The Pfizer Vaccine CRISPR Experiment
Introduction
The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat)
Technology is a genome-editing technique that has been used by Scientists
to alterate the genome in a population. The synthetic alteration of a Wildtype
population is called Gene Drive. A gene drive individual has an altered gene
inserted into one of his chromosomes. After sexual reproduction with a
Wildtype, each parent contributes one copy of each chromosome to their
offspring. Thus, the offspring carries only in 50% the altered gene from the
parent. The altered gene will persist in low frequency in the following
generations or can even go distinct after several generations. It would take
dozens of generations to recognize the characteristics of the altered gene
within a substantial fraction of the population(1).
However, the new genome editing technique CRISPR CAS9 increases the
odds that almost any altered gene will be inherited 100% to offspring,
potentially allowing the altered gene to spread through even wild
populations after only 12-15 generations for every thousand reproducing
gene drive individuals(2).
The CRISPR CAS9 technology is a well-known genome editing mechanism
that has been used by bacteria to defend itself from viral infections. CRISPR
is a genetic sequence with short palindrome repeats interspaced with viral
sequences called spacer RNA. The spacer RNA contains unique sequences
of viral RNA collected from past infections. During a viral invasion, the
bacterium transcribes a CRISPR RNA that contains the embedded memory
of the past viral infections. If the invaded viral RNA sequence matches the
transcribed CRISPR RNA with records from viral sequences, the bacterium
produces an enzyme called CAS9 that cuts the viral RNA and destroys it.
This gene-editing mechanism of the bacteria has been used by researchers to
insert and add altered gene sequences into the human DNA. Thus, an mRNA
can be engineered that contains the genetic information for the altered gene,
the information for the CAS9 enzyme and a guided RNA (gRNA) that tells
the CAS9 enzyme, where to cut and paste the altered gene sequence into the
human genome. After the mRNA has been injected into human cells, the
information on the mRNA will be translated into a CRISPR CAS9 enzyme
complex.
The CRISPR CAS 9 enzyme complex screens the human chromosomes for
a specific DNA sequence that matches the sequence on the gRNA. A match
activates the CAS 9 enzyme and induces a Double-Strand Break (DBS) by
cutting the human DNA at a specific chromosome site. The gRNA guides
the CAS9 to cut at this specific location. A short signal sequence of 2-6
nucleotides at the 3'end of the gRNA called PAM (protospacer adjacent
motif), tells the CAS9 enzyme to cut the altered host RNA off the mRNA.
The DNA cut stimulates the DNA repair system and inserts the free-floating
altered gene sequence into the human genome(3).
In other words, the human cells copy and paste the altered gene into the
Wild-type gene, when it repairs the DNA damage. Now, the gene-drive
individual has two identical gene copies on each chromosome, which will be
both transmitted to offspring. And the process repeats in subsequent
generations causing the alteration and spread through the population(1).
Because viruses are gene delivery systems, a virus is the perfect carrier for
the CRISPR CAS9 technology.
Pfizer describes on his website, the Cominarty vaccine under section
indication and usage as follows; COMIRNATY is a vaccine indicated for
active immunization to prevent coronavirus disease 2019 (COVID-19)
caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)
in individuals 16 years of age and older(4).
The increasing hospitalisation for Cominarty vaccines and reports of Covid
infections despite vaccination required a detailed analyzes of the Cominarty
mRNA code. The aim of this study was to analyze the mRNA code for
CRISPR-CAS9 gene-editing technology, which would explain the failure in
the SARS CoV-2 virus immunization and the increase in fatal side effects
after vaccination.
Method
1. First, the full sequenced and published mRNA code of the Pfizer
BNT-162b2, also known under the product name Cominarty was base by
base compared with the SARS CoV-2 Wuhan Hu-1 spike protein RNA
(Genbank Association MN908947.3) (6).
2. An online Palindrome sequence finder from the DNA sequencing
company, Novo Pro Lab from China, was used to find Short Palindrome
Repeats and DNA spacers(6).
