0% found this document useful (0 votes)
55 views122 pages

Lab Manual Mol Biol 2021

Uploaded by

lucas Omondi
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
55 views122 pages

Lab Manual Mol Biol 2021

Uploaded by

lucas Omondi
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 122

Molecular Biology: A Laboratory Manual

ALAM NUR-E-KAMAL PH.D.


Professor, Biology
[email protected]

1
Laboratory 1. Laboratory Safety, Metric System, and Micropipette Challenge
Exercise 1. Laboratory safety. Laboratory safety is defined as the ways to minimize potential danger to
human and environment. Following safety is recommended to minimize accident in laboratory.

Objective:
A. Become familiar with laboratory and surroundings:

1. Identify and locate exits, fire extinguishers, chemical showers, and eye wash.

2. Locate general and biohazard disposal containers.

3. Locate telephone set to use in case of emergency.

4. Locate fume hood and learn when you should use fume hood.

B. Safety signs and symbols: The National Fire Protection Association


(NFPA) has developed a labeling system. It consists of 4 sections in
color with a numerical code:
Blue: health hazard

Red: fire hazard

Yellow: reactivity/instability hazard

White: special hazard

Signs and symbols of Hazard: http://en.wikipedia.org/wiki/Hazard_symbol

Write down location of the following safety equipments:

Fume hood: ----------------------------------------------------------

Safety shower: ------------------------------------------------------

Eyewash shower: ---------------------------------------------------

Fire extinguisher: -----------------------------------------------------

Floor map of the building: -------------------------------------------

Assembly place in case of emergency evacuation: -------------------

2
C. Rules for disposing laboratory waste: It is required to follow the rules in

disposing laboratory waste to maintain safe and legal operation of

laboratory. You must follow these rules. In the following sections, record

information as instructed by your instructor.

Empty test tube, beaker, conical flask, pipettes ---------------------------------------------------

Broken glass apparatus (beaker, test tube, graduated cylinder etc.) ----------------------------

Microscopic slide with biological sample (eg. Leaf, bacteria, cheek cell) --------------------

Apparatus (eg. Pipettes, test tubes) used to transfer bacteria ------------------------------------

Electrophoresis gels -----------------------------------------------------------------------------------

Chloroform, acetic acid, methanol, ethanol -------------------------------------------------------

Bacterial plates ----------------------------------------------------------------------------------------

D. Rules to follow: Each student should follow the following rules while
working in the laboratory:

I. Do not:

*eat, drink, and smoke in the laboratory area.

*enter the laboratory in absence of your supervisor.

*leave any instrument turned “on” or plugged “in” while leaving the laboratory.

*discard any chemical in the sink.

*use cell phone while working in the laboratory.

*make loud conversation and any inappropriate conversation in the laboratory.

II. Do:

*Keep all books, coats, purses, backpacks etc. in designated areas.

3
*wear lab coats and safety glasses in each session of laboratory.

* Inform your teacher if you are pregnant, color blind, and allergic to any

chemicals.

* review laboratory exercise BEFORE coming to the lab session

and identify potential hazardous material.

*read complete lab session and make a plan to perform experiments.

* use only labeled chemicals and reagents.

*ask questions to your instructor BEFORE you attempt a

procedure that is not clear to you.

*return all apparatus, chemicals, and reagents in appropriate places.

*rinse all containers with water and dispose waste in designated containers.

*clean your hands and working area with disinfectants.

I have carefully read the above regulations and understood its

content. I fully agree to comply with the rules and understand that

violation of these regulations may result in expulsion from the laboratory.

Student name: ------------------------------------- Signature: -------------------------------

Date: Course name: Instructor:

4
Exercise 2. Metric Units and measurement (Please see next page)

A standard system of measurement commonly used in science. The units are: meter as a

unit length, the gram as a unit mass, liter as a unit of volume, and the second as a unit

time. Rulers are used to measure length. Graduated pipettes, graduated cylinders,

volumetric flasks, beakers and conical flasks are used to measure volume of a liquid,

Objective

Learn units of metric system.

Learn conversion of units.

Familiarize with common apparatus used in biology laboratory.

Understand importance of volume measurement.

Learn how to obtain data and interpret scientific information.

Materials:

1. Ruler 5.Graduated cylinder: 100 ml

2. Beakers : 250 ml 6. Pipettes: 10 ml

3. Pipettes pump 7. Balance.

4. Test tube

2. Units of measurement: A unit of measurement is a definite amount of a property

such as length, volume, or mass. Scientists measure things using metric system. Units

used for metric system are: meter (m) for length, gram (g) for weight, and liter for

volume. Some prefixes are used to express systematic relationship in a particular type of

unit.

5
Table I: Prefixes in metric system

Decimal Prefix Symbol Power to 10

1,000,000,000,000,000,000 exa E 1018


1,000,000,000,000,000 peta P 1015
1,000,000,000,000 tera T 1012
1,000,000,000 giga G 109
1,000,000 mega M 106
1,000 kilo K 103
100 hecto H 102
10 deca da 101
1 basic unit, no prefix 100
0.1 deci d 10-1
0.01 centi c 10-2
0.001 milli m 10-3
0.000001 micro  10-6
0.000000001 nano n 10-9
0.000000000001 pico p 10-12
0.000000000000001 femto f 10-15
0.000000000000000001 atto a 10-18

Exercise 3. Micropipette Challenge

Laboratory science often involves working with very small volumes of liquid.

Accurate transfer of such a small volume of liquid is critical and challenging

especially enzymatic reactions with protein, RNA, and DNA. Scientists working in

pharmaceutical industry, biotechnology laboratory, hospital, research laboratory etc.

need to acquire skill in using micropipette.

Objective

1. Become familiar with different types of micropipette.

2. Transfer small volume (µL) of liquid.

3. Determine color spectrum.

6
Practice I: Procedure to use Micropipette:

To draw liquid into the micropipette tip

a. Depress the button located at the top to the first stop and hold your finger at this

position.

b. Submerge the end of the tip below (2-3 mm) the fluid you want to withdraw.

Slowly release your finger keeping micropipette tip submerged in the liquid. Make sure

that no air bubbles created in liquid withdrawn in micropipette tip.

c. Take Micropipette out of the liquid.

To dispense liquid in a new container

a. Put the tip inside the container (touching inside/bottom) surface of the container

you want to dispense

b. Press the button to dispense the liquid. You need to press the button to first stop,

and then to second stop to make sure that you have dispensed all liquid.

c. Eject tip into appropriate waste container.

d. Following the same procedure, take volumes as directed in the Table and follow

instruction.

Practice II

Materials

1. Six test tubes


2. Three colored solutions: Red, blue, yellow
3. Water
4. Micropipette p1000
5. Tips

Methods

A. Setting up your tubes:

7
Label (1, 2, 3, 4, 5, and 6) the six tubes at your station.

Put 2100 µL of red water solution into test tube number 1

Put 2300 µL of yellow water solution into test tube number 3

Put 2500 µL of blue water solution into test tube number 5

B. Constructing color spectrum: Make sure you record action in Table II below:

Take 500 µL from test tube number 1 and add it into test tube number 2.

Take 500 µL from test tube number 1 and add it into test tube number 6.

Take Take 500 µL from test tube number 3 and add it into test tube number 4

500 µL from test tube number 3 and add it into test tube number 2

Take 500 µL from test tube number 5 and add it into test tube number 4

Take 500 µL from test tube number 5 and add it into test tube number 6

C. Crunching the numbers:

Calculate the total final volume of liquid in each tube.

Convert volume from µL to ml

Write color appeared in final solution

8
Table II. Record addition and subtraction

Test Tube Starting Amount ( µL) Total volume Total Color of the
volume volume solution
Number (µL)
Color to be added subtracted (mL)
added ( µL)

1 2100 (red)

2 0 µL

3 2300
(yellow)

4 0 µL

5 2500 (blue)

6 0 µL

Practice III

Materials

1. Six 1.5 ml tubes


2. Three colored solutions: Red, blue, yellow
3. Water
4. Micropipettes (p100. P10)
5. Tips (yellow)

9
Methods

A. Setting up your tubes:

Label (1, 2, 3, 4, 5, and 6) the six 1.5 ml size tubes at your station.

Put 25 µL of red water solution into test tube number 1

Put 30 µL of yellow water solution into test tube number 3

Put 40 µL of blue water solution into test tube number 5

B. Constructing color spectrum: Make sure you record action in Table II below:

Take 5 µL from tube number 1 and add it into tube number 2.

Take 5µL from tube number 1 and add it into tube number 6.

Take 5 µL from tube number 3 and add it into test tube number 4

Take 7 µL from tube number 3 and add it into tube number 2

Take 7 µL from tube number 5 and add it into tube number 4

Take 7 µL from tube number 5 and add it into tube number 6

C. Crunching the numbers:

Calculate the total final volume of liquid in each tube.

Convert volume from µL to ml

Write color appeared in final solution

10
Table III. Record addition and subtraction

Tube Starting Amount (µL) Total volume Total volume Color of the
volume ( µL) solution
Number color to be (µL) (mL)
added added Subtracted

1 25

2 0

3 30

4 0

5 40

6 0

11
Post lab questions:

1. List five important safety precautions should be taken while working in a molecular
biology lab.

2. What are the advantages of using micropipette ?

3. List different size of micropipettes you used in the laboratory.

4. What is the range of liquid volume recommended for each type of micropipette ?

P1000 :

P100:

P10:

5. Convert the following units:

20 g = µg = ng

M = 25 mM = µM

12
Self study:
SOLUTIONS

1. PERCENT SOLUTIONS

Parts of a solute per 100 total parts of solution.

A. % W/W

Percent of weight of solute in the total weight of the solution.

Example:

A 100% (W/W) NaCl solution is made by weighing 100 g NaCL and dissolving in 100 g of solution.

B. % W/V-

Percent of weight of solution in the total volume of solution.

Example:

A 4% (W/V) NaCl solution is 4 g of NaCl in 100 mL of solution.

C. % V/V

Percent of volume of solute in the total volume of solution %V/V.

Example:

A 10% (V/V) ethanol solution is 10 mL of ethanol in 100 mL of solution; unless otherwise stated, water is the
solvent.

2. MOLAR SOLUTIONS (M)

The definition of molar solution is a solution that contains 1 mole of solute in each liter of solution. A mole is the
number of gram molecular weights. Therefore, we can also say a 1M = 1 gMW solute/liter solution.

PROBLEMS

A. How would you make a liter of 4M CaCl2?

CaCl2 = 111 (MW)

B. How would you make 300 mL of a 0.5M NaOH solution?

NaOH = 40 (MW)

13
3. Making diluted solutions:

Many times the solutions we make are made from more concentrated solutions rather than dry chemicals. For
figuring these out it can just be easier to remember a formula than figuring them out.

That formula is:

V1C1 = V2C2

where V = volume

C = concentration (%, M, N)

SAMPLE PROBLEMS:

1. How much 12 N HCl do you need to make 400 mL of 2N solution?

14
Lab 2: Central Dogma of Molecular Biology: replication, transcription,
and translation
The discovery in 1953 of the double helix, the twisted-ladder structure of deoxyribonucleic
acid (DNA), by James Watson and Francis Crick marked a milestone in the history of biology
and gave rise to modern molecular biology, which is largely concerned with understanding how
genes control the chemical processes within cells. In short order, their discovery yielded ground-
breaking insights into the genetic code and protein synthesis. During the 1970s and 1980s, it
helped to produce new and powerful scientific techniques, specifically recombinant DNA
research, genetic engineering, rapid gene sequencing, and monoclonal antibodies, techniques on
which today's multi-billion dollar biotechnology industry is founded. Major current advances in
science, namely genetic fingerprinting and modern forensics, the mapping of the human genome,
and the promise, yet unfulfilled, of gene therapy, all have their origins in Watson and Crick's
inspired work. The double helix has not only reshaped biology, it has become a cultural icon,
represented in sculpture, visual art, jewelry, and toys.

Watson and Crick published their findings in a one-page paper, with the understated title "A
Structure for Deoxyribose Nucleic Acid," in the British scientific weekly Nature on April 25,
1953, illustrated with a schematic drawing of the double helix by Crick's wife, Odile. A coin toss
decided the order in which they were named as authors. Foremost among the "novel features" of
"considerable biological interest" they described was the pairing of the bases on the inside of the
two DNA backbones: A=T and C=G. The pairing rule immediately suggested a copying
mechanism for DNA: given the sequence of the bases in one strand, that of the other was
automatically determined, which meant that when the two chains separated, each served as a
template for a complementary new chain. Watson and Crick developed their ideas about genetic
replication in a second article in Nature, published on May 30, 1953.

DNA is a polymer. The monomer units of DNA are nucleotides, and the polymer is known as
a "polynucleotide." Each nucleotide consists of a 5-carbon sugar (deoxyribose), a nitrogen
containing base attached to the sugar, and a phosphate group. There are four different types of
nucleotides found in DNA, differing only in the nitrogenous base. The four nucleotides are given
one letter abbreviations as shorthand for the four bases.

A is for adenine

G is for guanine

C is for cytosine

T is for thymine

15
Purine Bases
Adenine and guanine are purines. Purines are the larger of the two types of bases found in
DNA. Structures are shown below:

Structure of A and G

Pyrimidine Bases
Cytosine and thymine are pyrimidines. The 6 stoms (4 carbon, 2 nitrogen) are numbered 1-6.
Like purines, all pyrimidine ring atoms lie in the same plane.

Structure of C and T

16
Base Pairs
Within the DNA double helix, A forms 2 hydrogen bonds with T on the opposite strand, and G
forms 3 hydrogen bonds with C on the opposite strand.

