© 2024 The Authors Journal of Water and Health Vol 22 No 4, 673 doi: 10.2166/wh.2024.

302

Occurrence of coliforms and biofilm-forming bacteria in raw, treated, and distributed

water from two waterwork systems in Osun State, Southwestern Nigeria

Abayomi Tolulope Oyewale a, *, Babatunde Wumi Odetoyinb, Anthonia Olufunke Oluduroc

and Israel Funso Adeniyid
a
Institute of Ecology and Environmental Studies, Obafemi Awolowo University, Ile-Ife, Nigeria
b
Department of Medical Microbiology and Parasitology, Obafemi Awolowo University, Ile-Ife, Nigeria
c
Department of Microbiology, Obafemi Awolowo University, Ile-Ife, Nigeria
d
Department of Zoology, Obafemi Awolowo University, Ile-Ife, Nigeria
*Corresponding author. E-mail: [email protected]; [email protected]

ATO, 0000-0001-9096-656X

ABSTRACT

This study assessed the bacteriological quality of raw, treated, and distributed water from Ede-Erinle and Opa reservoirs in Osun State,
Nigeria. This was to determine the potability of water from these waterwork stations. Eighteen sampling points were established across
the two reservoir networks for this study. Samples were collected bi-monthly for two annual cycles. Serial dilution and pour plate methods
were employed for the enumeration of bacterial load. Total heterotrophic bacteria count (THBC) and total coliform bacteria count (TCBC) were
enumerated on nutrient and MacConkey agar at 37 °C, respectively. Bacterial isolates were characterized using biochemical identification
methods with reference to Bergey’s Manual of Determinative Bacteriology. Bacterial isolates and biofilm formation were further identified
molecularly through the PCR method using specific universal primers. Mean values of THBC and TCBC in distributed water from Ede-
Erinle (9.61
104 + 1.50
104 CFU/mL; 69.56 + 26.81 CFU/mL) and Opa waterworks (9.58
104 + 2.55
104 CFU/mL; 142.94 +
44.41 CFU/mL) exceeded permissible limits for drinking water. Paenibacillus lautus, Bacillus pseudomycoides, Pseudomonas aeruginosa,
and Pseudomonas stutzeri showed biofilm-forming capacity. The study concluded that the presence of coliforms and biofilm-forming
bacteria in distributed water implies that the water is unfit for consumption without further treatment.

Key words: biofilm-forming bacteria, coliforms, reservoir, waterworks systems

HIGHLIGHTS

• Molecular identification of coliforms from the two reservoirs and their channels.
• Molecular detection of biofilm bacteria in water from the two waterwork systems.
• Comparison of molecular loads of water from the two waterwork systems.
• Health implications of the identified bacteria from the two waterwork systems.
• Potablilty of water from the two reservoirs and their stations.

This is an Open Access article distributed under the terms of the Creative Commons Attribution Licence (CC BY 4.0), which permits copying, adaptation and
redistribution, provided the original work is properly cited (http://creativecommons.org/licenses/by/4.0/).

Downloaded from http://iwaponline.com/jwh/article-pdf/22/4/673/1406582/jwh0220673.pdf

by guest
 Journal of Water and Health Vol 22 No 4, 674

GRAPHICAL ABSTRACT

Downloaded from http://iwaponline.com/jwh/article-pdf/22/4/673/1406582/jwh0220673.pdf

by guest
 Journal of Water and Health Vol 22 No 4, 675

INTRODUCTION
Water supplies in underdeveloped nations are still insufficiently treated, forcing communities to rely on the most available
sources (Sobsey 2002; Moyo et al. 2004). Many of these water sources are unprotected and vulnerable to contamination
from runoff, windblown debris, human and animal faeces, and filthy collecting methods (Chidavaenzi et al. 1998; WHO
2000; Moyo et al. 2004). The quantity of microorganisms present in drinkable water influences its microbiological quality.
However, because detecting each pathogenic organism in water is technically difficult, time-consuming, and expensive, it
is not employed for routine water testing processes (Grabow 1996). As a result, indicator organisms are commonly used to
assess the microbiological quality of water and provide a simple, quick, and reliable indication of water supply quality
(Grabow 1996). Coliforms are members of the family Enterobacteriaceae and are defined as facultative anaerobic, Gram-nega-
tive, non-sporing, rod-shaped bacteria that ferment lactose with gas formation within 48 h at 35 °C (Prescott et al. 1999).
Heterotrophic plate counts, total coliform bacteria (TCB), faecal coliform bacteria, and faecal Enterococci are utilized as a
system indicator in water quality investigations, providing information on the efficacy of water treatment (APHA 1995;
WHO 2000). The presence of coliforms in water samples indicates the existence of opportunistic pathogenic bacteria like
Klebsiella and Enterobacter that can multiply in water environments, as well as pathogenic bacteria like Salmonella spp.,
Shigella spp., and Escherichia coli. These groups of microorganisms have the potential to cause illnesses such as gastroenter-
itis, dysentery, cholera, typhoid fever, and salmonellosis in consumers of these water sources (DWAF 1996; Grabow 1996).
Biofilms can be found in industrial settings, hotels, wastewater channels, toilets, laboratories, and medical settings, and they
typically form on hard surfaces that are submerged in or exposed to aqueous solutions. They can form on living and non-living
surfaces (Rao et al. 2005).
Drinking water networks may be considered as biological reactors hosting a wide variety of microorganisms, such as bac-
teria, protozoa, and fungi, both in bulk water and on the surfaces of pipes. The Gram-negative bacteria predominate over
the Gram-positive bacteria, and Pseudomonas is the most prevalent bacterial organism in water supply systems, regardless
of the source. In microbial ecology, the rRNA-targeted oligonucleotide samples are identified and increasingly used to classify
the bacterial species found in biofilms produced in water delivery systems (Wagner et al. 1993; Kalmbach et al. 1997; Lud-
mány et al. 2006). There have been several investigations on the existence and significance of biofilms in drinking water
distribution systems (Momba et al. 1999; Gouider et al. 2009; Paris et al. 2009). Flemming et al. (2002) proposed that
95% of the bacteria would adhere to the pipeline surface and that only 5% would be present in the bulk water. Biofilm
can protect microorganisms from various stress conditions and disinfectants. Biofilm also provides the injured microorgan-
isms with the micro- and macro-nutrients needed for recovery and growth (Davey & O’Toole 2000). Chlorine, a potent
oxidizing agent, is the disinfectant most widely used in water distribution systems because of its effectiveness, stability,
simple to use, and affordability. In iron pipes, however, doses of chlorine as high as 4 mg/L have little impact on biofilm
reduction as iron corrosion products interfere with free chlorine disinfection. The demand for chlorine in iron pipes was
found to be as much as ten times higher than in pipes of a different composition.
Ede-Erinle and Opa reservoirs are land-treated surface water sources, which supply potable water to about 10 respective
Local Government Areas in Osun State and the Obafemi Awolowo University Campus, Ile-Ife, Nigeria. This work was car-
ried out to identify coliforms as well as the presence of biofilm-forming bacteria in water samples from the waterworks
stations with a view to determining the potability of distributed water from these reservoirs, thereby enhancing the actualiza-
tion of sustainable development (SDG) goal 6 (provision of clean water and sanitation) in this region of the Sub-Sahara
Africa.