3. An online DNA/RNA translation tool on the Website of the Swiss
Institute of Bioinformatics, called Expasy, was used to detect Open Reading
Frames(7). The results were confirmed and verified with the online NCBI
ORF finder(8).
4. Two further online tools were used to search for gRNAs with
cleavage sites for CAS enzymes. The gRNA search was mainly focused on
the plus strand to keep the study as understandable as possible for every
reader. The Giraldez Lab from Yale University offers an online CRISPR
gRNA search tool. The search was customized for Human Genoms, without
the occurrence of nucleotide mismatches and for cleavage sites for both
CAS9 and CAS12a enzymes(9). The second online tool was the CRISPR
Finder from the Sanger Institute for Genome Editing(10). The CRISPR
Finder provides correspondent CRISPR ID for the gRNAs in the online
Genome Database. Both CRISPR research tools gave the same results and
confirmed the findings.
5. And last, the CRISPR ID of each gRNA was searched in the online
BLAST Database for corresponding gene sequences in the human
genome(11).
Results
1. Cominarty analogy with SARS CoV-2 Wuhan Hu-1 Spike
protein
(Genbank Association MN908947.3)
The Cominarty mRNA matches in 24% with the SARS CoV-2 Wuhan Hu-1
Spike Protein. But 76% of the Cominarty genetic code is not related to the
SARS CoV-2 spike protein. The inserted spike protein sequences are located
mainly in the 3' end of the mRNA. Figure 1 shows highlighted in different
colours gene sequences that match the SARS CoV-2 spike protein. As we
can see from figure 1, fragmented spike protein sequences are added to new
DNA sequences (not highlighted).
2. Short Palindrome Repeats
The palindrome sequencer found 12 short palindrome repeats in the mRNA.
These are CAGCTG, CTGCAG, GCCGGC, CACGTG, TGTACA,
AGATCT, GCATGC, GATATC, TGATCA, TGGCCA, GGCGCC,
GCTAGC. The palindrome repeat CAGCTG appeared seven times and its
reverse version CTGCAG occurred six times in the mRNA. The Short
Palindrome repeats are highlighted in figure 2 in bright blue.
Between the short palindrome repeats are interspaced fragmented Spike
protein sequences. The same in colour highlighted spike protein sequences
from figure 1 are highlighted in figure 2 in gray. We can see in figure 2 that
the mRNA exists of fragmented spike protein pieces. Not the full-length
spike protein appears in the Cominarty mRNA as mentioned in the WHO
Program paper from September 2020 but fragments of spike protein
sequences that have been added to new gene sequences (12). Gene
sequences from the spike protein were even used to create some of the Short
Palindrome Repeats, which are presented in figure 3 as highlighted gray
nucleotides within bright blue fields. Figure 3 shows an example of a DNA
spacer. Fragmented virus spike protein sequences occur between short
palindrome repeats.
3. Open Reading Frames in the mRNA
Both the WHO Program Paper for the Cominarty vaccine and the published
Pfizer mRNA sequence show one large Open Reading Frame of over 3800
bp (12,5). This one open reading frame cannot possibly be translated into a
full-length spike protein due to two features in the mRNA. First, the spike
protein sequences express just fragmented amino acids and not complete
proteins. Second, the mRNA has stop and start codons in the middle of the
open reading frame, which triggers nonsense-mediated decay and
degradation of the mRNA (13). Noticeable is that the Stop codon UGA was
changed into UGAU.
But with the help of both, the expasy DNA/RNA translation tool and NCBI's
ORF finder, 13 hidden open reading frames were found within the long open
reading frame, which is translated into different fully functional proteins.
Figure 2 shows highlighted in dark and bright pink several open reading
frames.