Example of dA-dT base pair as found within DNA double helix

Example of dG-dC base pair as found within DNA double helix

 dA-dT and dG-dC base pairs are the same length, and occupy the same space within a
DNA double helix. Therefore the DNA molecule has a uniform diameter.
 dA-dT and dG-dC base pairs can occur in any order within DNA molecules

17
Exercise I: DNA model building
Work in a group of 2-4 students per group. Each group will construct a 9 rung DNA
model.
Material: Collect following components:
Pyrimidines: 4 cytosine (C) Blue
5 Thymine (T) Green
Purines: 4 Guanine (G) Orange
5 Adenine (A) Yellow

20 Phosphates white tubes


9 hydrogen bonds white rods
18 deoxyribose sugar black pentagon

What are the molecular components present in a nucleotide?


Answer: ----------------------------------------------------------------------------------------

Step 1: Build 18 nucleotides: 4 each of Cytosine (C) and Guanine (G)


5 each of Adenine (A) and Thymine (T)
Step 2: Use these nucleotide units to construct a 9 rung (GATTACACG) DNA strand by
connecting them through phosphodiester bonds.
Write complimentary DNA strand: --------------------------------------------------------

Step 3: Construct complimentary DNA strand as you have written above. You need to
connect nucleotides by phosphodiester bond as you have done in step 2.

Step 4: Connect two polynucleotide strands now using white color rods (hydrogen
bonds. Check double stranded DNA now if A-T and G-C base pair rule is followed or
not. Show your instructor the double stranded DNA for accuracy.

Exercise 2: DNA replication. The double helix is unwound and each strand acts as a
template for the next strand. Bases are matched to synthesize the new partner strands.
DNA replication is the process of producing two identical replicas from one original DNA
molecule.
Step 1: Build 18 more nucleotides of DNA (four C and G; five A and T. DO NOT MAKE
A SECOND DNA LADDER.
Step 2: Unzip the DNA ladder at week hydrogen bonds.

Which area of this DNA is preferred to be unzipped? Write down below DNA ladder that
you have constructed in exercise 1 and circle preferred area for unzipping.
---------------------------------------------------------------------------------------------------------------------
---------------------------------------------------------------------------------------------------------------------
---------------------------------------------------------------------------------------------------------------------
---------------------------------------------------------------------------------------------------------------------
----------------------------------------

18
Step 3. Unzip DNA at preferred area (one base at a time) and bring new nucleotide
complimentary to the “old” strand. Continue to connect complimentary nucleotides in
both direction to the end.

Step 4: Compare both double stranded DNA ladders.

Is there any difference in base sequence of both DNA ladders? Circle one: Yes or No

You now have two identical models: one half of each model is old and one half is newly
formed. This process of DNA replication is called semi-conservative model of DNA
synthesis. This is the way DNA is copied prior to cell division and maintain identical
base sequence of DNA in daughter cells.

Define semiconservative model of DNA synthesis.


---------------------------------------------------------------------------------------------------------------------
---------------------------------------------------------------------------------------------------------------------
---------------------------------------------------------------------------------------------------------------------
---------------------------------------------------------------------------------------------------------------------
----------------------------------------

Exercise 3. Transcription is the process of making a RNA copy of a gene sequence. Amino
acid coding RNA called a messenger RNA (mRNA) molecule in eukaryotes leaves the cell
nucleus and enters the cytoplasm, where it directs the synthesis of the protein.

List Differences between DNA and RNA:

---------------------------------------------------------------------------------------------------------------------
---------------------------------------------------------------------------------------------------------------------
---------------------------------------------------------------------------------------------------------------------
---------------------------------------------------------------------------------------------------------------------
---------------------------------------------------------------------------------------------------------------------
---------------------------------------------------------------------------------------------------------

Material: Collect following components:


Pyrimidines: cytosine (C) Blue
Uracil (U) Lavender tube
Purines: Adenine (A) Orange
Guanine (G) Yellow

Phosphates white tubes


Hydrogen bonds white rods
Ribose sugar purple pentagon
Ribosome
tRNA
Peptide bond

19
Amino acids
Procedure:
Step 1: Start with 9 rung DNA “ladder” as GATTACACG
CTAATGTGC template strand
Using your desk top to simulate a cell, place the DNA on a portion of the desk top chosen as the
nucleus and marked with chalk or a piece of tape, the rest of your desk can be the cytoplasm of
the cell. Place the ribosome, transfer RNAs and amino acids in the cytoplasm.
Step 2: Construct nine mRNA nucleotides which will be complimentary to the “sense” strand of
DNA. Remember that if DNA has adenine, it must match with uracil in RNA.
Step 3: Unzip the DNA strand model
Step 4: Bond the mRNA nucleotides with their partners of the DNA and to each adjoining
mRNA between the sugar of one and the phosphate of the next in the line.
GAUUACACG
CTAATGTGC
Step 5: Unzip the mRNA at the hydrogen bonds. You can zip DNA strand with its
complimentary strand.
Step 6: Take the “free” mRNA molecule from the nucleus.

Exercise 4. Translation is the process of translating the sequence of a messenger RNA


(mRNA) molecule to a sequence of amino acids during protein synthesis. The genetic code
describes the relationship between the sequence of base pairs in a gene and the corresponding
amino acid sequence that it encodes. In the cell cytoplasm, the ribosome reads the sequence of
the mRNA in groups of three bases to assemble the protein.
Fill in the blanks:
Genetic code of triplets of bases are present on ----------------------.
Anti-codons of triplets of bases are present on ---------------------------.

Procedure
Step 1: Place on the ribosome in the cytoplasm. This will be the site of protein synthesis.
Step 2.Construct the tRNA molecules by matching three bases that are complimentary to the
bases of a codon on the mRNA.
Step 3: Find the amino acids with the specific R- groups that matches each tRNA.
Step 4: Attach the tRNAs to the R-groups of their specific amino acids.
Step 5: Bring the tRNA-amino acid complex to the codon of mRNA which codes for that tRNA.
Attach the hydrogen bonds.
Step 6: Attach covalent (peptide) bonds (grey tubes) between adjoining amino acids. These
peptide bonds are formed through a series of dehydration reactions.
Step 7: Disconnect the polypeptide (amino acid chain) from the tRNAs. The polypeptide chain
will then coil or fold.

20
Step 8: The tRNAs are then disconnected from the mRNA. Both are now available to be used
again in the cytoplasm.

Post-lab questions:
1. Compare your DNA and RNA models in relation to the phosphates, sugars and bases.
--------------------------------------------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------------------------------------------------

2. Compare general appearance of DNA and RNA model.


--------------------------------------------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------------------------------------------------
3. What is produced in:
Replication: --------------------------------------------------------------------------------
Transcription: -----------------------------------------------------------------------------
Translation: --------------------------------------------------------------------------------

4. If TAC is the codon in DNA, what is the complimentary code of mRNA? ------------------------

5. If mRNA codons are AUG, GGU, CAG, what three codons of tRNA will attach to them?

6. What is the source of free amino acids in the cytoplasm?

7. If the DNA analysis of gene shows 23% adenine, what would be the percentage of:
Thymine --------------------------
Cytosine --------------------------
Guanine --------------------------

8. List by order (large to small) of size of the following: cell, gene, chromosome, atom, nucleus,
nitrogen base, nucleotide, nucleoside. -----------------------------------------------------------------------------
--------------------------------------------------------------------------------------------------------------------------------

9. Predict the consequence of a mutation (AAA to TAA) in a gene in relation to product (protein) of
this gene.

--------------------------------------------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------------------------------------------------

21
Laboratory 3: Isolation of genomic DNA from onion cells estimation
of DNA

Objective

*Describe physical property of DNA

*Describe chemical composition of DNA

* Explain importance of compartmentalization and location of DNA

*List different eukaryotic cellular organelles containing DNA

*Learn purpose of each step of DNA isolation.

A. Isolation of genomic DNA from onion cells

Principle: In eukaryotic cells chromosomal DNAs are double-stranded molecules

localized in the nucleus. Chromosomal DNA molecules are complexed with histone

proteins as nucleosome. In addition to the nucleus, the mitochondria and chloroplast

contain DNA, but not complexed with histone. Isolation of genomic DNA is extremely

important to study the structure of gene in the chromosome, regulation of gene

expression, and identification of mutation(s) in genes of interest in genetic diseases.

Chromosomal DNA in mammalian cells is released from the nucleus by lysis of the

plasma and nuclear membranes with solution containing detergent sodium dodecyl

sulfate (SDS). Proteins present in the lysate are denatured by chloroform extraction.

Genomic DNA is precipitated by adding ethyl alcohol. Precipitated chromosomal DNA

is then separated from RNA and picked up from solution.

22
Materials.

Homogenizer Glass rod Pipette

Conical flask 250 ml (15) Pipette aid Ethyl alcohol

Onion Chloroform Cuvette

Homogenizing solution (PBS, 0.1 M citrate, 1% SDS) Kim wipe

Water bath 65oC Cheese cloth Protein solution (1% BSA)

DNA solution Spectrophotometer Glass rod Ice box

Pre-lab study

1. Name different types of deoxynucleotides present in a DNA molecule.

2. List chemical components present in a nucleotide.

23
3. What is function of the following chemicals in DNA isolation:

Sodium dodecylsulphate (SDS).

Ethyl alcohol.

Chloroform

4. Write down the major steps involved in isolation of DNA from eukaryotic cells.

Experimental protocol:

Work in group (your instructor will determine the number of students per group).
Use gloves during DNA isolation procedure
Follow instruction precisely to avoid unwanted degradation of chromosomal DNA.
Keep a bottle of 250 ml 95% ethanol on ice.

Isolation of DNA from onion cell consist of three basic steps:

Homogenization: Breaks cell wall, plasma membrane, and nuclear membrane.

Deproteinization: Releases chromosomal protein (eg. Histone) from DNA

molecules.

Precipitation of DNA. Water of hydration is removed from the DNA

molecule. DNA cannot stay in solution and precipitate out.

24
Step I: Homogenization

1. Take fresh 50 g onion and make slices of 1-2 mm pieces.

2. Obtain a mass of 20 g fresh sliced onion in a 250 ml conical flask.

3. Add 100 ml homogenizing solution.

4. Mix thoroughly and incubate the flask at 65oC for 15 minutes

What happens at this stage by:

Heat (65oC): soften onion tissues, loosen cells, denature

enzymes.

SDS: dissolves membranes, and denatures protein.

5. Incubate the flask in ice bath (pieces of ice in water) to lower

temperature to 20oC.

6. Pour cooled onion slice preparation in a blender and fasten the lid.

Homogenize for 30 seconds at low speed, followed by 30 seconds at

high speed.

What happens by:

Homogenization: -----------------------------------------------------------

-----------------------------------------------------------------------------

Na-citrate: -------------------------------------------------------------------

--------------------------------------------------------------------------------.

7. Pour homogenate from the blender and keep on ice for 10 minutes.

25
8. Filter the homogenate through four layer thickness cheesecloth into

a clean 250 ml beaker. Keep filtrate on ice.

Where do you think most of the onion DNA is present?

Filtrate or material retained on cheesecloth.

Step II. De-proteinization

9. Transfer 50 ml of filtrate into a clean 250 ml conical flask.

10. Add 10 ml chloroform into the conical flask. You should see a

layer of chloroform separated from the homogenate at the bottom of

the flask.

11. Gently swirl the content of the flask a few times. DO NOT

VIGOROUSLY MIX SOLUTION.

What happens at this stage ?

----------------------------------------------------------------------------

----------------------------------------------------------------------------

26
12. Carefully collect homogenate (aqueous layer) into another clean

250 ml conical flask. Make sure that none of the chloroform and

protein precipitate contaminates aqueous layer.

13. Repeat steps 10-12 to remove more of the biomolecules other than

nucleic acid from the aqueous layer. Take aqueous layer in a clean 250

ml conical flask.

Where is onion DNA present now? Circle appropriate words below.

Aqueous layer Chloroform layer

Step III Precipitation of DNA

14. Place conical flask containing aqueous layer on ice for 5-10

minutes.

15. Slowly add 80 ml of ice cold 95% ethanol down the side of the

wall of conical flask. You may not need to add all of 80 ml of cold

95% ethanol to precipitate DNA.

16. Gently mix ethanol with aqueous solution. You will find stringy

DNA precipitate appears.

17. Using a glass rod, spool out stringy DNA onto glass rod by

rotating glass rod in one direction. Rotating in one direction reduces

physical damage/break long DNA molecules.

18. Transfer DNA into a 1.5 ml tube.

27
19. Air dry DNA for 5-10 minutes.

20. Dissolve DNA in appropriate volume of TE buffer (10 ml, consult

with your instructor). Close cap of the tube and store at -20oC for

future use.

B. Spectrophotometric determination of DNA concentration

Spectrophotometry is the quantitative estimation of the reflection or transmission light

passing through a solution. A spectrophotometer is an instrument employed to measure

the proportionate amount of light of different wavelengths absorbed or transmitted by a

chromophore in solution. A molecule or group of molecules usually absorbs light in a

unique pattern. This absorption pattern (maxima) can be used for characterization and

estimation of molecules.

Nucleic acids absorb maximum light at 260 nm while absorption maxima of

protein is at 280 nm. The quality and concentration of DNA can be determined by taking

absorption of sample at 280 nm. The higher the ratio of the absorbance at 260 nm to the

280 nm (A260 nm/280 nm) the higher the DNA content. You will work in teams (as your

instructor directs) to obtain data in this experiment.

Materials

Cuvettes TE DNA solution

Protein solution (mg/ml) Kim wipes 250 ml beaker

28
Procedure

1. Turn on spectrophotometer (Spectronic 20) at least before starting use.

2. Each team should fill two third of each cuvette with: A. TE (control), B. DNA

solution, and C. protein solution.

