PRINCIPLES OF RECOMBINANT DNA

1
TECHNOLOGY
| TOPIC 1 |
BIOTECHNOLOGY AND ITS PRINCIPLES
Biotechnology is a branch of applied science that deals with the techniques
that exploit living organisms or enzymes from organisms to produce products
and processes useful to humans. For thousands of years, human beings have
been using biotechnology, for example, the microbe-mediated processes, i.e.,
formation of curd, bread or wine through fermentation, which are one of the
oldest biotechnological processes.
Karl Ereky coined the term ‘biotechnology’ in 1917.The European Federation
of Biotechnology (EFB) defines biotechnology as 'the integration of natural
science and organisms, cells, parts thereof, and molecular analogues for
products and services'. This definition encompasses both traditional view and
modern molecular biotechnology. Processes like in vitro fertilisation forming
a ‘test-tube’ baby, synthesising a gene and using it, development of a DNA
vaccine or correcting a defective gene, are all parts of biotechnology.
Modern biotechnology consists of two core techniques, which are:
(1) Genetic engineering: It refers to the field of biotechnology that involves
the use of techniques to modify the chemical nature of genetic material
(DNA and RNA). This includes the introduction of the modified genetic
material into another organism (host), in order to change the phenotype of
the host organism.
Father of genetic engineering is Paul Berg.
(2) Bioprocess engineering: This method involves the maintenance of sterile
i.e., microbial contamination-free environment in chemical engineering
processes to enable growth of only the desired microbe/eukaryotic
cell. This results in production of microbes/cells in large quantities for
the manufacture of biotechnological products like antibiotics, vaccines,
enzymes, etc.
| TOPIC 2 |
PRINCIPLES OF GENETIC ENGINEERING
The process of sexual reproduction permits variations through crossing over
during meiosis by producing recombinant whereas asexual reproduction

2 Biology Class XII

Click here to access Educart complete book of Biology (Special Discount)
preserves the genetic information. Therefore, this method was utilised in
traditional hybridisation processes during plant and animal breeding, but it
often causes inclusion and multiplication of undesirable genes along with the
beneficial desired genes.
However, this limitation of traditional hybridisation process was overcome by
the use of techniques of genetic engineering, including:
(1) Creation of recombinant DNA
(2) Use of gene cloning and gene transfer
This allows isolation and introduction of only one or a set of desirable genes
without introducing undesirable genes into the target organism.
Fate of the piece of DNA transferred into a host (alien/foreign) organism
The piece of DNA transferred will not be able to multiply itself in the progeny
cells of the organism. But, when it gets incorporated into the genetic material
of the recipient organism, it starts multiplying and thus gets inherited along
with the host DNA. This occurs because the alien piece of DNA becomes a
part of the chromosome, which has the ability to replicate.
Origin of replication: This refers to a specific DNA sequence present in a
chromosome, which is responsible for the initiation of replication.
Therefore, in order to multiply an alien piece of DNA in an organism, it needs
to be a part of a chromosome(s) which has ‘origin of replication’. Thus, an alien
DNA is linked with the origin of replication, to enable the alien piece of DNA
to replicate and multiply itself in the host organism. This step is termed as
cloning or making multiple identical copies of any template DNA.
The three basic steps of genetic engineering or making a Genetically Modified
Organism (GMO) are:
(1) Identification of DNA with desirable genes.
(2) Introduction of the identified DNA into the suitable host to form
recombinant DNA (rDNA).
(3) Maintenance of introduced DNA in the host and transfer of the DNA to its
progeny.
Example 1.1: Can you tell whether enzymes are bigger or DNA is bigger
in molecular size? How did you know? [NCERT]
Ans. Both DNA and enzymes are macromolecules. DNA is a polymer
of deoxyribonucleotides, whereas, enzymes are proteins which are
polymers of amino acids. Compared to DNA molecules, enzymes are
smaller in size, because synthesis of proteins is regulated by a small
segment of DNA called gene. Three nucleotides in a sequence called

Biotechnology: Principles and Processes 3

Click here to access Educart complete book of Biology (Special Discount)
 codon in mRNA, codes for one amino acid, that polymerises to form the
polypeptide chain, hence proteins. Therefore, a larger number of proteins
are synthesised by a DNA molecule.