Interestingly, the first protein nt 275-410 does not contain a single
fragmented sequence from the spike protein (figure 4). The BLAST Protein
search for this protein results in the human Coronavirus HKU1isolate N5
(figure 5). Another hidden open reading frame expresses into a hypothetical
protein. A hypothetical protein is a computer-predicted protein that does not
exist in nature. This hypothetical protein expresses from nt 2795-2822
including the start and stop codon (figure 6). The modified stop codon
UGAU for the hypothetical protein matches in position with the spike
protein sequence. Figure 7 shows the BLAST result.
The Cominarty mRNA expresses also two short proteins, both of which
play a role in the human cell signalling pathway. The sequence
CCCAGGCAC expresses the PRH protein, which has a role in cancer
suppression. And the CCAGCGTCG expresses the PAS protein, which plays
a role in cell signalling.
And we also find fully synthetic spike proteins that resemble either 96% or
in another case 98% a measles mutant virus protein (figure 8 and 9). Right at
the 3'end of the mRNA at nt 2254-3367 is a synthetic protein that shows in a
FASTA search only analogy with the Human Homeobox Hox A-4.
Interestingly, this synthetic protein is the only protein that contains mainly
spike protein sequences (figure 3,10).
4. CRISPR gRNA findings
Three gRNAs including the PAM sequence were found for the plus strand
by Yale's University CRISPR research tool and confirmed with the CRISPR
sequence finder by the Sanger Institute. Each gRNA sequence ends with the
PAM sequence GGG.
4.1. The first gRNA has the CRISPR ID1161208236. The 21 bp long
sequence is AGCTGCCCCTTTCCCGTCCT GGG (figure 11).
4.2. The second gRNA has the CRISPR ID 992837047. The 21 bp long
sequence is TTAGCCTAGCCACACCCCCAC GGG (figure 12).
4.3. The third gRNA has the CRISPR ID 1202628979. The 23 bp long
sequence is AACTAAGCTATACTAACCCCA GGG (figure 13).
5. Corresponding gRNAs on human reference genome
All three gRNAs were searched in the BLAST Database for the human
genome. The results show that all gRNA sequences correspond to the
Human Reference Genome GRCh38.
The gRNA with CRISPR ID 1161208236 originates from Chromosome 5
(figure 14) of GRCh38. The gRNA with CRISPR ID 992837047 also
originates from Chromosome 5 (figure 15). And gRNA with CRISPR ID
1202628979 originates from Chromosome 19 of the GRCH38 Human
Reference Genome (figure 16).
6. In addition, this study found a protein sequence at nt 3879-4050 that
translated into a synthetic novel gp130 protein. The novel gp130 protein was
already engineered in 1998 by Y. Liu. The publication from 1998 has been
completely removed from the web. The function of this protein, therefore,
remains unclear.
Conclusion
The analysis clearly shows that the Cominarty vaccine cannot induce
immunization because it translates not into the full Covid spike protein
pathogen. Although all genome database searches result in fully synthetic
spike protein production for the Cominarty mRNA, the complete spike
protein, however, cannot possibly be translated due to the fragmented RNA
sequences and induced translation discontinuation, which would lead to
mRNA degradation. Thus, the inserted spike protein sequences mask the
real intention behind the Cominarty vaccine. The manipulation of the human
genome at Chromosome 5 and Chromosome 19 as part of a human gene
drive experiment.
This human gene drive experiment consists of three parts. The first part
hosts CRISPR RNA with typical features such as Short Palindrome Repeats
interspaced with viral RNA spacer.
The second part has hidden open reading frames that are translated into 13
several synthetical proteins such as hypothetical protein, a measles virus
mutant protein or even human coronavirus protein. The different fully
synthetic proteins have nothing to do with the SARS Cov-2 virus pathogen
and are designed to cause both, the collapse and breakdown of the immune
system.
