QIAexpressionist-A Handbook For High-Level Expression and Purification of 6xhis Tagged Proteins (QIAGEN)
QIAexpressionist-A Handbook For High-Level Expression and Purification of 6xhis Tagged Proteins (QIAGEN)
The QIAexpressionist ™
A handbook for
high-level expression and purification
of 6xHis-tagged proteins
June 2003
© 2001–2003 QIAGEN, all rights reserved.
QIAGEN Worldwide
QIAGEN Companies
Australia QIAGEN Pty Ltd PO Box 25 • Clifton Hill • Victoria 3068
ABN 75 072 382 944 Orders 03-9489-3666 • Fax 03-9489-3888 • Technical 1-800-243-066
Canada QIAGEN Inc. 2800 Argentia Road • Unit 7 • Mississauga • Ontario • L5N 8L2
Orders 800-572-9613 • Fax 800-713-5951 • Technical 800-DNA-PREP (800-362-7737)
Japan QIAGEN K.K. Forefront Tower II • 13-1, Kachidoki 3 Chome • Chuo-ku, Tokyo 104-0054
www.qiagen.co.jp Telephone 03-5547-0811 • Fax 03-5547-0818 • Technical 03-5547-0811
UK and Ireland QIAGEN Ltd. Boundary Court • Gatwick Road • Crawley • West Sussex, RH10 9AX
Orders 01293-422-911 • Fax 01293-422-922 • Technical 01293-422-999
www.qiagen.com
QIAGEN Distributors
Please see the last page for contact information for your local QIAGEN distributor.
Contents
Kit Contents 7
Storage Conditions 8
Technical Assistance 9
Safety Information 10
Cloning 21
Choosing a QIAexpress construct 21
Intended use of recombinant proteins and pQE vector choice 22
Protein size 22
Codon usage 23
Internal start sites 23
Inefficient translation 23
Secretion 23
Cloning procedures and vector maps 24
Procedure for direct cloning of PCR fragments using pQE-30 UA 24
Troubleshooting: UA cloning 28
Cloning procedures with pQE vectors using restriction enzymes 29
Preparation of pQE expression constructs 29
Propagation of pQE plasmids and constructs 35
Ligation, transformation, and screening 36
Expression in E. coli 48
Basic principles 49
Culture media 49
Maintenance of the expression plasmid 50
Small-scale expression cultures 50
Time-course analysis of protein expression 50
Specific considerations 51
Low expression levels 51
Toxic gene products 51
Hydrophobic regions 52
Unstable proteins 52
High expression levels, insoluble proteins, and inclusion bodies 53
Appendix 108
Ni-NTA Matrices 108
Specifications 108
Handling 109
Reuse of Ni-NTA Matrices 109
Preparation of guanidine-containing samples for SDS-PAGE 110
Media, solutions, and reagents 111
Bacterial media and solutions 111
Buffers for preparing competent E. coli 111
SDS-PAGE sample buffers 111
Solutions for colony-blot procedure 111
Alkaline phosphatase (AP) staining solutions 112
Horseradish peroxidase staining solutions 112
Buffers for purification under denaturing conditions 113
Buffers for purification under native conditions 114
Buffers for purification from mammalian cells using
Ni-NTA Magnetic Agarose Beads under native conditions 114
Buffer for Factor Xa Protease digestion and removal of
Factor Xa Protease with Xa Removal Resin 115
QIAexpress pQE vectors: multiple cloning sites 116
Restriction map of pREP4 118
Sequencing primers for pQE vectors 118
References 119
pREP4 1 µg 1 µg
Control expression 1 µg 1 µg
plasmid (pQE-40)
E. coli host strain 1 vial 1 vial
M15[pREP4]
E. coli host strain 1 vial 1 vial
SG13009[pREP4]
Ni-NTA Agarose 10 ml 10 ml
Disposable columns, 5 ml bed-volume 5 5
Disposable columns, 1 ml bed-volume 5 5
Frits for 5 ml 10 10
disposable columns
Frits for 1 ml 10 10
disposable columns
Sodium phosphate 100 ml 100 ml
stock solution
(0.5 M NaH2PO4,
50 mM Tris)
Imidazole stock 50 ml 50 ml
solution (1 M)
Urea 100 g 100 g
Guanidine 40 g 40 g
hydrochloride
IPTG (for 1 ml 1 M stock solution) 238 mg 238 mg
The QIAexpressionist ™
1 1
pQE vectors pQE-9, -30, -31, pQE-16, -60, pQE-80L, -81L pQE-100
-32, and 40 and 70 and 82L
The QIAexpressionist 1 1 1 1
Storage Conditions
Ni-NTA matrices, E. coli host strains, sodium phosphate stock solution, and imidazole
stock solution should be stored at 2–8°C. The E. coli host strain can be stored under these
conditions for up to 3 months without significant loss of viability – we recommend
establishing cultures and storing your own stabs or glycerol stocks as soon as possible
after receipt of your kit. All other kit components can be stored under these conditions for
up to 1 year without any reduction in performance. Ni-NTA matrices should not be frozen.
