Bioinformatics Technologies

Lokeswari Y Venkataramana
SSN College of Engineering
Dept. of CSE
 Overview
• What is Bioinformatics
• DNA, RNA,
• Genes
• Amino Acids
• Protein
• Applications of Bioinformatics
• Need for Bioinformatics Technologies
• Databases available for Research
• Overview of Bioinformatics Technologies
CS, IT, Bio Intersect. Biological experiments generate large amts of data
Computing, Math&Stats, IT/Physics, Life Sciences ---> Next
generation Sequencing in the middle Bioinformatics
Bioinformatics
Bioinformatics
Bioinformatics
 What is Bioinformatics?

Individuals

RNA Protein

DNA Phenotype

Evolution Selection

Populations
Biological Information
© Doug Brutlag 2015
LPOSET

Computational Goals of Bioinformatics

• Learn & Generalize: Discover conserved patterns (models) of sequences,
structures, metabolism & chemistries from well-studied examples.

• Prediction: Infer function or structure of newly sequenced genes, genomes,

proteomes or proteins from these generalizations.

• Organize & Integrate: Develop a systematic and genomic approach to molecular

interactions, metabolism, cell signaling, gene expression… Basis of systems
biology

• Simulate: Model gene expression, gene regulation, protein folding, protein-

protein interaction, protein-ligand binding, catalytic function, metabolism…
Goal of systems biology.

• Engineer: Construct novel organisms or novel functions or novel regulation of

genes and proteins. Basis of synthetic biology.

• Target: Mutations, RNAi to specific genes and transcripts or drugs to specific

protein targets. Practical biological and medical use of bioinformatics.

© Doug
Brutlag 2015
Central Paradigm of Molecular Biology

DNA RNA Protein Phenotype

© Doug Brutlag 2015

 Central Paradigm of Medicine

DNA RNA Protein Symptoms Opinions

© Doug Brutlag 2015

 Central Paradigm of Bioinformatics

Genetic Molecular Biochemical Phenotype

Information Structure Function (Symptoms)
MVHLTPEEKT
AVNALWGKVN
VDAVGGEALG
RLLVVYPWTQ
RFFESFGDLS
SPDAVMGNPK
VKAHGKKVLG
AFSDGLAHLD
NLKGTFSQLS
ELHCDKLHVD
PENFRLLGNV
LVCVLARNFG
KEFTPQMQAA
YQKVVAGVAN
ALAHKYH

© Doug Brutlag 2015

 Central Paradigm of Bioinformatics

Genetic Molecular Biochemical Phenotype

Information Structure Function (Symptoms)
MVHLTPEEKT
AVNALWGKVN
VDAVGGEALG
RLLVVYPWTQ
RFFESFGDLS
SPDAVMGNPK
VKAHGKKVLG
AFSDGLAHLD
NLKGTFSQLS
ELHCDKLHVD
PENFRLLGNV
LVCVLARNFG
KEFTPQMQAA
YQKVVAGVAN
ALAHKYH

© Doug Brutlag 2015

 Challenges Understanding Genetic Information

Genetic Molecular Biochemical

Phenotype
Information Structure Function

• Genetic information is redundant

• Structural information is redundant

© Doug Brutlag 2015

 Soybean Leghemoglobin and
Sperm Whale Myoglobin

Soybean Leghemoglobin Sperm Whale Myoglobin

© Doug Brutlag 2015

 Challenges Understanding Genetic Information

Genetic Molecular Biochemical

Phenotype
Information Structure Function

• Genetic information is redundant

• Structural information is redundant
• Genes and proteins are meta-stable

© Doug Brutlag 2015

 Challenges Understanding Genetic Information

redundant redundant genes and proteins are meta stable

Genetic Molecular Biochemical

Phenotype
Information Structure Function
they are 1D, but their func depends on 3D structure

• Genetic information is redundant

• Structural information is redundant
• Genes and proteins are meta-stable
• Genes and proteins are one dimensional but
their function depends on three-dimensional
structure

© Doug Brutlag 2015

 Slide from http://www.nd.edu/~networks/

GENOME

protein-gene
interactions

PROTEOME
protein-protein
interactions

Cell structure Metabolism

Sanguinetti, 2011 Bio2 lecture 1

 Central Dogma of Molecular Biology

replication

GENOTYPE (i.e. Aa) GENE (DNA) ATGCAAGTCCACTGTATTCCA

transcription reverse tr
MESSENGER (RNA) UACGUUCAGGUGACAUAAGGG

translation
PROTEIN

PHENOTYPE (pink) TRAIT

Central Dogma of Molecular Biology
Biological Nomenclature

⚫ Need to know the meaning of:

– Species, organism, cell, nucleus, chromosome, DNA
– Genome, gene, base, residue, protein, amino acid
– Transcription, translation, messenger RNA
– Codons, genetic code, evolution, mutation, crossover
– Polymer, genotype, phenotype, conformation
– Inheritance, homology, phylogenetic trees
Substructure and Effect
(Top Down/Bottom Up)

Substructure Species
Organism Affects the
Behaviour of
Cell Affects the
Function of
Nucleus Protein
Folds
Chromosome Amino Acid into

DNA strand
Prescribes
Gene
Base BGDCN
Cells

⚫ Basic unit of life

⚫ Different types of cell:
– Skin, brain, red/white blood
– Different biological function
⚫ Cells produced by cells
– Cell division (mitosis)
– 2 daughter cells
⚫ Eukaryotic cells
– Have a nucleus
Nucleus and Chromosomes

⚫ Each cell has nucleus

⚫ Rod-shaped particles inside
– Are chromosomes
– Which we think of in pairs
⚫ Different number for species
– Human(46),tobacco(48)
– Goldfish(94),chimp(48)
– Usually paired up
⚫ X & Y Chromosomes
– Humans: Male(xy), Female(xx)
– Birds: Male(xx), Female(xy)
DNA Strands

⚫ Chromosomes are same in every cell of organism

– Supercoiled DNA (Deoxyribonucleic acid)
⚫ Take a human, take one cell
– Determine the structure of all chromosonal DNA
– You’ve just read the human genome (for 1 person)
– Human genome project
⚫ 13 years, 3.2 billion chemicals (bases) in human genome
⚫ Other genomes being/been decoded:
– Pufferfish, fruit fly, mouse, chicken, yeast, bacteria
DNA Structure

⚫ Double Helix (Crick & Watson)

– 2 coiled matching strands
– Backbone of sugar phosphate pairs
⚫ Nitrogenous Base Pairs
– Roughly 20 atoms in a base
– Adenine  Thymine [A,T]
– Cytosine  Guanine [C,G]
– Weak bonds (can be broken)
– Form long chains called polymers
⚫ Read the sequence on 1 strand
– GATTCATCATGGATCATACTAAC
Differences in DNA
⚫ DNA differentiates:
– Species/race/gender
– Individuals
⚫ We share DNA with
– Primates,mammals
– Fish, plants, bacteria
⚫ Genotype
– DNA of an individual
⚫ Genetic constitution
⚫ Phenotype
– Characteristics of the
resulting organism
⚫ Nature and nurture
Genes

⚫ Chunks of DNA sequence

– Between 600 and 1200 bases long
– 32,000 human genes, 100,000 genes in tulips
⚫ Large percentage of human genome
– Is “junk”: does not code for proteins
⚫ “Simpler” organisms such as bacteria
– Are much more evolved (have hardly any junk)
– Viruses have overlapping genes (zipped/compressed)
⚫ Often the active part of a gene is spit into exons
– Seperated by introns
The Synthesis of Proteins

⚫ Instructions for generating Amino Acid sequences

– (i) DNA double helix is unzipped
– (ii) One strand is transcribed to messenger RNA
– (iii) RNA acts as a template
⚫ ribosomes translate the RNA into the sequence of amino acids
⚫ Amino acid sequences fold into a 3d molecule
⚫ Gene expression
– Every cell has every gene in it (has all chromosomes)
– Which ones produce proteins (are expressed) & when?
Transcription

⚫ Take one strand of DNA

⚫ Write out the counterparts to each base
– G becomes C (and vice versa)
– A becomes T (and vice versa)
⚫ Change Thymine [T] to Uracil [U]
⚫ You have transcribed DNA into messenger RNA
⚫ Example:
Start: GGATGCCAATG
Intermediate: CCTACGGTTAC
Transcribed: CCUACGGUUAC
Genetic Code

⚫ How the translation occurs

⚫ Think of this as a function:

– Input: triples of three base letters (Codons)
– Output: amino acid
– Example: ACC becomes threonine (T)