A vaccine designed to support the immune system would never contain a
hypothetical protein, whose post-translational function in human cells
remains unknown. Why would a vaccine manufacturer risk the overload of
the immune system with such a protein? Also questionable is why the
mRNA translates into a synthetic protein that is analogue to the human
Coronavirus? The human Coronavirus is a completely different type of virus
than the SARS CoV-2 (14). And finally, why should the vaccine
manufacturer go through so much trouble hiding 13 protein sequences
between Spacer DNAs instead of creating a simple mRNA that will be
translated into 13 full functional spike proteins?
The third part of Pfizer's CRISPR experiment contains three gRNAs
including the PAM sequence that cleavages for the CAS 9 and CAS 12a
enzyme. The analyzed gRNAs relate only to the plus strand. Additional
gRNAs emerged in the analysis for the reverse strand but hasn't been
discussed in this study. A pharmaceutical company cannot market a new
mRNA technology under the disguise of vaccines that actually contains a
technology to manipulate the human genome, where the public has not been
informed about.
The only individual, who could create such gRNAs in a stable mRNA
environment is Feng Zhang from the MIT Zhang lab. And the research
reveals that Pfizer announced back in 2016, a collaboration with MIT's
Zhang lab for cloud-based storage and analysis of human gene regulation
datasets(15). And in return, Pfizer, along with former Pfizer executive
Devyn Smith, raised $215 million in funds for Arbor Technology, Feng
Zhang's newly founded CRISPR company(16).
It comes as no surprise that MIT is the number one institution involved in
the human genome project. The complete mapping of the human genome
led to a database of stored reference genomes. The digital genome
sequences of 13 volunteers were stored under the human reference genome
GRCh38(17). Since the beginning of the Human Genome Project, the
GRCh38 genome has been modified in the database (18). The aim is to
create the desired human race using digital calculations and computer
predictions. Such computer-predicted perfect gene sequences have now
emerged in the Cominarty mRNA vaccine.
The individual, who was injected with a reference human genome from 13
different volunteers and the CRISPR CAS9 gene-editing tool was not
informed before vaccination and did not give consent for his genome to be
manipulated. Thus, this study also serves for criminal charges and legal
disputes against the Pfizer company for conducting genome experiments on
humans.
Reference
1. Youtube. Gene Drives from Harvard Wyss Institute. July 2014.
https://wyss.harvard.edu/media-post/crispr-cas9-gene-drives/ [Accessed
09/02/2022]
2. Wikipedia.Gene Drive. February 2022.
https://en.wikipedia.org/wiki/Gene_drive [Accessed 09/02/2022]
3. Matthew Behra, Jing Zhoub, Bing Xu, Hongwei Zhang. In vivo
delivery of CRISPR-Cas9 therapeutics: Progress and challenges. Acta
Pharmaceutica Sinica B. 2021;11(8):2150e2171.
4. Cominarty U.S. Physician Prescribing Information (Requires
Dilution). https://labeling.pfizer.com/ShowLabeling.aspx?id=15623
[Accessed 09/02/2022].
5. Dae-Eun Jeong, Matthew McCoy, Karen Artiles, Orkan Ilbay,
Andrew Fire, Kari Nadeau,
Helen Park, Brooke Betts, Scott Boyd, Ramona Hoh, and Massa Shoura.
Assemblies of
putative SARS-CoV2-spike-encoding mRNA sequences for vaccines BNT-
162b2 and
mRNA-1273.Virological.org.2021. https://virological.org/t/assemblies-of-
putative-sarscov2-
spike-encoding-mrna-sequences-for-vaccines-bnt-162b2-and-mrna-
1273/663
[Assecced 6.1.2022].
6. Novo Pro Labs.Tools. DNA Palindrome.
https://www.novoprolabs.com/tools/dna-palindrome [Accessed 06/02/2022]
7. Expasy.org.Translate. https://web.expasy.org/translate/ [Assecced
06/02/2022].