3. Take the cuvette containing TE and close sample holder cover.

4. Adjust absorbance to “zero” in Spectrophotometer at 260 nm.

5. Replace TE cuvette with cuvette containing DNA solution.

6. Determine absorption of DNA solution at 160 nm. If absorption at 160 is “off

scale”, dilute sample appropriately to have absorption within limit.

7. Select starting wavelength using knob ( ?) to 220 nm. Determine

absorption at 220 nm and enter in the Table below.

8. Using the wavelength knob, increase wavelength of 10 nm each

time upto 300 nm and record each result in the Table.

9. Replace DNA cuvette with a solution containing protein.

10. Follow the steps from 6 to 8 and enter results in Table below.

11. Draw graph of absorption spectrum for DNA and protein.

29
Table IV. Absorption of different wavelength of light by DNA and protein.

Wavelength
(nm) Absorption
Protein
DNA
220

230

240

250
260

270

280

290

300

30
Post lab questions

1. Define dependent and independent variable.

2. Values of dependent variable is plotted in the ------ axis and values independent
variable is plotted in the ----- axis.

3. Write down the absorption maxima of:

A) DNA:

B) RNA:

C) Protein:

31
4. What is the function of cuvette with TE solution.

5. Draw and label the structure of a nucleosome.

6. What did you learn about the properties of DNA when you have isolated DNA
from onion?

7. What structural property allowed DNA, but not RNA to be spooled out by a glass

rod?

8. What is the function of ethyl alcohol?

9. List three important uses of genomic DNA in the laboratory.

10. You are asked to determine DNA content of a liver tissue. Describe how you will

proceed in finding amount of DNA in the sample.

32
Lab. 4 Agarose gel electrophoresis: preparation and
loading DNA samples
Principle: Agarose gel electrophoresis is a technique widely used to separate molecules

based upon their charge, size and shape. It is particularly useful in separating charged

biomolecules such as DNA, RNA and protein. Molecules having a net negative charge

migrate towards the positive electrode (anode) while the net positively charged

molecules migrate towards the negative electrode (cathode). The buffer serves as a

conductor of electricity and to control the pH. Smaller molecules move through the

pores more easily than larger ones.

Hypothesis

Direction of migration of molecules in an electrical field is determined by its charge.

Prediction

Negative charged molecules will move toward anode (positively charged) electrode and

positively charged molecules will move toward cathode (negatively charged) electrode.

Pre-lab questions

1. Define electrophoresis.

2. List three key characteristics of DNA used in studying DNA in electrophoresis.

33
3. Why do you need to use a buffer while studying DNA by electrophoresis ?

4. What is the net charge of DNA at physiological pH (7.4)?

5. Which chemical entity of DNA (deoxynucleotide) is responsible for

developing this net charge of DNA?

6. Circle the appropriate word below. DNA in an electrical field will

move toward:

Positive electrode Negative electrode

7. Describe unique characteristics of agarose used in electrophoresis

34
Material

Gel tray Comb Agarose Running chamber with electrode

power supply, TBE buffer Globes micropipette Distilled water

Micropipette tips Graduated cylinder (1 L) Waste bin Microwave oven

Graduated cylinder (100 ml) 1.5 ml tubes and racks camera Rainbow colored

solutions Conical flask (250 ml) Weighing boat

35
Procedure:

Step I: Preparation of agarose gel (1%):

1. Weigh 1.0 g agarose powder in a conical flask (250 ml capacity).

2. Add 100 ml TBE (Trisma-Borate-EDTA) buffer into the conical flask.

3. Heat (~90oC) agarose suspension until it dissolves completely (do

not touch conical flask without gloves. You may burn your

hand)

4. Cool agarose solution to 55oC .

5. Make a set up for electrophoresis plate.

6. Pour appropriate amount of agarose solution into the electrophoresis plate.

7. Leave the plate at room temperature until agarose is solidified. Do

not disturb electrophoresis plate while gel is solidifying.

Well

36
B. Loading (pipetting) samples into the gel:

1. Set micropipette (p20) to 10 µL and attach a yellow tip.

2. Practice transferring 10 µL water three times (each student).

3. Place agarose gel (you prepared) in an electrophoresis chamber.

4. Add enough TBE buffer (1 mm above gel surface) to fully

submerge the loading wells in pipetting station.

5. Remove comb carefully and gently (do not break gel)

6. This stimulates an agarose gel in an electrophoresis chamber fill

with TBE buffer.

7. Load each type of 10 ul dye in designated well.

C. Electrophoresis:

1. Close electrophoresis chamber.

2. Run the gel at 100 v and observe the direction of dye movement.

3. Let run the from most dye travel about 60% of the gel.

4. Stop electrophoresis by disconnecting electric cord from outlet.

5. Open electrophoresis chamber and study gel.

37
Post-lab questions

1. What is the principle of electrophoresis.

2. Draw a picture of gel with labeling. Show positive and negative electrode.

Using letters “a, b, c, ---“indicate each type of colored molecules on gel

picture.

3. Which molecules are negatively charged?

4. Which molecules are positively charged?

38
Lab 5-7 Project 1: Molecular Cloning of Gene into
Plasmid Vector: Restriction digestion

When a population of cells is prepared by growth from a single cell, all the cells

in the population will be genetically identical. Such a population is called clonal. The

process of creating a clonal population is called cloning. The word “cloning” is

commonly used to indicate a technique to produce a large number of identical biological

entity. DNA cloning involves the use of manipulating DNA to produce multiple copies

of the identical DNA. Gene cloning requires a vector (usually plasmid) and gene (DNA)

of interest. A plasmid vector (Fig. below) is a small piece of DNA and usually have an

origin of replication, restriction endonuclease site, and a selection marker (antibiotic

resistant gene). For cloning purposes, plasmid and insertion DNA are cut with a

restriction endonuclease to produce DNA ends. Attachment of the insert DNA fragment

into the plasmid cloning vector is carried out by a process called “ligation” using DNA

ligase. Ligated DNA (called recombinant DNA) is then introduced into E. coli cells by a

process called transformation. While bacterial cell increase in number, the recombinant

DNA also increase in number. Recombinant DNA is then isolated in large amount from

bacteria and characterized.

39
Molecular cloning of DNA/gene involves the following main steps:

A. Restriction digestion of plasmid vector and insert DNA.

Steps: 1. Your instructor has taken two tubes Labeled “I” (for insert) and “P” (for plasmid).

2. Instructor has also added distilled water and restriction endonuclease buffer as shown

in Table below.

3. You will add Plasmid solution, insert DNA solution, and restriction endonuclease

(EcoRI) as shown in Table below:

Table V. Summary of the volume of chemicals to be added in experimental tube


(restriction endonuclease digestion).

I P

Instructor
H2O 23 23
added

Buffer
3 3

Plasmid
2 0
You add
Insert 0 2

EcoRI 2 2

5. Mix solution by tapering with finger.

6. Spin down (1000 rpm, 10 second) solution to bottom of the tube.

7. Incubate tubes at 37oC for 60 minutes.

40
B. DNA ligation: DNA ligation is a method of sealing two fragments of DNA. The process usually

performed by using an enzyme called DNA ligase. DNA pieces can be from either from same or different

sources. This very important technique used is genetic engineering. For ligation of plasmid and insert

DNA, transfer appropriate amount of the DNAs in a sterile 1.5 ml microfuge tubes (cloning sample tube

“S” and control tube “C”) as indicated in Table below.

Table VI. Summary of the volume of chemicals to be added in experimental tube (ligation).

Reagent Tube “S” Tube”C”

Plasmid/Eco RI 2 2

Insert/Eco RI 2 0

10X Ligase buffer 2 2

Dist. water 10 12

Ligase (0.5 unit/ul) 2 2

Incubate tubes at 4oC overnight.

41
C. Transformation of E. coli with recombinant plasmid DNA

Objective

1. Demonstrate successful transformation genetic material into Bacteria.

2. Determine the degree of success to genetically alter an organism.

Introduction

Genetic transformation occurs when a cell takes up (takes inside) and expresses a new

piece of genetic material—DNA. This new genetic information often provides the organism

with a new trait which is identifiable after transformation. A gene is a piece of DNA which

provides the instructions for making (codes for) a protein. This protein gives an organism a

particular trait/characteristics.Genetic transformation literally means change caused by genes and

involves the insertion of one or more gene(s) into an organism in order to change the organism’s

traits. Genetic transformation is used in many areas of biotechnology. In agriculture, genes

coding for traits such as frost, pest, or drought resistance can be genetically transformed into

plants. In bioremediation, bacteria can be genetically transformed with genes enabling them to

digest oil spills. In medicine, diseases caused by defective genes are beginning to be treated by

gene therapy; that is, by genetically transforming a sick person’s cells with healthy copies of the

defective gene that causes their disease. Genes can be cut out of human, animal, or plant DNA

and placed inside bacteria. For example, a healthy human gene for the hormone insulin can be

put into bacteria. Under the right conditions, these bacteria can make authentic human insulin.

This insulin can then be used to treat patients with the genetic disease, diabetes, because their

insulin genes do not function normally.

42
In this lab you will perform a procedure known as genetic transformation. Genetic

transformation literally means “change caused by genes,” and involves the insertion of a gene

into an organism in order to change the organism’s trait. You will use a procedure to transform

bacteria with a gene that codes for Green Fluorescent Protein (GFP). The real-life source of this

gene is the bioluminescent jellyfish Aequorea victoria. Green Fluorescent Protein causes the

jellyfish to fluoresce and glow in the dark. Following the transformation procedure, the bacteria

express their newly acquired jellyfish gene and produce the fluorescent protein, which causes

them to glow a brilliant green color under ultraviolet light.

In this activity, you will learn about the process of moving genes from one organism to

another with the aid of a plasmid. In addition to one large chromosome, bacteria naturally

contain one or more small circular pieces of DNA called plasmids. Plasmid DNA usually

contains genes for one or more traits that may be beneficial to bacterial survival. In nature,

bacteria can transfer plasmids back and forth allowing them to share these beneficial

genes. This natural mechanism allows bacteria to adapt to new environments. The recent

occurrence of bacterial resistance to antibiotics is due to the transmission of plasmids.

pGLO plasmid encodes the gene for GFP and a gene for resistance to the antibiotic ampicillin.

pGLO also incorporates a special gene regulation system, which can be used to control

expression of the fluorescent protein in transformed cells. The gene for GFP can be switched on

in transformed cells by adding the sugar arabinose to the cells’ nutrient medium. Selection for

cells that have been transformed with pGLO DNA is accomplished by growth on ampillicin

plates. Transformed cells will appear white (wild-type phenotype) on

plates not containing arabinose, and fluorescent green under UV light when arabinose is

included in the nutrient agar medium.

43
Pre-lab questions:

1. It is possible to transform an oorganism? Which Organism is most appropriate ?

2. How can you confirm that organism has been genetically transformed?

3. Predict the effect of ampicillin on the transformed and non-transformed E. coli cells?

4. What is the function of CaCl2 on E coli cells?

5. Define competent cells.

6.What is the function of heat shock during transformation?

7. On which of the plates would you expect to find bacteria most like the original

non-transformed E. coli colonies you initially observed? Explain your predictions.

44
8. If there are any genetically transformed bacterial cells, on which plate(s) would they

most likely be located? Explain your predictions.

Material

1. E. coli starter plate 11. LB nutrient broth 1

2. Poured agar plates (1 LB, 2 LB/amp, 1 LB/amp/ara) per group

3. Transformation solution (CaCl2) 12. Inoculation loops

4. Foam microcentrifuge tube holder/float 13. Pipets

5. Crushed ice (not cubed ice) 14. Marking pen

6. Microcentrifuge tubes 15. Microcentrifuge

7. Micropipettes and tips 16. Gloves

8. Waste disposal bin 17. pGLO plasmid solution (1 ng/µl)

9. 42°C water bath 18. UV Light

10. 37°C incubator

Procedure

1. Label one closed micro test tube +pGLO and another -pGLO. Label both tubes with

your group’s name. Place them in the foam tube rack.

2. Open the tubes and, using a sterile transfer pipet, transfer 250 µl of transformation

solution (CaCl2 ) into each tube.

45
4. Place the tubes on ice for 2 minutes.

4. Use a sterile loop to pick up 4 -8 large colonies of fresh bacteria from your starter plate.

Pick up the +pGLO tube and immerse the loop into the transformation solution at the bottom of

the tube. Spin the loop between your index finger and thumb until the entire colony is dispersed

in the transformation solution (with no floating chunks). Place the tube back in the tube rack in

the ice.

5. Using a new sterile loop, repeat for the -pGLO tube.

46
6. Examine the pGLO DNA solution with the UV lamp. Pipet 10 µl of pGLO plasmid into the

+pGLO tube & mix. (Do not add plasmid DNA to the -pGLO tube. Close both the + pGLO and -

pGLO tubes and return them to the rack on ice.).

7. Incubate the tubes on ice for 10 min. Make sure to push the tubes all the way down in

the rack so the bottom of the tubes stick out and make contact with the ice.

8. While the tubes are sitting on ice, label your four LB nutrient agar plates on the bottom

(not the lid) as follows: Label the LB plate: pGLO-, Label one LB/amp plate: Amp/pGLO-

,Label the other LB/amp plate: Amp/pGLO+, Label the LB/amp/ara plate: AMP/Ara/pGLO +,

9. Heat shock. Using the foam rack as a holder, transfer both the (+) pGLO and

(-) pGLO tubes into the water bath, set at 40o C, for 30 sec.

10. When the 30 sec are done, place both tubes back on ice for 2 min.

47
11. Remove the rack containing the tubes from the ice and place on the bench top.

12. Open a tube and add 250 µl of LB nutrient broth to the tube and reclose it.

13. Repeat with a new sterile pipet for the other tube. Incubate the tubes for 10 min at room

temperature.

14. Gently flick the closed tubes with your finger to mix and resuspend the bacteria.

15. Using a new sterile pipet for each tube, pipet 100 µl of the transformation and control

suspensions onto the appropriate nutrient agar plates.