MATERIALS AND METHODS

Study area and sampling stations
The study investigated the quality of water from the Ede-Erinle and Opa reservoirs. Ede-Erinle reservoir is located in Ede,
Olorunda Local Government Area of Osun State, Nigeria. The reservoir, which is owned and operated by the Osun State
Water Corporation, took its source from the ancient Erinle River. It has a catchment area of about 340 km2 and a surface
area of around 19 km2. The reservoir network stations lay between Latitude 07°320 32″ and 07°440 28″N and Longitude
004°240 15″–004°320 41″E, with an elevation range of 278–304 m (amsl) (Table 1 and Figure 1). It supplies water to about
10 Local Government Areas in Osun State. Opa Dam and the associated reservoir were built within the confines of the Uni-
versity of Ife estate (now Obafemi Awolowo University, Ile-Ife) in 1978 by the impoundment of the Opa River, which took its

Downloaded from http://iwaponline.com/jwh/article-pdf/22/4/673/1406582/jwh0220673.pdf

by guest
 Journal of Water and Health Vol 22 No 4, 676

Table 1 | Geographical location and description of sampling stations of Ede-Erinle and Opa waterwork systems

Sampling station Description Latitude (N) Longitude (E) Elevation (amsl) (m) Distance from reservoir (m)

0 0
ED 1 Ede-Erinle raw water 07°45 32″ 004°27 15″ 278 At the reservoir
ED 2 Ede-Erinle aerator 07°45’35″ 004°27’7″ 304 150
ED 3 Ede-Erinle clarifier 07°45’35″ 004°27’5″ 303 150
ED 8 Ede-Erinle filter bed 07°45’37″ 004°27’9″ 283 200
ED 4 Ede-Erinle clear water tank 07°45’36″ 004°27’11″ 300 250
ED 5 Sekona distribution 07°38’3″ 004°26’36″ 278 20,000
ED 6 Moro distribution 07°32’22″ 004°27’39″ 270 28,000
ED 7 Ile-Ife distribution 07°29’28″ 004°31’41″ 284 35,000
ED 9 Ede distribution 07°45’36″ 004°27’12″ 292 500
OP 1 Raw water 07°30’8″ 004°31’47″ 248 At the reservoir
OP 2 Opa aerator 07°30’8″ 004°31’41″ 244 100
OP 3 Opa clarifier 07°30’8″ 004°31’42″ 246 200
OP 4 Opa filter bed 07°30’8″ 004°31’43″ 245 250
OP 5 Opa clear water tank 07°30’9″ 004°31’40″ 241 350
OP 6 Biological sciences distribution 07°31’9″ 004°31’33″ 287 7,000
OP 7 Staff quarters distribution 07°31’21″ 004°30’59″ 289 5,000
OP 8 Fajuyi Hall distribution 07°31’6″ 004°30’49″ 263 5,000
OP 9 Staff club distribution 07°31’33″ 004°31’53″ 271 6,000
ED: Ede-Erinle station; OP: Opa Station; amsl: above mean sea level.

source from the Oke-Opa Hills. Approximately 2.5 km long and 0.5 km at its widest point, the reservoir was primarily created
to supply potable water to the university community, for which reason, fishing activities were permitted only for recreational
and research purposes. The waterworks channels lay between Latitude 07°300 8″ and 07°310 33″N and Longitude 004°290 47″–
004°320 53″E, with an elevation range of 248–289 m (amsl) (Table 1 and Figure 1).
The operating procedures in both water treatment plants are the same. A low lift machine draws raw water from the reser-
voir to the aerator, where dosing pumps deliver aluminium sulphate, lime, and hypochlorite into the water. The water then
enters the clarifier chamber, where it undergoes flocculation and/or coagulation (alum reacts with and traps dirt in the water).
Clear water will float to the top, while flocs will sink to the bottom. The water is then directed to the filter bed, where filter
media is used to catch the suspended particles that escape from the clarifier, allowing clean water to percolate to a conserved
region for further processing. Following that, some underground pipes will transport the water from the point of percolation
to the final destination, which is the clear well tank or the main reservoir, where water is stored underground for later dis-
tribution to the general public. Before the final water is routed to the clear water tank, a process known as post-
chlorination is performed to maintain a specified level of chlorine in the water.
Eighteen sampling stations were established for this study. Nine sampling stations were selected for each of the two water-
works investigated. Water samples were taken from the reservoirs (raw water; ED1, OP1), the treatment stages (treated water;
ED2, ED3, ED4, ED8, OP2, OP3, OP4, OP5), and at the final consumer taps (distribution water; ED5, ED6, ED7, ED9, OP6,
OP7, OP8, OP9). Water samplings were carried out in the morning (between 7.00 am and 10.00 am) bi-monthly and covered
both the dry and rainy seasons for two annual cycles between August 2017 and June 2019.

Sample collection
A total of 108 water samples were collected from each sampling station (raw water – 12 samples; treated water – 48 samples;
distribution water – 48 samples) of the two waterwork systems in 500-mL sterile corked bottles. Each sample after the collec-
tion was placed in an ice box prior to its immediate transfer to the laboratory within the holding period of 6 h for
bacteriological analyses, which include heterotrophic plate count, total coliform count, faecal coliform count using the
pour plate method, and most probable number (MPN) of the coliform presumptive test.

Downloaded from http://iwaponline.com/jwh/article-pdf/22/4/673/1406582/jwh0220673.pdf

by guest
 Journal of Water and Health Vol 22 No 4, 677

Figure 1 | Map of Ede-Erinle and Opa Reservoirs showing the sampling stations.