•
•
•

4 Biology Class XII

 OBJECTIVE Type Questions
[ 1 mark ]
Multiple Choice Questions
1. The figure below shows the structure of a plasmid.
Bam HI
R R
amp tet

pBR322

ori
rop

A foreign DNA was ligated at Bam HI. The transformants were then
grown in a medium containing antibiotics tetracycline and ampicillin.
Choose the correct observation for the growth of bacterial colonies
from the given table:
Medium with Tetracycline Medium with Ampicillin
(a) Growth No growth
(b) No growth Growth
(c) No growth No Growth
(d) Growth Growth
[CBSE SQP 2022]
Ans.(b) No growth, Growth
[CBSE Marking Scheme SQP 2022]
Explanation: Insertional inactivation is a technique used in recombinant
DNA technology. In this procedure, a bacteria carrying recombinant
plasmids or a fragment of foreign DNA is made to insert into a restriction
site inside a gene to resist antibiotics, hence causing the gene to turn
non-functional or in an inactivated state.
Therefore, when trasformants were grown in a medium containing
tetracycline does not shows growth as it is inactivated when foreign DNA
was ligated at Bam HI.
Assertion-Reason Questions
A statement of assertion followed by a statement of reason is given.
Choose the correct answer out of the following choices:
(a) Both A and R are true and R is the correct explanation of A.
(b) Both A and R are true and R is not the correct explanation of A.

Biotechnology: Principles and Processes 5

Click here to access Educart complete book of Biology (Special Discount)
 (c) A is true but R is false.
(d) A is false but R is true.
2.A restriction site is a segment of DNA with a base pair count between
6 and 8 that binds to a certain restriction enzyme. There are numerous
restriction enzymes that have been identified from bacteria. By
cleaving the viral Genome, they naturally render invasive viruses
inactive. Type II restriction enzymes identify restriction sites and break
the DNA at certain places inside or close to the restriction site. As an
illustration, consider the restriction enzyme EcoRI, which cleaves DNA
at the locations denoted by the arrows in figure given and is named
for the E. coli strain from which it was originally obtained.
On the basis of the given case, answer the following assertion-reason:
↓
||||||||||||||||||||||| G—A—A—T—T—C |||||||||||||||||||||||
||||||||||||||||||||||| C—T—T—A—A—G |||||||||||||||||||||||
↑
Assertion (A):More than one recognition sites within vector can
generate several fragments during gene cloning.
Reason (R): Gene cloning get complicated due to several recognition
sites.
Ans. (a) Both A and R are true and R is the correct explanation of A.
Explanation: Presence of more than one recognition sites within the
vector will generate several fragments, which will complicate the gene
cloning. Thus, in order to link the alien DNA, the vector needs to have very
few, preferably single, recognition sites for the commonly used restriction
enzymes.

CASE BASED Questions (CBQs)

[ 4 & 5 marks ]
Read the following passages and answer the questions that follow:
3. Some restriction enzymes break a phosphodiester bond on both the
DNA strands, such that only one end of each molecule is cut and these
ends have regions of single stranded DNA. BamH I is one such restriction
enzyme which binds at the recognition sequence, 5’-GGATCC- 3’ and
cleaves these sequences just after the 5’- guanine on each strand.
Restriction enzymes, also called restriction endonucleases, are enzymes that
cut DNA at specific sequences. Naturally found in bacteria to defend against
viral pathogens, restriction enzymes have been harnessed by researchers

6 Biology Class XII

Click here to access Educart complete book of Biology (Special Discount)
 and have proven a powerful asset for use in biotechnology applications,
such as DNA cloning. These enzymes typically recognize sequences of
DNA between 4 and 8 base pairs and can cut double-stranded DNA in a
staggered manner, leaving a single-stranded overhang (sticky end) or they
can cut at the same place on each strand producing a blunt end.
(A) What is the objective of this action?
(B) Explain how the gene of interest is introduced into a vector.
(C) You are given the DNA shown below.
5 ’ A T T T T G A G G A T C C G T A A T G T C C T 3 ’
3’TAAAACTCCTAGGCATTACAGGA 5’
If this DNA was cut with BamH I, how many DNA fragments would
you expect? Write the sequence of these double-stranded DNA
fragments with their respective polarity.
(D) A gene M was introduced into E. coli cloning vector pBR322 at
BamH I site. What will be its impact on the recombinant plamids?
Give a possible way by which you could differentiate non
recombinant to recombinant plasmids.
[Mod. CBSE SQP Term-2 2022]
Ans. (A) The two different DNA molecules will have compatible ends to
recombine.
(B) Restriction enzyme cuts the DNA of the vector and then ligates the
gene of interest into the DNA of the vector.
(C) Two fragments
5’ ATTTTGAG 3’5’GATCCGTAATGTCCT 3’ 3’ TAAAACTCCTAG
5’3’GCATTACAGGA 5’
(D) BamHI site will affect tetracycline antibiotic resistance gene, hence
the recombinant plasmids will lose tetracycline resistance due to
inactivation of the resistance gene.
Recombinants can be selected from non recombinants by plating into
a medium containing tetracycline, as the recombinants will not grow in
the medium because the tetracycline resistance gene is cut.
[CBSE Marking Scheme SQP Term-2 2022]