16. Use a new sterile loop for each plate. Spread the suspensions evenly around the

surface of the LB nutrient agar by quickly skating the flat surface of a new sterile loop

back and forth across the plate surface.

48
17. Stack up your plates and tape them together. Put your group name and class period

on the bottom of the stack and place the stack of plates upside down in the 37°C

incubator until the next day. The plates are inverted to prevent condensation on the

lid which may drip onto the culture and interfere with your results.

49
Results

Observe your plate under normal and UV light and record your observation in the table below./

Table VII. Number of transformed E. coli colonies in different plates.

Fluorescent

Hints:

1. How much bacterial growth do you see on each plate, relatively speaking?

2. What color are the bacteria?

3. How many bacterial colonies are on each plate (count the spots you see).

Determine total number of ampicillin resistant colonies: sum of #Amp pGLO +, and

pAmp/Ara/pGLO+.

Determine average number of colonies per plate = Total number of colonies / 2

50
Transformation efficiency. Qquantitative measurement of genetically modified E. coli cells is

referred to as the transformation efficiency. Usually, transformation efficiency is expressed as

number of antibiotic resistant colonies appeared per microgram of plasmid DNA. The

transformation efficiency is determine how well the E. coli cells are for genetic transformation is

working. The transformation efficiency is calculated using the following formula:

Transformation efficiency = Total number of colonies growing on the agar plate


per µg plasmid DNA.

To calculate the efficiency, you will need :

The total amount of pGLO plasmid DNA in the bacterial cells spread on each plate.

Determining the Total Amount of pGLO plasmid DNA


DNA in µg = (concentration of DNA in µg/µl) x (volume of DNA in µl)

In this experiment you used 10 µl of pGLO at concentration of 0.001 µg/µl. This

means that each microliter of solution contained 0.001 µg of pGLO DNA. Calculate

the total amount of DNA used in this experiment.

Enter that number here ➜

Total number of ampicillin resistant colonies per plate =

Determining the fraction of pGLO plasmid DNA (in the bacteria) that actually got spread

onto the LB/amp/ara plate:

Volume spread on LB/amp plate: 100 (µl)

Total sample volume in test tube: 510 (µl)

51
pGLO DNA spread in µg = Total amount of DNA used in µg x fraction of DNA used

Transformation efficiency = Total average number of colonies growing on the agar plate / pGLO

DNA used in µg. (usually expressed number of colonies/µg plasmid

DNA.

Enter transformation efficiency of each group in the Table.

Table VIII. Transformation efficiency competent cells prepared by different groups.

Group Name Transformation


efficiency

52
Post lab questions

1. Which plates should be compared to determine if any genetic transformation has

occurred? Why?

2. What is meant by a control plate? What purpose does a control serve?

3. What’s Glowing in E. coli cell when exposed to UV light?

4. What is the function of Arabinose?

5. What is the transformation efficiency of your competent E. coli cell?

6. Scientists prepare competent E. coli cells having a transformation efficiency of about 108

cells/ug plasmid DNA. Compare your competent E. coli cells with those prepared by scientists.

7. Calculate % score of your E. coli transformation efficiency (T.E.).

Your T.E.

% score = ------------------------------------------- X 100

T.E. of professionals (108)

53
Commonly used reagents and terms:

1. Agar: A gelatinous substance derived from seaweed. Provides a solid

Matrix below 55oC to support bacterial growth. Agar becomes liquid above 55oC. This is a very useful

characteristic of agar to be used in scientific experiments.

2. Antibiotic Selection: Use of an antibiotic to select bacteria containing the DNA of interest. The pGLO

plasmid DNA contains the gene for beta-lactamase that provides resistance to the antibiotic ampicillin. Once

bacteria aretransformed with the pGLO plasmid, they begin producing and secreting beta-lactamase protein.

Secreted beta-lactamase breaks down ampicillin, rendering the antibiotic harmless to the bacterial host. Only

bacteria containing the pGLO plasmid can grow and form colonies in nutrient medium containing ampicillin,

while untransformed cells that have not taken up the pGLO plasmid cannot grow on the ampicillin selection

plates.

2. Arabinose: A carbohydrate isolated from plants that is normally used as source of food by bacteria. In this

experiment, arabinose initiates transcription of the GFP gene resulting in fluorescent green cells under UV

light.

3. Colony: A clump of genetically identical bacterial cells growing on an agar

plate. Because all the cells in a single colony are genetically identical,

they are called clones.

4. Culture Media: The liquid and solid media referred to as LB (named after Luria and

Bertani) broth and agar are made from an extract of yeast and an enzymatic digest of meat byproducts

which provide a mixture of carbohydrates, amino acids, nucleotides, salts, and vitamins, all of which

are nutrients for bacterial growth. Agar, which is from seaweed,

polymerizes when heated and cooled to form a solid gel (similar to Jell-O gelatin), and functions to provide

a solid support on which to culture the bacteria.

5. Genetic Engineering. The manipulation of an organism’s genetic material (DNA) by

introducing or eliminating specific genes.

6. Gene Regulation. Gene expression in all organisms is carefully regulated to allow for differing

conditions and to prevent wastefuloverproduction of unneeded proteins. The genes involved in the transport

and breakdown of food are good examples of highly regulated genes. For example, the simple sugar,

54
arabinose, can be used as a source of energy and carbon by bacteria. The bacterial enzymes that are needed

to break down or digest arabinose for food are only expressed in the absence of arabinose but are expressed

when arabinose is present in the environment. In other words when arabinose is around, the genes for these

digestive enzymes are turned on. When arabinose runs out these genes are turned back off.

7. Fluorescent Protein gene. Green Fluorescent Protein Green Fluorescent Protein (GFP) was originally

isolated from the bioluminescent jellyfish, Aequorea victoria. The gene for GFP has recently been cloned. The

unique three-dimensional conformation of GFP causes it to

resonate when exposed to ultraviolet light and give off energy in the form of visible green light. When

exposed to UV light, the electrons in GFP's chromophore are excited to a higher energy state. When they

drop down to a lower energy state, they emit a longer wavelength of visible

fluorescent green light at ~509 nm.

8. Plasmid. A circular DNA molecule, capable of self-replicating, carrying one or more genes for antibiotic

resistance proteins and a cloned foreign gene such as GFP. It is an

extra-chromosomal DNA molecule separate from the chromosomal DNA. Plasmids usually occur naturally in

bacteria.

9. pGLO Plasmid containing the Green Fluorescent Protein gene sequence and ampicillin resistance gene,

which codes for beta-lactamase.

10. Recombinant DNA technology. The process of cutting and recombining DNA fragments. Technology as

a means to isolate genes or to alter their structure and function.

55
D. Isolation of Plasmid DNA from transformed E. coli cells

A plasmid is a DNA molecule that is separate from, and can replicate independently of, the

chromosomal DNA. They are double-stranded and, in many cases, circular. Plasmids usually

occur naturally in bacteria, but are sometimes found in eukaryotic organisms (e.g., the 2-

micrometre ring in Saccharomyces cerevisiae). Plasmid sizes vary from 1 to over 1,000 kbp. The

number of identical plasmids in a single cell can range anywhere from one to even thousands

under some circumstances. Plasmids can be considered mobile because they are often associated

with conjugation, a mechanism of horizontal gene transfer. The term plasmid was first

introduced by the American molecular biologist Joshua Lederberg in 1952. Plasmids are

considered replicons, capable of replicating autonomously within a suitable host. Plasmids can

be found in all three major domains: Archaea, Bacteria, and Eukarya.

Plasmids used in genetic engineering are called vectors. Plasmids serve as important tools

in genetics and biotechnology labs, where they are commonly used to multiply (make many

copies of) or express particular genes. Many plasmids are commercially available for such uses.

The gene to be replicated is inserted into copies of a plasmid containing genes that make cells

resistant to particular antibiotics and a multiple cloning site (MCS, or polylinker), which is a

short region containing several commonly used restriction sites allowing the easy insertion of

DNA fragments at this location.

56
In this laboratory, plasmid DNA will be purified using a plasmid mini kit is and eluted

into a small volume of aqueous buffer and is free of salts, bacterial chromosomal DNA, and

RNA. The purity of the plasmid produced by this system makes it ideal for use in automated

fluorescent sequencing and in any other molecular biology application.

Pre-lab questions:

Materials

1. Resuspension solution 7.Microcentrifuge 13. Lysis solution

2. Neutralization solution 8.Wash solution 14. Elution solution

3. plasmid mini columns 9.Gloves 15. Micropipettes

4. 2 ml capless wash tubes 10.Biohazard waste bin 16. LB broth

5. 15 ml sterile tubes 11. Incubator shaker 17. Ethanol

6. Inoculating needle, burner 12. Ampicillin 18. Plasmid isolation kit

Pre- lab questions

1. Define a plasmid.

2. List four important characteristics of plasmid DNA.

3. Describe the function of:

A. Lysis solution:

57
B. Neutralization solution:

C. Wash solution:

D. Elution solution:

E. Ethanol:

Procedure

I. Plasmid containing E. coli culture

1. Take 5 ml culture tube. Label your name and #1 and #2. Add 2 ml LB (Luria-Bertani

broth) containing 50 µg/ml ampicillin in each tube.

2. Each student will inoculate one ampicillin resistant E. coli colony in each of 15 ml

culture tube. YOUR INSTRUCTOR WILL SHOW HOW TO INOCULATE E. COLI.

3. Incubate tubes in a incubator shaker overnight at 37oC.

II. Plasmid isolation

1. Transfer up to 1.5 ml of plasmid-containing bacterial host to a 1.5–2.0 ml

58
capped microcentrifuge tube. Pellet the cells by centrifugation at 12 krpm for 3 min.

Remove all supernatant by decanting or pipetting.

2. Add 250 µl of resuspension solution and vortex or pipet up and down until

the cell pellet is completely resuspended.

3. Add 250 µl of lysis solution and mix by inverting the capped tube briskly

6–8 times. DO NOT VORTEX OR SHAKE. The solution should become

viscous and slightly clear.

Note: The neutralization solution should be added within 5 min after lysis.

4. Add 350 µl of neutralization solution and mix by inverting the capped tube

briskly 6–8 times. DO NOT VORTEX OR SHAKE. A visible precipitate should

form.

5. Centrifuge the neutralized lysate at 12 krpm for 5 min. A compact white debris pellet

will form along the side or at the bottom of the tube. The supernatant or cleared

lysate contains the plasmid DNA.

6. While centrifuging the lysate, insert a plasmid mini column into a 2 ml

capless wash tube (provided).

7. By decanting or pipetting, transfer the cleared lysate from step 5 to the

plasmid mini column. Centrifuge at 12 krpm for 1 min.

8. The wash solution is supplied as a 5x concentrate. Add 4 volumes (100 ml)

of 95–100% ethanol or reagent-grade (denatured) ethanol before initial use. Your

instructor will add ethanol to prepare 1X wash buffer.

9. Remove the plasmid mini column from the wash tube. Discard the filtrate

from the tube, and replace the column into the same wash tube. Add 750 µl

59
of wash solution and centrifuge at 12 krpm for 1 min.

10. Discard the wash solution from the tube, and replace the column into the

same wash tube. Centrifuge at 12 krpm for 1 additional minute to remove residual wash

solution.

11. Transfer the plasmid mini column to a 1.5–2.0 ml capped microcentrifuge

tube.. Add 50 µl of elution solution onto the membrane stack

at the base of the column and allow 2 min for the solution to saturate the

membranes. Centrifuge for 1 min to elute the plasmid.

11. Discard the mini column and store the eluted DNA at 4ºC. Plasmid DNA is ready for use.

60
E. Restriction Mapping of Plasmid DNA
A restriction map is a description of restriction endonuclease cleavage sites within

a piece of DNA. Generating such a map is usually the first step in characterizing an

unknown DNA, and a prerequisite to manipulating it for other study. Restriction mapping

involves digesting DNA with a series of restriction enzymes and then separating the

resultant DNA fragments by agarose gel electrophoresis. The distance between restriction

enzyme sites can be determined by the patterns of fragments that are produced by the

restriction enzyme digestion. In this way, information about the structure of an unknown

piece of DNA can be obtained.

In this experiment, plasmid DNA isolated in previous experiment will be cut with

restriction enzymes and the resulting restriction fragments are separated using gel

electrophoresis. Three samples of plasmid DNA are incubated at 37°C, each with one of three

restriction endonucleases: BamHI, EcoRI, and HindIII. A fourth sample, the negative

control, is incubated without an endonuclease. The DNA samples are then loaded into wells of

an agarose gel and electrophoresed. An electrical field applied across the gel causes the DNA

fragments in the samples to move from their origins (sample wells) through the gel matrix

toward the positive electrode. The restriction patterns are made visible by staining with a

compound that binds to DNA.

61
Pre-lab study and questions:

1. What is restriction endonuclease ? Study the base of the DNA below. If EcoRI

recognizes base sequence of GAATTC, write the DNA fragments (showin base

sequence) that will be produced after EcoRI digestion of this DNA.

5’ACGCGAATTGAATTCGATCGAATCCAGTAGCCGCAATTCCAAGAATTCTTC 3’
3’TGCGCTTAACTTAAGCTAGCTTAGGTCATCGGCGTTAAGGTTCTTAAGAAG 5’

2. An example of how restriction map is constructed is shown below. You have isolated a

clone in pBluescript. Big pBluescript portion of the plasmid is 3.0 kilobases and

restriction enzymes are present in the plasmid is known. You also know that the insert is

2.0 kb long and that it is inserted the Eco RI site. Your task is to find out more

information about the insert:

Digest plasmid with an enzyme that you know is in the pBluescript plasmid. Plasmid

DNA was digested with Bam HI and digested DNA fragment were studied by electrophoresis. A

picture of gel is shown below:

62
The sizes of the two fragments (determined by electrophoresis) will tell you where the

site is. In this case, we learn two pieces of information: 1) that there is a Bam HI site in the

insert, and 2) where the site is in relation to the one end of the insert. When the Bam HI digestion

is separated on an agarose gel, the sizes of the two fragments can be determined. In the above

gel, the fragments are 3.6 kb and 1.4 kb. Therefore, we know that the Bam HI site is 1.4 kb away

from the right hand side of the insert below.