Determination of total heterotrophic bacteria, total coliform bacteria, faecal coliform count, and preliminary
identification of bacteria
Enumeration of total heterotrophic bacteria (THB) and TCB was carried out using serial dilution technique by introducing
1 mL of water samples into 102 to 105 dilution folds and plated on sterile Petri dishes containing appropriately sterilized
nutrient and MacConkey agar, respectively. The plates were then incubated at 37°C for 24 h, after which the colonies were
counted using a manual colony counter.
The MPN of the coliform presumptive test was carried out on the water samples by placing three portions in each of three
dilutions in geometric series employing the use of sterile single- and double-strength Lactose broth. For the dilution, a set of
three test tubes, each containing 10 mL double-strength broth, and two sets of three test tubes, each containing 5 mL of sterile
single-strength broth, were utilized. Ten millilitres of the sample was inoculated into each tube of the double-strength broth;
1.0 mL of the sample was inoculated into each of the first set of the three single-strength tubes, while 0.1 mL of the sample
was inoculated into each of the other three single-strength broth. The culture tubes were incubated at 35 °C for 48 h, and each

Downloaded from http://iwaponline.com/jwh/article-pdf/22/4/673/1406582/jwh0220673.pdf

by guest
 Journal of Water and Health Vol 22 No 4, 678

tube was observed for growth with acid and gas production. A tube in which acid and gas were produced was referred to as ‘a
positive tube’. The combined number of positive tubes in each set arranged in order of least diluted to the most diluted tubes
was read out from the appropriate standard MPN table to obtain the estimated number of coliform cells present in 100 mL of
the original sample.
Bacterial isolates obtained were preliminarily identified using cultural, morphological, and biochemical tests. Probable
identification of bacteria in the water samples was carried out using Bergey’s Manual of Determinative Bacteriology (Holt
et al. 1994).

Phenotypic identification of biofilm producers

Phenotypic investigation for biofilm production by the isolates was performed using Congo Red Agar Medium, which was
prepared using the combination of brain heart infusion agar 52 g/L, sucrose 50 g/L, and Congo red indicator 0.8 g/L, as
described by Mathur et al. (2006). The Congo red was prepared as a concentrated aqueous solution separately from other
medium constituents and then sterilized in different containers before adding them together when the agar had cooled to
55 °C before being distributed to sterile plates to solidify. The plates were then inoculated with the test organisms using
point inoculation method and incubated at 37 °C for 24 h. The presence of black colonies on the positive plates, characterized
by a dry crystalline quality, signifies the formation of biofilm.

Molecular identification of bacterial isolates

Molecular DNA extraction from the bacterial isolates was carried out using the boiling technique, as described by Gueimonde
et al. (2004) and Naas et al. (2007). In further determining the identities of bacterial species isolated, polymerase chain reac-
tion (PCR) was used by employing bacterial-specific universal primers. The primer developed by Horakova et al. (2008)
amplified at 1465-bp sequence of 16srRNA gene was used as follows: 27F 50 -AGAGTTTGATCCTGGCTCAG–30 and
1429R 50 -GGTTACCTTGTTACGACTT-30 . The reaction mixture contained 12.5 μL of PCR Master Mix (New England Bio-
labs, SA), 0.5 μL each of Forward and Reverse Primers (Inqaba Biotech, SA), 3 μL of DNA template, and 8.5 μL of
nuclease-free water to constitute a total reaction volume of 25 μL. The PCR conditions for the detection of 16S rRNA
genes of the bacterial species were as described by Horakova et al. (2008) but with slight modification. Gene amplification
was carried out in an Applied Biosystems 2720 Thermal Cycler. The mixture was subjected to an initial denaturation at 94 °C
for 5 min, followed by denaturation at 94 °C for 1 min, annealing at 48 °C for 30 s, extension at 72 °C for 1 min for 37 times,
and final extension step at 72 °C for 10 min. For the identification of biofilm-producing bacteria, the following two sets of pri-
mers were utilized: (i) bcsA-F GCT TCT CGG CGC TAA TGT TG; bcsA-R GAG GTA TAG CCA CGA CGGTG (826 bp), as
described by Olowe et al. (2019), and (ii) BssS-F GATTCAATTTTGGCGATTCCTGC; BssS-R TAATGAAGTCATTCAGACT-
CATCC (225 bp), as described by Hassan & Abdalhamid (2014). The conditions for the forward and reverse biofilm primers
were initial denaturation at 94 °C for 2 min followed by 40 s of denaturation also at 94 °C, annealing at 48 °C for 1 min, exten-
sion at 72 °C for 1 min for 35 times, and final extension step at 72 °C for 5 min.
Electrophoresis was done by loading 10 μL aliquot of the amplicons on 1.5% agarose gel CSL-AG 100 (Cleaver Scientific
Ltd, SA) stained with 5 μL ethidium bromide (Sigma-Aldrich, USA) and ran in 1X TAE buffer (tri-acetate EDTA buffer) (Bio-
Concept, SA) for 1 h at 80 V. The PCR fragments were visualized with a UV transilluminator (Uvitec 07 10322). The 16S
rRNA PCR products were sequenced using the Nimagen, Brilliant-Dye™ Terminator Cycle Sequencing Kit V3.1, BRD3-
100/1000 according to the manufacturer’s instructions. Sequence chromatogram analysis was performed using Finch TV
analysis software version 1.4.0. All nucleotide sequences obtained were analysed by a BLAST search (http://www.ncbi.
nlm.nih.gov/BLAST).

Data analysis
The acquired data were analysed using descriptive, inferential (ANOVA), and multivariate (cluster analysis) statistics with
applicable statistical software such as PAST version 2.17 and SPSS version 20. The student sample t-test (p , 0.05) was
used to compare the bacteriological quality of the two reservoir systems to the World Health Organization (WHO) and
Nigerian Standard for Drinking Water Quality (NSDWQ) permitted standards.

Downloaded from http://iwaponline.com/jwh/article-pdf/22/4/673/1406582/jwh0220673.pdf

by guest
 Journal of Water and Health Vol 22 No 4, 679

RESULTS
Total heterotrophic bacteria and total coliform counts
In Ede-Erinle reservoir, THB over the period of study ranged from 0 to 1.30
106 CFU/mL, with overall mean and median
values of 1.54
105 and 1
105 CFU/mL, respectively (Table 2), whereas total coliform bacteria counts (TCBC) in water
samples collected from Ede-Erinle reservoir over the study period ranged from 0 to 1.1
103 CFU/mL, with overall mean
and median values of 182.23 + 33.91 CFU/mL and 10 CFU/mL, respectively (Table 2). Across the stations, the highest
THB mean value of 3.94
105 + 1.1
105 CFU/mL was recorded in the raw water station, while the lowest mean value
of 9.61
104 + 1.50
104 CFU/mL was recorded at the distributed water station. However, there was a significant spatial
difference (p , 0.001) across the stations. The highest TCBC mean value was recorded at the raw water station (9.67