8. NCBI. ORF Finder. https://www.ncbi.nlm.nih.gov/orffinder/
[Accessed 06/02/2022]
9. CRISR SCAN.org.Sequence. https://www.crisprscan.org/sequence/
[Accessed 06/02/2022]
10. WGE,Stem Cell, Sanger.ac.uk. Search by Sequence.
https://wge.stemcell.sanger.ac.uk/search_by_seq [Accessed 06/02/2022]
11. BLAST. NCBI. https://blast.ncbi.nlm.nih.gov/Blast.cgi [Accessed
07/02/2022]
12. WHO International Nonproprietary Names Programme. Berthub.EU.
https://berthub.eu/articles/11889.doc [Accessed 30/12/2021].
13. Youtube. Nonsense mediated and non stop mediated mRNA decay:
mRNA surveilance. https://www.youtube.com/watch?v=UTxiohosPro
[Assecced 02/02/2022].
14. Zigui Chen, Siaw S Boon, Maggie H Wang, Renee W Y Chan, Paul
K S Chan, Genomic and evolutionary comparison between SARS-CoV-2
and other human coronaviruses. J Virol Methods. 2021;289:114032.
15. Broadinstitute.News. https://www.broadinstitute.org/news/8064.
[Assecced 10/02/2022].
16. Endpoints.News.https://endpts.com/feng-zhangs-quiet-spinout-
snares-215m-in-a-race-for-the-next-big-crispr-company/. [Accesssed
10/02/2022].
17. E pluribus unum.Nat Methods.2010; 7:331.
https://doi.org/10.1038/nmeth0510-331
18. Human Genome Project Information Archive. 2019.
https://web.ornl.gov/sci/techresources/Human_Genome/project/index.shtml
[Accessed 10/02/2022]
Figures
Figure 1
Cominarty mRNA. Highlighted in
colour are SARS CoV-2 spike
protein sequences.
Figure 2
Highlighted in gray are fragmented
spike protein interspaced with
short palindrome repeats, which
are highlighted in bright blue.
Between the short palindrome
repeats are open reading frames,
which express full functional
proteins, here high-lighted in dark
and brigh pink. The open reading
frames have in some cases
modified stop codons TGAT
(UGAU), which are highlighted in
bright green. Also visible in figure
2 are start codons in dark blue and
stop codons in dark green that
occure in the middle of the open
reading frame, which cause
nonsense decay and mRNA
degradation. Gray highlighted
nucleotides within open reading
frames in pink or within short
palindrome repeats in bright blue
matches in position with the spike
protein sequence.
Figure 3.
Between two palindrome repeats in
bright blue appear interspaced
spike protein fragments as an
example for a DNA spacer. Gray
highlighted nucleotides within the
palindromes in bright blue matches
in position the spike protein
sequence. The DNA spacer is
followed by an open reading frame
for a protein that has 58% analogy
with the HoxA4 protein, here
highlighted in pink. This fully
synthetic protein contains mainly
of spike protein amino acids.
Figure 4
Human Coronavirus protein
without any analogy to the spike
protein. The stop codon UGAU is
modified.
Figure 5
BLAST result for Human
Coronavirus HKU1 isolate N5
Figure 6
Open Reading Frame that
translates into a Hypothetical
Protein. Stop codon has been
modified and matches in
nucleotide position with the spike
protein.
Figure 7
BLAST result for the Hypothetical
Protein
Figure 8
BLAST result for fully synthetic
protein with 96% analogy to a
mutant measles virus strain.
Figure 9
BLAST result for another fully
synthetic spike potein with 98%
analogy to a mutant measles virus
strain.
Figure 10
FASTA result for Hox A-4 protein
Figure 11
CRISPR gRNA result for
ID1161208236
Figure 12
CRISPR gRNA result for ID
992837047
Figure 13
CRISPR gRNA result for ID
1202628979
Figure 14
Corresponding BLAST result for
CRISPR ID 1161208236 on
Chromosome 19 of GRCH38
Figure 15
Corresponding BLAST result for
CRISPR ID 992837047 on
Chromosome 5 of GRCH38
Figure 16
Corresponding BLAST result for
CRISPR ID 1202628979 on
Chromosome 5 of GRCH38