In this way, you have "mapped" the Bam HI site:

63
Materials

1. Agarose 2. Loading dye 3. TBE buffer

4. 1.5 mL Reaction tubes 5. Gloves 6. Restriction buffer

7. Plasmid DNA 8. Restriction enzymes (BamHI, EcoRI, HindIII)

9. Micropipettors micropipet tips 10. Gel electrophoresis chambers and power supplies.

11. Masking tape for sealing 12. Gel-casting tray 13. Cracked ice

14. Sterile distilled water 15. Ppermanent laboratory markers

16. Microwave oven 17. Water bath at 37°C 18. Semilog graph paper

19. Metric rulers 20. UV light source

21. A Polaroid® “gun” camera or other camera is desirable for recording results.

Procedure
A: Set Up Restriction Digestion (Students work in group)

1. Label four 1.5-mL tubes, in which they will perform restriction reactions: B for

BamHI, E for EcoRI, H for HindIII, and –C for control.

One set for “1”

One set for “2”

2. Read down each column (Table below), add the same reagent to all appropriate tubes;

use a fresh tip for each reagent.

64
Table IX. Summary of the volume of chemicals to be added in different tubes.

Tube DNA Buffer EcoRI BamHI Hind III Water


(clone)
E 8 µL 1 µL 1 µL - - -

B 8 µL 1 µL - 1 µL - -

H 8 µL 1 µL - - 1 µL -

C 8 µL 1 µL - - - 1 µL

*All groups share the same BamHI, EcoRI, HindIII enzymes , buffer, and water.

3. Pool reagents and mixed by tapping the tube bottom on lab bench, or with a short pulse

in a microcentrifuge.

4. Incubate all reaction tubes for a minimum of 60 minutes at 37°C. You may need to

incubate the reactions for a longer period (you’re your instructor asks for).

B: Cast Agarose Gel

1. Seal ends of gel-casting tray with tape, and insert well forming comb. Place gel-

casting tray out of the way on lab bench, so that agarose poured in next step can set

undisturbed.

2. Dissolve 1 g agarose per 100 mL of TBE buffer by heating in a microwave oven. Cool

agarose solution (1%) on to about 60oC.

65
3. Carefully pour enough agarose solution into casting tray to fill to a depth of about 7

mm of comb teeth. While gel is still liquid, a pipet tip is used to move large bubbles or

solid debris to sides or end of tray.

3. Gel will become cloudy as it solidifies (about 10 minutes). Do not move or jar casting

tray while agarose is solidifying.

4. When agarose has set, unseal ends of casting tray and place tray on platform of gel box

so that comb is at negative (black) end.

5. Fill box with tris-borate-EDTA (TBE) buffer to a level that just covers entire surface of gel.

6. Gently remove comb, taking care not to rip wells (instructor will demonstrate).

7. Make certain that sample wells left by comb are completely submerged. If “dimples”

are noticed around wells, students slowly add buffer until dimples disappear. The gel is

now ready to load with DNA.

C. Load Gel:

1. Draw a gel showing the samples to be loaded in the specified well as shown

below:

M C E B H

Well

M: Molecular weight size marker

C: Control

E: EcoRI digest

B: BamHI digest

H: Hind III digest

66
2. Students add 1 µL loading dye to each reaction tube and mix dye with digested

DNA by tapping tube on lab bench, or with a pulse in microcentrifuge.

3. Students use a micropipet to load contents of each reaction tube (11 µL) into a

separate well in gel, as shown above. Students must use a fresh tip for each reaction tube.

• Steady pipet over well using two hands.

*Be careful to expel any air in micropipet tip end before loading gel.

• Dip pipet tip through surface of buffer, position it over the well, and slowly expel the mixture.

Sucrose in the loading dye weighs down the sample, causing it to sink to the bottom of the well.

Be careful not to punch tip of pipet through the bottom of the gel.

D. Electrophoresis:

1. Students close top of electrophoresis chamber and connect electrical leads to an

approved power supply, anode to anode (red-red) and cathode to cathode (black-black).

Make sure both electrodes are connected to same channel of power supply.

2. Students turn power supply on, and set voltage 100 v as directed by the instructor.

Shortly after current is applied, loading dye can be seen moving through gel toward

positive pole of electrophoresis apparatus.

3. The loading dye (color) will start moving toward anode. Xylene cyanol (a dye)

migrates at a rate equivalent to approximately 2000 base pairs while bromophenol blue

band moves approximately 500 base pair in a 1% gel.

5. Allow the DNA to electrophorese until the nears the end (~80%) of the gel.

5. Students turn off power supply, disconnect leads from the inputs, and

remove top of electrophoresis chamber.

6. Students should carefully remove casting tray and slide gel into

staining tray labeled with their group name. The students bring their

67
gels to the instructor for staining.

E. Ethidium Bromide Staining :

Ethidium bromide, like many natural and man-made substances, is a

mutagen and a suspected carcinogen. With responsible handling, the dilute staining

solution (1 µg/mL) poses minimal risk:

1. Wear rubber gloves when staining gel, viewing gels, and cleaning up.

2. Confine all staining to sink area restricted from student use.

3. Flood gels with ethidium bromide solution, and allow to stain for 5

minutes. (Staining time depends on thickness of gel.)

4. Following staining, use funnel to decant as much ethidium bromide

solution as possible from staining tray back into storage container.

F. Record results and analysis.

1. Keep a metric ruler beside the gel.

2. Examine your stained gel on a UV transilluminator.

3. Record gel results by taking a picture.

4. Measure from front edge of well to front edge of each band. Enter distances into

matrix. Alternatively, have students measure distance directly from stained gel or

from a photo of their ethidium stained gel.

5. Measure distance travelled by each DNA fragment and enter in the Table below.

6. Match base-pair sizes of Hind III fragments with bands that appear in the ideal digest.

Label each band with kilobase-pair (kbp) size. For example, 27,491 bp equals 27.5 kbp.

68
7. Set up semilog graph paper with distance migrated as the x (arithmetic) axis and log of

base-pair length as the y (logarithmic) axis. Then, plot distance migrated versus base-pair

length for each standard size marker DNA.

8. Connect data points with each other.

9. Locate on x axis the distance migrated by the first EcoRI fragment. Using a ruler, draw

a vertical line from this point to its intersection with the standard curve.

10. Now extend a horizontal line from this point to the y axis. This gives the base-pair

size of this EcoRI fragment.

11. Repeat Steps 9 and 10 for each HindIII and BamHI fragment.

12. Enter the base-pair size of EcoRI, HindIII, and BamHI fragments.

Table X. Summary of the DNA fragments characterized by agarose gel electrophoresis.

Size Marker EcoRI BamHI Hind III

Distance Size Distance Size Distance Size Distance Size

69
70
Post Lab questions

1. The electrophoresis apparatus creates an electrical field with positive and negative

poles at the ends of the gel. DNA molecules are negatively charged. To which electrode

pole of the electrophoresis field would you expect DNA to migrate? (+ or -)? Explain.

2. What color represents the negative pole?

3. After DNA samples are loaded into the sample wells, they are “forced” to move through

the gel matrix. What size fragments (large vs. small) would you expect to move toward

the opposite end of the gel most quickly? Explain.

4. Which fragments (large vs. small) are expected to travel the shortest distance from the

well? Explain.

5. . What can you assume is contained within each band?

3. What would be a logical explanation as to why there is more than one band of DNA for

each of the samples?

71
4. What caused the DNA to become fragmented?

5. Which sample has the smallest DNA fragment?

7. Assuming a circular piece of DNA (plasmid) was used as starting material, how many

restriction sites were there in lane three?

8. What determines where a restriction endonuclease will “cut” a DNA molecule?

9. A restriction endonuclease “cuts” two DNA molecules at the same location. What can

you assume is identical about the molecules at that location?

72
Lab 7 and 9 Project 2: Polymerase Chain Reaction:
Identification of a specific sequence of DNA in human genome

Introduction

In 1983, Kary Mullis at Cetus Corporation developed the molecular biology technique

that has since revolutionized genetic research, earning him the Nobel Prize in 1993. This

technique, termed the polymerase chain reaction (PCR), transformed molecular biology

into a multidisciplinary research tool. Many molecular biology techniques used before PCR

were labor intensive, time consuming and required a high level of technical expertise.

Additionally, working with only trace amounts of DNA made it difficult for researchers in

other biological fields (pathology, botany, zoology, pharmacy, etc.) to incorporate

molecular biology into their research schemes.

PCR had an impact on four main areas of biotechnology: gene mapping, cloning, DNA

sequencing, and gene detection. PCR is now used as a medical diagnostic tool to detect

specific mutations that may cause genetic disease, in criminal investigations and courts of

law to identify suspects on a molecular level, and in the sequencing of the human genome.

Prior to PCR the use of molecular biology techniques for therapeutic, forensic, pharmaceutical,

or medical diagnostic purposes was not practical or cost-effective. The development of

PCR technology changed these aspects of molecular biology from a difficult science to

one of the most accessible and widely used tools in genetic and medical research.

PCR produces exponentially large amounts of a specific piece of DNA from trace

amounts of starting material (template). The template can be any form of double-stranded

DNA, such as genomic DNA. A researcher can take trace amounts of DNA from a drop of

blood, a single hair follicle, or a cheek cell and use PCR to generate millions of copies of a

73
desired DNA fragment. In theory, only one single template strand is needed to generate

millions of new DNA molecules. Prior to PCR, it would have been impossible to do forensic or

genetic studies with this small amount of DNA. The ability to amplify the precise sequence of

DNA that a researcher wishes to study or manipulate is the true power of PCR. PCR

amplification requires the presence of at least one DNA template strand. In this experiment,

human genomic DNA isolated from students own cells will be the source of the template

strands. One of the main reasons PCR is such a powerful tool is its simplicity and specificity. All

that is required are inexpensive reaction buffers, four DNA subunits (deoxynucleotide

triphosphates of adenine, guanine, thymine, and cytosine), a DNA polymerase, two DNA

primers, and minute quantities of the template strand that one wants to amplify. Specificity

comes from the ability to target and amplify one specific segment of DNA out of a complete

genome. PCR Makes Use of Two Basic Processes in Molecular Genetics

1. Complementary DNA strand hybridization

2. DNA strand synthesis via DNA polymerase

In the case of PCR, complementary strand hybridization takes place when two different

oligonucleotide primers anneal to each of their respective complementary base pair

sequences on the template. The two primers are designed and synthesized in the laboratory

with a specific sequence of nucleotides such that they can anneal at the opposite ends and

on the opposite strands of the stretch of double-stranded DNA (template strand) to be

amplified.

Before a region of DNA can be amplified, one must identify and determine the sequence

of a piece of DNA upstream and downstream of the region of interest. These areas are then used

to determine the sequence of oligonucleotide primers that will be synthesized and used as

74
starting points for DNA replication. Primers are complimentary to the up- and downstream

regions of the sequence to be amplified, so they stick, or anneal, to those regions. Primers are

needed because DNA polymerases can only add nucleotides to the end of a preexisting

chain.

The DNA polymerase used in PCR must be a thermally stable polymerase because the

polymerase chain reaction cycles between temperatures of 60°C and 94°C. The

thermostable DNA polymerase (Taq) used in PCR was isolated from a thermophilic

bacterium, Thermus aquaticus, which lives in high-temperature steam vents such as those

found in Yellowstone National Park.

Two new template strands are created from the original double-stranded template on each

complete cycle of the strand synthesis reaction. This causes exponential growth of the number of

template molecules, i.e., the number of DNA strands doubles at each cycle. Therefore, after

30 cycles there will be 230 , or over 1 billion, times more copies than at the beginning. Once

the template has been sufficiently amplified, it can be visualized. This allows researchers to

determine the presence or absence of the desired PCR products and determine the

similarities and differences between the DNA of individuals. Depending on the DNA

75
sequence analyzed, differences among individuals can be as great as hundreds of

base pairs or as small as a single base pair or single point mutation.

In this activity, students will isolate their own genomic DNA from their cells. They will

use primers that flank both the entire Alu insertion (300 base pairs in length) and 641 base pairs

of the PV92 locus to amplify a 941 base pair fragment (if the Alu element is present) or a 641

base pair fragment (if the Alu element is absent). Agarose gel electrophoresis of the PCR

products is sufficient to distinguish among homozygotes (+/+) for the presence of the Alu

repeat (941 base pair product only), homozygotes (–/–) for the absence of the Alu repeat (641

base pair product only), and heterozygotes (+/–) having both the 641 and the 941 base pair

products.

76
PCR Step by Step

PCR involves a repetitive series of cycles, each of which consists of template

denaturation, primer annealing, and extension of the annealed primer by Taq DNA polymerase.

The first step of the PCR temperature cycling procedure involves heating the sample to

94°C. At this high temperature, the template strands separate (denature). This is called the

denaturation step.

In second step thermal cycler then rapidly cools to 60°C to allow the primers to anneal to

the separated template strands. This is called the annealing step. The two original template

strands may reanneal to each other or compete with the primers for the primers complementary

binding sites. However, the primers are added in excess such that the primers actually out-

compete the original DNA strands for the primers’ complementary

binding sites.