Related Theory
 Restrictions enzymes typically cleave double-stranded DNA. Each
restriction enzyme detects distinct DNA sequences, and depending on
the enzyme, cleavage might take place either close to or far from the
recognition sequence.

Biotechnology: Principles and Processes 7

Click here to access Educart complete book of Biology (Special Discount)
 VERY SHORT ANSWER Type Questions (VSA)
[ 1 mark ]

Mention any two characteristics that are important for a cloning

4.
vector.
[CBSE Question Bank 2022]
Ans.(1)Origin of Replication (Ori): The vector should contain an Ori, which
is a sequence that initiates replication. The copy number is likewise
controlled by the Ori site, hence cloning vectors with large copy
numbers are used.
(2)Selectable marker: The vector should include a selectable
marker that aids in distinguishing and identifying
non-transformants from transformants while allowing transformants
to grow selectively. Antibiotic genes such as ampicillin, tetracycline,
chloramphenicol, and kanamycin are thought to be valuable
E. coli selectable markers.
(3) Cloning Sites: A single recognition site for restriction enzymes to join
the foreign DNA should be included in the cloning vector. The existence
of many recognition sites results in multiple fragments and makes the
cloning process more difficult.
(4) It should have a large copy number so that numerous copies of the
DNA related to it may be obtained.
(5)They should be able to replicate independently. (Any two)

SHORT ANSWER Type Questions (SA)

[ 2 marks ]

pBR322 and normal E. coli genes were incorporated in the DNA of two
5.
test plant specimen A and B respectively.
Later, antibiotic ampicillin was administered to the two plant
specimen to combat bacterial infections.
What would most likely be the fate of each of the two test specimen
and why?
[CBSE Question Bank 2022]
Ans. There are a few ways to get the ligated DNA into the recipient cells.
After being made 'capable to receive,' recipient cells take up DNA from
their surroundings. When a recombinant DNA containing an antibiotic
resistance gene (for example, ampicillin resistance) is injected into E. coli

8 Biology Class XII

Click here to access Educart complete book of Biology (Special Discount)
 cells, the host cells are converted into ampicillin-resistant cells. Only
the changed cells will grow on agar plates with ampicillin, whereas
the untransformed recipient cells will die. Since, due to ampicillin
resistance gene, one is able to select a transformed cell in the presence
of ampicillin. In this scenario, the ampicillin resistance gene is referred to
as a selectable marker. This is the fate of each of the two specimens.

LONG ANSWER Type-I Questions (LA-I)

[ 3 marks ]

6.(A) What is insertional inactivation?

(B)State the roles of: (i) Ori and (ii) Rop gene in E. coli Cloning Vector
pBR3222. [Delhi Gov. SQP Term-2 2022]
Ans.(A) W
 hen an alien DNA or rDNA is ligated within the coding sequence
of an enzyme, the enzyme become inactivated, this phenomenon is
called as insertional inactivation.
(B)(i)Ori (origin of replication) is a sequence of DNA where replication
starts.
(ii)Rop gene codes for the proteins involved in replication of the plasmid.
[Delhi Gov. marking Scheme SQP Term-2 2022]

Biotechnology: Principles and Processes 9

 PROCESSES OF RECOMBINANT DNA
TECHNOLOGY
2
| TOPIC 1 |
STEPS INVOLVED IN RDT
Recombinant DNA technology consists of the following steps in specific
sequence:
(1) Isolation of genetic material (DNA).
(2) Fragmentation of DNA by restriction endonucleases.
(3) Separation and isolation of a desired DNA fragment.
(4) Ligation of the DNA fragment into a vector.
(5) Insertion/Transfer of the recombinant DNA into the host.
(6) Culturing the host cells in a medium at large scale.
(7) Extraction of the desired product.
Isolation of The Genetic Material (DNA)
The genetic material of all organisms is the nucleic acid. Majority of organisms
have deoxyribonucleic acid (DNA) as the genetic material.
In recombinant DNA technology, the DNA needs to be in pure form, i.e., free
from other macro-molecules, so that it can be cut with the help of restriction
enzymes.
The process of isolation of DNA involves the following steps:
(1) In order to release the DNA from the cell, the cell has to be broken
down as DNA is enclosed within membranes. Along with DNA, other
macromolecules such as RNA, proteins, polysaccharides and lipids are
also released from the cell. This is done by treating the bacterial cells or
plant or animal tissue with enzymes such as lysozyme (bacteria), cellulase
(plant cells), chitinase (fungus).
(2) The genes are located on long molecules of DNA interwined with proteins
such as histones. Removal of RNA is done by treatment with ribonuclease
whereas proteins are removed by treatment with protease.
(3) By applying appropriate treatments other molecules are also removed.
Ultimately the purified DNA is precipitates out after the addition of chilled
ethanol and the collection of fine threads in the suspension is removed by
a process called spooling.

