmly tighten the clamp (see Note 11).
5. Lift the assembled chamber and rotate to wet the slides and
confirm that the air bubble moves freely and that there are no
small bubbles that may inhibit mixing (see Note 12).
190 Joy D. Van Nostrand et al.
3.3.3 Hybridization 1. Put the slide chambers in the hybridization oven’s rotator rack
Protocol (see Note 13). Use empty slide chambers to keep the rotator
balanced, if necessary.
2. Hybridize arrays at 67 °C for 24 h with a rotation speed of 20 rpm.
3.3.4 Washing 1. Prepare the wash buffers in three separate wash dishes (see
Notes 14 and 15).
(a) Wash 1—The Wash Buffer 1 (WB1) dish should be placed
on the benchtop and maintained at room temperature.
(b) Wash 2—A second room temperature WB1 dish should be
placed on a magnetic stir plate and contain a slide rack and
a stirbar. There should be sufficient WB1 to completely
cover the slide rack.
(c) Wash 3—The third dish contains the prewarmed Wash
Buffer 2 (WB2) (see Note 16). This dish should be placed
on a magnetic stir plate with heating element to maintain
the buffer at 37 °C. There should be sufficient WB2 to
completely cover the slide rack. Insert a stir bar.
2. Remove one hybridization chamber from the incubator
(see Note 17).
3. Check to determine if any bubbles formed, if there was any leak-
age, and if the sample is still able to rotate freely (see Note 18).
4. Place the chamber on a flat surface, loosen the screw and
remove the clamp and chamber cover. Carefully lift one end of
the array and gasket slide and then hold the sides of the array,
maintaining its current orientation (array on top, gasket slide
on bottom) quickly place it into Wash 1.
5. Make sure the slide is completely submerged and then using
forceps to make a gentle twisting motion, pry the array slide
off the gasket slide. Leave the gasket slide and quickly place it
in the slide rack in Wash 2.
6. Repeat steps 2–4 until all slides have been transferred or there
are five slides in Wash 2, whichever comes first (see Note 19).
7. Turn on the magnetic stirrer in Wash 2, such that there is a
depression on the surface of the buffer without creating a vor-
tex. We were able to obtain this with a speed of 250–300 rpm
on a VWR (Radnor, PA) model magnetic stirplate with a maxi-
mum speed of 1600 rpm. Incubate for 5 min.
8. Transfer the slide rack to Wash 3 and then turn on stirrer as
described in step 6. Incubate for 1.5 min.
9. Slowly remove the slide rack from Wash 3. It should take about
10 s to remove. No additional spinning or drying is needed.
The slides are hydrophobic and should shed the buffer.
10. Discard used buffers and replenish if additional slides need to
be washed (see Note 14).
Hybridization of Environmental Microbial Community Nucleic Acids by GeoChip 191
3.3.5 Scanning 1. For the Agilent SureScan microarray scanner, the array slides
must be placed into slide holders. The array should be placed
array-side up. Close the holders, making sure you hear a click.
2. Place the slide holders containing microarray slides into the
scanner cassette.
3. Select the appropriate scanning protocol and check the settings
(see Note 20). For GeoChip arrays, which use the Agilent plat-
form, using the SureScan Microarray Scanner, scanning is done
in red and green channels (lasers with excitation wavelengths
at 640 and 532 nm, respectively), 3 μm resolution, 20 bit Tiff
dynamic range (>105), and 100 % photomultiplier tube sensi-
tivity for both channels.
4. Scan the slides and then extract the data using Agilent’s Feature
Extraction program. Select the appropriate grid template (each
array design should have its own specific template file gener-
ated by the array manufacturer) and the Feature Extraction
program will automatically place and optimize the grid place-
ment. Array features are automatically selected and mean pixel
intensity is scored using the program’s default settings.
5. Evaluate hybridization quality of the array. The slide image can
be displayed in the Feature Extraction program once scanning
is complete. Examine the images to make sure positive control
spots are present. GeoChip 5 contains a series of 16S rRNA
gene probes across the array in an easily observable pattern
(green channel) and the CORS probes should also be visible
across the array (red channel) (Fig. 2). Also make sure the
arrays have even hybridization and no obvious problems [areas
with no positive probes, very bright or dim areas, or “flares”
where spots are obscured by dust or other fluorescent contami-
nants (Fig. 3)]. Make sure the background is even and that
none of the arrays have a obviously higher background by
switching to log scale.
3.4 Data Processing There are a large variety of microarray analysis software available to
and Analysis use. Select the software that best meets your particular needs. The
GeoChip microarrays use an in-house developed data analysis pipe-
line. The pipeline allows the user to select normalization protocols,
the method to determine signal cutoff and what controls to use.
GeoChip data normalization and quality filtering is performed
with multiple steps [13, 21]. As a general rule, the following pro-
tocol is followed although other settings may be used depending
on the samples (see Note 21). First, the average signal intensity of
common oligo reference standard is calculated for each array, and
the maximum average value is applied to normalize the signal
intensity of samples in each array. Second, the sum of the signal
intensity of samples is calculated for each array, and the maximum
192 Joy D. Van Nostrand et al.
Fig. 2 GeoChip 5 microarray image. Image to the left is a hybridized GeoChip array. The circle spot is fluores-
cence from a piece of dust or other debris. The boxed area is enlarged to the right. The arrows point to a few
of the CORS control probes (shown as red spots). The boxed area in the right image shows the 16S rRNA
control probes
Fig. 3 Examples of poor quality hybridization or artifacts. (a) Low or no 16S rRNA gene probe signal and poor
sample hybridization (compare with b). (c) A “flare” likely from incomplete washing, and (d) an area of no/poor
hybridization
Hybridization of Environmental Microbial Community Nucleic Acids by GeoChip 193
4 Notes
Acknowledgement
References
1. Amann RI, Ludwig W, Schleifer KH (1995) 3. Whitman WB, Coleman DC, Wiebe WJ (1998)
Phylogenetic identification and in situ detec- Prokaryotes: the unseen majority. Proc Natl
tion of individual microbial cells without culti- Acad Sci U S A 95:6578–6583
vation. Microbiol Rev 59:143–169 4. Wu L, Thompson DK, Li G et al (2001)
2. Furhman JA, Campbell L (1998) Marine ecol- Development and evaluation of functional gene
ogy: microbial microdiversity. Nature 393: arrays for detection of selected genes in the envi-
410–411 ronment. Appl Environ Microbiol 67:5780–5790
196 Joy D. Van Nostrand et al.
5. He Z, Gentry TJ, Schadt CW et al (2007) 17. Zhang K, Martiny AC, Reppas NB et al (2006)
GeoChip: a comprehensive microarray for Sequencing genomes from single cells by poly-
investigating biogeochemical, ecological and merase cloning. Nat Biotechnol 24:680–686
environmental processes. ISME J 1:67–77 18. Khan AU, Mei YH, Wilson T (1992) A pro-
6. He Z, Deng Y, Van Nostrand JD et al (2010) posed function for spermine and spermidine:
GeoChip 3.0 as a high-throughput tool for protection of replicating DNA against damage
analyzing microbial community composition, by singlet oxygen. Proc Natl Acad Sci U S A
structure and functional activity. ISME 89:11426–11427
J 4:1167–1179 19. Marceau AH (2012) Functions of single-strand
7. Tu Q, Yu H, He Z et al (2014) GeoChip 4: a DNA-binding proteins in DNA replication,
functional gene arrays-based high throughput recombination, and repair. Methods Mol Biol
environmental technology for microbial com- 922:1–21
munity analysis. Mol Ecol Resour 14:914–928 20. Agilent (2012) Agilent Oligonucleotide Array-
8. He Z, Wu LY, Li XY et al (2005) Empirical Based CGH for Genomic DNA Analysis.
establishment of oligonucleotide probe design Version 3.4, July 2012. Agilent Technologies
criteria. Appl Environ Microbiol 71:3753–3760 21. Deng Y, He Z (2014) Microarray data analysis.
9. Liebich J, Schadt CW, Chong SC et al (2006) In: He Z (ed) Microarrays: current technology,
Improvement of oligonucleotide probe design innovations and applications. Caister Academic
criteria for functional gene microarrays in envi- Press, Norwich, UK, http://www.horizon-
ronmental applications. Appl Environ press.com/microarrays2
Microbiol 72:1688–1691 22. Luo Y, Hui D, Zhang D (2006) Elevated CO2
10. Li X, He Z, Zhou J (2005) Selection of optimal stimulates net accumulations of carbon and
oligonucleotide probes for microarrays using nitrogen in land ecosystems: a meta-analysis.
multiple criteria, global alignment and param- Ecology 87:53–63
eter estimation. Nucleic Acids Res 33: 23. ter Braak CJF (1986) Canonical correspon-
6114–6123 dence analysis: a new eigenvector technique for
11. Ning J, Liebich J, Kästner M et al (2009) multivariate direct gradient analysis. Ecology
Different influences of DNA purity indices and 67:1167–1179
quantity on PCR-based DGGE and functional 24. Legendre P, Anderson MJ (1999) Distance-
gene microarray in soil microbial community based redundancy analysis: testing multi-
study. Appl Microbiol Biotechnol 82: species responses in multi-factorial ecological
983–993 experiments. Ecol Monogr 69:1–24
12. NanoDrop (2007) 260/280 and 260/230 25. Økland RH, Eilertsen O (1994) Canonical
Ratios NanoDrop® ND-1000 and ND-8000 correspondence analysis with variation parti-
8-Sample Spectrophotometers. Technical tioning: some comments and an application.
Support Bulletin T009 J Veg Sci 5:117–126
13. Liang Y, He Z, Wu L et al (2010) Development 26. Ramette A, Tiedje JM (2007) Multiscale
of a common oligonucleotide reference stan- responses of microbial life in spatial distance and
dard (CORS) for microarray data normaliza- environmental heterogeneity in a patchy ecosys-
tion and comparison across different microbial tem. Proc Natl Acad Sci U S A 104:2761–2766
communities. Appl Environ Microbiol 27. Sambrook J, Russell DW (2001) Molecular
76:1088–1094 cloning a laboratory manual, vol 1. Cold
14. Xie J, Wu L, Van Nostrand JD et al (2012) Spring Harbor Laboratory Press, Cold Spring
Improvements on environmental DNA extrac- Harbor, NY
tion and purification procedures for matagenomic 28. Fare TL, Coffey EM, Dai H (2003) Effects of
analysis. J Cent South Univ 19:3055–3063 atmospheric ozone on microarray data quality.
15. Wu L, Liu X, Schadt CW et al (2006) Anal Chem 75:4672–4675
Microarray-based analysis of submicrogram 29. Branham WS, Melvin CD, Han T et al (2007)
quantities of microbial community DNAs Elimination of laboratory ozone leads to a dra-
by using whole-community genome amplifi- matic improvement in the reproducibility of
cation. Appl Environ Microbiol 72: microarray gene expression measurements.
4931–4941 BMC Biotechnol 7:8
16. Gao H, Yang ZK, Gentry TJ et al (2007) 30. Byerly S, Sundin K, Raja R et al (2009) Effects
Microarray-based analysis of microbial commu- of ozone exposure during microarray posthy-
nity RNAs by whole-community RNA amplifi- bridization washes and scanning. J Mol Diagn
cation. Appl Environ Microbiol 73:563–571 11:590–597
Chapter 12
Abstract
Microorganisms are central players in the turnover of nutrients in soil and drive the decomposition of
complex organic materials into simpler forms that can be utilized by other biota. Therefore microbes
strongly drive soil quality and ecosystem services provided by soils, including plant yield and quality. Thus
it is one of the major goals of soil sciences to describe the most relevant enzymes that are involved in nutri-
ent mobilization and to understand the regulation of gene expression of the corresponding genes. This
task is however impeded by the enormous microbial diversity in soils. Indeed, we are far to appreciate the
number of species present in 1 g of soil, as well as the major functional traits they carry. Here, also most
next-generation sequencing (NGS) approaches fail as immense sequencing efforts are needed to fully
uncover the functional diversity of soils. Thus even if a gene of interest can be identified by BLAST similar-
ity analysis, the obtained number of reads by NGS is too low for a quantitative assessment of the gene or
for a description of its taxonomic diversity. Here we present an integrated approach, which we termed the
second-generation full cycle approach, to quantify the abundance and diversity of key enzymes involved in
nutrient mobilization. This approach involves the functional annotation of metagenomic data with a rela-
tive low coverage (5 Gbases or less) and the design of highly targeted primer systems to assess the abun-
dance or diversity of enzyme-coding genes that are drivers for a particular transformation step in nutrient
turnover.
1 Introduction
Francis Martin and Stéphane Uroz (eds.), Microbial Environmental Genomics (MEG), Methods in Molecular Biology, vol. 1399,
DOI 10.1007/978-1-4939-3369-3_12, © Springer Science+Business Media New York 2016
197
198 Anne Schöler et al.
Fig. 1 Depicted is the principle of second-generation full cycle approach. DNA is extracted from soil, frag-
mented, and shotgun sequenced using next-generation sequencing (e.g. Miseq). Open-reading frames (ORFs)
are predicted from the reads and scanned for the presence of a protein family (PFAM) domain of interest.
Subsequently, primers are designed that either detect several similar sequences (1) or one specific sequence
(2). After careful validation, these primers can be used to quantify the abundance of genes or transcripts of
interest. Miseq machine image is Courtesy of Illumina, Inc
2 Materials
3 Methods
3.1 Metagenomic 1. Total DNA is extracted from 300 mg of soil using a suitable
Library Preparation DNA extraction method such as the DNA-isolation kit
and Sequencing “Genomic DNA from soil” NucleoSpin Soil Kit (Macherey–
Nagel, Düren, Germany). This amount may vary depending
on the microbial biomass of the soil. 300 mg are sufficient for
most soils under agricultural use in middle Europe. Amounts
up to 5 g may be used if soils from low biomass environments
like sand dunes or deserts are studied. The extracted DNA
should be free from contaminating compounds like humic
acids to avoid problems with any amplification step needed.
2. 1–2 μg of the extracted DNA is fragmented by ultra-sonication
for approximately 80 s using an Ultrasonicator (Covaris,
Wobum, USA; see Note 1). The success of the fragmentation
can be accessed using a Bioanalyzer with the Agilent DNA
1000 Kit. The fragmented DNA should have a broad length
distribution with a peak at around 600 bps (see Note 2).
3. The library for DNA sequencing is prepared using the
NEBNext® Ultra™ DNA Library Prep Kit for Illumina® (New
England Biolabs, Frankfurt, Germany) according to the proto-
col of the manufacturer without size selection.
4. Sequencing primers and barcodes are incorporated during the
library preparation and allow multiplexing of many samples in
one MiSeq™ run. These steps should be performed according
to the protocol provided by Illumina.
5. Size selection is carried out using Pippin Prep (Sage Science,
US) to select a size range between 686 and 786 bps corre-
sponding to an insert size between 550 and 650 bps.
Functional Traits of Microbes 201
3.2 Using HMMER The described pipeline can be used to assign reads to any microbial
to Identify Reads that gene of interest. It uses hidden Markov models (HMMs) to iden-
Are Homologous tify homologs of known protein sequences that have the function
to Genes Involved of interest. Functional predictions using HMMs are more accurate
in Nutrient Turnover and more sensitive compared to BLAST searches because of the
strength of the underlying mathematical models. To demonstrate
the practicability of the approach, wherever useful we refer to a
study where putative cellulases were identified from agricultural
soils. The size of the metagenome was 0.5 Gbases.
1. An overview of the entire workflow is depicted in Fig. 2. Prior
to analysis several quality-filtering steps need to be carried out
first to remove low-quality bases (e.g. trim read when at least
three successive bases have a Phred score below 20), filter out
primer sequences and remove sequences shorter than 50 bps.
Several packages exist to this end, including Biopieces (www.
biopieces.org) and Trimmomatic [8] (see Note 3). For a well-
operated sequencing only few percent of reads will be removed
at this step, but the reads are typically shortened to about
250 bp average length.
2. If a reasonable sequencing depth is obtained (>10 Gbases),
assembly of the sequences into contigs may be more informa-
tive but is not required.
3. Next, open reading frames are predicted using for instance
Frag Gene Scan [9] to obtain predicted amino acid sequences.
4. The predicted proteins are then scanned for the presence of a
protein family (PFAM) motif taken from the PFAM-A data-
base [10] using HMMER 3 [11] (see Note 4). For the identi-
fication of genes involved in cellulose degradation 32 different
motifs exist for glycoside hydrolase (GH) families, carbohy-
drate binding modules (CBM) and auxiliary activities (AA).
0.3 % of all predicted open reading frames were associated with
cellulose degradation.