⚫ Gene sequences end with:

– TAA, TAG or TGA
 A=Ala=Alanine

Genetic Code C=Cys=Cysteine

D=Asp=Aspartic acid
E=Glu=Glutamic acid
F=Phe=Phenylalanine
G=Gly=Glycine
H=His=Histidine
I=Ile=Isoleucine
K=Lys=Lysine
L=Leu=Leucine
M=Met=Methionine
N=Asn=Asparagine
P=Pro=Proline
Q=Gln=Glutamine
R=Arg=Arginine
S=Ser=Serine
T=Thr=Threonine
V=Val=Valine
W=Trp=Tryptophan
Y=Tyr=Tyrosine
Example Synthesis

⚫ TCGGTGAATCTGTTTGAT
Transcribed to:
⚫ AGCCACUUAGACAAACUA
Translated to:
⚫ SHLDKL
Proteins

⚫ DNA codes for

– strings of amino acids
⚫ Amino acids strings
– Fold up into complex 3d molecule
– 3d structures:conformations
– Between 200 & 400 “residues”
– Folds are proteins
⚫ Residue sequences
– Always fold to same conformation
⚫ Proteins play a part
– In almost every biological process
Evolution of Genes: Inheritance

⚫ Evolution of species
– Caused by reproduction and survival of the fittest
⚫ But actually, it is the genotype which evolves
– Organism has to live with it (or die before reproduction)
– Three mechanisms: inheritance, mutation and crossover
⚫ Inheritance: properties from parents
– Embryo has cells with 23 pairs of chromosomes
– Each pair: 1 chromosome from father, 1 from mother
– Most important factor in offspring’s genetic makeup
Evolution of Genes: Mutation

⚫ Genes alter (slightly) during reproduction

– Caused by errors, from radiation, from toxicity
– 3 possibilities: deletion, insertion, alteration
⚫ Deletion: ACGTTGACTC  ACGTGACTC
⚫ Insertion: ACGTTGACTC  AGCGTTGACTC
⚫ Substitution: ACGTTGACTC  ACGATGACTT
⚫ Mutations are almost always deleterious
– A single change has a massive effect on translation
– Causes a different protein conformation
Evolution of Genes:
Crossover (Recombination)

⚫ DNA sections are swapped

– From male and female genetic input to offspring DNA
Genetic Disorders

⚫ Disorders have fuelled much genetics research

– Remember that genes have evolved to function
⚫ Not to malfunction
⚫ Different types of genetic problems
⚫ Downs syndrome: three chromosome 21s
⚫ Cystic fibrosis:
– Single base-pair mutation disables a protein
– Restricts the flow of ions into certain lung cells
– Lung is less able to expel fluids
What we study with Bioinformatics Tools
Bioinformatics is the integrated discipline formed from the
combination of biology, computer science, and information
technology
 Related Field:
Computational Biology

❑ The study and application of computing methods for

classical biology
❑ Primarily concerned with evolutionary, population and
theoretical biology, rather than the cellular or molecular
level

Click here to download this powerpoint template : Human Computers Network Free Powerpoint Template
For more : Powerpoint Backgrounds

Page 39
 Related Field:
Medical Informatics

❑ The study and application of computing methods to

improve communication, understanding, and
management of medical data
❑ Generally concerned with how the data is manipulated
rather than the data itself

Click here to download this powerpoint template : Human Computers Network Free Powerpoint Template
For more : Powerpoint Backgrounds

Page 40
 Related Field:
Cheminformatics

❑ The study and application of computing methods, along

with chemical and biological technology, for drug design
and development

Click here to download this powerpoint template : Human Computers Network Free Powerpoint Template
For more : Powerpoint Backgrounds

Page 41
 Related Field:
Genomics

❑ Analysis and comparison of the entire genome of a

single species or of multiple species
❑ A genome is the set of all genes possessed by an
organism
❑ Genomics existed before any genomes were completely
sequenced, but in a very primitive state

Click here to download this powerpoint template : Human Computers Network Free Powerpoint Template
For more : Powerpoint Backgrounds

Page 42
 Related Field:
Proteomics

❑ Study of how the genome is expressed in proteins, and

of how these proteins function and interact
❑ Concerned with the actual states of specific cells, rather
than the potential states described by the genome

Click here to download this powerpoint template : Human Computers Network Free Powerpoint Template
For more : Powerpoint Backgrounds

