Identifying Unknown Bacteria Using
Identifying Unknown Bacteria Using
Credits: This lab was created by Robert Kranz, Kathleen Weston-Hafer, and Eric Richards. The lab was developed and written by Kathleen Weston-Hafer. Specific protocols were optimized by Kathleen Weston-Hafer and Wilhelm Cruz. This document was written and assembled by April Bednarski. Funding: This work was funded in part by a Professorship Award to Washington University in support of Sarah C.R. Elgin from Howard Hughes Medical Institute (HHMI) Correspondence: April Bednarski: [email protected]
Instructor Pages
- -
Purpose
The purpose of this lab is to introduce a variety of lab techniques to students working on the common problem of identifying an unknown bacterium. This lab helps students develop an understanding of the biochemical and molecular differences in bacteria and introduces the concept of identifying species based on characeristic gene sequences. Students work through two types of identification procedures, one classical and one involving DNA sequencing, then compare the results of the two methods.
Educational Context
The lab was created to accompany lecture topics in bacterial genetics and biochemistry. The main topics covered in lecture that relate to this lab are prokaryotic replication, transcription, and translation, enzyme function, and cellular respiration. This lab was tailored for second semester freshmen who are in their first semester of a three-semester introductory biology course. The first semester focuses on molecular biology, bacterial genetics, and introductory biochemistry. This lab was designed for 500 students split into lab sections of 20. However, this curriculum is easily adaptable to accommodate any number of students. In this lab, students identify an unknown bacteria using a biochemical method and a molecular method. For the biochemical method, students use a combination of differential growth tests and enzyme tests developed for clinical use. For the molecular method, students PCR amplify and sequence the 16S rRNA gene from their bacteria, then use BLAST to search the bacterial database and identify the species that most closely matches their sequence results for this gene.
Summary
This section contains a brief summary of the exercises contained in this lab. More thorough discussion of the materials follow in the General Materials section. The detailed protocol for each exercise is in the Student Section. Unknown bacteria are first collected by swabbing surfaces around and near the lab, then streaked on sterile LB agar plates and grown overnight in an incubator. A different unknown number is given to each place bacteria are collected. Students then use these plates to make their own unknown plate by streaking for single colonies. In the first step in the biochemical identification, students use a single colony to streak an EMB-lactose agar plate to determine if their unknown is gram positive or gram negative. The EMB dye will enter the gram positive bacteria and inhibit growth, but gram negative bacteria are protected by their enhanced cell wall and will be able to grow on these plates. If any students are working with a gram positive unknown, they pair up with a student with a gram negative unknown since the following methods in this lab were developed for gram Instructor Pages - 3
negative bacteria only. In the next step, students determine if their bacteria are positive for cytochrome c oxidase. In this test, the students are using dry oxidase test slides and pipet a small amount of their unknown from a liquid culture. If the bacteria contain the enzyme, then a substrate of this enzyme on the slide will be converted to a purple product and a spot will appear. The results of this oxidase test determine if students use an Enterotube or an Oxi/Ferm tube in the next step. These tubes were developed for clinical use to identify bacteria. They contain thirteen compartments, each with a different type of media, which will test for the presence of a different enzyme or set of enzymes in the unknown bacteria. Students innoculate the compartments with their unknown bacteria and place the tubes in the 37C incubator. After overnight incubation, students examine each compartment to determine the color of the media and look for gas production. Students compare the color of the compartments with a reference guide to determine if the color indicates a positive or negative result for the presence of that particular enzyme(s). Each positive result is used in