5. Depending on the gene or group of genes of interest the
PFAM motif can also be refined or generated de novo using a
202 Anne Schöler et al.
Fig. 2 Depicted is the workflow of using protein family (PFAM) motifs for the identification of genes of interest
from metagenomic data. The sequencing data are quality filtered and can contain an optional step of assembly,
if desired. Gene prediction is subsequently performed on either reads or contigs. These predicted proteins are
then scanned (using HMMER 3) for the presence of a PFAM motif (taken from the PFAM-A database) to identify
genes of interest. Miseq machine image is Courtesy of Illumina, Inc
3.3 Design of Primer 1. After selection of the sequences of interest, primer design can
Systems that Amplify be based on either conserved nucleotide or amino acid
the Genes Identified sequences shared between the sequences. In the case of our
by HMMER 3 study, 32 sequences corresponding to three different GH fami-
lies were selected. Note that whereas database sequences
derived from complete protein sequencing often include the
catalytic or functional domain, metagenome sequences are
mostly shorter and might code for a part of the sequence of the
Functional Traits of Microbes 203
Table 1
Pros and Cons of two different primer design strategies
4 Notes
References
1. Power AG (2010) Ecosystem services and 3. Griffiths BS, Philippot L (2013) Insights into
agriculture: tradeoffs and synergies. Philos the resistance and resilience of the soil microbial
Trans R Soc Lond B Biol Sci 365:2959–2971 community. FEMS Microbiol Rev 37:112–129
2. Maron PA, Mougel C, Ranjard L (2011) Soil 4. Lee MH, Lee SW (2013) Bioprospecting
microbial diversity: methodological strategy, potential of the soil metagenome: novel
spatial overview and functional interest. C R enzymes and bioactivities. Genomics Inform
Biol 334:403–411 11:114–120
206 Anne Schöler et al.
5. Torsvik V, Øvreås L (2012) Microbial diversity 11. Eddy SR (2011) A new generation of homol-
and function in soil: from genes to ecosystems. ogy search tools based on probabilistic infer-
Curr Opin Microbiol 5:240–245 ence. Genome Inform 23:205–211
6. Shi Y, Yang H, Zhang T, Sun J, Lou K (2014) 12. Lombard V, Golaconda Ramulu H, Drula E,
Illumina-based analysis of endophytic bacterial Coutinho PM, Henrissat B (2014) The
diversity and space-time dynamics in sugar carbohydrate-active enzymes database (CAZy)
beet on the north slope of Tianshan mountain. in 2013. Nucleic Acids Res 42(Database
Appl Microbiol Biotechnol 98:6375–6385 issue):D490–D495. doi:10.1093/nar/gkt1178
7. Neufeld JD et al (2007) DNA stable-isotope 13. Fu L, Niu B, Zhu Z, Wu S, Li W (2012)
probing. Nat Protoc 2:860–866 CD-HIT: accelerated for clustering the next-
8. Bolger AM, Lohse M, Usadel B (2014) generation sequencing data. Bioinformatics
Trimmomatic: a flexible trimmer for Illumina 28:3150–3152
sequence data. Bioinformatics 30:2114–2120 14. Gulvik CA, Effler TC, Wilhelm SW, Buchan A
9. Rho M, Tang H, Ye Y (2010) FragGeneScan: (2012) De-MetaST-BLAST: a tool for the
predicting genes in short and error-prone validation of degenerate primer sets and data
reads. Nucleic Acids Res 38:e191 mining of publicly available metagenomes.
10. Finn RD et al (2014) Pfam: the protein families PLoS One 7:e50362. doi:10.1371/journal.
database. Nucleic Acids Res 42(Database pone.0050362
issue):D222–D230. doi:10.1093/nar/gkt1223
Chapter 13
Abstract
Approaches in molecular biology, particularly those that deal with high-throughput sequencing of entire
microbial communities (the field of metagenomics), are rapidly advancing our understanding of the
composition and functional content of microbial communities involved in climate change, environmental
pollution, human health, biotechnology, etc. Metagenomics provides researchers with the most complete
picture of the taxonomic (i.e., what organisms are there) and functional (i.e., what are those organisms
doing) composition of natively sampled microbial communities, making it possible to perform investigations
that include organisms that were previously intractable to laboratory-controlled culturing; currently, these
constitute the vast majority of all microbes on the planet. All organisms contained in environmental
samples are sequenced in a culture-independent manner, most often with 16S ribosomal amplicon methods
to investigate the taxonomic or whole-genome shotgun-based methods to investigate the functional
content of sampled communities. Metagenomics allows researchers to characterize the community
composition and functional content of microbial communities, but it cannot show which functional
processes are active; however, near parallel developments in transcriptomics promise a dramatic increase in
our knowledge in this area as well.
Since 2008, MG-RAST (Meyer et al., BMC Bioinformatics 9:386, 2008) has served as a public resource
for annotation and analysis of metagenomic sequence data, providing a repository that currently houses
more than 150,000 data sets (containing 60+ tera-base-pairs) with more than 23,000 publically available.
MG-RAST, or the metagenomics RAST (rapid annotation using subsystems technology) server makes it
possible for users to upload raw metagenomic sequence data in (preferably) fastq or fasta format. Assessments
of sequence quality, annotation with respect to multiple reference databases, are performed automatically
with minimal input from the user (see Subheading 4 at the end of this chapter for more details). Post-
annotation analysis and visualization are also possible, directly through the web interface, or with tools like
matR (metagenomic analysis tools for R, covered later in this chapter) that utilize the MG-RAST API
(http://api.metagenomics.anl.gov/api.html) to easily download data from any stage in the MG-RAST
processing pipeline. Over the years, MG-RAST has undergone substantial revisions to keep pace with the
dramatic growth in the number, size, and types of sequence data that accompany constantly evolving devel-
opments in metagenomics and related -omic sciences (e.g., metatranscriptomics).
Key words Metagenomics, Comparative analysis, Sequence quality, Automated pipeline, High-
throughput, matR
Francis Martin and Stéphane Uroz (eds.), Microbial Environmental Genomics (MEG), Methods in Molecular Biology, vol. 1399,
DOI 10.1007/978-1-4939-3369-3_13, © Springer Science+Business Media New York 2016
207
208 Kevin P. Keegan et al.
1 Introduction
2 Materials
2.1 Database The MG-RAST automated analysis pipeline uses the M5nr (MD5-
based non-redundant protein database) [5] for annotation. The
M5nr is an integration of many sequence databases into one single,
210 Kevin P. Keegan et al.
2.2 Analysis Pipeline The pipeline shown in Fig. 1 contains a number of improvements
to previous MG-RAST versions. Several key algorithmic improve-
ments were needed to support the flood of user-generated data.
Initial analysis differentiates amplicon-based ribosomal 16S from
whole-genome shotgun (WGS) samples and processed them sepa-
rately (see Subheading 3.1 below for processing of WGS data and
Subheading 3.2 for processing of amplicon 26s data). WGS sam-
ples are analyzed with dedicated software to perform gene predic-
tion on nucleotide data prior to protein similarity-based annotation.
This provides drastic runtime improvements over nucleotide
similarity-based approaches. Clustering of predicted proteins at
90 % identity provides additional performance improvement while
preserving biological signals. While protein-based annotation is
used for proteins predicted from WGS samples, samples detected
as 16S ribosomal data are annotated with nucleotide-based
similarity.
MG-RAST, a Metagenomics Service for Analysis of Microbial Community Structure… 211
Fig. 1 Details of the analysis pipeline for MG-RAST. After upload, the pipeline
diverges for amplicon and WGS data sets. Amplicon samples run through RNA
detection, clustering, and identification. WGS samples undergo a number of addi-
tional processing steps to assess data quality prior to annotation
2.3 Compute While MG-RAST was originally built as a traditional, centrally located,
Resources cluster-based bioinformatics system, the most recent version embraces
novel technologies that make it possible for it to utilize local and
remote compute resources. MG-RAST data are stored in SHOCK
[18] and computing is orchestrated by AWE [19]. These technologies
were developed to enable execution on a variety of computational
platforms; currently, computational resources are contributed by the
DOE Magellan cloud at Argonne National Laboratory, Amazon EC2
Web services provided by individual users, and a number of traditional
clusters. An installation of the pipeline exists at DOE’s NERSC super-
computing center. In recent months, the system handles over 4 tera-
base-pairs of data per month. The use of Skyport [38] has enabled
multi cloud workflows without introducing management overhead.
3 Methods
The pipeline diverges after upload for 16S ribosomal amplicon and
whole-genome shotgun (WGS) samples. The WGS pipeline is com-
posed of several steps from the removal of low-quality reads, derep-
lication, gene calling, and annotation to creation of functional
abundance profiles. rRNA samples run through RNA detection,
clustering, and identification, and the production of taxonomic
abundance profiles. Subheading 4 found at the end of this chapter
includes additional details.
3.1 The WGS 1. Preprocessing. After upload, data are preprocessed by using
Pipeline SolexaQA [20] to trim low-quality regions from FASTQ data.
Platform-specific approaches are used for 454 data submitted
in FASTA format, reads more than two standard deviations
away from the mean read length are discarded [21]. All
sequences submitted to the system are available, but discarded
reads are not analyzed further.
212 Kevin P. Keegan et al.
3.2 The rRNA The rRNA pipeline starts with upload of rRNA reads and proceeds
Pipeline through the following steps:
1. rRNA detection. Reads are identified as rRNA through a simple
rRNA detection. An initial BLAT search against a reduced RNA
database efficiently identifies RNA. The reduced database is a
90 % identity clustered version of the SILVA database and is
used merely to differentiate samples containing solely rRNA
data from other samples (e.g., WGS or transcriptomic
samples).
2. rRNA clustering. The rRNA-similar reads are clustered at 97 %
identity, and the longest sequence is picked as the cluster
representative.
3. rRNA identification. A nucleotide BLAT similarity search for
the longest cluster representative is performed against the
M5rna database, integrating SILVA [31], Greengenes [32],
and RDP [33].
3.3 Using The MG-RAST system provides a rich web user interface that cov-
the MG-RAST User ers all aspects of metagenome analysis, from data upload to ordina-
Interface tion analysis of annotation abundances. The web interface can also
be used for data discovery. Metagenomic data sets can be easily
selected individually or on the basis of filters such as technology
(including read length), quality, sample type, and keyword, with
dynamic filtering of results based on similarity to known reference
216 Kevin P. Keegan et al.
3.3.1 Navigation The MG-RAST website is rich with functionality and offers several
options. The site at http://metagenomics.anl.gov has five main
pages and a home page, shown in blue in Fig. 2.
Fig. 2 Sitemap for the MG-RAST version 3 website. On the site map the main pages are shown in blue, manage-
ment pages in orange. The green boxes represent pages that are not directly accessible from the home page
MG-RAST, a Metagenomics Service for Analysis of Microbial Community Structure… 217
3.3.2 Upload Page Data and metadata can be uploaded in the form of spreadsheets
along with the sequence data by using both the ftp and the http
protocols. The web uploader will automatically split large files and
also allows parallel uploads. MG-RAST supports data sets that are
augmented with rich metadata using the standards and technology
developed by the GSC. Each user has a temporary storage location
inside the MG-RAST system. This inbox provides temporary stor-
age for data and metadata to be submitted to the system. Using the
inbox, users can extract compressed files, convert a number of
vendor-specific formats to MG-RAST submission-compliant for-
mats, and obtain an MD5 checksum for verifying that transmission
to MG-RAST has not altered the data. The web uploader has been
optimized for large data sets of over 100 giga-base-pairs, often
resulting in file sizes in excess of 150 GB.
3.3.3 Browse Page: The Browse page lists all data sets visible to the user (the users own
Metadata-Enabled Data data sets as well as all public data and all data shared by other
Discovery users). This page also provides an overview of the nonpublic data
sets submitted by the user or shared with users. The interactive
metagenome browse table provides an interactive graphical means
to discover data based on technical data (e.g., sequence type or
data set size) or metadata (e.g., location or biome).
3.3.4 Project Page The project page provides a list of data sets and metadata for a
project. The table at the bottom of the Project page provides access
to the individual metagenomes by clicking on the identifiers in the
first column. In addition, the final column provides downloads for
metadata, submitted data, and the analysis results via the three
labeled arrows. For the data set owners, the Project page provides
an editing capability using a number of menu entries at the top of
the page. Figure 3 shows the available options.
● Share Project—make the data in this project available to third
parties via sending them access tokens.
● Add Jobs—add additional data sets to this project.
218 Kevin P. Keegan et al.
Fig. 3 Project page, providing a summary of all data in the project and an interface for downloads
3.3.5 Overview Page MG-RAST automatically creates an individual summary page for
each data set. This metagenome overview page provides a summary
of the annotations for a single data set. The page is made available
MG-RAST, a Metagenomics Service for Analysis of Microbial Community Structure… 219
Technical Details The Overview page provides the MG-RAST ID for a data set, a
on Sequencing unique identifier that is usable as an accession number for
and Analysis publications. Additional information, such as the name of the
submitting PI, organization, and a user-provided metagenome name
are displayed at the top of the page. A static URL for linking to the
system that will be stable across changes to the MG-RAST web
interface is provided as additional information (Fig. 7).
MG-RAST provides an automatically generated paragraph of
text describing the submitted data and the results computed by the
pipeline. By means of the project information, we display addi-
tional information provided by the data submitters at the time of
submission or later.
One of the key diagrams in MG-RAST is the sequence break-
down pie chart (Fig. 4) classifying the submitted sequences
submitted into several categories according to their annotation sta-
tus. As detailed in the description of the MG-RAST v3 pipeline
above, the features annotated in MG-RAST are protein coding
genes and ribosomal proteins.
Sequence Breakdown
Failed QC
Unknown
Unknown Protein
13% 9.4% Annotated Protein
ribosomal RNA
9.9%
19.7%
48%
Fig. 4 Sequences to the pipeline are classified into one of five categories:
grey = failed the QC, red = unknown sequences, yellow = unknown function but
protein coding, green = protein coding with known function, and blue = ribosomal
RNA. For this example, over 50 % of sequences were either filtered by QC or
failed to be recognized as either protein coding or ribosomal
220 Kevin P. Keegan et al.
Metagenome Quality The analysis flowchart and analysis statistics provide an overview of
Control the number of sequences at each stage in the pipeline. The text
block next to the analysis flowchart presents the numbers next to
their definitions.
Source Hits Distribution The source hits distribution shows the percentage of the predicted
protein features annotated with similarity to a protein of known
function per source database. In addition, ribosomal RNA genes
are mapped to the rRNA databases.
In addition, this display will print the number of records in the
M5NR protein database and in the M5RNA ribosomal databases.
Other Statistics MG-RAST also provides a quick link to other statistics. For example,
the Analysis Statistics and Analysis Flowchart provide sequence
statistics for the main steps in the pipeline from raw data to
annotation, describing the transformation of the data between
steps. Sequence length and GC histograms display the distribution
before and after quality control steps. Metadata is presented in a
searchable table that contains contextual metadata describing
sample location, acquisition, library construction, and sequencing
using GSC compliant metadata. All metadata can be downloaded
from the table.
MG-RAST, a Metagenomics Service for Analysis of Microbial Community Structure… 221
3.3.6 Biological Part The taxonomic hit distribution display divides taxonomic units
of the Overview Page into a series of pie charts of all the annotations grouped at various
taxonomic ranks (domain, phylum, class, order, family, genus).
The subsets are selectable for downstream analysis; this also enables
downloads of subsets of reads, for example, those hitting a specific
taxonomic unit.
Rank Abundance The rank abundance plot provides a rank-ordered list of taxonomic
units at a user-defined taxonomic level, ordered by their abundance
in the annotations.
Alpha Diversity In this section, we display an estimate of the alpha diversity based
on the taxonomic annotations for the predicted proteins. The
alpha diversity is presented in context of other metagenomes in the
same project (see Fig. 6).
2088
1879
1670
Species Count
1462
1253
1044 Species: 1029
reads: 4620
835
626
418
209
0
0
49
0
09
14
19
24
29
34
39
44
49
70
14
21
28
35
42
49
56
63
70
Number of Reads
Fig. 5 Rarefaction plot showing a curve of annotated species richness (i.e., the number of unique species). This
curve is a plot of the total number of distinct species annotations as a function of the number of sequences
sampled
222 Kevin P. Keegan et al.
2σ σ μ σ
Fig. 6 Alpha diversity plot showing the range of -diversity values in the project the data set belongs to. The min,
max, and mean values are shown, with the standard deviation ranges in different shades. The alpha-diversity
of this metagenome is shown in red. The species-level annotations are from all the annotation source data-
bases used by MG-RAST
Functional Categories This section contains four pie charts providing a breakdown of the
functional categories for KEGG, COG, SEED Subsystems, and
EggNOGs. Clicking on the individual pie chart slices will save the
respective sequences to the workbench. The relative abundance of
sequences per functional category can be downloaded as a spread-
sheet, and users can browse the functional breakdowns.
A more detailed functional analysis, allowing the user to
manipulate parameters for sequence similarity matches, is available
from the Analysis page.
3.3.7 Analysis Page The MG-RAST annotation pipeline produces a set of annotations
for each sample; these annotations can be interpreted as functional
or taxonomic abundance profiles. The analysis page can be used to
view these profiles for a single metagenome or to compare profiles
from multiple metagenomes using various visualizations (e.g.,
heatmap) and statistics (e.g., PCoA, normalization).
The page is divided into three parts following a typical work-
flow (Fig. 7).
1. Data type
Selection of an MG-RAST analysis scheme, that is, selection of a
particular taxonomic or functional abundance profile mapping.
For taxonomic annotations, since there is not always a unique
mapping from hit to annotation, we provide three interpreta-
tions: best hit, representative hit, and lowest common ancestor.
When choosing the LCA annotations, not all downstream tools
are available. The reason is the fact that for the LCA annotations
not all sequences will be annotated to the same level, classifica-
tions are returned on different taxonomic levels.