QIAexpress pQE vectors are supplied lyophilized with sucrose and bromophenol blue for
visualization, and should be resuspended in a convenient volume of TE (e.g., 10 µl) and
stored at –20°C. Sucrose and bromophenol blue do not interfere with restriction
digestions or bacterial transformation.
Technical Assistance
At QIAGEN we pride ourselves on the quality and availability of our technical support.
Our Technical Service Departments are staffed by experienced scientists with extensive
practical and theoretical expertise in molecular biology and the use of QIAGEN® products.
They are always available to discuss any general or specific questions you may have. If
you have any questions or experience any problems regarding QIAexpress, or QIAGEN
products in general, please do not hesitate to contact us.
QIAGEN customers are also a major source of information regarding advanced or
specialized uses of our products. This information is helpful to other scientists as well as to
the researchers at QIAGEN. We therefore encourage you to contact us if you have any
suggestions about product performance or new applications and techniques.
For technical assistance and more information please call one of the QIAGEN Technical
Service Departments or local distributors (see inside front cover).
Safety Information
When working with chemicals, always wear a suitable lab coat, disposable gloves, and
protective goggles. For more information, please consult the appropriate material safety
data sheets (MSDSs). These are available online in convenient and compact PDF format
at www.qiagen.com/ts/msds.asp where you can find, view, and print the MSDS for each
QIAGEN kit and kit component.
CAUTION: DO NOT add bleach or acidic solutions directly to the sample-preparation waste.
The QIAexpress Type IV and ATG kits contain guanidine hydrochloride, which can form
highly reactive compounds when combined with bleach.
In case liquid containing these buffers is spilt, clean with suitable laboratory detergent and
water. If the spilt liquid contains potentially infectious agents, clean the affected area first
with laboratory detergent and water, and then with 1% (v/v) sodium hypochlorite.
QIAexpress Type IV Kit and Type ATG Kit
5x phosphate buffer stock solution
Contains sodium hydroxide: Irritant. Risk and safety phrases*: R36/38. S13-26-36-46.
Guanidine hydrochloride
Contains guanidine hydrochloride. Harmful, and irritant. Risk and safety phrases*: R22-
36/38. S22-26-36/37/39.
Imidazole solution
Contains imidazole. Irritant. Risk and safety phrases*: R36/37/38. S23-26-36/37/39-45.
Ni-NTA Agarose
Contains nickel-nitrilotriacetic acid. Harmful, sensitizer, and flammable. Risk and safety
phrases:* R10-22-40-42/43. S13-26-36-46.
24-hour emergency information
Emergency medical information in English, French, and German can be obtained 24 hours
a day from: Poison Information Center Mainz, Germany
Tel: +49-6131-19240
* R10: Flammable. R22: Harmful if swallowed. R36/38: Irritating to eyes and skin. R36/37/38: Irritating to
eyes, respiratory system and skin. R40: Possible risks of irreversible effects. R42/43: May cause sensitization by
inhalation and skin contact. S13: Keep away from food, drink and animal feedingstuffs. S22: Do not breathe
dust. S23: Do not breathe spray. S26: In case of contact with eyes, rinse immediately with plenty of water and
seek medical advice. S36: Wear suitable protective clothing. S36/37/39: Wear suitable protective clothing,
gloves and eye/face protection. S45: In case of accident or if you feel unwell, seek medical advice immediately
(show the label where possible). S46: If swallowed, seek medical advice immediately and show the container
or label.
Introduction
expression systems have been developed and are currently used to produce recombinant
proteins, the purification of the proteins obtained can still be problematic. Classical
purification procedures can be employed, but in most cases recombinant DNA techniques
permit the construction of fusion proteins in which specific affinity tags are added to the
protein sequence of interest; the use of these affinity tags simplifies the purification of the
recombinant fusion proteins by employing affinity chromatography methods.
The QIAexpress® System is based on the remarkable selectivity and affinity of QIAGEN’s
exclusive, patented nickel-nitrilotriacetic acid (Ni-NTA) metal-affinity chromatography
matrices for biomolecules which have been tagged with 6 consecutive histidine residues
(6xHis tag, Figure 1). The unique features of the QIAexpress System provide a number of
significant advantages (Table 1) that are not available with other affinity-tag and
chromatography methods.
QIAexpress expression products comprise vectors that can be used for expression of
6xHis-tagged recombinant proteins in bacterial, baculovirus, and mammalian expression
systems.
additional products are available (see ordering information on page 122), and a detailed
handbook describing the use of these products is available. For a free copy, call one of
the QIAGEN Technical Service Departments or local distributors (see inside front cover).
Features Benefits
• The interaction of the 6xHis tag with • One-step purification can be carried
Ni-NTA matrices is conformation independent. out under native or denaturing conditions.
• Mild elution conditions can be used. • Binding, washing, and elution are highly repro-
ducible, and have no effect on protein structure.
• Pure protein products are ready for direct use in
downstream applications.
• The 6xHis tag is much smaller than other • 6xHis tags can be used in any
commonly used tags. expression system.