102 + 7.0
101 CFU/mL), while the lowest mean value occurred at the distributed water stations (69.56 + 26.81
CFU/mL). In general, the mean values of TCBC across the stations were significantly different (p , 0.001) from each
other (Table 2). The THB count was higher in the rainy season than in the dry season, but the seasonal mean values were
not significantly different from each other (p . 0.05) (Table 3). Meanwhile, the TCBC was generally higher in the dry
season than in the rainy season, but there was no significant difference (p . 0.05) between the two seasonal mean values
(Table 3). The total heterotrophic bacteria count (THBC) in the Opa waterworks system ranged from 0 to 3.10
107 CFU/
mL, with an overall mean of 4.91
105 + 2.9
105 CFU/mL and median of 5.0
103 (Table 2). TCBC ranged from 0 to
1.1
102 CFU/mL, with overall mean and median values of 3.9
102 + 4.5
101 CFU/mL and 93.00 CFU/mL, respectively
(Table 2). The highest THB mean value of 3.31
106+ 2.57
106 CFU/mL was recorded in the raw water, while the lowest
mean value of 9.58
104 + 2.55
104 CFU /mL occurred at the distributed water station. The highest mean TCBC value
(723.00 + 129.28 CFU/mL) was recorded at the raw water station, while the lowest mean value (142.94 + 44.41 CFU/mL)
occurred at the distributed water station. The difference in mean values across stations was significant at p , 0.001
(Table 2). The THB abundance was higher in the dry season than in the rainy season, but the seasonal mean values were
not significantly different from each other (p . 0.05) (Table 3). Whereas TCBC was higher during the rainy season
(458.40 + 55.75 CFU/mL) than in the dry season (242.58 + 95.66 CFU/mL), and there was a significant difference
(p , 0.05) between the two seasonal mean values (Table 3).
The biochemical characteristics and probable bacterial isolates identified during this study from Ede-Erinle and Opa water
samples are presented in Table 5.

Comparison of microbial loads in raw, treated, and distributed water between Ede-Erinle and Opa waterwork
systems
From the bacteriological analysis carried out during the study, THBC was significantly higher (p , 0.05) in the Opa reser-
voir (3.60
106 + 2.57
105 CFU/mL) than in the Ede-Erinle reservoir station (3.94
105 + 1.1
105 CFU/mL), while
TCBC were significantly higher ( p , 0.01) in the Ede-Erinle reservoir (967.50 + 70.74 CFU/mL) than in the Opa reser-
voir station (723.00 + 129.28 CFU/mL) (Table 7). However, THBC and TCBC were higher in the Opa-treated water
stations (1.43
105 CFU/mL and 545.83 + 71.48 CFU/mL) than in the Ede-Erinle stations (1.02
105 CFU/mL and
98.58 + 34.33 CFU/mL) during the study, and there was a significant difference ( p , 0.001) in the mean values of
TCBC during the study (Table 4). Similarly, analysis of the distributed water from the Ede-Erinle and Opa waterworks
stations revealed that THBC and TCBC were both higher in the Opa distribution stations (6.35
104 + 2.20

104 CFU/mL and 143.02 + 44.41 CFU/mL) than in the Ede-Erinle stations (5.18
104 + 1.42
104 CFU/mL and
69.56 + 26.81 CFU/mL). There was a significant difference ( p , 0.05) in the mean values of TCBC across the stations
during the study (Table 4).
As shown in Figure 2, the hierarchical cluster analysis (HCA) plot indicated the relationship between THB and TCB dis-
tribution in the Ede-Erinle stations. ED 3 (Ede Clarifier), ED 4 (Ede clear water), Ed 7 (Ile-Ife distribution), Ed 6(Moro
distribution), and ED 8 (Ede filter bed) were independently related to each other. There was also a close relationship between
ED 2 (Ede aeration chamber) and ED 1 (Ede raw water) in one of the major clusters formed. Similarly, Figure 3 shows the
similarities that exist in the distribution of THB and TCB in the stations of Opa waterworks. The HCA plot showed related-
ness in OP 8 (Opa Fajuyi Hall distribution), OP 5 (Opa clear water), OP 9 (Opa staff club water), and OP 1 (Opa raw water).
Also, there was a relationship between OP4 (Opa filter bed), OP 3 (Opa clarifier), OP 2 (Opa aeration chamber), and OP 6
(Opa biological sciences) stations, while OP7 demonstrated a distant relationship to the group.

Downloaded from http://iwaponline.com/jwh/article-pdf/22/4/673/1406582/jwh0220673.pdf

by guest
 Table 2 | ANOVA statistics of bacterial load in raw, treated, and distributed water from Ede-Erinle and Opa waterwork systems (August 2017–June 2019)

Raw water (n ¼ 12) Treated water (n ¼ 48) Distributed water (n ¼ 48) Overall (n ¼ 108) ANOVA
Ede-Erinle
reservoir Range Mean + SEM Range Mean + SEM Range Mean + SEM Range Mean + SEM F p

THBC 9.0
10 – 2
3.94
10 + 5
1.12
1.53
10 +
5
0–4.0
9.61
10 +4
0–1.30
1.54
10 +
5
10.317 0.000***
(CFU/mL) 1.3
106 1.1
105 102–1.28
106 3.16
105 105 1.50
104 106 2.12
102
TCBC 4.60
102– 9.67
102+ 0–1.1
102 98.58 + 34.35 0–1.1
69.56 + 26.81 0–1.1
182.23 + 33.91 88.608 0.000***
(CFU/mL) 1.1
103 7.0
101 102 103
Opa reservoir
THBC 5.0
103– 3.31
106 + 73–2.33
106 1.83
105 + 0–6.30
9.58
104 + 0–3.10
4.91
105 + 6.394 0.002**
(CFU/mL) 3.10
107 2.57
106 5.88
104 106 2.55
104 107 2.92
105
TCBC 93–1.1
103 723.00 + 129.28 0–1.1
102 545.83 + 71.48 0–1.1
142.94 + 44.41 0–1.1
2.92
102 + 15.663 0.000***
(CFU/mL) 102 103 4.5
101
THBC, total heterotrophic bacterial count; TCBC, total coliform bacterial count.

Journal of Water and Health Vol 22 No 4, 680

**Significant (p , 0.01).
***Significant (p , 0.001).
***Significant (p , 0.001).

Downloaded from http://iwaponline.com/jwh/article-pdf/22/4/673/1406582/jwh0220673.pdf

 Journal of Water and Health Vol 22 No 4, 681

Table 3 | ANOVA statistics of the seasonal variation in bacterial load of water samples from Ede-Erinle and Opa waterworks system (August
2017–June 2019)

Rainy season (n ¼ 72) Dry season (n ¼ 36) Overall (n ¼ 108) ANOVA

Ede-Erinle
reservoir Range Mean + SEM Range Mean + SEM Range Mean + SEM F p

THBC 0–1.30
1.65
10 + 5

0–5.10
1.32
10 +
5
0–1.30
1.54
10 +
6
0.546 0.462
(CFU/mL) 105 2.99
104 105 2.21
104 105 2.12
105
TCBC 0–1.10
178.49 + 39.71 0–1.10
189.72 + 64.41 0–1.10
182.23 + 33.91 0.024 0.877
(CFU/mL) 102 102 102
Opa reservoir
THBC 0–6.21
2.41
105 + 0–3.10
9.92
105 + 0–3.10
4.91
105 + 1.472 0.228
(CFU/mL) 106 9.23
104 107 8.60
105 107 2.93
105
TCBC 0–1.10
458.40 + 55.75 0–1.10
242.58 + 95.66 0–1.10
386.46 + 45.20 5.269 0.024*
(CFU/mL) 102 102 102
THBC, total heterotrophic bacterial count; TCBC, total coliform bacterial count.
*Significant difference (p , 0.05).