MG-RAST, a Metagenomics Service for Analysis of Microbial Community Structure… 223
Fig. 7 Three-step process in using the Analysis page: (1) select a profile and hit (see text) type; (2) select a list
of metagenomes and set annotation source and similarity parameters; (3) choose a comparison
Rarefaction The rarefaction view is available only for taxonomic data. The
rarefaction curve of annotated species richness is a plot (see Fig. 8)
Fig. 8 Rarefaction plot showing a curve of annotated species richness. This curve is a plot of the total number
of distinct species annotations as a function of the number of sequences sampled
MG-RAST, a Metagenomics Service for Analysis of Microbial Community Structure… 225
Bar Charts The bar chart visualization option on the Analysis page has a built-in
ability to drill down by clicking on a specific category. You can expand
the categories to show the normalized abundance (adjusted for sam-
ple sizes) at various levels. The abundance information displayed can
be downloaded into a local spreadsheet. Once a sub-selection has
been made (e.g., the domain Bacteria selected), data can be sent to
the workbench for detailed analysis. In addition, reads from a specific
level can be added into the workbench.
Tree Diagram The tree diagram allows comparison of data sets against a hierarchy
(e.g., Subsystems or the NCBI taxonomy). The hierarchy is dis-
played as a rooted tree, and the abundance (normalized for data set
size or raw) for each data set in the various categories is displayed
as a bar chart for each category. By clicking on a category (inside
the circle), detailed information can be requested for that node
Workbench The workbench was designed to allow users to select subsets of the
data for comparison or export. Specifically, the workbench supports
selecting sequence features and submitting them to further analysis
or other analysis. A number of use cases are described below. An
important limitation with the current implementation is that data
sent to the workbench exist only until the current session is closed.
MG-RAST, a Metagenomics Service for Analysis of Microbial Community Structure… 227
Fig. 9 Data sets shared in MG-RAST by users (orange dots), shown as connecting
edges
228 Kevin P. Keegan et al.
tools. Users can utilize these built-in tools or any of the enormous
variety of tools available within the R universe. The release version of
matR is available through CRAN (http://cran.r-project.org/web/
packages/matR/); pre-release and development versions are avail-
able on github (https://github.com/MG-RAST/matR/); a google
group is available (https://groups.google.com/forum/#!forum/
matr-forum); a publication demonstrating the ease with which matR
can be used to conduct large-scale analyses is forthcoming.
4 Notes
tated reads, but will produce a set of reads that have a higher over-
all quality (less likely to contain artifacts that could lead to erroneous
annotations).
Data options
After processing through MG-RAST, users have a number of
options that they can use to filter annotation abundance data
(accessed via the). Chief among these are the parameters described
briefly below,
Annotation source (default m5NR)
MG-RAST provides users with the unique ability to provide anno-
tations for analyzed data from multiple source databases. By
default, the m5NR is used—but users are free to use any one of the
numerous additional annotation sources. As the m5NR represents
a non-redundant union of all annotation databases contained
within MG-RAST, we generally recommend its use over any of the
individual databases.
Max e-value cutoff (default 1e−5)
The max e-value cutoff indicates the largest (least stringent) e-value
for an annotation to be included in the output annotations. We
generally recommend that users not use larger (less stringent)
e-value cutoff. The use of smaller (more stringent) e-values will
ensure that annotations exhibit higher statistical fidelity; however,
this will come at the cost of a smaller overall number of annotated
features. We suggest that users experiment with multiple e-values
until they arrive at one that produces enough annotations to
address the hypothesis(es) in question while minimizing the num-
ber of spurious (false positive) annotations.
Min % identity cutoff (default 60 %)
The minimum percent identity represents the lower bound thresh-
old for annotations to be returned to the user. Matches between
the query and selected annotation that match or exceed this value
are retained, all others are rejected. We recommend that users not
select a value any lower than the default. Users may choose larger
values to return annotations only if they meet more stringent
match criteria. An increase in the minimum percent identity cutoff
will produce annotations that exhibit closer matches to the refer-
ence database at the cost of a lower overall number of annotations.
Once again, we encourage users to experiment with this threshold
until it produce the desired number of annotations at an acceptable
level of stringency.
Min alignment length cutoff (default 15)
The minimum length cutoff represent the lower bound threshold
for alignment lengths to be included in output annotations. As
with the e-value and percent identity cutoffs, we recommend that
232 Kevin P. Keegan et al.
References
1. Wilkening J, Wilke A, Desai N et al (2009) ysis system for metagenomes. Nucleic Acids
Using clouds for metagenomics. A case study. Res 36(Database issue):D534–D538
In: IEEE Cluster, 2009 11. Kanehisa M (2002) The KEGG database.
2. Angiuoli S, Matalka M, Gussman A et al (2011) Novartis Found Symp 247:91–101
Clovr, a virtual machine for automated and por- 12. Benson DA, Cavanaugh M, Clark K (2013)
table sequence analysis from the desktop using Genbank. Nucleic Acids Res 41(Database
cloud computing. BMC Bioinformatics 12:356 issue):D36–D42
3. Meyer F, Paarmann D, D’Souza M et al (2008) 13. Dwivedi B, Schmieder R, Goldsmith DB et al
The metagenomics RAST server—a public (2012) PhiSiGns: an online tool to identify signa-
resource for the automatic phylogenetic and ture genes in phages and design PCR primers for
functional analysis of metagenomes. BMC examining phage diversity. BMC Bioinformatics
Bioinformatics 9:386 13:37
4. Field D, Amaral-Zettler L, Cochrane G et al 14. Overbeek R, Begley T, Butler RM et al (2005)
(2011) The genomic standards consortium. The subsystems approach to genome annota-
PLoS Biol 9:e1001088 tion and its use in the project to annotate 1000
5. Wilke A, Harrison T, Wilkening J et al (2012) genomes. Nucleic Acids Res 33:5691–5702
The m5nr, a novel non-redundant database 15. Magrane M, Uniprot Consortium (2011)
containing protein sequences and annotations UniProt knowledgebase: a hub of integrated
from multiple sources and associated tools. protein data. Database (Oxford). doi:10.1093/
BMC Bioinformatics 13:141 database/bar009
6. Altschul SF, Gish W, Miller W et al (1990) 16. Snyder EE, Kampanya N, Lu J et al (2007)
Basic local alignment search tool. J Mol Biol PATRIC: the VBI PathoSystems resource inte-
215:403–410 gration center. Nucleic Acids Res 35(Database
7. Kent WJ (2002) Blat—the blast-like alignment issue):D401–D406
tool. Genome Res 12:656–664 17. Jensen LJ, Julien P, Kuhn M et al (2008)
8. Brooksbank C, Bergman MT, Apweiler R et al Eggnog: automated construction and annota-
(2014) The European Bioinformatics Institute’s tion of orthologous groups of genes. Nucleic
data resources 2014. Nucleic Acids Res 42 Acids Res 36(Database issue):D250–D254
(Database issue):D18–D25 18. Tang W, Wilkening J, Desai N, Gerlach W,
9. Reference Genome Group of the Gene Wilke A, Meyer F (2013) A scalable data analy-
Ontology Consortium (2009) The Gene sis platform for metagenomics. Proceedings of
Ontology’s Reference Genome Project: a uni- the 2013 International Conference on Big Data
fied framework for functional annotation across 19. Bischof, J., Wilke, A., Gerlach, W., Harrison,
species. PLoS Comput Biol 5:e1000431 T., Paczian, T., Tang, W., Trimble, W.,
10. Markowitz VM, Ivanova NN, Szeto E et al Wilkening, J., Desai, N. and Meyer, F. (2015),
(2008) IMG/M, a data management and anal- Shock: Active Storage for Multicloud Streaming
MG-RAST, a Metagenomics Service for Analysis of Microbial Community Structure… 233
Data Analysis, 2nd IEEE/ACM International Paarmann D, Paczian T, Parrello B, Pusch GD,
Symposium on Big Data Computing, Limassol, Reich C, Stevens R, Vassieva O, Vonstein V,
Cyprus, 2015 Wilke A, Zagnitko O (2008) The RAST
20. Cox MP, Peterson DA, Biggs PJ (2010) Server: rapid annotations using subsystems
Solexaqa: at-a-glance quality assessment of illu- technology. BMC Genomics 9:75. doi:10.1186/
mina second-generation sequencing data. 1471-2164-9-75
BMC Bioinformatics 11:485 31. Pruesse E, Quast C, Knittel K et al (2007)
21. Huse SM, Huber JA, Morrison HG et al SILVA: a comprehensive online resource for
(2007) Accuracy and quality of massively paral- quality checked and aligned ribosomal RNA
lel DNA pyrosequencing. Genome Biol 8:R143 sequence data compatible with ARB. Nucleic
22. Gomez-Alvarez V, Teal TK, Schmidt TM Acids Res 35:7188–7196
(2009) Systematic artifacts in metagenomes 32. DeSantis TZ, Hugenholtz P, Larsen N et al
from complex microbial communities. ISME (2006) Greengenes: a Chimera-Checked 16S
J 3:1314–1317 rRNA gene database and workbench compati-
23. Keegan KP, Trimble WL, Wilkening J et al ble with ARB. Appl Environ Microbiol
(2012) A platform-independent method for 72:5069–5072
detecting errors in metagenomic sequencing 33. Cole JR, Chai B, Marsh TL et al (2003) The
data, Drisee. PLoS Comput Biol 8:e1002541 ribosomal database project (RDP-II): preview-
24. Langmead B, Trapnell C, Pop M et al (2009) ing a new autoaligner that allows regular
Ultrafast and memory-efficient alignment of updates and the new prokaryotic taxonomy.
short DNA sequences to the human genome. Nucleic Acids Res 31:442–443
Genome Biol 10:R25 34. Yilmaz P, Kottmann R, Field D et al (2011)
25. Trimble WL, Keegan KP, D’Souza M et al Minimum information about a marker gene
(2012) Short-read reading-frame predictors sequence (MIMARKS) and minimum informa-
are not created equal, sequence error causes tion about any (x) sequence (MIxS) specifica-
loss of signal. BMC Bioinformatics 13:183 tions. Nat Biotechnol 29:415–420
26. Rho M, Tang H, Ye Y (2009) Fraggenescan, 35. Bolotin A, Quinquis B, Sorokin A et al (2005)
Predicting genes in short and error prone Clustered regularly interspaced short palin-
reads. Nucleic Acids Res 38:e191 drome repeats (CRISPRS) have spacers of
27. Edgar RC (2010) Search and clustering orders extrachromosomal origin. Microbiology
of magnitude faster than blast. Bioinformatics 151:2551–2561
26:2460–2461 36. Reeder J, Knight R (2009) The ‘rare biosphere’,
28. Caporaso JG, Kuczynski J, Stombaugh J et al a reality check. Nat Methods 6:636–637
(2010) QIIME allows analysis of high- 37. Ondov BD, Bergman NH, Phillippy AM
throughput community sequencing data. Nat (2011) Interactive metagenomic visualization
Methods 7:335–336 in a web browser. BMC Bioinformatics 12:385
29. Huson DH, Auch AF, Qi J et al (2007) Megan 38. Gerlach, W., Tang, W., Keegan, K., Harrison,
analysis of metagenomic data. Genome Res T., Wilke, A., Bischof, J., D’Souza, M., Devoid,
17:377–386 S., Murphy-Olson, D., and Desai, N. (2014)
30. Aziz RK, Bartels D, Best AA, DeJongh M, Disz Skyport – Container-based execution environ-
T, Edwards RA, Formsma K, Gerdes S, Glass ment management for multi-cloud scientific
EM, Kubal M, Meyer F, Olsen GJ, Olson R, workflows. In Proc. 5th Int’l Workshop on
Osterman AL, Overbeek RA, McNeil LK, Data-Intensive Computing in the Clouds.
IEEE Press, pp. 25–32
Chapter 14
Abstract
Methylotrophs are microorganisms ubiquitous in the environment that can metabolize one-carbon (C1)
compounds as carbon and/or energy sources. The activity of these prokaryotes impacts biogeochemical
cycles within their respective habitats and can determine whether these habitats act as sources or sinks of
C1 compounds. Due to the high importance of C1 compounds, not only in biogeochemical cycles, but
also for climatic processes, it is vital to understand the contributions of these microorganisms to carbon
cycling in different environments. One of the most challenging questions when investigating methylo-
trophs, but also in environmental microbiology in general, is which species contribute to the environmen-
tal processes of interest, or “who does what, where and when?” Metabolic labeling with C1 compounds
substituted with 13C, a technique called stable isotope probing, is a key method to trace carbon fluxes
within methylotrophic communities. The incorporation of 13C into the biomass of active methylotrophs
leads to an increase in the molecular mass of their biomolecules. For DNA-based stable isotope probing
(DNA-SIP), labeled and unlabeled DNA is separated by isopycnic ultracentrifugation. The ability to
specifically analyze DNA of active methylotrophs from a complex background community by
high-throughput sequencing techniques, i.e. targeted metagenomics, is the hallmark strength of DNA-SIP
for elucidating ecosystem functioning, and a protocol is detailed in this chapter.
Key words Carbon-13, DNA stable isotope probing, DNA-SIP, High-throughput sequencing,
Isotopic labeling, Methylotrophy, Metagenomics, One-carbon compounds
1 Introduction
Francis Martin and Stéphane Uroz (eds.), Microbial Environmental Genomics (MEG), Methods in Molecular Biology, vol. 1399,
DOI 10.1007/978-1-4939-3369-3_14, © Springer Science+Business Media New York 2016
235
236 Martin Taubert et al.
2 Materials
Use analytical grade reagents and ultrapure water for the preparation
of all solutions. For suspending DNA, use nuclease-free water. All
solutions should be prepared and stored at room temperature,
unless otherwise indicated.
2.1 Density Gradient 1. EDTA solution: 0.5 M EDTA, pH 8.0. Dissolve 186.1 g of diso-
Centrifugation dium ethylenediamine tetraacetate dihydrate (EDTA) in 900 mL
Components of water. Add 2 M NaOH to adjust the pH to 8.0 (see Note 1)
and make up to 1 L with water. Sterilize in an autoclave.
2. Tris-EDTA (TE) buffer: 10 mM Tris–HCl, 1 mM EDTA,
pH 8.0. Dissolve 60.6 mg of Tris in 40 mL of water. Add
100 μL of a 0.5 M EDTA solution, mix and adjust pH to 8.0
with 0.5 M HCl. Make up to 50 mL with water. Filter sterilize
(0.22 μm) or autoclave.
3. DNA from a metabolic labeling experiment using the
13
C-labeled C1 compound of interest and DNA from a control
treatment with the same 12C compound, in TE buffer or water
(see Note 2), with known DNA concentrations.
4. CsCl solution: Dissolve 603.0 g of CsCl in water to a final
volume of 500 mL, resulting in a 7.163 M CsCl solution
(see Note 3). Adjust the density to a final value between 1.88
and 1.89 g/mL at 20 °C (see Note 4).
5. Gradient buffer (GB): 0.1 M Tris–HCl, 0.1 M KCl, 1 mM
EDTA, pH 8.0. Dissolve 12.11 g of Tris and 7.46 g of KCl in
900 mL of water. Add 2 mL of a 0.5 M EDTA solution, mix
and adjust pH to 8.0 with HCl. Make up to 1 L with water.
Sterilize in an autoclave.
6. Ultracentrifuge tubes: 5.1 mL, 13 mm × 51 mm Polyallomer
Quick-Seal Centrifuge Tubes (Beckman Coulter Ltd., High
Wycombe, UK).
7. Ultracentrifuge rotor capable of withstanding 177,087 × g
average: e.g. VTi 65.2 Beckman Coulter Vertical (Beckman
Coulter Ltd., High Wycombe, UK).
8. Pump for fractionation: Syringe pump or peristaltic pump able
to deliver a constant flow of 425 μL/min.
9. Digital refractometer: e.g. AR200 Digital Handheld
Refractometer (Reichert Technologies, Depew, NY, USA).
DNA-SIP for Analysis of Active Methylotrophs 239
2.2 DGGE 1. PCR primers for DGGE: Primer set 341f_GC (CGCCCG
Components CCGC GCGCGGCGGG CGGGGCGGGG GCACGGGG
GG CCTACGGGAG GCAGCAG) and 518r (ATTACCGCGG
CTGCTGG) targeting bacterial 16S rRNA genes [31].
2. 50× Tris-Acetate-EDTA (TAE) buffer: 2 M Tris–HCl, 1 M
Acetic acid, 0.05 M EDTA. Dissolve 242 g of Tris in 800 mL
of water. Add 57.1 mL of 100 % acetic acid and 100 mL of
0.5 M EDTA solution. Make up to 1 L with water.
3. 30 % DGGE solution: 1× TAE, 10 % acrylamide/bis-
acrylamide, 12 % formamide (v/v), 12.6 % urea (w/v). Dissolve
6.3 g of urea in 10 mL of water. Add 6 mL of formamide,
1 mL of 50× TAE buffer and 12.5 mL of 40 % acrylamide/bis
(37.5:1). Make up to 50 mL with water while the remaining
urea dissolves.