generating a five-digit number. This five-digit number, or biocode, can then be looked up in either the Enterotube or Oxi/Ferm tube code book, as appropriate; the number will correspond to a species of bacteria that produces that particular combination of enzymes. Students will usually successfully identify their unknown bacteria on completion of this test. The molecular identification protocol introduces students to PCR and cycle sequencing. Students first follow a simple protocol to isolate genomic DNA from their unknown bacteria. This protocol involves breaking the cells open with a series of freeze/thaw cycles, then centrifuging to remove cellular debris. Students then set up a PCR reaction to amplify a region of the 16S rRNA gene. The PCR product is cleaned up using an ExoSAP-IT kit, which cleaves excess primers and inactivates free nucleotides. The cleaned PCR product is then used as the template for a sequencing reaction. Students set up the sequencing reaction using BigDye reagents and the reactions are run in a thermocycler (PCR machine). The completed samples are then sent to a core facility to obtain the sequence. In the final exercise, students view the electropheragrams from their sequencing reaction, then use the sequence in a BLAST search limited to a bacterial data base. Students identify their unknown bacteria by examining the top-scoring sequences from the BLAST search results. Additional background information for the biochemical tests described here is best obtained from the product information guides from the manufacturers. Background and animations of PCR and DNA sequencing are available on the following Websites: PCR: http://www.dnalc.org/ddnalc/resources/pcr.html Cycle sequencing: http://www.dnalc.org/ddnalc/resources/cycseq.html Sanger sequencing: http://www.dnalc.org/ddnalc/resources/sangerseq.html www.nslc.wustl.edu/elgin/genomics/
Instructor Pages
- -
Select Genome Sequencing Center Video Tour in the first paragraph. This 30 min video provides a tour of the Washington University Genome Sequencing Center with explanations and animations of each step of the sequencing process, which includes PCR and cycle sequencing.
Instructor Pages
- -
Time Table
The table below provides a general outline for student lab time to perform the experiments. The table does not include the time it may take in lab for students to view and discuss their results or to complete their lab reports. Part 1 Activities
Single Colonies EMB Analysis Oxidase Test Enterotube Test
Liquid culture
90 min 45 min
* Can remove plates from incubator and store at 4C until students can view results in lab ** Sample preparation, time required to obtain results, and retrival guidelines will vary depending on what facility generates the sequencing results. Refer to the sequencing core facility you choose to use for more information.
Note: The lab is presented here with students performing one exercise during each lab period. However, if desired, students could view their EMB results and perform Exercises 3 and 4 from Part 1 and Exercise 1 from Part 2 on the same day.
Instructor Pages
- -
In order to prevent culturing possibly harmful bacteria, strains can be ordered from the American Type Culture Collection (ATCC), a nonprofit organization which provides strains at a reasonable cost for educational purposes. See www.atcc.org for more information. A list of strains used previously used in this lab along with their experimental results is provided in the following table. Strain Table and Results Bacteria Enterobacter cloacae Serratia liquifaciens Escherichia coli Pseudomonas aeroginosa Enterobacter agglomerans Alcaligenes faecalis Klebsiella pneumaniee Enterobacter aerogenes Gram NEGATIVE NEGATIVE NEGATIVE NEGATIVE NEGATIVE NEGATIVE NEGATIVE NEGATIVE Oxidase NEGATIVE NEGATIVE NEGATIVE POSITIVE NEGATIVE POSITIVE NEGATIVE NEGATIVE Biocode 32163 26061 26170 30303 20100 10001 24373 36361
Instructor Pages
- -
Instructor Pages
- -
PCR mix Component dH2O Taq buffer MgCl2 dNTPs Forward primer Reverse primer Taq polymerase Stock 10x 50 mM 10 mM 20 M 20 M 5 U/L Final 1x 1.5 mM 0.25 mM 0.4 M 0.4 M 0.02 U/L 5 rxn 195.25 L 25 L 7.5 L 6.25 L 5 L 5 L 1 L
Student directions state to use 49 L of the above mix and 1 L of their prepared template DNA per PCR reaction. Sequencing mix Make a 1.6 M stock solution of the forward primer. For each reaction, add 2 L of primer, 8 L of BigDye Student directions state to add 10 L of their PCR products (after Exo-SAP IT protocol) to the Big Dye/primer mix.