Table 4 | t-test statistics of the raw water samples from Ede-Erinle and Opa waterwork systems

Reservoir t-test
NSDWQ maximum WHO maximum
Parameters (unit) Ede-Erinle Mean + S.E (N ¼ 12) Opa Mean + S.E (N ¼ 12) t p permitted level permitted level

Raw water
THBC (CFU/mL) 3.94
105 + 1.1
105 3.60
106 + 2.57
105 1.1133 0.029* 10 0
TCBC (CFU/mL) 967.50 + 70.74 723.00 + 129.28 1.659 0.001** 10 0
Treated water
THBC (CFU/mL) 1.02
105 + 3.20
104 1.43
105 + 5.74
104 0.622 0.155 10 0
TCBC (CFU/mL) 98.58 + 34.33 545.83 + 71.48 5.640 0.000*** 10 0
Distributed water
THBC (CFU/mL) 5.18
104 + 1.42
104 6.35
104 + 2.20
104 0.450 0.141 10 0
TCBC (CFU/mL) 69.56 + 26.81 143.02 + 44.41 1.416 0.028* 10 0
Source: NSDWQ (2015); WHO (2017).
*Significant (p , 0.05).
**Significant (p , 0.01).
***Significant (p , 0.001).

Identified bacterial isolates

The biochemical characteristics and probable bacterial isolates identified during this study from Ede-Erinle and Opa water
samples are presented in Table 5.

Molecular identification of bacterial isolates

Table 6 shows the respective sequences, accession numbers, and the identified species of 10 randomly selected bacterial iso-
lates subjected to 16S rRNA PCR amplification. This result revealed the isolates’ identity to be Bacillus pseudomycoides,
Pseudomonas stutzeri, Bacillus cereus, Aeromonas jandaei, Bacillus paramycoides, Morganella morganii, Paenibacillus
lautus, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Providencia rettgeri. Gel electrophoresis showed that the
band size of all the selected isolates fell within the range of the expected band size of 1,500 base pairs (bp), as indicated
in Figure 4.
Out of the ten bacterial isolates that showed biofilm-forming ability phenotypically, as shown in Table 7, only four were
genotypically confirmed. These confirmed biofilm-forming bacterial isolates were P. lautus (isolated from the Ile-Ife distri-
bution station of Ede-Erinle waterworks), B. pseudomycoides (isolated from the raw water station of Ede-Erinle

Downloaded from http://iwaponline.com/jwh/article-pdf/22/4/673/1406582/jwh0220673.pdf

by guest
 Journal of Water and Health Vol 22 No 4, 682

Figure 2 | Cluster diagram showing the relationship among sampling stations of Ede-Erinle reservoir based on bacterial population
(THB and TCB).

waterworks), P. aeruginosa (isolated from the clear water tank of Ede-Erinle waterworks), and P. stutzeri (isolated from the
raw water station of Ede-Erinle waterworks). The gel electrophoresis with the band size is as shown in Figure 5.

DISCUSSION
Water pollution happens when particles, chemicals, or bacteria invade a water supply. Some of the major causes of water
contamination are agricultural runoff, industrial contamination, insufficiently treated water, natural catastrophes, and
sewage leaks. Although it is reasonable to assume the presence of certain contaminants in drinking water because pure unpol-
luted water does not occur in nature, some contaminants in drinking water may be dangerous if ingested in certain quantities.
Also, the presence of these contaminants in water may lead to biofilm formation. In this study, THBC and TCBC exceeded the
NSDWQ (2015) and WHO (2017) permissible limit for drinking water standards in the stations of Ede-Erinle and Opa water-
work systems, notably at the distribution water stations. This poses a significant threat to the health of consumers of these
water supplies in the region. Also, a higher population of bacterial species was isolated in the rainy season than in the dry
season in the Ede-Erinle and Opa waterwork systems. This could be attributed to the discharge and washing of organic
matter into the water bodies, which promotes the proliferation of these bacterial species. This was consistent with the findings
of many researchers (Ogbonna 2010; Oluyege et al. 2011; Adesoji & Ogunjobi 2013; Balogun et al. 2013) who hypothesized
that the presence of a greater number of heterotrophic bacterial species in rivers and other sources of drinking water during

Downloaded from http://iwaponline.com/jwh/article-pdf/22/4/673/1406582/jwh0220673.pdf

by guest
 Journal of Water and Health Vol 22 No 4, 683

Figure 3 | Cluster diagram showing the relationship among sampling stations of Opa reservoir based on bacterial population (THB and TCB).

the wet season compared to the dry season could be due to favourable physicochemical conditions, which could be attributed
to the presence of allochthonous materials from the catchment area of the river during the rainy season.
High microbial loads (higher than the WHO permissible limits for heterotrophic and coliform bacteria in any water
meant for drinking) documented at the distribution stations of the two waterwork systems despite treatment may be due
to leakage as observed during the collection of samples in the pipelines at some distribution channels. Leakage in pipe
water transmission pipelines might have enabled pollutants to reach the water transmission line. This is analogous to
the observation of Van Zyl (2004) that there is a renewed international concern that water delivery systems are ageing
and decaying worldwide, as the demands on these systems, and thus on our natural water supplies, are growing. In several
towns and cities around the world, non-revenue water in water delivery systems is reaching alarming levels. In their find-
ings, the United Nations (2002) and Hall (2006) stated that about half of the water in the drinking water supply systems in
the developing world is lost due to leakage, illegal hook-ups, and vandalism that could eventually lead to poor microbial
quality water production and eventually to a public health crisis. Another possible explanation for this could be that the
disinfectants used or their dose might be bacteriostatic and not effective enough to completely eliminate the microbes.
This can trigger the static microbes to reactivate a few days after disinfection. Another reason may also be the lack of ade-
quate residual chlorine in some of the treated water being pumped out into the various distribution stations of Ede-Erinle
and Opa waterwork systems.
The presence of P. aeruginosa and other genera of Enterobacteriaceae (coliforms) such as E. coli (faecal coliform),
especially in the Opa waterworks system, is an indication that the water sources are of poor microbiological quality. The pres-
ence of these coliforms and non-coliform pathogenic bacteria in the Ede-Erinle and Opa waterwork systems over the two
seasons considered in the course of this study could have consequential health effects on the final consumer of the water
sources. P. aeruginosa and other genera of Enterobacteriaceae are associated with gastroenteritis (Adeniyi & Olabanji
2005). A few strains of E. coli have been implicated to cause diarrhoea and kidney failure (Karch et al. 2005). K. pneumoniae