4. 70 % DGGE solution: 1× TAE, 10 % acrylamide/bis-
acrylamide, 28 % formamide (v/v), 29.4 % urea (w/v). Dissolve
14.7 g of urea in 10 mL of water. Add 14 mL of formamide,
1 mL of 50× TAE buffer and 12.5 mL of 40 % acrylamide/bis
(37.5:1). Make up to 50 mL with water while the remaining
urea dissolves. 5 mg of bromophenol blue can be added for
visual differentiation from the 30 % DGGE solution.
5. 5× DGGE loading dye: 50 % glycerol (v/v), 0.2 M EDTA,
0.05 % bromophenol blue (w/v). Mix 2.5 mL of glycerol,
2 mL of 0.5 M EDTA solution and 2.5 mg of bromophenol
blue. Make up to 5 mL with water.
6. DGGE system: e.g. DCode Universal Mutation Detection
System (Bio Rad, Hemel Hempstead, UK) or DGGEK-2001-
110 (C.B.S. Scientific, San Diego, CA, USA).
240 Martin Taubert et al.
Table 1
PCR primer sets for functional genes involved in methylotrophy
2.3 DNA 1. PCR primer sets targeting functional genes (Table 1).
Amplification 2. Multiple displacement amplification (MDA) kit: e.g. REPLI-g
Components Mini Kit (QIAGEN Ltd., Manchester, UK).
and Bioinformatics
3. Software package mothur: www.mothur.org [32].
Tools
4. Software package USEARCH: www.drive5.com/usearch/ [33].
3 Methods
3.1 Metabolic Setup conditions for metabolic labeling experiments are complex
Labeling with and depend on many factors, including the composition of the
13
C-Labeled C1 microbial community, type of heavy isotope substrate used,
Compounds metabolic activity of the target population, conversion efficiency
and biochemical processes of interest. Thus, no comprehensive
protocol can be given for this part of the experiment (see Note 5).
DNA-SIP for Analysis of Active Methylotrophs 241
100, 120, and 140 μL GB. Measure the density of the mixtures
(see Note 4). Measure refractive indices with a digital refrac-
tometer with a resolution of at least 0.0001 and temperature
correction (nD-TC) to 20 °C. Plot density versus nD-TC and
calculate a linear regression. The calibration curve is required
to convert nD-TC readings to density to set up samples of the
correct density for density gradient centrifugation and to verify
gradient formation afterward (see Note 6).
2. Calculate the required amount of GB to get to the desired
starting density for density gradient centrifugation of 1.725 g/
mL. This can be done using the formula:
names and rotor positions; tube labels can come off during
ultracentrifugation. Prepare the rotor according to the manu-
facturer’s instructions.
3.4 Identification 1. Check retrieval and quality of DNA obtained from individual
of Labeled DNA fractions by applying 5 μL to 1 % (w/v) agarose gel electrophoresis
by DGGE following standard laboratory procedures. Quantification of
Fingerprinting DNA is possible by fluorometric assays. Do not use photometric
DNA quantification based on absorbance in the UV range,
because this is usually not sensitive enough to detect the low
amounts of DNA that might be present. High molecular mass
DNA bands should be visible under UV light after staining with
ethidium bromide (0.5 μg/mL gel) in at least some of the
fractions, typically between fractions 6 and 12. For trouble-
shooting on DNA retrieval, see Table 2.
2. Perform a PCR with primers targeting rRNA genes of the
organisms of interest, including a GC clamp. To target bacterial
16S rRNA genes, we typically use the primer set 341f_GC/518r
which amplifies a ~230 bp portion of the gene, spanning the V3
hypervariable region. The PCR conditions are: 95 °C for 5 min,
30 cycles of 94 °C for 1 min, 55 °C for 1 min, 72 °C for 1 min,
followed by a final extension of 72 °C for 5 min [31]. The final
reaction volume is 50 μL. Check the PCR products by applying
5 μL to 1 % (w/v) agarose gel electrophoresis. Prepare samples
for DGGE by mixing 4–40 μL of the PCR product, according
to band intensity on the agarose gel, with DGGE loading dye
to achieve a 1× final concentration.
3. Prepare a gel for denaturing gradient gel electrophoresis. The
following volumes are given for DGGE equipment supporting
20 × 20 cm glass plates in a 6.5 L tank. Transfer 12.5 mL of the
30 % and 70 % DGGE solution to two 15 mL falcon tubes and
keep them on ice. Add 12.6 μL of TEMED and 126 μL of APS
solution to each tube and transfer to a gradient mixer. Cast
246 Martin Taubert et al.
Table 2
Potential sources of problems in fractionation of DNA from SIP experiments and recommended
solutions
Fig. 2 DGGE gels obtained from fractionated DNA of (a) 12C and (b) 13C incuba-
tions on 13C-labeled methanol after electrophoresis for 16 h at 75 V. Black box:
bands occurring in the same fractions in 12C and 13C incubations representing
unlabeled DNA. White box: bands enriched in the heavy fractions of the 13C incu-
bation due to labeling of DNA by methylotrophic activity
248 Martin Taubert et al.
3.5 Analysis 1. Perform PCR assays with primers targeting bacterial 16S
of Labeled DNA rRNA genes on the labeled DNA. Purify PCR products
obtained using PEG-NaCl precipitation as described in
Subheading 3.2, step 6. Perform sequencing of 16S rRNA
gene PCR amplicons to acquire an overview of the phyloge-
netic composition of the labeled DNA and to identify putative
methylotrophs (see Note 18). This may also be done with the
unlabeled (light) DNA of the 13C sample for comparison, to
illustrate the relative enrichment of genes from methylotro-
phic organisms in the labeled DNA (see Fig. 3).
2. Screen for functional genes encoding key enzymes for methy-
lotrophy by PCR. Depending on the investigated processes and
applied substrates, different genes can be of interest. Commonly
targeted are mxaF, encoding the large subunit of methanol
dehydrogenase, pmoA and mmoX, encoding subunits of the
particulate and soluble methane monooxygenase, as well as
mauA and gmaS, encoding genes for alternative pathways of
methylamine degradation (see Table 1 for PCR primers and
references). Purify obtained PCR products using PEG-NaCl
precipitation as described in Subheading 3.2, step 6.
3. Sequence functional gene PCR amplicons by 454 pyrosequenc-
ing. We commonly use the software packages mothur and
USEARCH when analyzing data from a GS FLX Titanium system
(see Note 19). Use Mothur to extract flowgrams from raw *.sff
data files with the sffinfo() command. Discard flowgrams with
less than 450 usable flows and cut remaining flowgrams to 720
flows with trim.flows(). Denoise flowgrams and translate to
DNA-SIP for Analysis of Active Methylotrophs 249
4 Notes
1. EDTA will slowly dissolve as the pH gets near 8.0. When using
solid NaOH pellets, around 18–20 g are required. Use a 2 M
NaOH solution for more precise adjustment of the pH.
2. DNA extraction protocols will differ based on the source mate-
rial (e.g. soil, sediment, sludge, biofilm, or aquatic samples)
and, consequently, no specific instructions can be given. Do
test extractions from source material obtained directly from
the environment to establish a suitable DNA extraction method
before starting a metabolic labeling experiment.
3. The high amount of CsCl leads to an increase in volume when
dissolving. Make sure not to add too much water initially.
Stirring and gently warming in a water bath will help to dis-
solve the CsCl more quickly.
4. For measuring density, use a digital density meter or carefully
weigh 1-mL aliquots in triplicate. Make sure the solution is at
20 °C before beginning this process. If the density is too low,
add more CsCl. Adding 5–10 g of CsCl increases the density
by ~0.01 g/mL. A density above 1.89 g/mL can still be used
if adjustments are done when setting up samples for ultracen-
trifugation (see Subheading 3.1, step 4).
5. This is discussed in more detail elsewhere [24, 25].
6. Density measurement using an analytical balance is tedious and
much less accurate than refractive index measurement, and also
provides a higher chance for sample loss or DNA contamination.
7. For example, when using 4.8 mL of a stock solution with a
density of 1.890 g/mL, this equates to:
Required volume = (1.890–1.725 g/mL) × 4.8 mL × 1.52 mL/g
Required volume = 1.20 mL of GB
Acknowledgement
This work was possible thanks to financial support from the Gordon
and Betty Moore Foundation Marine Microbiology Initiative
Grant GBMF3303 to J. Colin Murrell and Yin Chen and through
the Earth and Life Systems Alliance, Norwich Research Park,
Norwich, UK.
254 Martin Taubert et al.
References
1. Carpenter LJ, Archer SD, Beale R (2012) 14. Neufeld JD, Schafer H, Cox MJ, Boden R,
Ocean–atmosphere trace gas exchange. Chem McDonald IR, Murrell JC (2007) Stable-
Soc Rev 41:6473–6506 isotope probing implicates Methylophaga spp.
2. Heikes BG, Chang WN, Pilson MEQ, Swift E, and novel Gammaproteobacteria in marine
Singh HB, Guenther A, Jacob DJ, Field BD, methanol and methylamine metabolism. ISME
Fall R, Riemer D, Brand L (2002) Atmospheric J 1:480–491
methanol budget and ocean implication. 15. Wischer D, Kumaresan D, Johnston A, El
Global Biogeochem Cycles 16:8001–8013 Khawand M, Stephenson J, Hillebrand-
3. Carini P, White AE, Campbell EO, Giovannoni Voiculescu AM, Chen Y, Colin Murrell J (2014)
SJ (2014) Methane production by phosphate- Bacterial metabolism of methylated amines and
starved SAR11 chemoheterotrophic marine identification of novel methylotrophs in Movile
bacteria. Nat Commun 5:4346 Cave. ISME J 9:195–206
4. Chen Y, McAleer KL, Murrell JC (2010) 16. Shokralla S, Spall JL, Gibson JF, Hajibabaei M
Monomethylamine as a nitrogen source for a (2012) Next-generation sequencing technolo-
nonmethylotrophic bacterium, Agrobacterium gies for environmental DNA research. Mol
tumefaciens. Appl Environ Microbiol Ecol 21:1794–1805
76:4102–4104 17. Lüke C, Frenzel P (2011) Potential of pmoA
5. Kiene RP, Linn LJ, Bruton JA (2000) New and amplicon pyrosequencing for methanotroph
important roles for DMSP in marine microbial diversity studies. Appl Environ Microbiol
communities. J Sea Res 43:209–224 77:6305–6309
6. Anthony C (1982) The biochemistry of meth- 18. Kolb S, Stacheter A (2013) Prerequisites for
ylotrophs. Academic, New York amplicon pyrosequencing of microbial metha-
7. Neufeld JD, Wagner M, Murrell JC (2007) nol utilizers in the environment. Front
Who eats what, where and when? Isotope- Microbiol 4:1–12
labelling experiments are coming of age. ISME 19. Venter JC, Remington K, Heidelberg JF,
J 1:103–110 Halpern AL, Rusch D, Eisen JA, Wu D,
8. Chistoserdova L (2011) Modularity of methy- Paulsen I, Nelson KE, Nelson W, Fouts DE,
lotrophy, revisited. Environ Microbiol 13: Levy S, Knap AH, Lomas MW, Nealson K,
2603–2622 White O, Peterson J, Hoffman J, Parsons R,
Baden-Tillson H, Pfannkoch C, Rogers YH,
9. Holmes AJ, Costello A, Lidstrom ME, Murrell Smith HO (2004) Environmental genome
JC (1995) Evidence that participate methane shotgun sequencing of the Sargasso Sea.
monooxygenase and ammonia monooxygenase Science 304:66–74
may be evolutionarily related. FEMS Microbiol
Lett 132:203–208 20. Chistoserdova L (2014) Is metagenomics
resolving identification of functions in micro-
10. McDonald IR, Murrell JC (1997) The metha- bial communities? Microb Biotechnol 7:1–4
nol dehydrogenase structural gene mxaF and
its use as a functional gene probe for methano- 21. Boschker H, Nold S, Wellsbury P, Bos D, De
trophs and methylotrophs. Appl Environ Graaf W, Pel R, Parkes R, Cappenberg T
Microbiol 63:3218–3224 (1998) Direct linking of microbial populations
to specific biogeochemical processes by
11. Costello AM, Lidstrom ME (1999) Molecular 13
C-labelling of biomarkers. Nature 392:
characterization of functional and phylogenetic 801–805
genes from natural populations of methano-
trophs in lake sediments. Appl Environ 22. Radajewski S, Ineson P, Parekh NR, Murrell
Microbiol 65:5066–5074 JC (2000) Stable-isotope probing as a tool in
microbial ecology. Nature 403:646–649
12. Auman AJ, Stolyar S, Costello AM, Lidstrom
ME (2000) Molecular characterization of 23. Neufeld JD, Vohra J, Dumont MG, Lueders T,
methanotrophic isolates from freshwater Manefield M, Friedrich MW, Murrell JC
lake sediment. Appl Environ Microbiol 66: (2007) DNA stable-isotope probing. Nat
5259–5266 Protoc 2:860–866
13. Hutchens E, Radajewski S, Dumont MG, 24. Murrell JC, Whiteley AS (2011) Stable isotope
McDonald IR, Murrell JC (2004) Analysis of probing and related technologies. ASM,
methanotrophic bacteria in Movile Cave by Washington, DC
stable isotope probing. Environ Microbiol 25. Neufeld JD, Dumont MG, Vohra J, Murrell JC
6:111–120 (2007) Methodological considerations for the
DNA-SIP for Analysis of Active Methylotrophs 255
use of stable isotope probing in microbial 34. Cebron A, Bodrossy L, Stralis-Pavese N, Singer
ecology. Microb Ecol 53:435–442:2027 AC, Thompson IP, Prosser JI, Murrell JC
26. Dunford EA, Neufeld JD (2010) DNA stable- (2007) Nutrient amendments in soil DNA
isotope probing (DNA-SIP). J Vis Exp 42:2027 stable isotope probing experiments reduce the
27. Neufeld JD, Chen Y, Dumont MG, Murrell JC observed methanotroph diversity. Appl Environ
(2008) Marine methylotrophs revealed by Microbiol 73:798–807
stable-isotope probing, multiple displacement 35. Altschul SF, Madden TL, Schaffer AA, Zhang
amplification and metagenomics. Environ J, Zhang Z, Miller W, Lipman DJ (1997)
Microbiol 10:1526–1535 Gapped BLAST and PSI-BLAST: a new gen-
28. Kalyuzhnaya MG, Lapidus A, Ivanova N, eration of protein database search programs.
Copeland AC, McHardy AC, Szeto E, Salamov Nucleic Acids Res 25:3389–3402
A, Grigoriev IV, Suciu D, Levine SR, Markowitz 36. Meyer F, Paarmann D, D'Souza M, Olson R,
VM, Rigoutsos I, Tringe SG, Bruce DC, Glass EM, Kubal M, Paczian T, Rodriguez A,
Richardson PM, Lidstrom ME, Chistoserdova Stevens R, Wilke A, Wilkening J, Edwards RA
L (2008) High-resolution metagenomics tar- (2008) The metagenomics RAST server - a
gets specific functional types in complex public resource for the automatic phylogenetic
microbial communities. Nat Biotechnol and functional analysis of metagenomes. BMC
26:1029–1034 Bioinformatics 9:386
29. Green SJ, Leigh MB, Neufeld JD (2010) 37. Bartram A, Poon C, Neufeld J (2009) Nucleic
Denaturing Gradient Gel Electrophoresis acid contamination of glycogen used in nucleic
(DGGE) for microbial community analysis. In: acid precipitation and assessment of linear
Timmis K (ed) Handbook of hydrocarbon and polyacrylamide as an alternative co-precipitant.
lipid microbiology. Springer, Berlin Heidelberg, Biotechniques 47:1019–1022
pp 4137–4158 38. Huson DH, Mitra S, Ruscheweyh HJ, Weber
30. Binga EK, Lasken RS, Neufeld JD (2008) N, Schuster SC (2011) Integrative analysis of
Something from (almost) nothing: the impact environmental sequences using MEGAN4.
of multiple displacement amplification on Genome Res 21:1552–1560
microbial ecology. ISME J 2:233–241 39. Dumont MG, Lüke C, Deng YC, Frenzel P
31. Muyzer G, De Waal EC, Uitterlinden AG (2014) Classification of pmoA amplicon pyro-
(1993) Profiling of complex microbial popula- sequences using BLAST and the lowest com-
tions by denaturing gradient gel electrophore- mon ancestor method in MEGAN. Front
sis analysis of polymerase chain Microbiol 5:1–11
reaction-amplified genes coding for 16S rRNA. 40. Caporaso JG, Kuczynski J, Stombaugh J,
Appl Environ Microbiol 59:695–700 Bittinger K, Bushman FD, Costello EK, Fierer
32. Schloss PD, Westcott SL, Ryabin T, Hall JR, N, Pena AG, Goodrich JK, Gordon JI, Huttley
Hartmann M, Hollister EB, Lesniewski RA, GA, Kelley ST, Knights D, Koenig JE, Ley RE,
Oakley BB, Parks DH, Robinson CJ, Sahl JW, Lozupone CA, McDonald D, Muegge BD,
Stres B, Thallinger GG, Van Horn DJ, Weber Pirrung M, Reeder J, Sevinsky JR, Turnbaugh
CF (2009) Introducing mothur: open-source, PJ, Walters WA, Widmann J, Yatsunenko T,
platform-independent, community-supported Zaneveld J, Knight R (2010) QIIME allows
software for describing and comparing microbial analysis of high-throughput community
communities. Appl Environ Microbiol 75: sequencing data. Nat Methods 7:335–336
7537–7541 41. Yilmaz S, Allgaier M, Hugenholtz P (2010)
33. Edgar RC (2013) UPARSE: highly accurate Multiple displacement amplification compro-
OTU sequences from microbial amplicon mises quantitative analysis of metagenomes.
reads. Nat Methods 10:996–998 Nat Methods 7:943–944
Chapter 15
Abstract
Activity-based metagenomics is one of the most efficient approaches to boost the discovery of novel
biocatalysts from the huge reservoir of uncultivated bacteria. In this chapter, we describe a highly generic
procedure of metagenomic library construction and high-throughput screening for carbohydrate-active
enzymes. Applicable to any bacterial ecosystem, it enables the swift identification of functional enzymes
that are highly efficient, alone or acting in synergy, to break down polysaccharides and oligosaccharides.