Instructor Pages
- -
Ordering Information (for 5 students or student groups adjust as needed) General chemicals not listed here can be purchased from Sigma-Aldrich (www.sigmaaldrich.com) General materials not listed here can be purchased from Fisher Scientific (www.fishersci.com) Oxidase test slides (need 5 slides) Becton, Dickinson, and Company (www.bd.com) Catalog number 231746 Enterotubes II (need 5 or less) Becton, Dickinson, and Company (www.bd.com) Catalog number 211832 Oxi/Ferm tubes II (need 5 or less) Becton, Dickinson, and Company (www.bd.com) Catalog number 212116 Enterotube Interpretation Guide (need 1) Becton, Dickinson, and Company (www.bd.com) Catalog number 243383 Oxi/Ferm Interpretation Guide (need 1) Becton, Dickinson, and Company (www.bd.com) Catalog number 243235 Forward and reverse primers for 16S rRNA gene (in E. coli K12) to give a 481 bp product Forward sequence: CGG CCC AGA CTC CTA CGG GAG GCA GCA G Reverse sequence: GCG TGG ACT ACC AGG GTA TCT AAT CC Invitrogen Life Sciences Custom Primers (www.invitrogen.com/oligos) (Order 40 nmoles of forward primer and 20 nmoles of reverse primer) Taq polymerase and buffer (5 units) Invitrogen (www.invitrogen.com) Catalog number 18038-018 PCR-grade dH2O (500 mL) Invitrogen (www.invitrogen.com) Catalog number 10977-015 Big Dye Terminator v1.1 Cycle Sequencing Kit (1 kit) Applied Biosystems (www.appliedbiosystems.com) Product number 4336774 dNTP mix (10 mM) (10 L) Invitrogen (www.invitrogen.com) Catalog number 18427-013 ExoSAP-IT (5 reactions) GE Healthcare (Amersham Biosciences www.amershambiosciences.com) Catalog number US78200
Instructor Pages
- -
10
Method 1 Exercise 1:
5 types of unknown bacteria streaked to create a lawn on sterile LB agar plates (prepare one unknown per student or student group) 5 LB/agar plates 15 sterile loops for streaking (each group uses 3)
Exercise 2:
Plates containing single colonies of unknown bacteria (prepared by students in Exercise 1) 5 EMB + lactose agar plates 5 LB agar plates 10 sterile loops
Exercise 3:
Prepare 4 mL sterile LB broth in culture tubes (one tube for each unknown). Label each tube with the unknown number, then innoculate with a colony from each unknown plate the day before the students meet again. Grow the samples overnight in a shaker at 37C to an approximate OD of 2. These samples will be used for the oxidase test slide. Students only need 20 L per test, so each 4 mL liquid culture can be re-used many times if needed. If desired, also prepare a liquid culture of a known oxidase positive strain and a known oxidase negative strain to use as controls in the oxidase test. 5 Oxidase test slides
Exercise 4:
Plates containing single colonies of the unknown bateria (prepared by students in Exercise 1) 5 (or less) Enterotubes II and Oxi/Ferm Tubes II 5 (or less) Enterotubes and Oxi/Ferm Interpretation guides will be needed, but tubes must first incubate at 37C overnight. When interpreting these results, it is useful for students to have a copy of the interpretation table that accompanies each kind of tube. This table contains columns labelled reaction name, negative, positive, remarks, and has a row corresponding to each
Instructor Pages
- -
11
compartment. The remarks column contains information about the specific reaction for that compartment and how the color change or gas was produced. Using this table, students can learn more about the specific biochemical test in each compartment and get information about how to best interpret unclear results. For more information about how these tests were developed, see the references below: Enterotubes: MacFaddin, J.F. Biochemical Tests for Identification of Medical Bacteria, 2nd ed., Baltimore: Williams and Wilkins, 1980. Farmer, J.J. et al., New groups of Enterobacteriaceae, Journal of Clinical Microbiology, Vol.21, pp.46-76, 1985. Oxi/Ferm tubes: Gilardi, G.L.: Nonfermentative Gram-Negative Rods. Laboratory Identification and Clinical Aspects. Marcel Dekker Inc., 1985. Lennette, E.H., Balows, A., Hausler, W.J., Jr., Shadomy, H.J. (ed.): Manual of Clinical Microbiology 4th ed. Washington, D.C.: American Society for Microbiology, 1985.