Downloaded from http://iwaponline.com/jwh/article-pdf/22/4/673/1406582/jwh0220673.pdf

by guest
 Table 5 | Biochemical characteristics of bacterial isolates obtained from Ede-Erinle and Opa reservoir water sampling stations

Sulfur;
Triple Indole;
Sugar Iron Motility Methyl Voges
Isolate Cell Gram’s (TSI) (SIM) Red Proskauer O- Nitrate
code shape stain Catalase Oxidase reaction I-M-H2S Citrate (MR) (VP) Glucose Maltose Mannitol Sucrose Lactose F reduction Possible organism

COP1b SR  þ  YGY þ þ þ þ þ  YG YG YG YG YG F þ Citrobacter

freundii
EED5d LR  þ þ YNcNc þ   þ  Y Y Nc Nc Nc F þ Chromobacterium
violaceum
DED1a SR  þ þ NcNcNc — þ   Nc Nc Nc Nc Nc F þ Chromobacterium
sp.
DED4b LR þ þ þ NA þ   þ þ Y Y Nc Y Nc F þ Bacillus alvei
EOP1a SR  þ  YGYNc þ þ  þ  YG YG YG YG YG F þ Escherichia coli
a
EED7 SR  þ þ YGYNc þþ  þ þ  YG YG YG YG YG F þ Paenibacillus
lautus
AOP1a MLR  þ  YYNc — þ þ  YG YG YG YG YG F þ Klebsiella
pneumoniae
COP8a LR  þ þ NcNcNc þ     Nc Nc Nc Nc Nc   Alcaligenes
faecalis
DED5b Cocci þ þ   —  þ  Y Y Y Y Y F þ Staphylococcus
aureus
BED7a MLR  þ  YGNc þ þ þ þ þ þ YG Nc Nc YG Nc  þ Proteus mirabilis
b
COP5 LR    YGY þ þþ þ  þ þ YG YG Nc YG Nc   Proteus vulgaris

Journal of Water and Health Vol 22 No 4, 684

CED1c LR  þ þ YNcNc —  þ þ Y Y Nc Nc Y F þ Bacillus
pseudomycoides
BED1c MLR  þ þ YGNcNc þ  þ þ YG YG YG YG YG F þ Pseudomonas
stutzeri
CED4b LR  þ þ YNcNc —  þ  Y Y Y Y Y F þ Pseudomonas
aeruginosa
COP8c LR  þ þ YNcNc —  þ  Y Y Nc Nc Nc F þ Aeromonas
jandaei
EED5b MLR  þ þ YNcNc —  þ  Y Y Nc Nc Y F  Klebsiella
SR: short rod; MLR: medium long rod; LR: long rod; YG: acid and gas production; Y: acid production; Nc: no change; I: indole production; M: motility; H2S: hydrogen sulphide production; F: fermentative; Ox: oxidative; : negative; þ:
positive.

Downloaded from http://iwaponline.com/jwh/article-pdf/22/4/673/1406582/jwh0220673.pdf

 Journal of Water and Health Vol 22 No 4, 685

Table 6 | Molecular identification of selected bacterial isolates obtained from Ede-Erinle and Opa Waterworks system

Isolate code Sequence Accession number Organism identified

c
CED1 GTAAG…TTTCT NR_114422.1 Bacillus pseudomycoides
BED1c CTCGG…GACCC NR_118798.1 Pseudomonas stutzeri
d
CED4 ATCCG…GAGCG NR_115526.1 Bacillus cereus
COP8c CCCGG…TTACT NR_119040.1 Aeromonas jandaei
c
COP5 CCGGG…TTTTT NR_157734.1 Bacillus paramycoides
FOP7c GGTTA…TATCG NR_113580.1 Morganella morganii
EED7a TCCAG…GAACG NR_040882.1 Paenibacillus lautus
AOP1a ATTCG…ATTCA NR_037084.1 Klebsiella pneumoniae
b
CED4 ATCAA…GGGGG NR_114471.1 Pseudomonas aeruginosa
JOP9d CTGAT…AGACG NR_115880.1 Providencia rettgeri
Note: Full sequences available upon request.

Figure 4 | A representative gel picture of amplified 16S rRNA genes of selected bacterial isolates from Ede-Erinle and Opa waterwork sys-
tems. L: 300 bp DNA ladder; 2: Bacillus pseudomycoides; 4: Pseudomonas stutzeri; 11: Bacillus cereus; 13: Aeromonas jandaei; 15: Bacillus
paramycoides; 17: Morganella morganii; 21: Paenibacillus lautus; 23: Klebsiella pneumoniae; 28: Pseudomonas aeruginosa; 45: Providencia
rettgeri.

are important causes of different bacterial infections such as bacteraemia, respiratory and urinary tract infections, neonatal
meningitis, and pneumonia (Vasaikar et al. 2017).
The molecular identification of B. pseudomycoides, a bacterium generally known to be found in the soil worldwide in the
reservoir station of the Ede-Erinle waterworks system, could be a result of erosion or runoff of sub-surface soil into the water
body. The bacterial species may also have found their way into the water body from the bottom sediments of the reservoir.
Similarly, P. stutzeri, a common clinical isolate that was identified in the Ede-Erinle reservoir water station, might be a result
of runoff from hospital wastes or urines from humans and animals into water bodies, which could find their way into the
reservoir. The isolation of A. jandaei from the distribution station in the Fajuyi Hall of Opa waterwork systems was in agree-
ment with the work of Kühn et al. (1997), who reported the presence of A. jandaei from a drinking water distribution system
in Sweden. This bacteria is capable of producing toxins, which could be harmful to the consumers of the distributed water.

Downloaded from http://iwaponline.com/jwh/article-pdf/22/4/673/1406582/jwh0220673.pdf

by guest
 Journal of Water and Health Vol 22 No 4, 686

Table 7 | Phenotypic and molecular detection of biofilm-forming abilities of bacterial species isolated from Ede-Erinle and Opa waterwork
systems

Phenotypic detection

Bacterium 16–18 h 18–24 h 48 h Molecular detection

Paenibacillus lautus  þ þ þ
Bacillus pseudomycoides  þþ þþ þ
Pseudomonas aeruginosa þ þþ þ þþ þ þ
Pseudomonas stutzeri þ þ þ þ
Bacillus cereus  þ þ 
Klebsiella pneumoniae þþ þþ þþ 
Aeromonas jandaei þþ þþ þþ 
Citrobacter freundii þ þþ þþ 
Staphylococcus aureus þ þ þ 
Providencia rettgeri  þ þþ 
: non-biofilm forming; þ: weak biofilm forming; þþ : moderate biofilm forming; þþ þ : strong biofilm forming. Molecular detection, þ: positive; : negative.