Page 43
 Related Field:
Pharmacogenomics

❑ The application of genomic methods to identify drug

targets
❑ For example, searching entire genomes for potential
drug receptors, or by studying gene expression patterns
in tumors

Click here to download this powerpoint template : Human Computers Network Free Powerpoint Template
For more : Powerpoint Backgrounds

Page 44
 Related Field:
Pharmacogenetics

❑ The use of genomic methods to determine what causes

variations in individual response to drug treatments
❑ The goal is to identify drugs that may be only be
effective for subsets of patients, or to tailor drugs for
specific individuals or groups

Click here to download this powerpoint template : Human Computers Network Free Powerpoint Template
For more : Powerpoint Backgrounds

Page 45
 APPLICATIONS

Click here to download this powerpoint template : Human Computers Network Free Powerpoint Template
For more : Powerpoint Backgrounds

Page 46
 Pharmaceutical:

• Biobanks
➢ A biobank is a type of biorepository which stores human biological
samples (including tissue providers, others include genetic profiling) for
use in research.
➢ Since the late 1990s: a key resource for supporting many types of
contemporary research, e.g. genomics and personalized medicine.
➢ Drivers: the need to accelerate the discovery and development of drugs.
As that industry shifts to more-personalised medicine, the need for high-
quality, well-maintained biospecimens intensifies.

• Veterinary Science/ Animal Health

➢ Divided into Production animals and companion animals, the animal
health market covers diagnostics, medicines and vaccines for farmed
animals and pets.
➢ Drivers:growing demand for animal proteins, as well as a strong
Click here to download this powerpoint template : Human Computers Network Free Powerpoint Template
consumer need for companion animal health care.
For more : Powerpoint Backgrounds

Page 47
 Medical Implications:

• Pharmacogenomics
– Not all drugs work on all patients, some good drugs cause death
in some patients
– So by doing a gene analysis before the treatment the offensive
drugs can be avoided
– Also drugs which cause death to most can be used on a minority
to whose genes that drug is well suited – volunteers wanted!
– Customized treatment
• Gene Therapy
– Replace or supply the defective or missing gene
– E.g: Insulin and Factor VIII or Haemophilia

Click here to download this powerpoint template : Human Computers Network Free Powerpoint Template
For more : Powerpoint Backgrounds

Page 48
 Diagnosis of Disease:

❑ Diagnosis of disease
❑ Identification of genes which cause the disease will help detect
disease at early stage e.g. Huntington disease -
❑ Symptoms – uncontrollable dance like movements, mental
disturbance, personality changes and intellectual
impairment
❑ Death in 10-15 years
❑ The gene responsible for the disease has been identified
❑ Contains excessively repeated sections of CAG
❑ So once analyzed the couple can be counseled

Click here to download this powerpoint template : Human Computers Network Free Powerpoint Template
For more : Powerpoint Backgrounds

Page 49
 Drug Design:

• Can go up to 15yrs and $700million

• One of the goals of bioinformatics is to reduce the time and cost involved with
it.
• The process
– Discovery
• Computational methods can improves this
– Testing

Click here to download this powerpoint template : Human Computers Network Free Powerpoint Template
For more : Powerpoint Backgrounds

Page 50
 Drug Discovery:

Target identification
– Identifying the molecule on which the germs relies for its survival
– Then we develop another molecule i.e. drug which will bind to the target
– So the germ will not be able to interact with the target.
– Proteins are the most common targets

Click here to download this powerpoint template : Human Computers Network Free Powerpoint Template
For more : Powerpoint Backgrounds

Page 51
 Drug Discovery:

• For example HIV produces HIV protease which is a protein and which in turn
eat other proteins
• This HIV protease has an active site where it binds to other molecules
• So HIV drug will go and bind with that active site
– Easily said than done!