Method 2 Exercise 1:
Prepare liquid cultures of unknown bacteria as described in Part 1 Exercise 3 above. Students will use 500 L per PCR reaction. 245 L PCR mix If preparing in advance, prepare as directed under General Materials, omitting Taq polymerase, and store at 20C until ready to use. Add 1 L Taq polymerase to the mix immediately prior to use. Taq polymerase 5, 0.2 mL microcentrifuge tubes 1.25 mL PCR-grade dH2O Dry ice Water bath at 70C
Exercise 2:
PCR samples from Part 2 Exercise 1 5, 0.2 mL microcentrifuge tubes, each with 2 L ExoSAP-IT 35 L dH2O
Instructor Pages
- -
12
Water baths at 37C and 80C 5, 0.2 mL microcentrifuge tubes, each with 10 L Sequencing mix Companies for DNA sequencing: http://www.genegateway.com/ http://www.genomex.com/
Instructor Pages
- -
13
Instructor Pages
- -
14
Unknown bacteria collected from faucet in bathroom: Method 1: EMB-lactose plate see growth Oxidase test slide positive Oxi/Ferm tube 30303 Method 2: 16S rRNA sequence GTACGCCTTCTTCGGATTGTTAGCCCCTTTTGTTGGGTTACTGCTGTA GTTATTTCCTTGCTGTTTTGACGTTACCATCAGTATTAGCACCGGCTA TCTTCGTGCCAGCAGCCGCGGTATTACGATGGGTGCAAGCGTTAATC GGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGA TGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGA GCTAGAGTACGGTAGAGGGTGGTGGAATTTCCTGTGTAGCGGTGAA ATGCGTAGATATAGGAAGGAACACCAGTGGCGAAGGCGACCACCTG GACTGATACTGACACTGAGGTGCGAAAGCGTGGGGAGCAAACAGGA TTAGATACCCTGGTATGCAACGCAATTGGGGTCTCGTTTTTAGAAGG GGGTTTCGTTAAAAACTAAAGCGTTTGACGCTTTT Unknown is Pseudomonas aeroginosa.
Instructor Pages
- -
15
Student Pages
- -
2. Choose an "unknown" bacterial sample. Record the unknown bacteria number in LINE 1 of your lab report and in the box below: MY UNKNOWN BACTERIA NUMBER IS: 3. Open the petri dish of your unknown, without placing the top of the dish down on the bench top. Using the loop gently swipe across an area of bacteria to transfer the bacteria from the dish to your loop. 4. Gently streak the bacteria onto the agar surface of your labeled fresh plate as demonstrated by your lab instructor. You should make three successive streaks of bacteria. Dispose of the loop in the benchtop biohazard waste container and get a new one before each new streak. See the diagram below for an example:
5. You will examine your plate in lab next week. Things you should look for are: Can you see a progressive dilution? Did you isolate single colonies?
3. Using a sterile loop, carefully select a bacterial colony and streak it on EMB + lactose plate.
Student Pages
- -
3. Obtain a liquid culture stock of your Gram-negative unknown bacteria. 4. Obtain a dry oxidase test slide. On each slide, there are four test areas. Therefore, up to four samples can be tested on one slide. 5. Transfer 20 l of your liquid culture stock onto the center of the 2 test areas, noting which of the four test areas contains your sample. If any control samples are available, pipet them into the remaining test areas. 6. Incubate the test slide on your bench at room temperature for 20 seconds and no longer than 2 minutes. 7. Record the results of the oxidase test on LINE 6 of your lab report. A blue/purple color indicates that the bacteria is oxidase positive while no color change indicates oxidase negative.
Student Pages
- -
Student Pages
- -
3.
Did you isolate single colonies? ______________ If not, is there anything you could do differently next time to increase your chances of isolating single colonies?
4.
(a) Record the results of your replica plating. Did your bacteria grow on the EMB + lactose plate? ________________ (b) What is the Gram classification of your unknown bacteria? _______________________
After you have obtained the EMB+lactose results and concluded whether your bacteria is Gram positive or Gram-negative, you will pair up with a lab partner to work together to further identify your unknown bacteria. However, for the remainder of the semester, your group will be working with a Gram-negative unknown bacteria strain. So, if you concluded that your starting bacteria is Gram-positive, you must pair up with another student that has a Gram-negative bacteria.