Figure 5 | A representative gel picture of biofilm-forming bacterial isolates detected by PCR from Ede-Erinle and Opa waterwork systems.
L: 100 bp DNA ladder; 1: Paenibacillus lautus; 2: Bacillus paramycoides; 3: Pseudomonas aeruginosa; 4: Pseudomonas stutzeri.

The isolation of P. rettgeri and M. morganii from the Staff Club distribution station and Staff Quarters distribution station of
the Opa waterworks system, respectively, could cause a wide variety of human infections in the consumer of water from this
station without prior treatment. This may range from urinary tract infections to gastroenteritis and bacteraemia (O’Hara et al.
2000). P. rettgeri has previously been isolated from poultry, reptile and amphibian faeces, and surface waters. It is only some-
times isolated from human faeces and the urinary tract. The bacterium generates urease, which causes urine alkalinization
and catheter encrustation. Wounds, burns, and blood infection have also been linked to P. rettgeri (Traub et al. 1971;
Kaslow et al. 1976; Müller 1986; Yoh et al. 2005). Bacterial biofilm formation and subsequent resistance to antibiotics
and disinfectants is a slow but substantial hazard to human health. Biofilm production has become a common occurrence
not just in human and animal illnesses but also in non-biological settings. The biofilm-forming bacteria recorded at distri-
bution stations of the Ede-Erinle and Opa waterworks could be attributed to treatment processes or distribution
infrastructure deficiencies, as suggested by Lehtola et al. (2004).

Downloaded from http://iwaponline.com/jwh/article-pdf/22/4/673/1406582/jwh0220673.pdf

by guest
 Journal of Water and Health Vol 22 No 4, 687

Molecular identification of bacteria complements the phenotypic methods, as conventional biochemical identification
methods have been shown to be insufficient in the identification of bacterial isolates to species level; hence, to avoid misiden-
tification of such isolates, molecular identification is more reliable.

CONCLUSION
The study concluded that the identification of coliform bacteria in the treated and distributed water sources of the two water-
work systems, most especially the isolation of E. coli and K. pneumoniae at the Opa distributed water station, is an indication
of faecal pollution. This could pose a high health risk to the consumers of these water sources without further treatment
before use. The presence of biofilm-forming bacteria in the distributed water from these waterwork systems may compromise
the efficacy of water treatment operations. It could also lead to the evolution of antibiotic-resistance genes in aquatic bacteria,
making treatment harder for affected consumers of these water sources.

DATA AVAILABILITY STATEMENT

All relevant data are included in the paper or its Supplementary Information.

CONFLICT OF INTEREST
The authors declare there is no conflict.

REFERENCES

Adeniyi, I. F. & Olabanji, I. O. 2005 The physico-chemical and bacteriological quality of rainwater collected over different roofing materials
in Ile-Ife, southwestern Nigeria. Chemistry and Ecology 21 (3), 149–166.
Adesoji, A. T. & Ogunjobi, A. A. 2013 Occurrence of multidrug-resistant bacteria in selected water distribution systems in Osun State, Nigeria.
Global Veterinaria 11 (2), 214–224.
APHA (American Public Health Association) 1995 Standard Methods for the Examination of Water and Waste Water, 19th edn. American
Public Health Association Inc, New York, pp. 1193.
Balogun, S. A., Ejelonu, B. C., Lasisi, A. A. & Adeogun, A. I. 2013 Microbiological and chemical assessment of spring water from a rural
setting in Ondo State Southwest, Nigeria. African Journal of Environmental Science and Technology 7 (6), 555–559.
Chidavaenzi, M. T., Jere, M., Chanda, C., Chingundury, D. & Bradley, M. 1998 An evaluation of water runs to maintain domestic water
quality. 24th WEDC Conference. In: Sanitation and Water for All, Islamabad, Pakistan, pp. 249–253.
Davey, M. E. & O’toole, G. A. 2000 Microbial biofilms: From ecology to molecular genetics. Microbiology and Molecular Biology Reviews
64 (4), 847–867.
DWAF – Department of Water Affairs and Forestry 1996 South Africa Water Quality Guidelines. Domestic use. The Government Printer,
Pretoria, South Africa, p. 155.
Flemming, H. C., Percival, S. L. & Walker, J. T. 2002 Contamination potential of biofilms in water distribution systems. Water Science and
Technology: Water Supply 2 (1), 271–280.
Gouider, M., Bouzid, J., Sayadi, S. & Montiel, A. 2009 Impact of orthophosphate addition on biofilm development in drinking water
distribution systems. Journal of Hazardous Materials 167 (1–3), 1198–1202.
Grabow, W. O. K. 1996 Waterborne diseases: Update on water quality assessment and control. Water South Africa. 22 (2), 193–202.
Gueimonde, M., Tölkkö, S., Korpimäki, T. & Salminen, S. 2004 New real-time quantitative PCR procedure for quantification of bifidobacteria
in human fecal samples. Applied and Environmental Microbiology 70 (7), 4165–4169.
Hall, D. 2006 Water and Electricity in Nigeria. PSIRU Reports. A Report Commissioned by Public Services International (PSI). Available
from: www.world-psi.org.
Hassan, H. & Abdalhamid, B. 2014 Molecular characterization of extended-spectrum beta-lactamase producing Enterobacteriaceae in a
Saudi Arabian tertiary hospital. The Journal of Infection in Developing Countries 8 (03), 282–288.
Holt, J. G. K., Sneath, N. R., Staley, P. H., Williams, J. T. & Stanley, T. 1994 Bergey’s Manual of Determinative Bacteriology
(No. QR81 S6 1994). Williams and Wilkins, Baltimore, MD.
Horakova, K., Mlejnkova, H. & Mlejnek, P. 2008 Specific detection of Escherichia coli isolated from water samples using polymerase chain
reaction targeting four genes: Cytochrome bd complex, lactose permease, ß-d-glucuronidase, and ß-d-galactosidase. Journal of Applied
Microbiology 105 (4), 970–976.
Kalmbach, S., Manz, W. & Szewzyk, U. 1997 Isolation of new bacterial species from drinking water biofilms and proof of their in situ
dominance with highly specific 16S rRNA probes. Applied and Environmental Microbiology 63 (11), 4164–4170.
Karch, H., Tarr, P. I. & Bielaszewska, M. 2005 Enterohaemorrhagic Escherichia coli in human medicine. International Journal of Medical
Microbiology 295 (6–7), 405–418.