1 Introduction
Francis Martin and Stéphane Uroz (eds.), Microbial Environmental Genomics (MEG), Methods in Molecular Biology, vol. 1399,
DOI 10.1007/978-1-4939-3369-3_15, © Springer Science+Business Media New York 2016
257
258 Lisa Ufarté et al.
retrieved from metagenomes these last few years [2, 3], most of
them presenting very original sequences [4], sometimes belonging
to novel protein families [5] and/or displaying inedited key
functions of carbohydrate foraging [6] which would not have been
predicted by genomic or metagenomic sequence analysis.
In this chapter, we describe a robust and inexpensive procedure
of high-throughput functional exploration of bacterial ecosystems
(soil being used as an example), to drive in-depth metagenome
sequencing and focus on genes encoding catabolic CAZymes.
Even if alternative strains with different expression and secretion
capabilities can be used [7, 8], we detail the construction of E. coli
fosmidic metagenomic libraries, as it allows to easily and rapidly
explore extremely large sequence spaces, covering several Gbp of
metagenomic DNA. Search for functional CAZyme encoding
genes consists here in applying a multistep screening approach to
(1) isolate clones producing catalysts with the desired specificity
toward polysaccharidic and oligosaccharidic substrates, (2)
discriminate endo- and exo-hydrolytic activities (Fig. 2a, b) and
even discover enzyme cocktails, encoded by multigenic clusters
that are frequently found on large metagenomic fosmidic inserts
(sizing between 30 and 50 kbp) that are involved in the break-
Fig. 2 High-throughput screening of E. coli metagenomic libraries for endo- and exo-acting glycanases. (a)
Pictures of primary screening results (solid medium) on (a) insoluble AZCL-polysaccharides, blue halos show-
ing the release of soluble AZCL-oligosaccharides; (b) solubilized Azo-polysaccharides, clear halo showing the
degradation of the colored polymer; (c) X-mono/oligosaccharides, blue color showing the release of free
X-compounds; (d) minimal medium supplemented with oligosaccharides as carbon source, the sole growing
clone being able to degrade the targeted oligosaccharides. (b) Pictures of secondary screening results (liquid
medium) on (a) AZCL-polysaccharides, blue color showing the release of soluble AZCL-oligosaccharides in the
reaction medium; (b) pNP-mono/oligosaccharides, yellow color showing the release of free pNP-compounds
in the reaction medium; (c) HPAEC-PAD analysis of, in black, oligosaccharides substrate (fructo-oligosaccha-
rides as an example) before enzymatic hydrolysis; in red, hydrolysis reaction products (glucose and fructose
as an example) after 24 h of reaction
260 Lisa Ufarté et al.
down of plant cell wall. If the automated solid plate assays used in
the primary screens can be easily carried out by only one person at
a throughput of 240,000 assays per week (corresponding to the
screening of 20,000 clones for 12 different activities) for only few
k€, the discriminating assays in liquid media are used with a lower
throughput of around 500 assays per week. However, they are
highly recommended in order to avoid total or partial sequence
redundancy between the hits presenting the same activities.
Sequence redundancy can also be avoided by choosing to screen
several little libraries (of few dozens of thousands clones)
constructed from different samples rather than only a large one (of
hundred thousand clones) issued from one unique sample.
This highly generic approach is applicable to mine all complex
bacterial communities for novel catabolic CAZymes. Depending on
their ability to face the structural complexity of plant cell wall, and to
use it as the main carbon source for growing and maintaining them-
selves in their habitat, the hit rates will vary from less than 0.2 ‰ (for
example for soil communities) to more than 4 ‰ (for highly special-
ized ecosystems like termite guts [9]). In any case, in order to increase
hit yield, we recommend (1) increasing the number of primary screens
by using a large diversity of polysaccharidic and oligosaccharidic sub-
strates, varying in nature of glycosidic residues, type of osidic linkages,
polymerization degree and ramification content; (2) increasing the
library size, preferably constructed from several metagenomic DNA
samples, in order to minimize sequence redundancy.
After hit recovery, fosmid sequencing with high coverage
(more than 10×) allows to easily identify the genes, or the gene
clusters, that are responsible for the screened activity, and their
taxonomic origin, sometimes up to species level. As the functional
and taxonomical annotation procedures do not differ from those
developed for sequenced-based metagenomics and genomics, they
will not be detailed in this chapter.
2 Materials
All plastics used are certified free of DNAse and DNA. All tools
and materials used should be washed and cleaned with 70 % ethanol
solution (see Note 1). Glass or metal materials, as well as solutions
when specified, are sterilized before use (121 °C, 20 min). Prepare
all solutions using ultrapure water (18 MΩ cm at 25 °C) and
analytical grade reagents. Follow all waste disposal regulations
when disposing waste materials.
2.3 Media For libraries using the pEpiFOS-5 Fosmid Vector (EPICENTRE).
and Solutions
1. 1000× Cm stock solution: 12.5 mg/mL chloramphenicol
for Functional
(Cm) in ethanol, stored at −20 °C.
Screening
262 Lisa Ufarté et al.
3 Methods
3.1 DNA Sampling 1. Collect soil core samples of 6 cm in diameter from surface soils
(0–20 cm) by using geostatistical methods as described for
3.1.1 Soil Sampling
example by Atteia [10] on a grid of 6.20 × 3.20 m (see Note 10).
2. Transfer soil cores as soon as possible to the laboratory in
plastic bags.
3. Sieve soil at 2 mm and store it at 4 °C until rapid processing
(within a week).
3.1.2 Bacterial Cells 1. Refrigerate HMP, NaCl and Nycodenz solutions at 4 °C and
Recovery perform following procedures on ice unless otherwise speci-
fied. Mix the equivalent of 50 g of dry soil with 180 mL of
HMP and about 20 glass beads and stir strongly (CATSSO
stirrer, set to position 1/min) for 2 h at 22 °C.
2. Centrifuge in a swing rotor (Eppendorf A-4-81) at 18 × g for
1 min at 10 °C to eliminate coarse particles.
3. Filter supernatant on sterile gaze into a new 250-mL Nalgene
tube and centrifuge in a swing rotor at 3,220 × g for 20 min at
10 °C.
4. Eliminate supernatant and suspend pellet in 35 mL NaCl
(see Note 11).
5. Fill two 50-mL falcon tubes with 11 mL Nycodenz solution
and carefully add on surface half of the soil suspension in both
tubes (see Note 12) [11].
6. Centrifuge in a swing rotor at 3,220 × g for 40 min at 10 °C
without acceleration and deceleration (set to 0).
7. Pipette the white bacterial ring (approximately 4 mL) without
disturbing Nycodenz gradient at the interface between
Nycodenz and NaCl (see Note 13), pool both rings in a single
50-mL falcon tube and fill with NaCl up to 40 mL.
8. Centrifuge the falcon tube with a fixed-angle rotor at 9,000 × g
for 20 min at 10 °C (see Note 14).
9. Eliminate supernatant, wash pellet with 10 mL NaCl and
transfer to a 15-mL Falcon tube.
10. Centrifuge with a fixed-angle rotor at 9,000 × g for 15 min at
10 °C.
Functional Metagenomics for CAZyme Discovery 265
3.1.3 High Molecular 1. Mix bacterial pellets with an equal volume of molten 1.6 %
Weight DNA Extraction InCert® agarose (see Note 15) [12], transfer into disposable
plug mold.
2. Let it stand at 4 °C until solidification, then unmold the solidi-
fied cell suspension and transfer into a 50-mL Falcon tube.
3. Add 45 mL of LA solution and incubate at 37 °C for 6 h.
4. Transfer the plug into a new 50-mL Falcon tube, add 45 mL
of LBB solution and incubate at 55 °C for 24 h.
5. Repeat the operation: transfer plug in 45 mL of fresh LBB
solution into a new 50-mL Falcon tube and incubate at 55 °C
for 24 h.
6. Wash plug in 10 mL of storage buffer containing PMSF for
2 × 1 h at 50 °C (see Note 16).
7. Dialyze the plug in three successive 10 mL storage buffer baths
for 8 h and store at 4 °C until use.
3.3 Replication 1. The day before replication, place the metagenomic library at
of the Metagenomic 4 °C to allow gentle thawing from −80 °C storage.
Library Prior 2. New 384-well microtiter plates are filled with LB + 8 % Glycerol
to Functional solution, 70 μL per well, using an automated liquid handling
Screening station.
3. The metagenomic library is replicated, using a QPixII colony
picker (3 h for 54 microplates, totalizing 20,736 clones).
4. The mother plates are stored back at −80 °C, covered with
microplate aluminum sealing tapes. The copy plates are incu-
bated overnight (about 16 h) at 37 °C, covered by porous
adhesive membranes.
3.4 High-Throughput 1. Sterilize the autoclavable tubing of the PM600 Jouan pump, as
Primary Screening well as deionized water to wash the tubing between two differ-
ent media distribution. The quantity of water depends on the
3.4.1 QTray Preparation
number of substrates (see Note 21).
2. Calibrate the pump using sterile water.
3. Pour 200 mL of underlay for each substrate using the pump
(see Note 22). For chromogenic substrates, use LB medium;
for selective growth, use M9 medium. Leave them to dry
under the hood, lid off, for ~30 min.
4. Pour 100 mL of overlay medium for each substrate (see Note
22). For chromogenic substrates, use LB medium containing
2 g/L of AZCL/Azo-substrate, or 60 mg/L of X-substrates;
for selective growth, use M9 medium containing a final
concentration of 0.5 % (w/v) oligosaccharidic carbon source.
Leave them to dry, stacked under the hood, lid off, for ~30 min
(see Notes 23 and 24).
5. Until the day of the gridding, stock the plates at 4 °C, upside
down.
3.4.2 Gridding 1. When storing the plates at 4 °C, place them at room tempera-
ture the day before the gridding.
2. Microtiter plates are gridded on large LB agar plates, using a
K2 automated plate replication system. One QTray can accom-
modate the clones from six 384-well plates, for a total number
of 2304 fosmid clones per plate. In 7 h, 54 microtiter plates
can be gridded on 12 different substrates.
3. Plates containing arrayed clones are incubated at 37 °C.
3.4.3 Hit Isolation, 1. Positive clones are recognized: (1) for AZCL-substrates,
Selection, and Validation thanks to the blue-colored halo formed around the colonies
(Fig. 2a.a); (2) on Azo-substrates by the appearance of a
discoloration halo around positive clones (Fig. 2a.b); (3) as
blue-colored colonies on X-substrates (Fig. 2a.c); (4) as the
sole growing colonies on M9 media supplemented with tar-
geted carbon source (see Note 25) (Fig. 2a.d).
Functional Metagenomics for CAZyme Discovery 267
4 Notes
Acknowledgements
References
1. Lombard V, Golaconda Ramulu H, Drula E, 9. Bastien G, Arnal G, Bozonnet S, Laguerre S,
Coutinho PM, Henrissat B (2014) The Ferreira F, Fauré R, Henrissat B, Lefèvre F, Robe
carbohydrate-active enzymes database (CAZy) P, Bouchez O, Noirot C, Dumon C, O’Donohue
in 2013. Nucleic Acids Res 42:D490–D495 M (2013) Mining for hemicellulases in the
2. André I, Potocki-Véronèse G, Barbe S, Moulis fungus-growing termite Pseudacanthotermes
C, Remaud-Siméon M (2014) CAZyme dis- militaris using functional metagenomics.
covery and design for sweet dreams. Curr Opin Biotechnol Biofuels 6:78
Chem Biol 19:17–24 10. Atteia O, Dubois JP, Webster R (1994)
3. Li L-L, McCorkle SR, Monchy S, Taghavi S, Geostatistical analysis of soil contamination in
van der Lelie D (2009) Bioprospecting metage- the Swiss Jura. Environ Pollut (Barking Essex)
nomes: glycosyl hydrolases for converting bio- 86:315–327
mass. Biotechnol Biofuels 2:10 11. Courtois S, Frostegård A, Göransson P,
4. Ferrer M, Golyshina OV, Chernikova TN, Depret G, Jeannin P, Simonet P (2001)
Khachane AN, Martins Dos Santos VAP, Yakimov Quantification of bacterial subgroups in
MM, Timmis KN, Golyshin PN (2005) Microbial soil: comparison of DNA extracted directly
enzymes mined from the Urania deep-sea hyper- from soil or from cells previously released
saline anoxic basin. Chem Biol 12:895–904 by density gradient centrifugation. Environ
5. Tasse L, Bercovici J, Pizzut-Serin S, Robe P, Microbiol 3:431–439
Tap J, Klopp C, Cantarel BL, Coutinho PM, 12. Ginolhac A, Jarrin C, Gillet B, Robe P, Pujic P,
Henrissat B, Leclerc M, Doré J, Monsan P, Tuphile K, Bertrand H, Vogel TM, Perriere G,
Remaud-Simeon M, Potocki-Veronese G Simonet P, Nalin R (2004) Phylogenetic analy-
(2010) Functional metagenomics to mine the sis of polyketide synthase I domains from soil
human gut microbiome for dietary fiber cata- metagenomic libraries allows selection of
bolic enzymes. Genome Res 20:1605–1612 promising clones. Appl Environ Microbiol
6. Ladevèze S, Tarquis L, Cecchini DA, Bercovici 70:5522–5527
J, André I, Topham CM, Morel S, Laville E, 13. Cecchini DA, Laville E, Laguerre S, Robe P,
Monsan P, Lombard V, Henrissat B, Potocki- Leclerc M, Doré J, Henrissat B, Remaud-
Véronèse G (2013) Role of glycoside phos- Siméon M, Monsan P, Potocki-Véronèse G
phorylases in mannose foraging by human (2013) Functional metagenomics reveals novel
gut bacteria. J Biol Chem 288:32370–32383 pathways of prebiotic breakdown by Human
7. Ekkers DM, Cretoiu MS, Kielak AM, van Elsas gut bacteria. PLoS One 8:e72766
JD (2012) The great screen anomaly—a new 14. Moreira D, López-Garcı́a P (2002) The molec-
frontier in product discovery through func- ular ecology of microbial eukaryotes unveils a
tional metagenomics. Appl Microbiol hidden world. Trends Microbiol 10:31–38
Biotechnol 93:1005–1020 15. Oliver MA, Webster R (2010) Combining
8. Taupp M, Mewis K, Hallam SJ (2011) The art nested and linear sampling for determining the
and design of functional metagenomic screens. scale and form of spatial variation of regional-
Curr Opin Biotechnol 22:465–472 ized variables. Geogr Anal 18:227–242
Chapter 16
Abstract
Functions expressed by eukaryotic organisms in soil can be specifically studied by analyzing the pool of
eukaryotic-specific polyadenylated mRNA directly extracted from environmental samples. In this chapter,
we describe two alternative protocols for the extraction of high-quality RNA from soil samples. Total soil
RNA or mRNA can be converted to cDNA for direct high-throughput sequencing. Polyadenylated
mRNA-derived full-length cDNAs can also be cloned in expression plasmid vectors to constitute soil
cDNA libraries, which can be subsequently screened for functional gene categories. Alternatively, the
diversity of specific gene families can also be explored following cDNA sequence capture using exploratory
oligonucleotide probes.
Key words Metatranscriptomics, Environmental RNA, cDNA synthesis, cDNA size fractionation,
cDNA libraries, Sequence capture
1 Introduction
Francis Martin and Stéphane Uroz (eds.), Microbial Environmental Genomics (MEG), Methods in Molecular Biology, vol. 1399,
DOI 10.1007/978-1-4939-3369-3_16, © Springer Science+Business Media New York 2016
273
274 Rajiv K. Yadav et al.
2 Materials
2.1 Soil Sampling, 1. Soil sampling strategies need to be adapted to the scope and
Processing, hypotheses to be tested in individual studies and therefore, only
and Storage some general guidelines can be given in this chapter. The main
factors to be taken into consideration regard sampling time and
the number, spacing, and volume of soil samples. With respect
to sampling time, soil microbial activity, and therefore meta-
transcriptomic RNA diversity, is highly responsive to environ-
mental parameters, such as plant cover, temperature, and water
content. Concerning sample numbers, soil microbial communi-
ties and more specifically fungal ones are spatially structured
and therefore a single soil core, of a few centimeters in diame-
ter, will only capture a small fraction of the taxonomic and func-
tional diversity of the corresponding microbial community.
Finally, most non-agricultural soils are vertically structured in
discrete soil horizons colonized by often taxonomically and
functionally distinct microbial species. As a consequence, when
fine scale spatial structure does not represent an issue, it may be
advisable to collect multiple soil cores, regularly distributed in a
plot of interest, across different horizons which can be mixed
together to constitute a composite soil sample.