Lab Report
- -
5. Record your unknown Gram-negative bacterial strain number here: _____________ 6. Record the results of your oxidase test here. Was your bacterial strain oxidase positive or oxidase negative? __________________ 7. Did you inoculate your unknown bacterial strain into an enterotube or an oxi/ferm tube? __________________ 8. What code number did you get from your enterotube or oxi/ferm tube? _________________
9.
Lab Report
- -
3. Remove the liquid supernatant from the tube and discard in the biohazard waste container on your bench. 4. Add 250 l of water to the cell pellet in the tube. Vortex well to resuspend the cells in the water. 5. Place the tube of cells in the dry ice bath for 3 minutes. 6. Transfer the tube to the 90C water bath for 3 minutes. 7. Repeat steps 5 and 6 twice. (The freeze/thaw cycle lyses the cells and releases the template DNA into solution). 8. Centrifuge at 13,000 rpm for 1 minute. B. PCR Amplification 1. Label the top of a sterile 0.2 mL microcentrifuge tube with your initials. Pipet 49 l of the "PCR mix" in your ice bucket into the 0.2 mL microcentrifuge tube. The PCR mix contains the forward and reverse primers, dNTPs, Taq polymerase, MgCl2 and PCR reaction buffer. 2. To the PCR mix add 1 L of the cell solution from step 7 above. (Note how little of the template solution we are adding.) 3. Your sample is now ready for amplification. Your instructor or TA will collect your reaction tube for amplification with the rest of the section. The reaction is conducted in a PCR machine (also known as a thermal cycler). The reaction will proceed as follows: 1 cycle followed by 40 cycles 94C for 3 minutes (Denature) 94C for 1 minute (Denature) 50C for 1 minutes (Anneal) 72C for 1 minutes (Elongation)
the DNA replication reaction of special nucleotides called 2', 3'-dideoxynucleotides. As the name implies, these nucleotides do not have an -OH group on either the 2' or 3' carbon. Whenever they are incorporated into a growing DNA strand, they are the last nucleotide incorporated, because there is no 3' -OH available for the next phosphodiester bond. If one has a way of identifying the different dideoxynucleotides (A or G or T or C), one can know the last base incorporated in any newly replicated strand of DNA. In our sequencing reactions, we will use dideoxynucleotides labeled with different colored fluorescent tags. Also, in DNA sequencing only one primer is used, so only one of the two strands is used as a template in the sequencing reaction. Once the results of the DNA sequencing are known (next week), we will be able to search the database of known sequences for a match to your sequence. A. Removal of free primer and nucleotides from the PCR reaction 1. Recall your PCR sample code number and obtain your PCR sample tube that you set up last week. 2. Obtain an ExoSAP-IT tube which is a small (0.2 ml), PCR reaction tube that has a red mark (dot) on the lid and is kept on ice. This tube contains 2 l of ExoSAP-IT. ExoSAP-IT is a mixture of Exonuclease I and Shrimp Alkaline Phosphatase that removes left-over primers and free nucleotides from the PCR reaction. Having left-over components from the PCR reaction will complicate the sequencing reaction. 3. Transfer 5 l of your PCR product into the ExoSAP-IT tube. 4. Label this tube so that you can differentiate it from other tubes in the class. 5. Incubate your tube at 37 C for 15 minutes to allow the degradation of primers and free nucleotides. 6. Transfer your tube to the 80 C water bath and incubate for 15 minutes to inactivate the ExoSAP-IT enzymes. 7. Add 7 l of water to the tube. You are now ready to prepare your DNA sequencing reaction. B. Cycle-Sequencing 1. Obtain a Big Dye Terminator tube from your lab instructor. This tube (which is kept on ice) is a small (0.2 ml), unmarked PCR reaction tube that contains 10 l of a pinkish solution. This pink-ish solution consists of 2 l of primer and 8 l of BigDye Terminator Reagent.