Downloaded from http://iwaponline.com/jwh/article-pdf/22/4/673/1406582/jwh0220673.pdf

by guest
 Journal of Water and Health Vol 22 No 4, 688

Kaslow, R. A., Lindsey, J. O., Bisno, A. L. & Price, A. 1976 Nosocomial infection with highly resistant: Proteus rettgeri. American Journal of
Epidemiology 104 (3), 278–293.
Kühn, I., Allestam, G., Huys, G., Janssen, P., Kersters, K., Krovacek, K. & Stenström, T. A. 1997 Diversity, persistence, and virulence of
Aeromonas strains isolated from drinking water distribution systems in Sweden. Applied and Environmental Microbiology 63 (7),
2708–2715.
Lehtola, M. J., Miettinen, I. T., Keinänen, M. M., Kekki, T. K., Laine, O., Hirvonen, A., Vartiainen, T. & Martikainen, P. J. 2004 Microbiology,
chemistry and biofilm development in a pilot drinking water distribution system with copper and plastic pipes. Water Research 38 (17),
3769–3779.
Ludmány, Z., Borsányi, M., Vargha, M., 2006 Evaluation of biofilms occurring in drinking water distribution systems of Balatonfüred. In:
Chemicals as International and Accidental Global Environmental Threats (Simeonov, L. & Chirila, E. eds.). Lavoisier, Cachan Cedex,
France, pp. 501–507.
Mathur, T., Singhal, S., Khan, S., Upadhyay, D. J., Fatma, T. & Rattan, A. 2006 Detection of biofilm formation among the clinical isolates of
staphylococci: An evaluation of three different screening methods. Indian Journal of Medical Microbiology 24 (1), 25–29.
Momba, M. N., Cloete, T. E., Venter, S. N. & Kfir, R. 1999 Examination of the behaviour of Escherichia coli in biofilms established in
laboratory-scale units receiving chlorinated and chloraminated water. Water Research 33 (13), 2937–2940.
Moyo, S., Wright, J., Ndamba, J. & Gundry, S. 2004 Realising the maximum health benefits from water quality improvements in the home:
A case from Zaka district, Zimbabwe. Physics and Chemistry of the Earth. Parts A/B/C 29 (15–18), 1295–1299.
Müller, H. E. 1986 Occurrence and pathogenic role of Morganella-Proteus-Providencia group bacteria in human feces. Journal of Clinical
Microbiology 23 (2), 404–405.
Naas, T., Oxacelay, C. & Nordmann, P. 2007 Identification of CTX-M-type extended-spectrum-β-lactamase genes using real-time PCR and
pyrosequencing. Antimicrobial Agents and Chemotherapy 51 (1), 223–230.
NSDWQ 2015 Nigerian standard for drinking water quality. Standards Organisation of Nigeria. http//www.unicef.org/Nigeria/ng
publications Nigerian standard for Drinking water Quality.pdf. Accessed on 25/08/2019.
Ogbonna, D. N. 2010 Seasonal dynamics of microbial population and physicochemical characteristics of a water body receiving industrial
pollutants in Port Harcourt, Nigeria. Agriculture and Biology Journal of North America 1 (6), 1333–1339.
O’Hara, C. M., Brenner, F. W. & Miller, J. M. 2000 Classification, identification, and clinical significance of Proteus, Providencia, and
Morganella. Clinical Microbiology Reviews 13 (4), 534–546.
Olowe, O. A., Adefioye, O. J., Ajayeoba, T. A., Schiebel, J., Weinreich, J., Ali, A. & Schierack, P. 2019 Phylogenetic grouping and biofilm
formation of multidrug resistant Escherichia coli isolates from humans. Animals and Food products in South- West Nigeria. Scientific
African 6, e00158.
Oluyege, J. O., Koko, A. E. & Aregbesola, O. A. 2011 Bacteriological and physico-chemical quality assessment of household drinking water in
Ado-Ekiti, Nigeria. Water Science and Technology: Water Supply 11 (1), 79–84.
Paris, T., Skali-Lami, S. & Block, J. C. 2009 Probing young drinking water biofilms with hard and soft particles. Water Research 43 (1),
117–126.
Prescott, L. M., Harley, J. P., Klein, D. A. & Walker, C. G. 1999 Microbiology. McGraw Hill Publishers, New York, pp. 477–487.
Rao, V., Ghei, R. & Chambers, Y. 2005 Biofilms research – implications to biosafety and public health. Applied Biosafety 10 (2), 83–90.
Sobsey, M. D. 2002 Managing water in the home: Accelerated health gains from improved water supply. World Health Organization
Sustainable Development and Healthy Environments. World Health Organization, Geneva. WHO/SDE/WSH/02.07. Society for
Experimental Biology and Medicine 90, 210–213
Traub, W. H., Craddock, M. E., Raymond, E. A., Fox, M. & McCall, C. E. 1971 Characterization of an unusual strain of Proteus rettgeri
associated with an outbreak of nosocomial urinary-tract infection. Applied Microbiology 22 (3), 278–283.
United Nations 2002 Facts about Water. Fact Sheet, Johannesburg Summit 2002. Johannesburg, South Africa.
Van Zyl, J. E. 2004 The effect of pressure on leaks in water distribution systems. In: Proceedings of the 2004 Water Institute of Southern Africa
(WISA) Biennial Conference. WISA, Cape Town, pp. 1104–1109. ISBN: 1-92001728-3.
Vasaikar, S., Obi, L., Morobe, I. & Bisi-Johnson, M. 2017 Molecular characteristics and antibiotic resistance profiles of Klebsiella isolates in
Mthatha, Eastern Cape province, South Africa. International Journal of Microbiology 14, 23–27.
Wagner, M., Amann, R., Lemmer, H. & Schleifer, K. H. 1993 Probing activated sludge with oligonucleotides specific for proteobacteria:
Inadequacy of culture-dependent methods for describing microbial community structure. Applied and Environmental Microbiology
59 (5), 1520–1525.
WHO 2000 Global Water Supply and Sanitation Assessment Report. World Health Organization, Geneva. ISBN 92-4156202-I.
World Health Organization and UNICEF 2017 Progress on Drinking Water, Sanitation and Hygiene: 2017 Update and SDG Baselines.
Available from: www.un.org/jsummit/html/media_info/.
Yoh, M., Matsuyama, J., Ohnishi, M., Takagi, K., Miyagi, H., Mori, K. & Honda, T. 2005 Importance of Providencia species as a major cause
of travellers’ diarrhoea. Journal of Medical Microbiology 54 (11), 1077–1082.

First received 25 September 2023; accepted in revised form 22 February 2024. Available online 6 March 2024

Downloaded from http://iwaponline.com/jwh/article-pdf/22/4/673/1406582/jwh0220673.pdf

by guest