2. As patterns of gene expression quickly change over time, it is
advisable to process the soil samples as soon as possible (e.g.
within 0–6 h) after sampling. Processing can be limited to siev-
ing (e.g. by using a 2 mm-mesh sieve) to remove most plant
roots, coarse plant debris and stones as well as the macro-fauna.
Aliquots of soils are then quickly frozen in either dry ice or
liquid nitrogen and stored at −70/80 °C. We have successfully
extracted seemingly undegraded RNA from forest soil samples
stored frozen for more than 5 years.
2.3 Individual 1. Chemicals of the highest grade must be used (the purchase of
Chemicals so-called “RNase-tested” or “RNase-free” chemicals is however
and Molecular Biology usually not necessary): sodium dodecyl sulfate (SDS), LiCl, Na
Products acetate, Tris–HCl, Na2EDTA, NaCl, ethanol, isopropanol, iso-
amyl alcohol, chloroform, water-saturated phenol (at acidic pH
or adjusted at pH 8.0, must be stored at 4 °C in the dark), beta-
mercaptoethanol, orange G, xylene cyanol FF, ethidium bro-
mide, diatomaceous earth (e.g. from Sigma Chemical company),
acid-washed glass beads (106 μm in diameter from Sigma).
2. Molecular biology products include: agarose of molecular
biology grade, low melting point agarose, yeast tRNA (e.g.
10 mg/mL from Ambion), SfiI endonuclease (which recog-
nizes and cuts the degenerate GGCCNNNNNGGCC restric-
tion sites), T4 DNA ligase (and its buffer containing ATP),
RNase-free DNase I.
2.5 RNA Extraction RNA extraction from soil can be performed using commercial
and Manipulation kits, which can sometimes fail to give high-quality
RNA. Alternatively, the two RNA extraction protocols described
below (see Subheadings 3.1 and 3.2) can be used.
1. When working with RNA it is advisable to work on a dedicated
bench with dedicated pipette sets and labware.
2. Filter pipette tips should be systemically used.
3. Gloves must be worn all time.
4. Glassware can be made free of RNase by baking for 2 h at
160 °C.
5. Reusable plasticware must be thoroughly washed with deter-
gents, abundantly rinsed with deionized water and sterilized
water before being autoclaved twice at 120 °C for 20 min.
6. Jars of microtubes (usual microbiology grade) must be filled
with gloved hands and autoclaved twice at 120 °C for 20 min.
7. To prepare RNase-free water, pour deionized or ultrapure
water in baked glass bottles and immediately sterilize twice by
autoclaving (see Note 2).
8. All aqueous solutions or suspensions (20 % w/v SDS, 3 % dia-
tomaceous earth in water, 4 M LiCl, 3 M Na acetate pH 4.8 or
5.2, Tris Borate EDTA (TBE) electrophoresis buffer) must be
prepared in sterile RNase-free water and sterilized twice at
120 °C for 20 min.
9. pH measurements performed with thoroughly cleaned
electrodes.
10. The denaturing and lysis solutions used in step 2 in
Subheading 3.3 contain (per L): denaturing solution: 472.64 g
of guanidine thiocyanate, 1.21 g of Tris–HCl, 0.37 g of
Na2EDTA, pH 8.0; lysis solution: 12.44 g of Tris–HCl, 7.44 g
of Na2EDTA, 5.84 g of NaCl, 20 g of SDS, pH 9.0.
3 Methods
3.1 RNA Extraction 1. This protocol was originally described in [15]. Ten different
Protocol 1 soil samples can be extracted contemporaneously. To each
2 mL RNase-free screw-cap tube add 0.5 g of acid-washed
glass beads (106 μm in diameter), 0.4 g of frozen soil and
350 μL of RNase-free water. Vortex mix to homogenize and
incubate immediately for 1 h at −80 °C (see Note 3).
2. To the still frozen tubes add in the following order: 34 μL of
20 % SDS, 167 μL of homogenized 3 % diatomaceous earth
and 583 μL of water-saturated phenol at pH 8.0.
3. Mix by shaking for 3 min at 1600 beats/min or 2.5 min at
2000 beats/min at room temperature using a bead-beater.
278 Rajiv K. Yadav et al.
3.2 RNA Extraction, 1. This protocol was originally described in [7] and [16]. Ten
Alternative Protocol 2 different soil samples can be extracted contemporaneously. To
each 2 mL RNase-free screw-cap tube quickly add in the fol-
lowing order: 0.5 g of 106 μm in diameter glass beads, 0.65 g
of frozen soil, 950 μL of a mix of so-called denaturing and lysis
Metatranscriptomics of Soil Eukaryotic Communities 279
Fig. 2 Electrophoretic separation of soil total RNA. RNA was size fractionated on
an Agilent Bioanalyser using a RNA 6000 nano kit. Soil rRNA small subunits (SSU)
usually form two discrete bands: the smallest most intense one presumably of
bacterial origin (16S), the largest and faintest one presumably of eukaryotic ori-
gin (18S). LSU large rRNA subunit (of both bacterial and eukaryotic origin)
3.3 Synthesis 1. The protocol described here uses the components of the
of First-Strand Mint-2 cDNA synthesis kit to synthesize eukaryotic cDNA
Eukaryotic cDNAs starting from their 3′ poly-A tails and to introduce SfiIA
from Total Soil RNA (GGCCATTACGGCC) and SfiIB (GGCCGCCTCGGCC)
restriction sites at their 5′ and 3′ ends respectively [17].
280 Rajiv K. Yadav et al.
3.5 cDNA Size 1. This protocol was originally described by Wellenreuther et al.
Fractionation by Two- [18]. Melt the 0.7 % (w:v) agarose in half-strength (0.5×) stan-
Dimensional Agarose dard Tris Borate EDTA (TBE) electrophoresis buffer. Cast two
Gel Electrophoresis identical agarose gels (i.e. identical volumes) without ethidium
bromide in two separate but identical electrophoresis trays.
Add identical volumes of 0.5× TBE buffer to each of the trays.
2. Mix 50 μL of previously synthesized ds cDNA (Subheading 3.4,
step 3) to 10 μL of loading buffer (see Note 12) and load in the
first well of one of the two gels. Load in the first well of the second
gel 10 μg of a DNA size marker (see Note 13). Connect both gel
trays to the same power supply and run both gels for the same
length of time at a low voltage (e.g. 3 V/cm). Stop the electro-
phoresis after the Orange G dye has run out of the gel that is
when the 0.1 kb DNA size marker reaches the near end of the gel.
3. Without staining the gels, using a scalpel blade and a ruler, cut
the gel lanes containing the cDNA and the DNA size marker.
Metatranscriptomics of Soil Eukaryotic Communities 281
Rotate the gel slices at 90° and place them at the upper end of
two separate but identical gel trays. Pour in each tray identical
volumes of 1.4 % low melting point agarose in 0.5× TBE buf-
fer, enough as to cover the slices. As in step 2 in Subheading 3.5,
connect both trays to the same power supply and run the gels
for the same time-span at a low voltage, as to allow the 0.1 kb
size marker to reach the near end of the gel.
4. Stain the gel containing the DNA size marker for 30 min in a
0.5 μg/mL ethidium bromide solution while leaving unstained
the gel containing the cDNAs. Soak the gel for 15 min in ster-
ilized water to remove excess ethidium bromide. Place the
DNA size marker-containing gel on a “Blue light transillumi-
nator” (see Note 1) and superimpose the cDNA gel over the
DNA marker gel. Using a scalpel blade, cut out from the upper
cDNA gel different pieces of agarose corresponding to differ-
ent cDNA size ranges (see Fig. 3a). Place the pieces of agarose
in 1.5 mL tubes. Extract the cDNA from the agarose gel using
a (commercial) gel extraction kit. Elute the cDNA in as little as
10 μL of elution buffer.
Fig. 3 cDNA size fractionation by two-dimensional agarose gel electrophoresis. (a) Separation of a DNA size
marker by two-dimensional agarose gel electrophoresis. The unstained gel containing the cDNA is superim-
posed to the DNA size maker gel placed on a blue-light transilluminator to cut out the different cDNA size
fractions. (b) Electrophoretic separation of three different PCR-amplified cDNA size fractions along a PCR-
amplified non-fractionated cDNA sample. (c) Electrophoretic separation of SfiI-digested samples of three sized
cDNA libraries, the large intense band corresponds to the linearized plasmid vector
282 Rajiv K. Yadav et al.
3.6 Amplification 1. As in Subheadings 3.3 and 3.4, this protocol makes use of
of the cDNA Size components of the Mint-2 cDNA synthesis kit. In a 0.2 mL
Fractions PCR tube, mix 36 μL of sterile RNase-free water, 5 μL of 10×
Encyclo buffer, 1 μL of 10 mM dNTP mix, 2 μL of 10 μM
PCR primer M1 (see Note 10), 5 μL of gel-eluted cDNA (from
Subheading 3.5, step 4), and 1 μL of 50× Encyclo DNA poly-
merase. Mix the components by gently pipetting up and down.
2. Place the tube in a thermal cycler and apply a PCR cycle com-
prising an initial denaturation at 95 °C for 1 min, x cycles of
95 °C for 15 s, 66 °C for 20 s, and 72 °C for y min. Number
of cycles (x) and extension time (y) must be adjusted for each
cDNA size fraction. As an example, we used (see ref. 17) x = 30
and y = 0.5 min for size fractions between 100 and 500 bp,
x = 26 and y = 1 min for size fractions between 500 and 1000 bp,
and x = 22 and y = 3 min for size fractions between 1000 and
3000 bp. Control the amplification and the success of the size
fragmentation by running 5 μL of the PCR reaction mix in a
1 % agarose gel (Fig. 3b).
3.7 cDNA Solution The aim of this protocol is to specifically select the different mem-
Hybrid Selection bers of a specific gene family among the numerous and diverse
Capture environmental cDNA sequences. This protocol, first reported in
[19], represents a specific use of the DNA hybrid selection capture
detailed in [13]. As for the first-strand cDNA synthesis (see
Subheading 3.3) and the second-strand cDNA synthesis and ampli-
fication (see Subheading 3.4), the protocol makes use of the Mint-2
cDNA synthesis kit.
1. Perform first-strand cDNA synthesis from 2 μg of total soil
RNA as described in Subheading 3.3. Proceed to second-
strand synthesis and cDNA amplification according to
Subheading 3.4 by using a number of PCR cycles allowing
recovery of μg amounts of cDNA (usually between 18 and 30
cycles depending on the RNA sample) (see Note 14).
2. Add 50 μL of water to 50 μL of amplified cDNA and perform
a phenol:chloroform:isoamyl alcohol extraction followed by a
chloroform:isoamyl alcohol extraction as described in step 3 in
Subheading 3.2. Transfer the upper aqueous-phase into a new
1.5 mL tube and add 0.1 volume of 3 M Na acetate pH 5.2;
1.3 μL of 20 mg/mL glycogen and 2.5 volume of cold
(−20 °C) pure ethanol. Incubate overnight at −20 °C and cen-
trifuge for 20 min at 18,000 × g and 4 °C. Remove the super-
nantant and wash the pellet with 100 μL of cold (−20 °C) 70 %
ethanol. Dry the pellet for 10 min at room temperature and
dissolve the cDNA in 10 μL of water. Quantify DNA by spec-
trophotometry at 260 nm.
3. Perform a first round of hybrid selection capture using 500 ng
of cDNA as described in steps 1–13 in Subheading 3.4 of
Metatranscriptomics of Soil Eukaryotic Communities 283
3.8 Cloning 1. Purify the amplified cDNA fractions by using a commercial kit
of the cDNA Size (e.g. Qiagen Qiaquick PCR purification kit) and separately
Fractions digest overnight the cDNA fractions and the cloning vector
(see Note 15) with the SfiI restriction enzyme at 50 °C.
2. Deactivate the enzyme by successive phenol:chloroform:isoamyl
alcohol and chloroform:isoamyl alcohol extractions. Precipitate
the DNA using 3 M Na acetate pH 4.8 and pure ethanol. Wash
the pellets with cold 70 % ethanol and resuspend in a small
volume (e.g. 20 μL) of water. Measure the concentration by
spectrophotometry at 260 nm.
3. Ligate each of the cDNA fractions to the vector using the T4
DNA ligase and an approximate insert to plasmid molar ratio
of 3:1 by following the instruction provided with the DNA
ligase enzyme.
4. Perform an initial small-scale transformation of E. coli cells (see
Note 16) using a small fraction of the ligation mix (5–10 %).
Spread serial dilutions of the transformation mix on plates
filled with a selective medium supplemented with the antibi-
otic corresponding to the plasmid antibiotic resistance gene.
Incubate at 37 °C overnight and count the colonies.
5. Amplify, by colony PCR, the cDNA inserts present in ca 20
bacterial colonies using PCR primers located on each side of
the plasmid cloning sites. Run the amplified products on a
1 % agarose gel to estimate the percentage of plasmids
devoid of inserts and the average size of the cloned cDNAs
(see Note 17).
284 Rajiv K. Yadav et al.
4 Notes
Acknowledgements
References
1. Rondon MR, August PR, Bettermann AD, 7. Bailly J, Fraissinet-Tachet L, Verner MC,
Brady SF, Grossman TH, Liles MR et al Debaud JC, Lemaire M, Wesolowski-Louvel
(2000) Cloning the soil metagenome: a strat- M, Marmeisse R (2007) Soil eukaryotic func-
egy for accessing the genetic and functional tional diversity, a metatranscriptomic approach.
diversity of uncultured microorganisms. Appl ISME J 1:632–642
Environ Microbiol 66:2541–2547 8. Damon C, Lehembre F, Oger-Desfeux C, Luis
2. Ferrer M, Beloqui A, Timmis KN, Golyshin P, Ranger J, Fraissinet-Tachet L, Marmeisse R
PN (2009) Metagenomics for mining new (2012) Metatranscriptomics reveals the diver-
genetic resources of microbial communities. sity of genes expressed by eukaryotes in forest
J Mol Microbiol Biotechnol 16:109–123 soils. PLoS One 7:e28967
3. Chistoserdova L (2010) Recent progress and 9. Damon C, Vallon L, Zimmermann S, Haider
new challenges in metagenomics for biotech- MZ, Galeote V, Dequin S et al (2011) A novel
nology. Biotechnol Lett 32:1351–1359 fungal family of oligopeptide transporters
4. He S, Wurtzel O, Singh K, Froula JL, Yilmaz identified by functional metatranscriptomics of
S, Tringe SG et al (2010) Validation of two soil eukaryotes. ISME J 5:1871–1880
ribosomal RNA removal methods for micro- 10. Lehembre F, Doillon D, David E, Perrotto S,
bial metatranscriptomics. Nat Methods 10:807– Baude J, Foulon J et al (2013) Soil metatran-
812 scriptomics for mining eukaryotic heavy metal
5. Stewart FJ, Ottesen EA, DeLong EF (2010) resistance genes. Environ Microbiol 15:2829–
Development and quantitative analyses of a 2840
universal rRNA-substraction protocol for 11. Kellner H, Luis P, Portetelle D, Vandenbol M
microbial metatranscriptomics. ISME J 4:896– (2011) Screening of a soil metatranscriptomic
907 library by functional complementation of
6. Grant S, Grant WD, Cowan DA, Jones BE, Saccharomyces cerevisiae mutants. Microbiol
Ma Y, Ventosa A, Heaphy S (2006) Res 166:360–368
Identification of eukaryotic open reading 12. Bragalini C, Ribière C, Parisot N, Vallon L,
frames in metagenomic cDNA libraries made Prudent E, Peyretaillade E et al (2014)
from environmental samples. Appl Environ Solution hybrid selection capture for the
Microbiol 72:135–143 recovery of functional full-length eukaryotic
Metatranscriptomics of Soil Eukaryotic Communities 287
cDNAs from complex environmental samples. the analysis of soil RNA. FEMS Microbiol Ecol
DNA Res 21:685–694 74:693–705
13. Ribière C, Beugnot R, Parisot N, Gasc C, 17. Yadav RK, Barbi F, Ziller A, Luis P, Marmeisse
Defois C, Denonfoux J et al (2015) Targeted R, Reddy MS, Fraissinet-Tachet L (2014)
gene capture by hybridization to illuminate Construction of sized eukaryotic cDNA librar-
ecosystem functioning, Methods in molecular ies using low input of total environmental meta-
biology. Springer, New York transcriptomic RNA. BMC Biotechnol 14:80
14. Zhu YY, Machleder EM, Chenchik A, Li R, 18. Wellenreuther R, Schupp I, Poustka A,
Siebert PD (2001) Reverse transcriptase tem- Wiemann S (2004) SMART amplification
plate switching: a SMART approach for full- combined with cDNA size fractionation in
length cDNA library construction. Biotechniques order to obtain large full-length clones. BMC
30:892–897 Genomics 5:36
15. Luis P, Kellner H, Martin F, Buscot F (2005) 19. Denonfoux J, Parisot N, Dugat-Bony E,
A molecular method to evaluate basidiomycete Biderre-Petit C, Boucher D, Morgavi DP et al
laccase gene expression in forest soils. (2013) Gene capture coupled to high-
Geoderma 128:18–27 throughput sequencing as a strategy for tar-
16. Damon C, Barroso G, Ferandon C, Ranger J, geted metagenome exploration DNA. DNA
Fraissinet-Tachet F, Marmeisse R (2010) Res 20:185–196
Performance of the COX1 gene as a marker for 20. Green MR, Sambrook J (2012) Molecular
the study of metabolically active Pezizomycotina cloning, a laboratory manual, vol 1, 4th edn.
and Agaricomycetes fungal communities from Cold Spring Harbor Laboratory, New York
Chapter 17
Abstract
The development of next-generation sequencing has led to a breakthrough in the analysis of ancient
genomes, and the subsequent genomic analyses of the skeletal remains of ancient humans have revolution-
ized the knowledge of the evolution of our species, including the discovery of a new hominin, and dem-
onstrated admixtures with more distantly related archaic populations such as Neandertals and Denisovans.