Student Pages
- -
11
2. Transfer 10 l of your "clean" PCR product (from step 7 above) to the Big Dye Terminator tube. Flick the tube with your finger to mix the contents. 3. Label the Big Dye Terminator tube with your PCR sample code number and return this tube your lab instructor. 4. The samples will be run through a cycling protocol similar to the PCR protocol, purified to remove excess dyes, and sent to a sequencing facility to be run on a gel and read by the automated reader. We will have the sequence data back next week. Exercise 3: BLAST Analysis of 16S rRNA Gene Sequence BLAST (Basic Local Alignment Search Tool) is a web-based program that is able to align your search sequence to thousands of different sequences in a database (that you choose) and show you a list of the top matches. This program can search through a database of thousands of entries in under a minute. (The time will be longer if there are many users using the search program at the same time.) For this lab, you will use a database that contains all the bacterial sequences that have been published. BLAST performs its alignment by matching up each position of your search sequence to each position of the sequences in the database. For each position, BLAST gives a positive score if the nucleotides match. BLAST can also insert gaps when performing the alignment. Each gap inserted has a negative effect on the alignment score, but if enough nucleotides align as a result of the gap, this negative effect is overcome and the gap is accepted in the alignment. These scores are then used to calculate the alignment score in bits which is converted to the statistical E-value. A high bit score correlates with a low E-value. The lower the Evalue, the more similar the sequence found in the data base is to your query sequence. When the results are given, the most similar sequence is the first result listed. This program can be accessed at: http://www.ncbi.nlm.nih.gov/BLAST
Reference: Altschul, S.F., Gish, W., Miller, W., Myers, E.W. & Lipman, D.J. (1990) "Basic local alignment search tool." J. Mol. Biol. 215:403-410.
Student Pages
- -
12
NAME: ___________________________________ Lab Report: PCR Amplification and DNA Sequencing In order to provide you with a thorough understanding of PCR, the following exercise leads you through three rounds of PCR from a hypothetical DNA template. Read carefully to ensure that you answer all of the questions. One strand of the double helix of DNA will be designated Original-1 (O1). While our starting template DNA is actually very long, we will show only a short sequence for convenience. 1. Write the nucleotide sequence of the complementary strand designated Original-2 (O2). (O1) Original- 5- C G T A A T G T A T C A T G G C T T C A G C C T A -3 1: (O2) Original- 3- __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ -5 2: A chemically synthesized piece of DNA known as the primer is made that has a nucleotide sequence complementary to the bases adjacent to the segment of interest on the 3' end of Original-1. Another primer is made that has a nucleotide sequence complementary to the bases adjacent to the segment of interest on the 3' end of Original-2. The primer sequences are shown in bold. (Note: In experiments primers are typically about 20 nucleotides long, not as short as shown here. This is important since a 5 bp sequence is much less likely than a 20 bp sequence to be unique to the DNA of interest.) In cycle 1, and in all subsequent cycles of the PCR reaction, a copy of each of the two original strands will be made beginning at the 3' end of the primer and continuing to the 5' end of the original strand. 2. Write the sequence of the copies that are made from the strands of (O1) and (O2) in the blanks below. (O1) Original-1: 5- C G T A A T G T A T C A T G G C T T C A G C C T A -3 (C1) Copy of 3G T C G G -5 O1: (O2) Original-2: 3- G C A T T A C A T A G T A C C G A A G T C G G A T -5 (C2) Copy of 5T A A T G -3 O2: During the second cycle of PCR, a copy is made of each of the strands of Original-1, Copy-1 (C1), Original-2, and Copy-2 (C2) obtained in cycle 1.