In third step, the thermal cycler heats the sample to 72°C for Taq DNA polymerase to

extend the primers and make complete copies of each template DNA strand. This is called the

extension step. Taq polymerase works most efficiently at this temperature. Two new copies of

each complementary strand are created. There are now two sets of double-stranded DNA

(dsDNA). These two sets of dsDNA can now be used for another cycle and subsequent strand

synthesis.

Therefore, if 20 thermal cycles were conducted from one double-stranded DNA

molecule, there would be 1 set of original genomic template DNA strands, 20 sets of

intermediate template strands, and 1,048,576 sets of precise-length template strands. After 40

cycles, there would be 1 set of original genomic template DNA strands, 40 sets of intermediate

template strands, and 1.1 x 1012 sets of precise-length template strands (Figure below).

77
Pre-lab study and questions

1. A single-stranded DNA has a base sequence of 5’ GACTCCGTAACGGTTAACC 3’. Study

the DNA sequences shown below that will base pair (hybridize) with this DNA. Circle the

correct answer (s).

5’ GACTCCGTAACGGTTAACC 3’

5’CTGAGGCATTGCCAATTGG 3’

3’CTGAGGCATTGCCAATTGG 5’

5’ AGGCATTGCCAATT 3’

3’ AGGCATTGCCAATT 5’

2.Why is it necessary to chelate the metal ions from solution during the boiling/lysis step

at 100°C? What would happen if you did not use a chelating agent such as the InstaGene matrix?

3. What is needed from the cells for PCR?

4. What structures must be broken to release the DNA from a cell?

5. Why do you think the DNA is stored cold with the InstaGene matrix after boiling the

samples?

78
6. Why is it necessary to have a primer on each side of the DNA segment to be amplified?

7. How did Taq DNA polymerase acquire its name?

8. Why are there nucleotides (A, T, G, and C) in the master mix? What are the other

components of the master mix, and what are their functions?

9. Describe the three main steps of each cycle of PCR amplification and what reactions

occur at each temperature.

10. Explain why the precise length target DNA sequence doesn’t get amplified until the

third cycle. You may need to use additional paper and a drawing to explain your

answer.

79
Materials

A. DNA Template Preparation

1. 1.5 ml micro test tubes 6. Screwcap tubes with InstaGene matrix

3. Foam micro test tube holders 7. Micropipets, tips

4. Permanent marker 8. Waste container

5. Cups with 10 ml 0.9% saline 9. Microcentrifuge

6. Water baths (56 and 100°C) 10. Vortexer

B. PCR Amplification

1. PCR tubes 7. Gel trays

2. Complete master mix (containing primers) 8. Molten agarose

3. micro test tube holders 9. Lab tape

4. Ice bucket with ice 10. MyCycler™ thermal cycler

5. Permanent marker 11. Microcentrifuge

6. Waste container

7. Amplified positive control samples

PV92 homozygous (+/+)

PV92 homozygous (–/–)

PV92 heterozygous (+/–)

C. Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels


1. Agarose gel 6. Foam micro test tube holders

2. PCR samples 7. Gel box and power supply

3. DNA loading dye 8. Gel staining tray

4. EZ Load™ molecular mass ruler (DNA standards)

5. Permanent marker 9. Waste container 10. Microcentrifuge

80
Procedure

A. Cheek Cell DNA Template Preparation (Protocol)

1. Each member of your team should have 1 screwcap tube containing 200 µl

InstaGene™ matrix, 1.5 ml micro test tube, and a cup containing 10 ml of 0.9% saline

solution. Label one of each tube and a cup with your initials.

2. Do not throw away the saline after completing this step. Pour the saline from the cup

into your mouth. Rinse vigorously for 30 seconds. Expel the saline back into the cup.

3. Set a P-1000 micropipet to 1,000 µl and transfer 1 ml of your oral rinse into the micro

test tube with your initials. If no P-1000 is available, carefully pour ~1 ml of your

swished saline into the micro test tube (use the markings on the side of the micro test

tube to estimate 1 ml).

4. Spin your tube in a balanced centrifuge for 2 minutes at 10 krpm. When the centrifuge

has completely stopped, remove your tube. You should be able to see a pellet of

whitish cells at the bottom of the tube. Ideally, the pellet should be about the size of a

match head. If you can’t see your pellet, or your pellet is too small, pour off the saline

81
supernatant, add more of your saline rinse, and spin again.

5. Pour off the supernatant and discard. Taking care not to lose your cell pellet, carefully

blot your micro test tube on a tissue or paper towel. It’s ok for a small amount of

saline (~50 µl, about the same size as your pellet) to remain in the bottom of the

tube.

6. Resuspend the pellet thoroughly by vortexing or flicking the tubes until no cell clumps

remain.

7. Using an adjustable volume micropipet set to 20 µl, transfer your resuspended cells into

the screwcap tube containing the InstaGene with your initials. You may need to use the

pipet a few times to transfer all of your cells.

8. Screw the caps tightly on the tubes. Shake or vortex to mix the contents.

9. Place the tubes in the foam micro test-tube holder. When all members of your team have

collected their samples, float the holder with tubes in a 56°C water bath for 10 minutes. At

the halfway point (5 minutes), shake or vortex the tubes several times. Place the tubes

back in the water bath for the remaining 5 minutes.

82
10. Remove the tubes from the water bath and shake them several times. Now float the

holder with tubes in a 100°C water bath for 5 minutes.

11. Remove the tubes from the 100°C water bath and shake or vortex several times to

resuspend the sample. Place the eight tubes in a balanced arrangement in a centrifuge.

Pellet the matrix by spinning for 5 minutes at 6,000 x g (or 10 minutes at 2,000 x g).

12. Store your screwcap tube in the refrigerator until the next laboratory period, or proceed

to step 2 of Lesson 2 if your teacher instructs you to do so.

B. PCR Amplification (Protocol)

1. Obtain your screwcap tube that contains your genomic DNA template from the

refrigerator. Centrifuge your tubes for 2 minutes at 6,000 rpm or for 5 minutes at

3,000 rpm in a centrifuge.

2. Each member of the team should obtain a PCR tube and capless micro test tube. Label

each PCR tube on the side of the tube with your initials and place the PCR tube into the

capless micro test tube as shown. Place the PCR tube in the foam micro test tube holder.

83
Table XI: Summary of mixing chemicals for PCR

Reagent C +/+ +/- -/- V X Y Z

Genomic 0 20 20 20 20 20 20 20
DNA, µL

Master mix, 20 20 20 20 20 20 20 20

µL

H2O, µL 20 0 0 0 0 0 0 0

3. Transfer 20 µl of your DNA template from the supernatant in your screwcap tube into

the bottom of the PCR tube. Do not transfer any of the matrix beads into the PCR

reaction because they will inhibit the PCR reaction.

84
4. Locate the tube of yellow PCR master mix (labeled “Master”) in your ice bucket.

Transfer 20 µl of the master mix into your PCR tube. Mix by pipetting up and down

2–3 times. Cap the PCR tube tightly and keep it on ice until instructed to proceed to the

next step. Avoid bubbles, especially in the bottom of the tubes.

5. Remove your PCR tube from the capless micro test tube and place the tube in the thermal cycler.

6. When all of the PCR samples are in the thermal cycler, the teacher will begin the PCR

reaction. The reaction will undergo 35 cycles of amplification, which will take

approximately 3 hours.

PCR Program:

95oC 95oC 55oC 72oC 72oC 4o C

30 sec 30 sec 30 sec 60 sec 5 min ∞

35 cycles

D. Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose


Gels (Protocol)
1. Remove your PCR samples from the thermal cycler and place in the micro test tube

holder. If a centrifuge is available, place the PCR tubes in the capless micro test tubes

and pulse-spin the tubes (~3 seconds at 2,000 x g) to bring the condensation that

formed on the lids to the bottom of the tubes.

85
2. Take 10 µL PCR sample in separate 1.5 mL tubes.

3. Add 2 µl of loading dye to each of 10 µL PCR sample tube and mix gently.

3. Obtain an agarose gel (either the one you poured or one pre-poured by your teacher).

( See Lab 3 protocol)

Place the casting tray with the solidified gel in it, onto the platform in the gel box. The

wells should be at the cathode (–) end of the box, where the black lead is connected.

Very carefully remove the comb from the gel by pulling it straight up, slowly.

4. Pour ~275 ml of electrophoresis buffer into the electrophoresis chamber, until it just

covers the wells.

5. Using a clean tip for each sample, 12 µL load the samples into the 8 wells of the gel in the

following order:

Table XII. Loading sample into gel

Lane Sample Load Volume

1 MMR (DNA standard) 12 µl

2 Homozygous (+/+) control 12 µl

3 Homozygous (–/–) control 12 µl

4 Heterozygous (+/–) control 12 µl

5 Student V 12 µl

6 Student X 12 µl

7 Student Y 12 µl

8 Student Z 12 µl

86
6. Secure the lid on the gel box. The lid will attach to the base in only one orientation: red

to red and black to black. Connect the electrical leads to the power supply.

7. Turn on the power supply. Set it to 100 V and electrophorese the samples.

8. When electrophoresis is complete (front dye runs upto 80%), turn off the power and remove

the lid from the gel box. Carefully remove the gel tray and the gel from the gel box. Be careful,

the gel is very slippery. Nudge the gel off the gel tray with your thumb and carefully slide it into

your plastic staining tray.

Ethidium bromide staining

1. Wear rubber gloves when staining gel, viewing gels, and cleaning up.

2. Confine all staining to sink area restricted from student use.

3. Flood gels with ethidium bromide solution (1 µg/mL), and allow to stain for 5

minutes. (Staining time depends on thickness of gel.)

5. Following staining, use funnel to decant as much ethidium bromide solution as possible

from staining tray back into storage container.

Results and Discussion

1. Keep a metric ruler beside the gel.

2. Examine your stained gel on a UV transilluminator.

3. Record gel results by taking a picture.

87
4. Measure from front edge of well to front edge of each band. Enter distances into

matrix. Alternatively, have students measure distance directly from stained gel or

from a photo of their ethidium stained gel.

5. Measure distance travelled by each DNA fragment and enter in the Table below.

Table XIII. Information of DNA fragments obtained in different PCR samples.

Size Marker Homozygous (+/+) Homozygous (-/-) Heterozygous (+/-)

Distance Size Distance Size Distance Size Distance Size

88
89
Table XIV. Genotypic variation among student population.

Student Genotype (number of Genotype


Group students)
number
+/+ +/- -/- +/+ +/- -/-

II

III

IV

Post Lab Questions

1. Explain the difference between an intron and an exon.

2. Why do the two possible PCR products differ in size by 300 base pairs?

3. Explain how agarose electrophoresis separates DNA fragments. Why does a smaller

90
DNA fragment move faster than a larger one?

4. What kind of controls are run in this experiment? Why are they important? Could others

be used?

5. What is your genotype for the Alu insert in your PV92 region?

6. What are the genotypic frequencies of +/+, +/–, and –/– in your class population? Fill in

the table below with your class data.

Table XV. Observed Genotypic Frequencies in the Class

Category Number Frequency (# of Genotypes/Total) X 100

Homozygous (+/+)

Heterozygous (+/–)

Homozygous (–/–)

91
Lab 10-12 Project 3: Mammalian cell culture: morphology,
cytoskeleton, actin arrangement

Cell culture is a process by which cells are grown under controlled conditions. In

practice, the term "cell culture" has come to refer to the culturing of cells derived from

multicellular eukaryotes, especially mammalian cells. The historical development and methods

of cell culture are closely interrelated to those of tissue culture and organ culture. Animal cell

culture became a common laboratory technique in the mid-1900s, but the concept of maintaining

live cell lines separated from their original tissue source was discovered in the 19th century.

The 19th-century English physiologist Sydney Ringer developed salt solutions containing

the chlorides of sodium, potassium, calcium and magnesium suitable for maintaining the beating

of an isolated animal heart outside of the body. In 1885 Wilhelm Roux removed a portion of

the medullary plate of an embryonic chicken and maintained it in a warm saline solution for

several days, establishing the principle of tissue culture. Ross Granville Harrison, working

at Johns Hopkins Medical School and then at Yale University, published results of his

experiments from 1907–1910, establishing the methodology of tissue culture.

Cell culture techniques were advanced significantly in the 1940s and 1950s to support

research in virology. Growing viruses in cell cultures allowed preparation of purified viruses for

the manufacture of vaccines. The injectable polio vaccine developed by Jonas Salk was one of

the first products mass-produced using cell culture techniques. This vaccine was made possible

by the cell culture research of John Franklin Enders, Thomas Huckle Weller, and Frederick

Chapman Robbins, who were awarded a Nobel Prize for their discovery of a method of growing

the virus in monkey kidneycell cultures.

92
Maintaining cells in culture

Cells are grown and maintained at an appropriate temperature and gas mixture (typically,

37°C, 5% CO2 for mammalian cells) in a cell incubator. Culture conditions vary widely for each

cell type, and variation of conditions for a particular cell type can result in

different phenotypes being expressed.

Aside from temperature and gas mixture, the most commonly varied factor in culture

systems is the growth medium. Recipes for growth media can vary in pH, glucose

concentration, growth factors, and the presence of other nutrients. The growth factors used to

supplement media are often derived from animal blood, such as calf serum. One complication of

these blood-derived ingredients is the potential for contamination of the culture

with viruses or prions, particularly in biotechnology medical applications. Current practice is to

minimize or eliminate the use of these ingredients wherever possible, but this cannot always be

accomplished. Alternative strategies involve sourcing the animal blood from countries with

minimum BSE/TSE risk such as Australia and New Zealand, and using purified nutrient

concentrates derived from serum in place of whole animal serum for cell culture.[5]

Plating density (number of cells per volume of culture medium) plays a critical role for some cell

types. For example, a lower plating density makes granulosa cells exhibit estrogen production,

while a higher plating density makes them appear as progesterone producing theca lutein cells.[6]

Cells can be grown in suspension or adherent cultures. Some cells naturally live in suspension,

without being attached to a surface, such as cells that exist in the bloodstream. There are also cell

lines that have been modified to be able to survive in suspension cultures so that they can be

grown to a higher density than adherent conditions would allow. Adherent cells require a surface,

such as tissue culture plastic or microcarrier, which may be coated with extracellular matrix

93
components to increase adhesion properties and provide other signals needed for growth and

differentiation. Most cells derived from solid tissues are adherent. Another type of adherent

culture is organotypic culture which involves growing cells in a three-dimensional environment

as opposed to two-dimensional culture dishes. This 3D culture system is biochemically and

physiologically more similar to in vivo tissue, but is technically challenging to maintain because

of many factors (e.g. diffusion).