Moreover, it has also yielded novel insights into the evolution of ancient pathogens. The analysis of ancient
microbial genomes allows the study of their recent evolution, presently over the last several millennia.
These spectacular results have been attained despite the degradation of DNA after the death of the host,
which results in very short DNA molecules that become increasingly damaged, only low quantities of
which remain. The low quantity of ancient DNA molecules renders their analysis difficult and prone to
contamination with modern DNA molecules, in particular via contamination from the reagents used in
DNA purification and downstream analysis steps. Finally, the rare ancient molecules are diluted in environ-
mental DNA originating from the soil microorganisms that colonize bones and teeth. Thus, ancient skel-
etal remains can share DNA profiles with environmental samples and identifying ancient microbial genomes
among the more recent, presently poorly characterized, environmental microbiome is particularly chal-
lenging. Here, we describe the methods developed and/or in use in our laboratory to produce reliable and
reproducible paleogenomic results from ancient skeletal remains that can be used to identify the presence
of ancient microbiota.
Key words Ancient DNA, NGS, Double-stranded library, Single-stranded library, IonTorrent,
Illumina, Contamination
1 Introduction
Francis Martin and Stéphane Uroz (eds.), Microbial Environmental Genomics (MEG), Methods in Molecular Biology, vol. 1399,
DOI 10.1007/978-1-4939-3369-3_17, © Springer Science+Business Media New York 2016
289
290 Olivier Gorgé et al.
Fig. 2 Qiavac Manifold equipped with Qiaquick Spin columns and extenders to
purify DNA from large-volume extracts
and possibly up to the first several years, after death, DNA is hydro-
lyzed enzymatically into small fragments leading to a median size of
50–70 bp (Guimaraes et al., unpublished) [3]. Over time, DNA
bases become modified; in particular the cytosines become deami-
nated, which occurs preferentially close to the molecule ends [4].
The quantity of endogenous aDNA varies among samples, and even
in different locations in the same skeletal remains. Although there
may be other factors, temperature in particular has been character-
ized as playing a major role in aDNA preservation [5].
In order to study the genomes of pathogens that are associ-
ated with an animal (vertebrate) at the time of its death, one must
consider all the events taking place during the diagenetic transfor-
mation of biomolecules, including DNA, following death. The
body and its constituents will begin to decompose, mostly due to
the action of microorganisms and insects. They not only metabo-
lize biomolecules, but also deposit their own DNA, becoming the
first contaminants of skeletal remains. Once the soft tissues and
accessible organic parts of the bones have been consumed, the
skeletal parts will enter a slow decay phase involving mostly chem-
ical processes. When bones are buried, either intentionally at the
time of death or simply due to natural burial of the skeleton over
time, there will be a slow but regular exchange of biomolecules
between bone and soil. Thus, at the time of excavation, the DNA
that can be recovered may contain (1) DNA from the initial organ-
ism; (2) the DNA of the microbes, as well as parasites, that were
associated with the organism during its lifetime (some of which
may possibly have been the cause of its death); (3) the DNA of the
organisms that have contributed to the decomposition of the body
following its death; (4) and the DNA of the soil organisms that
have penetrated into the bone. If at the time of excavation no
special precautions are taken, and the bones are handled and
washed as is routinely done, the bone can be further contaminated
with fresh modern DNA, mostly of human and microbial origin,
as well as from various other sources. The microbial composition
of skeletal remains therefore reflects the microbial composition of
the burial environment, showing that fossilizing skeletal remains
resemble environmental samples. Indeed, when DNA retrieved
from ancient bones is sequenced with a shotgun approach, typi-
cally only a few percent, or tenths of percent, of the sequenced
DNA correspond to the initial organism, the rest being identified
as “environmental DNA.” Most of this “environmental DNA”
cannot be mapped to sequenced genomes, and remains as
“unknown” [6]. Since older DNA is increasingly degraded until
complete disappearance, one could expect that most of the envi-
ronmental DNA recovered from the skeletal remains is of recent
origin. The DNA decay rate depends on the environment; how-
ever, special “molecular niches” within the bone may offer more
protected DNA-stabilizing microenvironments [7–9]. This can
explain the exceptional preservation found in a limited number of
292 Olivier Gorgé et al.
2 Materials
2.1 DNA Extraction Prepare all solutions from autoclaved deionized water. We use
Reagents household bleach (2.6 % sodium hypochlorite) and RNase away
(Life Technologies, Carlsbad, CA, USA) as agents for decontami-
nation and DNA removal.
1. Commercial soil extraction and purification kits are used, but
the reagents are only opened in the high-containment labora-
tory, under controlled conditions to avoid contamination. We
currently use MoBio PowerMax Soil DNA Isolation kit (MO
294 Olivier Gorgé et al.
2.2 qPCR Reagents 1. MixG (homemade qPCR mix) [23]: To prepare 100 μL of 10×
mixG, mix 19.5 μL γ-irradiated water (see Note 1), 6.25 μL 10
mg/mL bovine or horse serum albumin (BSA or HSA), 3 μL
10 % Lubrol-17A17 (SERVA Electrophoresis GmbH,
Heidelberg, Germany), 50 μL 50 % glycerol, 1.25 μL 5 M KCl,
and 20 μL 2.5 M AMPD (2-amino-2-methyl-1,3-propanediol)
pH 8.3 (see Note 2). For volumes higher than 200 μL, aliquot
200 μL each in UV-transparent tubes (Qubit Assay tubes, Life
Technologies, ref. Q32856) and treat with UV (see Note 3),
dilute 10,000× SYBR-Green I (Life Technologies, ref. S-7585)
1/40 in DMSO and add 1 μL diluted SYBR-Green I per 100 μL
mix. Freeze overnight at −80 °C (see Note 4).
2. BIOTEC buffer: To prepare 10 mL BIOTEC buffer, mix 200
μL 1 M Tris–HCl pH 7.5, 800 μL 25 mM MgCl2, 20 μL 5 M
NaCl, 5 mL 50 % glycerol, 10 μL 10 % Triton x100, complete
to 10 mL with γ-irradiated water. Aliquot 540 μL each in UV-
transparent tubes, UV irradiate 300 s on each side on a UV
cross-linker (see Note 3).
3. Thermolabile double-strand DNase (2 u/μL hl-dsDNase)
from ArcticZymes (Tromsø, Norway, ref. #70800). For a final
activity of 0.02 u/μL, add 1 μL 2 u/μL of hl-dsDNase to 99
μL of BIOTEC buffer.
4. Decontaminated Taq DNA polymerase: 108 μL of 5 u/μL
Hot Start Taq polymerase in its storage buffer is supplemented
with 6 μL premixed 200 mM MgCl2, 20 mM CaCl2, and 2.45
μL 50 mM DTT, then incubated with 6 μL 2 u/μL hl-dsDN-
ase for 30 min at 25 °C followed by a 20-min inactivation step
at 50 °C. Aliquot to desired volumes. Final activity of decon-
taminated Taq is 4.4 u/μL.
5. Decontaminated dNTPs: 20 μL of dATP, dCTP, dGTP, and
40 μL of dUTP (100 mM stock solutions each) are mixed with
100 μL of γ-irradiated water. 40 μL of this dNTP mix is mixed
with 35 μL γ-irradiated water, 4 μL 50 mM DTT, 20 μL 250
Ancient DNA in Microbial Ecology 295
2.4 Double-Stranded Use γ-irradiated water for all solutions and buffer preparations as
DNA Library well as for any dilution or elution steps (unless otherwise indicated)
Preparation (see Note 1).
1
Appendix E, p. 56–57, Publication Part Number MAN0009847; Revision
C.0 Date 29 April 2014.
296 Olivier Gorgé et al.
2.5 Single-Stranded Use γ-irradiated water for all solutions and buffer preparations as
DNA Library well as for any dilution or elution steps (unless indicated other-
Preparation wise) (see Note 1).
1. Oligos (see Note 10)
(a) 10× Annealing buffer UV-irradiated (see Note 3)
(b) 40 μM Annealed CL53/CL73 adapters (see Note 6)
2. DNA preparation
(a) 100 u/μL Circligase II ssDNA ligase with 10× Circligase
buffer and 50 mM MnCl2 solution (Epicentre, Chicago,
IL, USA, ref. CL902)
(b) 10 u/μL Endonuclease VIII (NEB, ref. M0299)
(c) 1 u/μL codUNG from ArticZymes (optional)
(d) 1 u/μL FastAP (Thermo Scientific, Waltham, MA, USA,
ref. EF065), a thermosensitive alkaline phosphatase
3. First adapter ligation
(a) 50 % PEG 4000 (Sigma-Aldrich, St. Louis, MO, USA, ref.
95904)
(b) Dynabeads MyOne Streptavidin C1 (Life Technologies,
ref. 6500)
(c) Bead binding buffer: 1 M NaCl, 10 mM Tris–HCl pH
8.0, 1 mM EDTA pH 8.0, 0.05 % Tween-20, 0.5 %
SDS. Prepare buffer just before use and discard immedi-
ately. Buffer has no shelf life after adding SDS.
(d) Wash buffer A: 100 mM NaCl, 10 mM Tris–HCl pH 8.0,
1 mM EDTA pH 8.0, 0.05 % Tween-20, 0.5 % SDS. Can
be stored at room temperature for a month.
(e) Wash buffer B: 100 mM NaCl, 10 mM Tris–HCl pH 8.0,
1 mM EDTA pH 8.0, 0.05 % Tween-20. Can be stored at
room temperature for a year.
(f) Stringency wash buffer: 0.1× SSC, 0.1 % SDS. Can be
stored at room temperature for a month.
(g) 10× ThermoPol Buffer (NEB, ref. B9004)
(h) Bst 2.0 DNA Polymerase (NEB ref. M0537)
(i) 10× Tango buffer (Thermo Scientific, Waltham, MA,
USA, ref. BY5)
(j) 1 % Tween-20 (Sigma-Aldrich, St. Louis, MO, USA, ref.
P2287)
(k) T4 DNA polymerase (Thermo Scientific, ref. EP006)
(l) Stop solution: 0.5 M EDTA pH 8.0, 2 % Tween-20
298 Olivier Gorgé et al.
(a) Decontaminate the hood and all tools with pure household
bleach (use RNAse away for decontaminating metal tools).
(b) Cover the base of the working station with a sheet of alu-
minum foil.
(c) Remove the outer layer of the sample with a scalpel. Use a
new scalpel for each sample, and discard used scalpels.
(d) Set up and turn on a vacuum cleaner during cutting to pre-
vent the dispersal of bone powder in the working station.
(e) Sample preparation in a freezer mill:
● Use a Dremel multitool equipped with a diamond cut-
ting wheel to cut pieces (up to 200 mg), adjusting the
speed to the density/mineralization of the bone.
Decontaminate the cutting wheel using the medium
flame of a Bunsen burner at around 500 °C, but not
above, to avoid damaging the diamond wheel.
● Weigh the bone fragment(s) and pulverize it in a freezer
mill in liquid nitrogen for 1 min (10 impacts per second).
● After transferring the powder to a clean tube, clean
freezer mill tubes. Metal parts: remove remaining bone
powder in a bath of RNase away, rinse in a water bath,
and dry under UV light. Plastic tubes: brush with water
to remove remaining bone powder, rinse in a bleach
bath, then with water and let them dry overnight on
clean aluminum foil. Do not expose to UV light.
(f) Sample preparation using a drill
● Depending on the density of the bone, its shape, and
the location of the sampling area, various drill bits can
be chosen according to the user’s needs. Assemble and
decontaminate the drill bit using the medium flame of
a Bunsen burner (ca. 500 °C). Drill at the lowest speed
possible giving efficient bone powder production.
● Transfer the bone powder in a pre-weighed tube and
weigh it.
(g) Cleaning
● Between preparations of each sample, change the alumi-
num foil, clean the working station with bleach, and
change gloves. Flame the drill bit or the cutting wheel
using the medium flame of a Bunsen burner (ca. 500 °C).
● After completion of the preparation series, decontami-
nate the Dremel tool with 70 % ethanol and RNase
away (not bleach), and flame the drill bit or the cutting
wheel using the medium flame of a Bunsen burner (ca.
500 °C). Clean and decontaminate with bleach the
working station and the vacuum cleaner, place a UV
Ancient DNA in Microbial Ecology 301
3.2 DNA 1. To test whether the DNA extracts from the ancient bone sam-
Amplification ples inhibit the PCR (see Note 20), serial dilutions of the
extracts spiked with a known quantity of positive internal con-
trol are amplified [24]. Subsequently, the Ct (crossing point at
threshold) is analyzed for each serial dilution of the same sam-
ple. We dilute the extract two- and fourfold at the highest, con-
sidering that further dilution of ancient DNA extracts potentially
containing only few molecules could cause the loss of targets.
2. For DNA amplification (see Note 21), we systematically use a
home-made decontaminated qPCR mix (mixG). Endogenous
DNA detection relies on the amplification of DNA fragments
that are informative enough to discriminate between animals
or, for bacteria, between phyla, classes, orders, genera, or even
species depending on the targeted genes. To assess bacterial
diversity, the 16S rRNA gene is a powerful tool, thanks to its
ubiquity and structure, which make it an optimal marker for
the characterization of environmental samples (see Note 22).
Amplification is performed with a LightCycler 2.0 (Roche
Applied Sciences). Prepare a PCR mix using 1 μL of DNA
extract, 1 μL of mixG, 1 mM MgCl2, 1 μM each of primer, 0.01
u of codUNG, 200 μM dNTPs (with dUTP in place of dTTP),
0.1 u of Taq, and complete to 10 μL with γ-irradiated water.
Hybridization times and temperatures are primer dependent
and elongation times are defined according to user’s needs.
3. With qPCR, amplification is reported by fluorescence emission
of SYBR Green I intercalated in double-strand DNA. Non-
specific products, which are sometimes synthetized during
qPCR and are mainly primer-dimers, also lead to fluorescence
302 Olivier Gorgé et al.
3.3 Library 1. For each sample, mix 20 μL of PCR product (diluted if neces-
Preparation for PCR sary—see Note 23), 5 μL of 10× enzyme buffer, 0.1 μL of end
Products repair enzyme, and 24.9 μL of γ-irradiated water. Gently pipet
the total volume up and down 1–2 times to mix and incubate
for 30 min at 25 °C (see Note 24).
2. Purify end-repaired products using a 96-well plate system (for
high-throughput) or in tubes by magnetic beads or silica col-
umns according to the manufacturer’s instructions (see Note
25). The final elution volume is usually 50 μL. Samples may be
frozen at −20 °C at this point.
3. In a 96-well plate, add 1 μL of a different barcoded adapter
mix (A + P1) combination to each well to be used. Distribute a
premix composed of 6 μL of 5× ligation buffer, 1 μL of Quick
ligase, and 2 μL of γ-irradiated water to each well and add 20
μL of each purified end-repaired sample (see Note 26). Gently
pipet up and down 1–2 times to mix and incubate for 30 min
at 16 °C.
4. Immediately after the ligation, add binding buffer to each well
according to the manufacturer’s recommendation (60 μL of
NT buffer, Macherey-Nagel), mix well, and pool all samples
before loading on a silica column. The binding, washing, and
drying steps are performed as recommended. Elute in a vol-
ume between 30 and 50 μL. Samples may be frozen at −20 °C
at this point.
5. Use an electrophoresis system for DNA sizing and purification
to size-select your library and eliminate adapter dimers or multi-
mers of amplicons. We use the E-Gel SizeSelect or the Caliper
Labchip XT depending on the size range of amplicon size
Ancient DNA in Microbial Ecology 303
(see Note 27). To determine the size range to select, add the
length of the two adapters (85–87 bp depending on the bar-
code length, see Note 5) to your minimal and maximal ampli-
con size.
6. Nick repair and amplification are made sequentially with the
same reaction mix (see Note 28). Add 8 μL of size-selected
sample, 1 μL of 10 μM Primer A, 1 μL of 10 μM Primer P1,
and 10 μL of 2× OneTaq Hot Start Master Mix with buffer.
Gently pipet up and down 1–2 times to mix, incubate for
20 min at 68 °C (nick repair step), and then amplify the library
using the following program: initial denaturation at 94 °C for
5 min (94 °C for 15 s, 60 °C for 15 s, 68 °C for 40 s) for six
cycles, final elongation at 68 °C for 5 min (see Note 29).
7. Purify the amplified libraries with a silica column or SPRI mag-
netic beads. Final elution volume is usually 30 μL. Samples may
be frozen at −20 °C at this point.