Lab Report
- -
13
3a. In the appropriate blanks below, write the sequence of C1 formed during the replication of O1 in cycle 2. (O1) Original-1: 5- C G T A A T G T A T C A T G G C T T C A G C C T A -3 (C1) Copy of 3G T C G G -5 O1: 3b. Does the sequence differ from that of C1 made in the first cycle? __________ 3c. In the appropriate blanks below, write the sequence of C2 formed during the replication of O2 in the second cycle. (O2) Original-2: 3- G C A T T A C A T A G T A C C G A A G T C G G A T -5 (C2) Copy of 5T A A T G -3 O2: 3d. Does the sequence differ from that of C2 made in the first cycle? __________ To make a copy of the C1 strand, a primer attaches to appropriate sequences on the strand. Note that only one of the two primers will be appropriate. The other primer will anneal to the C2 strand. 3e. Complete the sequence of (CC1) and (CC2) below: Note: in subsequent steps all strands can be categorized as O, C or CC (1 or 2). Think about the size differences among these three choices. (C1) Copy of O1: 3- A T T A C A T A G T A C C G A A G T C G G A T -5 (CC1) Copy of 5- T A A T G -3 C1 (C2) Copy of O2: 5- C G T A A T G T A T C A T G G C T T C A G C C -3 (CC2) Copy of 3G T C G G -5 C2
4. How many strands of each of the following are present after the second cycle? (O1) (C1) (CC1) (O2) (C2) (CC2)
Lab Report
- -
14
5a. For the third cycle of PCR, each of the eight strands present after the completion of Cycle 2 will act as a template and be replicated. Using CC1 and CC2 as your template, complete the sequences below and label the new strand that is produced in the blank space provided to the left of each sequence: (CC1) Copy of C1: 5- T A A T G T A T C A T G G C T T C A G C C -3 3G T C G G -5
3- A T T A C A T A G T A C C G A A G T C G G -5 5- T A A T G -3
5b. In the blanks below, write the symbol of the strand produced by replication of O1, O2, C1, C2, CC1, and CC2. Note that O, C, and CC are the only choices. CCC is not an acceptable choice. Think about the sequence and length of the strand produced. Replication of (O1) produces ______ Replication of (C1) produces ______ Replication of (CC1) produces _____ Replication of (O2) produces ____ Replication of (C2) produces ____ Replication of (CC2) produces ________
6. How many strands of each of the following types are present after the third cycle? Total number _______ (O1) _____ (O2) ___ (C1) _____ (C2) ___ (CC1) ___ (CC2) ___
Lab Report
- -
15
7. Review the numbers you have compiled so far, and deduce the patterns. Use this information to fill in the table below.
Lab Report
- -
16
8. Go to the website below to read about "traditional" Sanger dideoxy sequencing: http://www.dnalc.org/ddnalc/resources/sangerseq.html The following diagram represents what would be seen on an autoradiogram (film) at the end of the gel electrophoresis. Starting at the bottom of the gel, "read" the DNA sequence shown and record it below.
9. Think about the way DNA sequencing works. Does the sequence you wrote above represent the sequence of the template DNA or the newly synthesized strands? Provide a sketch showing the template, primer, and labeled product.
10. In lab we used a modified version of Sanger "dideoxy" sequencing called cycle sequencing. Use the website below to learn about cycle sequencing. Give two important similarities and two important differences between traditional dideoxy and cycle sequencing. Cycle sequencing: http://www.dnalc.org/ddnalc/resources/cycseq.html
Lab Report
- -
17
NAME: ___________________________________ Lab Report: Molecular Identification of Bacterial Unknown 1. Examine the sequence from the 16s rRNA gene of your unknown bacteria. You can look at either the graphic (color peaks) or text version of the sequence. About how many bases of quality sequence did you get in your experiment?
2. Submit your sequence to the NCBI database using these directions and answer the following questions: Go to the NCBI website (www.ncbi.nlm.nih.gov/BLAST) Select the nucleotide-nucleotide BLAST (blastn) Copy your sequence from the file then past it in the search box on the blastn website. Click BLAST, then on the next page, click Format You will be asked to wait a few seconds while the program runs. Your search results page should open. It will contain a graphic with several red horizontal lines representing homologous sequences. Scroll to the text list of sequences below this graphic. a) How many matches ("hits") did you obtain from the search?
b) What is the name of the organism with the best match to your sequence?
c) How good is the match between your sequence and the top match (score)?
Lab Report
- -
18
d) Give the name of one other organism that has a match to your sequence.
e) Is sequencing the 16S rRNA gene a useful way to discriminate among bacteria?
3. What result did you get several weeks ago from the biochemical identification of your unknown bacteria? Did your sequencing results match the biochemical identification? Discuss, in general, why the results may not match and which technique you think is the best for identifying an unknown bacterial strain.
Lab Report
- -
19