Click here to download this powerpoint template : Human Computers Network Free Powerpoint Template
For more : Powerpoint Backgrounds

52
Page 52
Bioinformatics Application #1
Phylogenetic trees
⚫ Understand our evolution
⚫ Genes are homologous
– If they share a common ancestor
⚫ By looking at DNA seqs
– For particular genes
– See who evolved from who
⚫ Example:
– Mammoth most related to
⚫ African or Indian Elephants?
⚫ LUCA:
– Last Universal Common Ancestor
– Roughly 4 billion years ago
Bioinformatics Application #2
Predicting Protein Structure

⚫ Proteins fold to set up an active site

– Small, but highly effective (sub)structure
– Active site(s) determine the activity of the protein
⚫ Remember that translation is a function
– Always same structure given same set of codons
– Is there a set of rules governing how proteins fold?
– No one has found one yet
– “Holy Grail” of bioinformatics
Protein Structure Knowledge

⚫ Both protein sequence and structure

– Are being determined at an exponential rate
⚫ 1.3+ Million protein sequences known
– Found with projects like Human Genome Project
⚫ 20,000+ protein structures known
– Found using techniques like X-ray crystallography
⚫ Takes between 1 month and 3 years
– To determine the structure of a protein
– Process is getting quicker
Sequence versus Structure
500000
Protein sequence
Number 400000

300000

200000

100000
Protein structure
0
85 90 95 00
Year
Database Approaches

⚫ Slow(er) rate of finding protein structure

– Still a good idea to pursue the Holy Grail
⚫ Structure is much more conservative than sequence
– 1.3m genes, but only 2,000 – 10,000 different conformations
⚫ First approach to sequence prediction:
– Store [sequence,structure] pairs in a database
– Find ways to score similarity of residue sequences
– Given a new sequence, find closest matches
⚫ A good match will possibly mean similar protein shape
⚫ E.g., sequence identity > 35% will give a good match
– Rest of the first half of the course about these issues
Potential (Big) Payoffs
of Protein Structure Prediction

⚫ Protein function prediction

– Protein interactions and docking

⚫ Rational drug design

– Inhibit or stimulate protein activity with a drug

⚫ Systems biology
– Putting it all together: “E-cell” and “E-organism”
– In-silico modelling of biological entities and process
 Need for Bioinformatics technologies
• Bioinformatics has attracted a great deal of attention from various disciplines, such as information technology, mathematics,
and non-traditional biological sciences in recent years.
• Due to the availability of enormous amounts of public and private biological data and the compelling need to transform
biological data into useful information and knowledge.
• Bioinformatics can therefore be considered to be the combination of several scientific disciplines that include biology,
biochemistry, mathematics, and computer science.
• It involves the use of computer technologies and statistical methods to manage and analyze a huge volume of biological data
about DNA, RNA, and protein sequences, protein structures, gene expression profiles, and protein interactions.
• The transformation of voluminous biological data into useful information and valuable knowledge is the challenge of
knowledge discovery.
• Identification and interpretation of interesting patterns hidden in trillions of genetic and other biological data is a critical goal
of bioinformatics.

• Several types of databases available to researchers in the field of

many genome sequencing projects
they generate large volumes of data
biology manual analysis not practical
Bioinf has attracted attention from IT, math and non- need computational tools and technologies
traditional biological sciences in recent years need data driven decisions
It's a combination of several disciplines including - convert large volumes of data into useful, valuable
biology, biochem, math and CS knwoledge=knowledge discovery
There is large amounts of public&private biological Pattern recognition and relationship
data that can be transformed into useful info and
knowledge---this is the challenge of knowledge
discovery (and IDing patterns in it is the goal of bioinf)

Bioinf involves use of computer technologies and stat

methods to manage and analyze large vols of this
data abt DNA, RNA, protein seq/structs/interactions,
gene expr profiles
 An Overview of Bioinformatics Technologies
• Bioinformatics can be viewed as naturally evolving from computer and biological sciences.
➢ biological data collection such as NCBI (http://www. ncbi.nih.gov/), GeneBank, DDBJ and
PDB,
➢ biological data creation such as the human genome project, gene discovery and gene
expression,
➢ biological databases such as EMBL, EMBI and SWISS-PROT,
➢ biological data management such as bioinformatics data warehousing and Sequence
Retrieval Systems (SRS),
➢ biological data structures such as structural bioinformatics,
➢ biological modeling such as HMM, comparative modeling, probabilistic modeling and
molecular modeling,
➢ biological data analysis and exploration such as bioinformatics data mining, and biological
understanding such as machine learning and pattern matching and visualization of biological
sequences,
➢ sequence analysis: sequence assembly and alignment, and biological processes.
collection-NCBI, GeneBank modelling-HMM, comparative, probabilistic, molecular
creation-human genome project, gene discovery/expr analy and expl-bioinf data mining, ML pattern matching vis of seq
DBs-EMBL, SWISS-PROT seq analy-seq assembly & alignment
data management - bioinf data warehousing & Seq Retrieval System (SRS)
Data structures-structural bioinf
 An Overview of Bioinformatics Technologies
Bioinformatics technology is an interdisciplinary field, a confluence of a set of technologies
Structure and Process
Database TEch
Data Mining
Pattern Matching
ML
Network and Tools
Modelling and visualization