8. Qualitative analysis on a Bioanalyzer is recommended to check
the final library product (see Note 30). Products saved at inter-
mediate steps (sizing and amplification) can also be run on the
same chip and compared. Libraries are quantified using a Qubit
2.0 to determine the concentration and adapt it to the emul-
sion PCR for IonTorrent PGM sequencing. A qPCR is also
recommended to compare the new library to a known refer-
ence to ensure that the Qubit measurement corresponds to
samples ligated with the two adapters.
9. Follow the manufacturer’s recommendations to prepare the
chip for sequencing. Depending on the heterogeneity of the
PCR product(s) and the number of samples analyzed, either
314, 316, or 318 chips (V2) can be used.
3.5 Single-Stranded Prepare all enzymatic mixes prior to each step to avoid letting the
DNA Library beads dry between steps.
Preparation
1. Dilute the purified DNA extract (between 1 fmol and 1 pmol
of DNA) with γ-irradiated water to a final volume of 29 μL (see
Note 34).
2. To optimize damaged DNA recovery prior to library prepara-
tion, add 29 μL of diluted DNA extract, 8 μL of 10× Circligase
buffer, 4 μL of 50 mM MnCl2, and 0.5 μL 10 u/μL
Endonuclease VIII to a 1.5 mL tube and incubate for 1 h at 37
°C (see Note 35).
3. Add 1 u of FastAP to the above reaction and mix. Spin briefly
and incubate for 10 min at 37 °C. Incubate the reaction for
2 min at 95 °C to heat denature the DNA, then transfer tube
to an ice-water bath, and leave for 1 min. Spin briefly.
4. To ligate the first adapter
(a) Add 32 μL 50 % PEG-4000, 1 μL 10 μM adapter oligo
CL78, and 1 μL 100 u/μL Circligase II. Incubate tube for
1.5–3 h at 60 °C. Samples may be frozen safely at −20 °C at
this point.
(b) For each sample, transfer 20 μL of MyOne C1 dynabeads
into a 1.5 mL tube. Use additional tubes for more than
five samples. Wash beads by placing tube on a magnetic
rack for 2 min. Discard supernatant and wash beads twice
with 500 μL bead binding buffer (see Note 36).
306 Olivier Gorgé et al.
4 Notes
13. Many techniques exist to extract DNA from soil. Authors pro-
pose different buffers, but the general purpose is to homoge-
nize and lyse the soil in a liquid buffer mechanically (Precellys,
MoBio homogenizer, etc.) or using chemicals (SDS, NLS,
etc.) while limiting the interactions between DNA and soil
particles using a buffer of high ionic strength (such as NaCl
1.5 M). Different DNA extraction techniques have been found
to modify the representation of bacterial populations [29, 30].
14. We use MoBio PowerSoil to obtain the least variable results
and to be able to perform comparisons from one extract to
another, since the various DNA purification protocols extract
different bacterial populations [26].
15. Buffers usually pass through the column in a few minutes.
With a vacuum pump capable of producing a vacuum of −800
to −900 mbar, buffers pass through the column in 5–10 min.
Clogging of the silica membrane by particles remaining in the
sample can sometimes occur during the DNA binding step.
When this occurs, the remaining sample can be passed through
one or more fresh columns and combined after elution. If
clogging continues to occur, columns can be centrifuged mul-
tiple times (10,000 × g usually for 1 min) using 700 μL of buf-
fer per centrifugation.
16. For maximal recovery, elution can be performed using 2× 75
μL preheated (50 °C) EB as follows:
(a) Load spin columns with 75 μL preheated EB and incubate
for 2 min.
(b) Centrifuge for 1 min at 12,500 × g.
(c) Load spin columns with 75 μL preheated EB and incubate
for 1 min in the thermo-block at 50 °C.
(d) Centrifuge for 2 min at 12,500 × g.
(e) Pool the eluates and store at −20 °C.
17. The situation is more complicated since the skeletal remains
are chemically not homogeneous but rather consist of multiple
chemical microenvironments, each with its specific chemistry,
in which DNA preservation can be variable.
18. Since there is no specific lysis procedure to open up microbial
cells, it is likely that the DNA recovery from live microbial cells
is low.
19. A complete overview of the process can be seen in a movie,
available at http://www.univ-paris-diderot.fr/Mediatheque/
spip.php?article246&var_mode=calcul, especially after the sev-
enth minute.
20. In environmental samples, many soil compounds can interfere
with molecular techniques used downstream, such as humic
and fulvic substances.
312 Olivier Gorgé et al.
21. The 16S rRNA gene includes both conserved regions, which
can be used for designing amplification primers across taxa,
and nine hypervariable regions (V1–V9), which can be
effectively used to discriminate between taxa [27]. Nearly
every hypervariable region or combination thereof has been
studied. Owing to the short size of DNA fragments in degraded
ancient samples, we selected V5 (28 bp long in Escherichia
coli). Among published primers, we selected the pair providing
the best coverage according to SILVA TestPrime and SILVA
SSU refNR r114 [28]. We selected a forward primer (E786F)
from Baker et al. [29] and a reverse primer (926r) from
Watanabe et al. [30], the pair producing a 141 bp long frag-
ment [29].
22. To prevent carry-over contamination, we systematically use
dUTP instead of dTTP in qPCR mixes [31]. Incorporation of
dUTP during PCR allows for elimination of amplicons from
previous PCR steps when incubation with uracil-N-glycosylase
(UNG) precedes each PCR. We selected codUNG from
ArcticZymes (Tromsø, Norway) for its enhanced thermolabil-
ity and high efficiency [18].
23. 20 pmol of adapters are present in subsequent preparation
steps and must be in excess with respect to PCR products. A
maximum amount of 5 pmol of amplicon products is recom-
mended per sample.
24. This step will create blunt-ended 5′ phosphorylated DNA
using two enzymes: T4 DNA polymerase and T4 polynucleo-
tide kinase. T4 DNA polymerase fills in 5′-protruding ends
and removes 3′-protruding ends, thus producing blunt ends.
T4 polynucleotide kinase phosphorylates the 5′-ends of DNA.
25. We use a TECAN EVO 100 and NucleoSpin 96 PCR clean-up
(Macherey-Nagel ref. 740658) to achieve automated 96-well
purification.
26. This step ensures ligation of DNA fragments with adapters. We
use Quick Ligase to increase the ligation reaction and reduce
incubation time.
27. E-Gel is preferred when amplicons have similar sizes (within
about 50 bp) whereas the Caliper XT is better suited when the
amplicon sizes are more heterogeneous.
28. This step allows the removal of the small fragment of the adapt-
ers and the fill-in of the 3′-protruding end of the ligated
adapter. We use OneTaq from NEB, a blend of Taq and Deep
VentR™ DNA Polymerases.
29. Save 1 μL for bioanalyzer analysis if desired.
30. If libraries are amplified beyond the point at which PCR starts
saturating, multimers of PCR products may form due to the
Ancient DNA in Microbial Ecology 313
36. To wash beads, twist tube three turns while seated in the mag-
netic rack.
37. For example, if preparing three samples, resuspend beads in
750 μL.
Acknowledgments
References
1. Pruvost M, Schwarz R, Correia VB, Champlot 10. Meyer M, Kircher M, Gansauge MT, Li H,
S, Braguier S, Morel N et al (2007) Freshly Racimo F, Mallick S et al (2012) A high-
excavated fossil bones are best for amplification coverage genome sequence from an archaic
of ancient DNA. Proc Natl Acad Sci U S A Denisovan individual. Science 338:222–226
104:739–744 11. Orlando L, Ginolhac A, Zhang G, Froese D,
2. Fortea J, de la Rasilla M, Garcia-Tabernero A, Albrechtsen A, Stiller M et al (2013)
Gigli E, Rosas A, Lalueza-Fox C (2008) Recalibrating Equus evolution using the
Excavation protocol of bone remains for genome sequence of an early Middle
Neandertal DNA analysis in El Sidron Cave Pleistocene horse. Nature 499:74–78
(Asturias, Spain). J Hum Evol 55:353–357 12. Prufer K, Racimo F, Patterson N, Jay F,
3. Sawyer S, Krause J, Guschanski K, Savolainen Sankararaman S, Sawyer S et al (2014) The
V, Paabo S (2012) Temporal patterns of nucle- complete genome sequence of a Neanderthal
otide misincorporations and DNA fragmenta- from the Altai Mountains. Nature 505:43–49
tion in ancient DNA. PLoS One 7:e34131 13. Reich D, Green RE, Kircher M, Krause J,
4. Briggs AW, Stenzel U, Johnson PL, Green RE, Patterson N, Durand EY et al (2010) Genetic
Kelso J, Prufer K et al (2007) Patterns of dam- history of an archaic hominin group from
age in genomic DNA sequences from a Denisova Cave in Siberia. Nature
Neandertal. Proc Natl Acad Sci U S A 468:1053–1060
104:14616–14621 14. Bos KI, Harkins KM, Herbig A, Coscolla M,
5. Smith CI, Chamberlain AT, Riley MS, Cooper Weber N, Comas I et al (2014) Pre-Columbian
A, Stringer CB, Collins MJ (2001) Neanderthal mycobacterial genomes reveal seals as a source
DNA. Not just old but old and cold? Nature of New World human tuberculosis. Nature
410:771–772 514:494–497
6. Noonan JP, Hofreiter M, Smith D, Priest JR, 15. Bos KI, Schuenemann VJ, Golding GB,
Rohland N, Rabeder G et al (2005) Genomic Burbano HA, Waglechner N, Coombes BK
sequencing of Pleistocene cave bears. Science et al (2011) A draft genome of Yersinia pestis
309:597–599 from victims of the Black Death. Nature
7. Geigl EM (2002) On the circumstances sur- 478:506–510
rounding the preservation and analysis of very 16. Schuenemann VJ, Singh P, Mendum TA,
old DNA. Archaeometry 44:337–342 Krause-Kyora B, Jager G, Bos KI et al (2013)
8. Geigl EM (2005) Why ancient DNA research Genome-wide comparison of medieval and
needs taphonomy. In: O’Connor T (ed) modern Mycobacterium leprae. Science
Biosphere to lithosphere, new studies in verte- 341:179–183
brate taphonomy. Oxbow Books, Oxford, 17. Warinner C, Rodrigues JF, Vyas R, Trachsel C,
pp 79–86 Shved N, Grossmann J et al (2014) Pathogens
9. Salamon M, Tuross N, Arensburg B, Weiner S and host immunity in the ancient human oral
(2005) Relatively well preserved DNA is pres- cavity. Nat Genet 46:336–344
ent in the crystal aggregates of fossil bones. 18. Champlot S, Berthelot C, Pruvost M, Bennett
Proc Natl Acad Sci U S A 102:13783–13788 EA, Grange T, Geigl EM (2010) An efficient
Ancient DNA in Microbial Ecology 315
Francis Martin and Stéphane Uroz (eds.), Microbial Environmental Genomics (MEG), Methods in Molecular Biology, vol. 1399,
DOI 10.1007/978-1-4939-3369-3, © Springer Science+Business Media New York 2016
317
MICROBIAL ENVIRONMENTAL GENOMICS (MEG)
318 Index
Plasmids ..................................... 15, 44, 45, 50, 51, 104, 106, from soil samples ..........................................................13
111, 258, 276, 283, 285, 286 from water samples .................................................12, 13
preparation.................................................. 105, 113–114 RNase ............................................. 7, 10, 11, 17, 33, 42, 153,
Platform ..................................... 17, 137, 191, 200, 227, 249, 161, 164, 277, 278, 280, 284, 293, 296, 300
270, 284, 298, 302 RT-PCR ..................................................91, 94, 99, 154, 158
Polyadenylated mRNA
Polymerase chain reaction (PCR) S
amplification ................................. 47, 64, 65, 94, 97, 103, Saccharomyces cerevisiae ................................................ 91, 285
116, 145, 280, 284, 285 Sample identification tag sequences ...................................69
optimization ...........................................................75–77 Sampling sediment ........................................9, 10, 12, 13, 25
protocols .....................................................................106 Sampling soil ................................ 10, 12, 13, 56, 59, 97, 126,
Preservation 128, 131, 134, 142, 144, 145, 147, 195, 275,
for single cell genomics .................................................10 277–279
sediment samples ..........................................................10 Sampling water ......................................................... 9–12, 23
soil samples ...................................................................10 Sanger sequencing .........................16–17, 106–107, 114, 302
water samples............................................................9, 10 Screening ............................................91, 126, 212, 229, 236,
Primer design ...........................................................202–204 249, 258–260, 262, 263, 266–267, 270
Probes ....................................... 35, 46, 48, 51, 168, 172–175, Sediment .............................................4, 9, 10, 241, 269, 293
177, 180, 181, 184–186, 188, 189, 191, 195, 267 SEED subsystems............................................. 210, 214, 222
Prokaryote .................................................................. 70, 268 Sequence analysis
Proteinase K .................................... 6, 11, 33, 35, 42, 46, 261 assembly..................................................................18–19
Protein coding genes ........................................................219 functional analysis............................................... 213, 222
Protein identification ........................................................213 gene detection.........................................................19–20
Protists.............................................................. 125–137, 274 phylogenetic analysis ....................................................21
Protozoa phylogenomic analysis ............................................20, 21
Pulsed-field electrophoresis system (PFGE) ............ 261, 265 quality control ...............................................................18
statistics .......................................................... 19–20, 220
Q
Sequence capture
qPCR. See Quantitative real-time PCR (qPCR) Sequencing 454/Roche .....................................................200
QTrays ...............................................262, 263, 266, 267, 270 Sequencing illumina ........................................... 17, 308, 309
Quality control (of sequence data) ......................................18 Sequencing sanger .........................16–17, 106–107, 114, 302
Quantitative real-time PCR (qPCR) .................... 35, 45, 50, Sexual reproduction .................................................... 62, 142
51, 65, 85, 99, 156, 162, 163, 198, 204, 294, 295, Shotgun libraries large-insert size ......................................15
298, 301, 303, 304, 308, 313 Shotgun libraries small-insert size ......................................14
SHS. See Solution hybrid selection (SHS)
R Single-cell genomics ................................................... 3, 4, 15
Rarefaction ............................................... 137, 221, 223–225 Single-stranded DNA .......................187, 293, 297, 305–308
Real-time quantitative PCR (qPCR) ..................... 30, 44–45 Small subunit rDNA ................................................ 101, 279
Replicating .......................................................................263 SIP. See Stable isotope probing (SIP)
Réseau de mesures de la qualité des sols 16S rRNA .......................................... 11, 16, 24, 30, 50, 191,
(RMQS) .....................................................57, 59 239, 245, 248, 293, 301, 312
Restriction fragment length polymorphism Software ............................................. 22, 35, 45, 79, 84, 106,
(RFLP) ................................................... 105, 112 114, 115, 117, 118, 133, 168, 185, 191, 208, 210,
Reverse transcription .....................91, 97, 155, 162, 280, 285 240, 248, 253
Ribonucleic acid (RNA) ........................... 211, 215, 219, 220 Soil
Ribosomal RNA (rRNA) genes............................. 20, 24, 62, DNA extraction ..................................................129–131
101, 102, 153, 168, 211, 213, 215, 220, 236, 237, fungi ..................................................................... 29, 141
245, 248, 249, 252, 253, 273, 274, 278, 284 microbiome .........................................................197–206
annotation sampling ......................................... 10, 12, 13, 56, 59, 97,
clustering ....................................................................215 126, 128, 131, 134, 142, 144, 145, 147, 195, 275,
detection .....................................................................215 277–279
identification...............................................................215 Solution hybrid selection (SHS) ....................... 168, 282–283
RNA purification Species identification ..........................................................62
from sediment samples .................................................13 Spore propagation ........................................................30, 37
MICROBIAL ENVIRONMENTAL GENOMICS (MEG)
Index
321
Stable isotope probing (SIP) ................................. 90–94, 98, Transmission electron microscopy .......................... 32–33, 40
151–166, 198, 236, 237, 243, 246 Truffle.......................................................................141–149
Structure ......................................... 22, 40, 56, 128, 141, 142, Tuber melanosporum ..........................................................141
145, 168, 184, 193, 198, 205, 207–232, 275, 301
Substrates ............................................. 37, 62, 63, 69, 73, 83, U
90, 91, 98, 151, 153, 154, 237, 240, 241, 246, 248, Ultracentrifugation ...............................94, 99, 157, 159–160,
259, 260, 262, 266, 269, 270 237, 243–246, 250, 251
Symbionts ........................................................... 30, 153, 156 Unculturable bacteria....................................................30, 50
Symbiosis..........................................................................141
W
T
Water samples .......................................................... 9, 10, 23
Taphonomy ......................................................................292 Whole community genome amplification ........................185
Targets .......................................... 44, 45, 50, 51, 83, 93, 106, Whole genome shotgun sequencing ................. 208, 210, 211
128, 132, 136, 156, 186, 188, 203, 240, 245, 293,
301, 302 X
Taxonomic annotation ............... 118, 213, 214, 221, 222, 225
X-oligosacccharides ..........................................................263
Taxonomic content
Taxonomic resolution ................................. 62, 132–134, 208 Y
Templiphi 500 amplification kit ............................... 185, 187
Traceability .........................................................................56 Yeast ......................................................8, 105, 262, 276, 279