Materials.

1. NIH 3T3 cells 18. Forcep 19. Microscope


2. DMEM with 10% FCS
3. Gloves

4. Paper towel, waste container

5. Micropipettes and tips

6. 24 well cell culture plate

7. Cover glass

8. Microscope
9. CO2 incubator
10. Water bath: 37oC
11. Cell culture hood

12. Weighing balance, weighing boat/paper

13. 16% Paraformaldehyde (formaldehyde) aqueous solution (Electron Microscopy Sciences)


14. PBS
15. Alexa Fluor® 488 phalloidin (Invitrogen)
16. 0.1% Triton X-100
17. Microscope slides

94
DETERMINING CELL NUMBER AND VIABILITY WITH A HEMACYTOMETER

AND TRYPAN BLUE STAINING

1. Determining the number of cells in culture is important in standardization of culture

conditions and in performing accurate quantitation experiments. A hemacytometer is

a thick glass slide with a central area designed as a counting chamber. The exact

design of the hemacytometer may vary; the one described here is the Improved

Neubauer from Baxter Scientific (Fig. below ).

2. The central portion of the slide is the counting platform which is bordered by a 1-mm

groove. The central platform is divided into two counting chambers. This grid is

divided into nine secondary squares. The four corner squares and the central square

are used for determining the cell count. The corner squares are further divided into 16

tertiary squares and the central square into 25 tertiary squares to aid in cell counting.

Accompanying the hemacytometer slide is a thick, even-surfaced coverslip. Ordinary

coverslips may have uneven surfaces that can introduce errors in cell counting;

therefore, it is imperative that the coverslip provided with the hemacytometer is used

in determining cell number.

95
3. Cell suspension is applied to a defined area and counted so cell density can be

calculated.y a transverse groove. Each counting chamber consists of 1 to 4).

4. Dilute cells as needed to obtain a uniform suspension. Disperse any clumps.

When using the hemacytometer, a maximum cell count of 20 to 50 cells per 1 x 1–mm

square is recommended.

5. Load hemacytometer

Use a sterile Pasteur pipet to transfer cell suspension to edge of hemacytometer

counting chamber. Hold tip of pipet under the coverslip and dispense one drop of

suspension. Suspension will be drawn under the coverslip by capillary action.

The hemacytometer should be considered nonsterile. If cell suspension is to be used for

cultures, do not reuse the pipet and do not return any excess cell suspension in the pipet

to the original suspension.

6. Fill second counting chamber.

Count cells

7. Allow cells to settle for a few minutes before beginning to count. Blot off excess

liquid.

8. View slide on microscope with total 100X magnification.

A 10X ocular with a 10X objective = 100Xmagnification.

Position slide to view the large central area of the grid; this area is bordered by a set of three

parallel lines. The central area of the grid should almost fill the microscope field. Subdivisions

within the large central area are also bordered by three parallel lines and each subdivision is

divided into sixteen smaller squares by single lines. Cells within this area should be evenly

distributed without clumping.

96
9. Count cells in sixteen small squares. Repeat counts for other counting chamber and enter

number in the table below.

Count cells touching the middle line of the squares.

Calculate cell number

10. Determine cells per milliliter by the following calculations:

cells/ml = average count per sixteen squares X dilution factor 104

Total number of cells = cells/ml X volume of cell suspension (in ml).

The number 104 is the volume correction factor for the hemacytometer: each square is 1 X

1 mm and the depth is 0.1 mm.

Table XVI. Cell count in different samples.

Cell type Square # Cell # Cell #/Sq Cell/ml Total #

Living

(colorless)

Non-living

(red color)

97
Formaldehyde Fixation and Staining Actin Filaments with Fluorescent-Phalloidin

1. Fix in 4% formaldehyde (16% stock EM grade) in CBS for 20 minutes

2. Rinse in TBS

3. Permeabilize in TBS-0.5% TX for 10 minutes

4. Rinse in TBS-0.1% TX (3 changes in 3-5 minutes is adequate)

5. Block in Abdil for 10 minutes

6. Incubate in fluorescent-phalloidin (1ug/ml from 1mg/ml frozen stock in DMSO) for 20

minutes at room temperature. Do not incubate for longer than 20 minutes; highly

98
fluorescent compounds such as fluorescent-phalloidin are usually sticky and will increase

background staining with longer incubations.

7. Wash in TBS-0.1% TX

8. Incubate in 1-10ug/ml DAPI or Hoesht in Abdil to stain nuclei if required for 10 minutes

9. Wash in TBS-0.1% TX

10. Rinse in TBS

11. Drain, mount, seal

12. When sealed add water to the top of the coverslip, then aspirate.

99
Lab report:

1. List chemical factors required for mammalian cell culture.

2. List physical and environmental factors required for mammalian cell culture.

3. Draw a cells appeared (morphology) in a microscopic field at a total magnification of 100 X.

4. Define the following terms: focal adhesion, filopodia, lamellepodia.

5. Draw a typical mammalian cell showing focal adhesion, filopodia, lamellipodia.

100
Lab 13 and 14
Project 4. Polymerase Chain Reaction: Genetically Modified Organism
Investigation

With the world population exploding and farmable land disappearing, agricultural

specialists are concerned about the world's ability to produce enough food to feed the growing

population. Environmentalists are concerned about the overuse of pesticides and herbicides and

the long-term effects of these chemicals on the environment and human health. Might there be a

solution to both of these problems? The biotechnology industry thinks so. Its proponents believe

genetically modified organisms (GMOs), particularly genetically modified (GM) crop plants, can

solve both problems. This proposed solution, however, has met with great opposition throughout

the world. Dubbed "frankenfoods" by opponents and restricted in most European countries,

GMOs are widely produced and sold in the United States. Currently in the US, foods that

contain GMOs do not have to be labeled as such.

Genetic manipulation of crop plants is not new. Farmers have been genetically modifying

crops for centuries and crop breeding to encourage specific traits, such as high yield, is still

an important part of agriculture today. However, there is now the option to place genes for

selected traits directly into crop plants. These genes do not have to originate from the same

plant species—in fact, they do not have to come from plants at all. One popular class of

GM crops has a gene from the soil bacterium Bacillus thuringiensis (Bt) inserted into their

genomes. Bt crops produce a protein called delta-endotoxin that is lethal to European corn

borers, a common pest on corn plants. Farmers who plant Bt crops do not have to apply

pesticide because the plants produce the toxic protein inside their cells. When the corn

borers feed on the genetically modified plant, they die. Other GMOs include those that are

101
herbicide-resistant delayed for fruit ripening, are resistant to fungi or drought, have

increased crop yield, or bear improved fruits.

Many people object to the use of GM crop plants. They argue that there is a potential to

create super-weeds through cross-pollination with herbicide-resistant crops or that superbugs

will evolve that are no longer resistant to the toxins in pest-resistant crops. Many are

concerned with potential allergic reactions to the novel proteins or antibiotic resistance arising

from the selectable markers used to develop the crops or other unforeseen effects on public

health. Proponents of GM foods argue these crops are actually better for the environment.

Fewer toxic chemicals are put into the environment and thus fewer toxic chemicals can

harm the environment and human health. In addition, these crops can preserve arable land

by reducing stresses on the land, improve the nutritional value of food in developing

countries, and allow crops to be grown on previously unfarmable land.

Whatever position one takes in the GMO debate, it would be beneficial to be able to

test foods found in the grocery store for the presence of GMO-derived products. This can

be done in several ways. One would be to use an antibody-based test such as the

enzyme-linked immunosorbent assay (ELISA), which can detect the proteins that are

produced specifically by GM crops. However, the ELISA is not useful for testing foods that

have been highly processed, because the proteins have most likely been destroyed and

different GM foods produce different proteins. Another method is to use the polymerase

chain reaction (PCR) to look for a DNA sequence common to GM foods. DNA is more

resistant than proteins to processing and can be extracted from even highly processed

foods. It is these GMO DNA sequences that we will be testing for in this laboratory.

In the first lesson you will extract genomic DNA from food samples, in the second lab

102
you will run PCR reactions to amplify GMO and natural plant sequences from the DNA, and

in the third lab you will electrophorese the amplified samples to visualize the DNA.

Let's see if your favorite food contains GMOs!

Pre-lab questions

1. How can you test a food to find out if it contains material derived from a genetically

modified organism (GMO)?

2. In what organelles is plant DNA located?

3. Many foods containing GM crops are highly processed. Can you suggest how DNA

from whole plants may differ from that extracted from processed foods, e.g., corn chips,

cornmeal, etc.?

4. What molecules are present in the cell that might interfere with DNA extraction?

5. Why do you also perform analysis on food that is known to be a non-GMO food control?

103
6. Why was the non-GMO food control prepared prior to your test food sample?

6. What chemicals and molecules are needed for PCR, and what is the function of each

component?

7. Examine the 150 base promoter sequence below.

5'TAGAAAAGGA AGGTGGCTCC TACAAATGCC ATCATT GCGA TAAAGGAAAG

GTATCATT C AAGATGCCTC TGCCGACAGT GGTC CCAAAG ATGGACCCC C

ACCCACGAGG AGC ATCGTGG AAAAAGAAGA CGTTCCAACC ACGTCT TCAA3'

Write in the sequence of the complementary strand and mark the 3' and 5' ends of the

complementary strand.

Remembering that DNA polymerases can only add nucleotides to the 3' end of DNA,

design a forward primer and a reverse primer, each 10 bases long, to amplify a target

sequence of the DNA that is at least 100 bp long. Write the sequence of the primers below,

with their 3' and 5' ends indicated. Also indicate on the sequence above which strand they

complementary to (will anneal to).

Forward primer sequence:

104
Reverse primer sequence:

8.Why are you performing two PCR reactions on each DNA sample?

9.What is the purpose of the GMO-positive control DNA?

Materials and supplies required at the workstation prior to beginning this exercise are

listed below.

1. Material Quantity Screwcap tube with 500 µl InstaGene matrix

2. Beaker of distilled water 1 Food samples 1 or 2

3. Disposable plastic transfer pipets (DPTP) 2

4. 2–20 µl micropipet (if preparing non-GMO food control) 1

5. 2–20 µl pipet tips, aerosol barrier 1 rack 6. Mortar and pestle 1

7. Marking pen 8. Common Workstation Material Quantity 25 g

9. Water bath set to 95–100°C 10. Microcentrifuge or 3–4 mini centrifuges

11. Balance and weigh boats

Protocol

Note: ALWAYS process the non-GMO control before the test sample to reduce the risk of

contamination.

Grind non-GMO food control (your instructor may perform this step for you)

1. Find your screwcap tubes containing 500 µl of InstaGene matrix and label one “non-

105
GMO” and one “test”.

2. Weigh out 0.5–2 g of the certified non-GMO food control and place in mortar.

2. Using the transfer pipet, add 5 ml of distilled water for every gram of food using the

graduations on the transfer pipet. To calculate the volume of water you need, mulitply

the mass in grams of the food weighed out by 5 and add that many millimeters.

Mass of Food = g x 5 = ml

3. Grind with pestle for at least 2 min until a slurry is formed.

4. Add 5 volumes of water again and mix or grind further with pestle until the slurry is

smooth enough to pipet.

5. Add 50 µl of ground slurry to the screwcap tube containing 500 µl of InstaGene matrix

labeled “non-GMO” using a transfer pipet.

6. Recap tube and shake well.

7. Wash mortar with detergent and dry.

106
Grind Test Food

1. Weigh out 0.5–2 g of test food and place in mortar.

2. Using the transfer pipet, add 5 ml of distilled water for every gram of food using the

graduations on the transfer pipet. To calculate the volume of water you need, mulitply

the mass in grams of the food weighed out by 5 and add that many millimeters.

Mass of food = g x 5 = ml

3. Grind with pestle for at least 2 min until a slurry is formed.

4. Add 5 more volumes of water and mix or grind further with pestle until the slurry is

smooth enough to pipet.

5. Add 50 µl of ground slurry to the screwcap tube labeled “Test” using the 50 µl mark on

a transfer pipet.

6. Recap tube and shake well.

Process Samples to Extract DNA

1. Place non-GMO food control and test food sample tubes in 95°C water bath for 5 min.

2. Place tubes in a centrifuge in a balanced conformation and spin for 5 min at max

speed.

3. Store tubes in refrigerator until the next lesson.

107
Lesson Two Set Up PCR Reactions

Student Workstations

Material Quantity

Ice bath containing 3 tubes 1

GMO master mix (red) (on ice) 1

Plant master mix (green) (on ice) 1

GMO positive control DNA (on ice) 1

Test food DNA (from previous lab) 1

Non-GMO food control DNA (from previous lab) 1

PCR tubes 6

PCR adaptors 6

Foam microtube holder 1

Marking pen 1

2–20 µl adjustable-volume micropipet or fixed-volume 20 µl micropipet 1

2–20 µl pipet tips, aerosol barrier 1 rack

1. Number six PCR tubes 1–6 and label them with your initials. The numbers correspond

to the following tube contents:

Tube Number DNA Master Mix

1 20 µl Non-GMO food control DNA 20 µl Plant master mix (green)

2 20 µl Non-GMO food control DNA 20 µl GMO master mix (red)

3 20 µl Test food DNA 20 µl Plant master mix (green)

108
4 20 ul Test food DNA 20 µl GMO master mix (red)

5 20 µl GMO positive control DNA 20 µl Plant master mix (green)

6 20 µl GMO positive control DNA 20 µl GMO master mix (red)

2. Keep the tubes on ice for the remaining steps.

3. Using a fresh tip each time, add 20 µl of the indicated master mix to each tube. I.E. add

20 µl of green plant master mix (PMM) to tubes 1, 3, and 5. Then add 20 µl of red GMO

master mix (GMM) to tubes 2, 4, and 6. Cap each tube.