10 Biology Class XII

Click here to access Educart complete book of Biology (Special Discount)
Cutting of DNA at Specific Locations
The purified DNA molecules are incubated with the restriction enzyme, at
the optimal conditions for that specific enzyme for performing the restriction
enzyme digestions.
Separation and Isolation of DNA Fragments
Fragments of DNA are produced after the cutting of DNA by restriction
endonucleases. These fragments are separated with the help of a technique
known as Gel electrophoresis.
The DNA fragments being negatively charged molecules are separated by
applying an electric field that force the DNA molecules to move towards the
anode (+), under an electric field through an appropriate medium/matrix.
Agarose is the most commonly used matrix; it is a natural polymer extracted
from sea weeds. The basis of gel electrophoresis is that the DNA fragments
separate (resolve) according to their size through sieving effect provided by the
agarose gel. Therefore, the smaller the fragment size, the farther it moves. The
separated DNA fragments thus can be visualised only after staining the DNA
with a compound known as Ethidium Bromide (EtBr) followed by exposure to
UV radiation. Thus, in an ethidium bromide-stained gel exposed to UV light,
bright orange-coloured bands of DNA can be seen. Finally, the separated
stained bands of DNA are cut out from the agarose gel and extracted from
the gel piece. This step is termed as elution. Thus, the purified DNA fragments
(containing gene of interest) are used in constructing recombinant DNA by
joining them with cloning vectors with the help of DNA ligase.
Wells
DNA
bands
Largest Smallest
4
3
2
1

A Typical Agarose Gel Electrophoresis Showing Migration of Undigested

(Lane 1) and Digested set of DNA Fragments (Lane 2 to 4)

•
•
•

Biotechnology: Principles and Processes 11

Click here to access Educart complete book of Biology (Special Discount)
12 Biology Class XII
 OBJECTIVE Type Questions
[ 1 mark ]
Multiple Choice Questions
7.Given below are two statements about polymerase chain reactions.
(P) It mimics DNA replication that happens in a cell.
(Q) It cannot be used to amplify RNA molecules.
Which of these is/are TRUE?
(a) Only P
(b) Only Q
(c) Bothe P and Q
(d) neither P nor Q [CBSE Question Bank 2023]
Ans.(a) Only P
Explanation: By repeatedly copying the target DNA to create significant
amounts of the desired DNA, PCR effectively replicates biological
DNA replication in the test tube. With the help of numerous cycles of
denaturation, oligonucleotide annealing, and DNA polymerase extension,
nucleic acid sequences are amplified enzymatically using the polymerase
chain reaction (PCR).

VERY SHORT ANSWER Type Questions (VSA)

[ 1 mark ]

8. What do you mean by a continuous culture system in bioreactors?

Ans. 
Continuous culture is a collection of methods used to consistently
produce microorganisms at submaximal growth rates at various growth
restrictions while maintaining almost constant (or "steady state") culture
conditions over extended periods of time.

LONG ANSWER Type-I Questions (LA-I)

[ 3 marks ]

9. A cell free method of amplifying DNA first developed in the mid

1980’s revolutionised the field of biotechnology. Name the method
and explain the basic steps of the technique involved.
[CBSE Term-2 2022]
Ans. Name of the method is Polymerase Chain Reaction
Steps involved in the technique are:

Biotechnology: Principles and Processes 13

Click here to access Educart complete book of Biology (Special Discount)
 1. Denaturation: This step is done at the temperature of 94°C. In this the
high temperature breaks the hydrogen bonds between the two strand
of DNA and converts them to single – stranded DNA. Instrument used in
PCR is called thermal cycler.
2. Annealing: In this step, the sample mixture cooled to 50-60°C.
DNA primers bind to the specific sequences of DNA. At this point,
the nucleotides (A, T, C, G) from the added mixture solution will pair
with the individual separated strands of DNA that resulted from the
heating process.
3. Extension: At this step, the sample is given the temperature of 72-
80°C degree celcius. This elongates the DNA in 5’ to 3’ direction. Taq.
Polymerase attaches to the primer and incorporates DNA bases to
the ss-DNA to form ds-DNA.
Related Theory
 PCR was discovered by Kary Mullis in 1985.
 PCR has many applications like detection of pathogenic microbes
followed by genotyping, DNA analysis of arachaeological specimens etc.