DDMMNPS
Data Mining
Database Tech
ML
Modeling and Visualization
Network & Tools
Pattern Matching
Structure and Process
 An Overview of Bioinformatics Technologies
• The existing research in bioinformatics is related to knowledge discovery, sequence analysis,
structure analysis, and expression analysis.
• Sequence analysis is the discovery of functional and structural similarities and differences
between multiple biological sequences.
• This can be done by comparing the new (unknown) sequence with well-studied and annotated
(known) sequences.
• If two similar sequences are from different organisms, they are said to be homologous sequences.
• 1. One proposed method for sequence comparison is sequence alignment.
• It is a procedure for base-by-base comparison of two (pairwise) or more (multiple) sequences
by searching for a series of individual characters or character patterns that are in the same
order in the sequences. To search for an identical character or character patterns, the string
matching technique is widely used.
• 2. Gene prediction is the process of detecting meaningful signals in uncharacterized DNA
sequences.
• Gene prediction uses homology search to acquire knowledge of the interesting information in
DNA. 1. find struct and func sim and diff b/w multiple biological sequences
2. compare known and unknown seq
3. If 2 sim seq are from diff orgs, they are homologoues species
4.i. Seq alignment --- base by base comparison of seq (characte-by-character/patterns of characters in an order)--for string matching is used
ii. Gene prediction-finding useful signals in uncharacterized DNA seq-homology search is used
 An Overview of Bioinformatics Technologies
• The existing research in bioinformatics is related to knowledge discovery, sequence
analysis, structure analysis, and expression analysis.
• Structure analysis is the study of proteins and their interactions. Proteins are complex
biological molecules composed of a chain of units, called amino acids, in a specific
order.
• They are large molecules required for the structure, function, and regulation of the body’s
cells, tissues, and organs.
• Each protein has unique functions.
• The understanding of protein structures and their functions leads to new approaches
for diagnosis and treatment of diseases, and the discovery of new drugs.

1. It's the study of proteins and their interaction.

2. Proteins are large coml bio moled composed of chain of amino acids in a spec order
3. They are req for structure, function and reg of body's cells, tissues and organs.
4. Each protein has unique func
5. Understanding protein struct and func-new approachs for diagnosis and treatment and drug discovery
 An Overview of Bioinformatics Technologies
• The existing research in bioinformatics is related to knowledge discovery, sequence
analysis, structure analysis, and expression analysis.
• Expression analysis includes gene expression analysis and gene clustering.
• gene expression analysis is a study that determines the similarities or differences of
genes expressed in a particular cell type or tissue.
• First, comparing the expression profiles of genes: if the expression profiles are similar,
the genes are co-regulated and functionally related.
• Second, by comparing the expression profiles of samples, one can consider whether
genes are expressed differently
• Gene clustering aims to group together genes having similar expression profiles.
• Genes in a specific group are co-regulated and functionally related to each other rather
than to genes in different groups.
1. Expr analysis= gene expr analysis + gene clustering
2. Gene expr analy = det sim or diff of genes expressed in a particular celll type or tissue
3. i. Compre expr profiles of genes-if similar? it means they are corregulated and functionally related
ii. Compare expr profile of samples--see whether genes are expr diff
4. Genes having sim expr profile? Group'em, clustering
5. 1 grp--coregulated and functionally rel to each other than to genes in other grps
Knowledge discovery in Bioinformatics
Complexity of Biological System
 Summary
• What is Bioinformatics
• DNA, RNA,
• Genes
• Amino Acids
• Protein
• Applications of Bioinformatics
• Need for Bioinformatics Technologies
• Databases available for Research
• Overview of Bioinformatics Technologies
 References
• https://archive.nptel.ac.in/courses/102/106/102106065/
• https://archive.nptel.ac.in/courses/102/106/102106065/
• Yi-Ping Phoebe Chen (Ed), “Bioinformatics Technologies”, First Indian
Reprint, Springer Verlag, 2007