4. Using a fresh pipet tip for each tube, add 20 µl of the DNA to each tube as indicated in

the table above. Take care not to transfer any of the InstaGene beads to your PCR

reaction. If the beads are disrupted, recentrifuge your DNA samples to pellet the beads.

Add 20 µl of non-GMO food control DNA to tube 1 and pipet up and down to mix.

Discard your tip. Use a fresh tip to add 20 µl of non-GMO food control DNA to tube 2

and mix. Discard your tip. Similarly add 20 µl of test food DNA to tubes 3 & 4, and add

20 µl of GMO positive control DNA to tubes 5 & 6, changing your tip for every tube.

Recap tubes.

5. When instructed to, place the PCR tubes in the thermal cycler.

DNA template

109
Supernatant

Matrix

PCR tube

Lesson 3 Electrophoresis of PCR Products

You have completed your PCR amplification. You cannot, however, at this point

determine whether or not you have PCR products. To do this, you must visualize your

products. You will do this using gel electrophoresis. Your PCR product bands are very small

compared to those in other DNA experiments you may have done. For example, fragments

produced from a HindIII digest of lambda DNA are 23,130, 9,416, 6,557, 4,361, 2,322, 2,027,

and 500 base pairs (bp). The product band sizes in this lab are 455 bp for the plant primers and

200 bp for the GMO primers, and a 1% gel would not separate these bands. Instead, a tighter gel

matrix is needed to impede the movement of these bands so that they are separated more on the

gel and can be seen. Therefore, if you are using agarose electrophoresis, you will use a 3%

agarose gel. Alternatively, your teacher may elect to use a polyacrylamide gel, which has smaller

pores, to separate your products. Polyacrylamide gel electrophoresis (PAGE) is used to separate

smaller molecules for visualization. Regardless of the gel type, you will load a molecular weight

ruler (DNA standard) so that you have a reference to determine your product bands' sizes. The

gel will then be stained with Fast Blast stain to make the bands visible.

110
Pre-lab questions

1. Why did you resolve your PCR products by electrophoresis?

2. Explain why DNA fragments separate according to size in an electrophoresis gel.

3. Why do you need a molecular weight ruler alongside your samples?

4. What results do you expect in each lane? Fill in the chart below.

Expect band
Lane Sample (Yes, No, Don’t know)?
1 Sample 1: Non-GMO food control with plant primers

2 Sample 2: Non-GMO food control with GMO primers

3 Sample 3: Test food with plant primers

4 Sample 4: Test food with GMO primers

5 Sample 5: GMO positive control DNA with plant primers

6 Sample 6: GMO positive control DNA with GMO primers

Workstation

Material Quantity

Gel (3% agarose) 1


Samples from previous lab period 6
Running buffer (1x TAE for agarose gels) 300–350 ml
Orange G loading dye 1 vial
PCR molecular weight ruler 1 vial
2–20 µl adjustable-volume pipet 1
1–20 µl pipet tips 1 rack
Gel electrophoresis chamber 1
Power supply 1
Fast Blast DNA stain 1
Gel staining tray 1

111
Protocol

1. Set up your gel electrophoresis apparatus as instructed.

Details on setting up electrophoresis equipment can be found in the Instructor's guide.

2. Using a fresh tip each time, add 10 µl of Orange G loading dye to each sample and mix

well.

3. Load 20 µl of the PCR molecular mass ruler and 20 µl of each sample onto your gel in

the order indicated below.

Lane Sample Load volume

1 Sample 1: Non-GMO food control with plant primers 20 µl

2 Sample 2: Non-GMO food control with GMO primers 20 µl

3 Sample 3: Test food with plant primers 20 µl

4 Sample 4: Test food with GMO primers 20 µl

5 Sample 5: GMO positive DNA with plant primers 20 µl

6 Sample 6: GMO positive DNA with GMO primers 20 µl

7 PCR molecular weight ruler 20 µl

4. The run time and voltage will depend on the type of gel you are running.

• Run an agarose gel at 100 V for 30 minutes. Do not let the orange dye front

migrate out of the agarose gel.

5. Stain the gel in Fast Blast DNA stain. Refer to specific instructions below for your gel

type.

112
Staining of Agarose Gels

1. When electrophoresis is complete, turn off the power and remove the lid from the gel

box.

2. Carefully remove the gel tray and the gel from the gel box. Be careful, the gel is very

slippery. Nudge the gel off the gel tray with your thumb and carefully slide it into your

plastic staining tray.

3. Quick Staining (requires 20 minutes)–This method will allow you to

see bands quickly (within 15 min) but may require extensive destaining to obtain optimal

band-to-background intensity. Note: it is important to use warm water for destaining

steps of this protocol.

a. Immerse your gel in 100x Fast Blast.

b. Stain the gel for 5 minutes with gentle agitation. Save the used stain for future

use.

c. Transfer the gels into a large washing container and rinse with warm (40–55°C)

tap water approximately 10 seconds.

d. Destain by washing three times in warm tap water for 5 minutes each with

gentle shaking for best results. You should be able to visualize bands after

10 min if you view the gel with light coming through the bottom of the staining

tray. If necessary continue destaining in warm water until the desired contrast

is reached.

113
Post lab Questions

1. What was your test food?

2. Did your test food generate a 200 bp band with GMO primer (lane 4)?

3. What does this tell you about the GMO status of your food?

4. What other information do you need to confirm the GMO status of your sample?

5. How do the results of your other five PCR reactions help support or undermine your

result for your test food?

6. If you were to repeat the procedure what laboratory practice might yield better results?

114
Lab 13 and 14 Project 4 DNA Fingerprinting: Identification of Criminal

DNA Fingerprinting

Each person has similarities and differences in DNA sequences. To show that a piece

of DNA contains a specific nucleotide sequence, a radioactive complementary DNA probe

can be made that will recognize and bind that sequence. Radioactive probes allow molecular

biologists to locate, identify, and compare the DNA of different individuals. This probe can

be described as a "radioactive tag" that will bind to a single stranded DNA fragment and

produce a band in a gel or a band on a piece of blotting membrane that is a replica of the

gel (also known as a Southern blot). Because of its specificity, the radioactive probe can be

used to demonstrate genotypic similarities between individuals. In DNA fingerprinting, the

relative positions of radiolabeled bands in a gel are determined by the size of the DNA

fragments in each band. The size of the fragments reflect variations in individuals’ DNA.

The evidence needed for DNA fingerprinting can be obtained from any biological

material that contains DNA: body tissues, body fluids (blood and semen), hair follicles, etc.

DNA analysis can even be done from dried material, such as blood stains or mummified

tissue. If a sample of DNA is too small it may be amplified using PCR techniques. The

DNA is then treated with restriction enzymes that cut the DNA into fragments of various

length.

115
Pre-lab questions.

1. Compare the “backbone” of the sugar-phosphate arrangement in the side chains of all
three figures. Are there any differences?

2. In the above figure, do all three samples contain the same bases? Describe your
observations.

116
3. Are the bases paired in an identical manner in all three samples? Describe the pattern
of the base pair bonding.

6. In your attempt to analyze DNA samples from three different individuals, what conclusions.

Consideration How can we detect differences in base sequences?


At first sight, your task might seem rather difficult. You need to determine if the linear
base pair sequence in the DNA samples is identical or not! An understanding of some
historically important discoveries in recombinant DNA technology might help you to
develop a plan.
In 1968, Dr. Werner Arber at the University of Basel, Switzerland and Dr. Hamilton
Smith at the Johns Hopkins University, Baltimore, discovered a group of enzymes in
bacteria, which when added to any DNA will result in the breakage [hydrolysis] of the
sugar-phosphate bond between certain specific nucleotide bases [recognition sites].
This causes the double strand of DNA to break along the recognition site and the DNA
molecule becomes fractured into two pieces. These molecular scissors or “cutting”
enzymes are restriction endonucleases.
Two common restriction enzymes (endonucleases) are EcoRI and PstI which will be
provided to you in this lab procedure. To better understand how EcoRI and PstI may
help you in performing your DNA fingerprinting experiment, first you must understand
and visualize the nature of the "cutting" effect of a restriction endonuclease on DNA:

The line through the base pairs represents the sites where bonds will break if the
restriction endonuclease EcoRI recognizes the site GAATTC. The following analysis
questions refer to how a piece of DNA would be affected if a restriction endonuclease
were to "cut" the DNA molecule in the manner shown above.

117
1. How many pieces of DNA would result from this cut? ___________

2. Write the base sequence of the DNA fragments on both the left and right side of the
“cut”.

Left: Right:

3. What differences are there in the two pieces?

With reference to the numbered lanes, analyze the bands in the gel drawing below,

then answer the questions on page 40. Note that this picture is an example and it may

not correspond to the pattern of bands that you will see in the lab.

Lane 1 2 3 4 5 6

118
Lesson 1 Restriction Digestion

1. Place the tube containing the restriction enzyme mix, labeled ENZ, on ice.

2. Label one of each colored micro test tubes as follows:

green tube CS (crime scene)

blue tube S1 (suspect 1)

orange tube S2 (suspect 2)

violet tube S3 (suspect 3)

red tube S4 (suspect 4)

yellow tube S5 (suspect 5)

Label the tubes with your name, date, and lab period. Place the tubes in the foam micro

test tube holder.

3. Using a fresh tip for each sample, pipet 10 μl of each DNA sample from the stock

tubes and transfer to the corresponding colored micro test tubes. Make sure the sample

is transferred to the bottom of the tubes.

4. Pipet 10 μl of enzyme mix (ENZ) into the very bottom of each tube. Use a fresh tip to

transfer the ENZ sample to each tube. Pipet up and down carefully to mix well.

5. Tightly cap the tubes and mix the components by gently flicking the tubes with your

finger. If a microcentrifuge is available, pulsespin in the centrifuge to collect all the liquid

in the bottom of the tube. Otherwise, gently tap the tube on the table top.

6. Place the tubes in the foam micro tube holder and incubate for 45 min at 37°C or

overnight at room temperature in a large volume of water heated to 37°C.

7. If required, follow the instructors directions to pour a 1% agarose gel.

119
8. After the incubation period, remove the tubes from the water bath and place in the

refrigerator until the next laboratory period. If there is sufficient time to continue,

proceed directly to step 2 of

Lesson 2.

Forensic DNA Fingerprinting Kit Quick Guide

ENZ CS S1 S2 S3 S4 S5

Water bath

Ice

Stock CS S1 S2 S3 S4 S5

DNA Samples

Enzyme Mix

Flick Tap

Lesson 2 Agarose Gel Electrophoresis

1. Remove the digested DNA samples from the refrigerator (if applicable).

2. If a centrifuge is available, pulse spin the tubes in the centrifuge to bring all of the

liquid into the bottom of the tube or gently tap on the table top.

3. Using a separate tip for each sample, add 5 μl of loading dye "LD" into each tube.

Cap the tubes and mix by gently flicking the tube with your finger. Collect the sample at

the bottom of the tube by tapping it gently on the table or by pulse-spinning in a

centrifuge.

120
4. Remove the agarose gel from the refrigerator (if applicable) and remove the plastic

wrap.

5. Place the agarose gel in the electrophoresis apparatus. Fill the electrophoresis

chamber with 1x TAE buffer* to cover the gel, using approximately 275 ml of buffer for a

Bio-Rad Mini-Sub Cell, horizontal electrophoresis chamber.

6. Check that the wells of the agarose gels are near the black (–) electrode and the

bottom edge of the gel is near the red (+) electrode.

7. Using a separate tip for each sample, load the indicated volume of each sample into

7 wells of the gel in the following order:

Lane 1: M, DNA size marker, 10 μl

Lane 2: CS, green tube, 20 μl

Lane 3: S1, blue tube, 20 μl

Lane 4: S2, orange tube, 20 μl

Lane 5: S3, violet tube, 20 μl

Lane 6: S4, red tube, 20 μl

Lane 7: S5, yellow tube, 20 μl

8. Carefully place the lid on the electrophoresis chamber. The lid will attach to the base

in only one orientation. The red and black jacks on the lid of the horizontal

electrophoresis chambers will match with the red and black jacks on the base. Plug the

electrodes into the power supply, red to red and black to black.

9. Turn on the power and electrophorese your samples at 100 V for 30 minutes.

* or 0.25x TAE if using the Fast Gel Protocol

121
Visualization of DNA Fragments

1. When the electrophoresis run is complete, turn off the power and remove the top of

the chamber. Carefully remove the gel and tray from the gel box. Be careful — the gel

is very slippery. Slide the gel into the staining tray.

2. You have two options for staining your gel:

Quick staining (requires 12–15 minutes)

a. Add 120 ml of 100x Fast Blast DNA stain into a staining tray (2 gels per

tray).

b. Stain the gels for 2 minutes with gentle agitation. Save the used stain for future use.

c. Transfer the gels into a large washing container and rinse with warm (40–55°C) tap

water for approximately 10 seconds.

d. Destain by washing twice in warm tap water for 5 minutes each with gentle

shaking for best results.

e. Record results.

f. Trim away any unloaded lanes.

g. Air-dry the gel on gel support film and tape the dried gel into your laboratory

notebook.

122

You might also like