LONG ANSWER Type-II Questions (LA-II)

[ 4 & 5 marks ]

10. State
the steps involved in the Recombinant DNA technology.
[DIKSHA]
Ans. Recombinant DNA technology involves the following steps which are
discussed below:
(1)Isolation of DNA: The first step in recombinant DNA technology
is the isolation of desired DNA in its pure form (free from other
macromolecules). As we know DNA exists within the cell membrane
along with other macromolecules like RNA, polysaccharides, proteins,
and lipids, then it must be separated and purified.
Thus, this can be achieved by treating the bacterial cells or plant or
animal tissue with enzymes such as lysozyme (bacteria), cellulase
(plant cells), chitinase (fungus). Removal of RNA is done by treatment
with ribonuclease whereas proteins are removed by treatment with
protease. Other macromolecules are removed with other enzymes or
proper treatments. Finally, the addition of chilled ethanol causes the
purified DNA to precipitate out as fine threads.
(2)Cutting of DNA at Specific locations: Under the optimal conditions,
purified DNA is cut by restriction enzymes at specific locations.

14 Biology Class XII

Click here to access Educart complete book of Biology (Special Discount)
 Restriction enzymes act as molecular scissors and these reactions
are called ‘restriction enzyme digestions’. The technique of ‘Agarose
Gel Electrophoresis’ expresses the progress of the restriction enzyme
digestion.
This technique involves running out the DNA fragments on an agarose
gel. Since DNA is negatively charged, it travels to the positive electrode
and is separated out based on size. Finally, the separated bands of DNA
are cut out from the agarose gel and extracted from the gel piece. The
vector DNA is also processed using the same procedure.
(3)Amplification of Gene of Interest by using PCR: The Polymerase
Chain Reaction or PCR is a method of in vitro making multiple copies
of a DNA sequence using the enzyme DNA polymerase. It helps to
amplify a single copy or a few copies of DNA into thousands to millions
of copies. Polymerase Chain Reaction runs on ‘thermal cyclers’ using
the following components:
• DNA template: It is the double-stranded DNA that needs to be
amplified.
• Two nucleotide primers: Small, chemically synthesised
oligonucleotides that are complementary to a region of the DNA
template.
• Enzyme: Taq DNA polymerase (isolated from a bacterium, Thermus
aquaticus).
The cut fragments of DNA molecule can be amplified using PCR
technology and then ligated with the cut vector for further cloning.
(4)Preparation and Insertion of recombinant DNA into the host cell
or organisms: The purified DNA and the vector with gene of interest
are cut with the same restriction enzyme to produce complementary
sticky ends. With the help of DNA ligase enzyme, these two pieces are
joined together and produce a recombinant DNA.
Further, the recombinant DNA is introduced into a recipient host cell
mostly, a bacterial cell. This process is known as transformation.
Bacterial cells do not accept foreign DNA easily. Thus, they are treated
to make them ‘competent’ to accept new DNA. The processes used may
be thermal shock, Ca++ ion treatment, electroporation etc. After this, the
transformed bacterial cells can be identified using suitable selectable
markers.
(5)Obtaining the foreign gene product: The transformed bacterial
cells (recombinants) are grown in bioreactor having suitable nutrient

Biotechnology: Principles and Processes 15

Click here to access Educart complete book of Biology (Special Discount)
 medium. Bioreactors provide optimum conditions for achieving the
desired product by providing optimum growth conditions such as
temperature, pH, suitable salts, vitamins, oxygen etc. The desired
protein is extracted from bacterial cells by separation and purification.
These processes constitute downstream processing.

TOPPER’S CORNER
LONG ANSWER Type-I Questions (LA-I)
[ 3 marks ]
1. 
Restriction endonucleases are used in genetic engineering to form
recombinant DNA. Explain only with the help of a flow chart the
steps carried in the formation of a recombinant DNA.
Ans.

[CBSE Topper Term-2 2022]

16 Biology Class XII