• Tag does not interfere with the structure and
function of the recombinant protein.
• The 6xHis tag is uncharged at physiological pH. • The 6xHis tag does not interfere with secretion.
• The 6xHis tag is poorly immunogenic. • The recombinant protein can be used without prior
removal of the tag as an antigen to generate
antibodies against the protein of interest.
• Using Factor Xa Protease, 6xHis tag can be • The detagged protein can be used for
easily and efficiently removed crystallographical or NMR studies where removal
of the 6xHis tag may be preferred.
• Some QIAexpress vectors feature a 6xHis- • Small peptides fused to the 6xHis DHFR tag
dihydrofolate reductase tag (6xHis-DHFR tag). are stabilized while being expressed.
• The 6xHis-DHFR tag is not highly immunogenic in
mouse and rat, so that peptides fused to the tag
can be used directly for immunizations or epitope
mapping.
Introduction
to a pure, 6xHis-tagged protein: cloning (page 21), expression (page 48), and
purification (page 63). Preceding these sections and immediately following the
introduction is a chapter detailing the QIAexpress System (page 15).
• If you have not worked with bacterial expression vectors before, you should first review
the introduction, and the cloning section that addresses the cloning steps which include
the design of the construct, preparation of insert and vector DNA, ligation,
transformation, and identification of clones that express the desired protein. Specific
cloning protocols (restriction digestion, ligation etc.) are not presented here, but can
be found in standard laboratory manuals (Ausubel et al. 1995; Sambrook et al.
1989). Once you have a clear understanding of the strategies and the methods
necessary to produce the desired 6xHis-tagged protein, proceed with the expression
(page 48) and purification (page 63) sections.
• If you already have a bacterial clone that expresses a 6xHis-tagged protein, make sure
that you understand the problems that can arise if the clone is not properly maintained,
cultured, and stored. Review the introduction to the QIAexpress System (page 15) and
then proceed to the expression (page 48) and purification (page 63) sections.
• If you are already familiar with expression vectors, but have not worked with 6xHis-
tagged proteins and Ni-NTA resins, you should review the chapters detailing the
QIAexpress System (page 15), protein expression (page 48), and purification of
6xHis-tagged proteins (page 63).
• If you are producing 6xHis-tagged proteins in yeast, baculovirus, or mammalian
expression systems and have not worked with Ni-NTA resins, you need to be aware
of some of the specific circumstances that can affect the success of your purification
procedures when using Ni-NTA matrices. Guidelines and references for the purification
of 6xHis-tagged proteins produced in yeast are included in the section “Yeast”, page 57.
For the purification of 6xHis-tagged proteins produced in baculovirus and mammalian
expression systems specific protocols are included in this handbook (see pages 88
and 86 respectively). Be sure to review the purification section (page 63) and
specifically ”Purification of 6xHis-tagged proteins produced in other expression systems”
(page 76).
• The intracellular solubility of the 6xHis-tagged protein expressed by your clone determines
the choice of lysis and purification protocols that work under native conditions (for
soluble proteins) or denaturing conditions (for insoluble proteins). The choice of these
protocols is also influenced by the scale, i.e. the amount of the recombinant protein
that is to be purified.
Figure 2. Strategy for the expression and purification of 6xHis-tagged proteins using the QIAexpress System.
Cloning
Prepare vector–insert construct
(see page 24 and 29)
Expression
(see page 39)
Purification
Small amounts Large amounts Small amounts Large amounts
(<1 mg) (>1 mg) (<1 mg) (>1 mg)
Protein minipreps Batch purification FPLC purification Protein minipreps Batch purification FPLC purification
under native under native under native under denaturing under denaturing under denaturing
conditions conditions conditions conditions conditions conditions
(Protocol 14) (Protocol 12) (Protocol 13) (Protocol 19) (Protocol 17) (Protocol 18)
The QIAexpress System
The QIAexpress System provides materials for expression, purification, detection, and
assay of 6xHis-tagged proteins. The QIAexpressionist covers expression and purification
products (pQE vectors, host strains, and Ni-NTA chromatographic matrices) which allow the
fast and efficient production and purification of heterologously expressed 6xHis-tagged proteins.
Xho I (0/3416)
promoter/operator
bla Eco RI
RBS II
Bgl I (2544) pQE (121)
polylinker/
6xHis tag
t0
T1
ori Xba I (1118) Figure 3. pQE vectors.
advantage of the 6xHis tag is that it allows the immobilization of the protein on metal-
chelating surfaces such as Ni-NTA HisSorb™ Strips or Plates and therefore simplifies many
types of protein interaction studies. In addition, Anti·His Antibodies can be used for detection.
Ni-NTA technology
Immobilized-metal affinity chromatography (IMAC) was first used to purify proteins in
1975 (Porath et al. 1975) using the chelating ligand iminodiacetic acid (IDA, Figure 4).
IDA was charged with metal ions such as Zn2+, Cu2+, or Ni2+, and then used to purify a
variety of different proteins and peptides (Sulkowski 1985). IDA has only 3 metal-chelating
sites and cannot tightly bind metal ions. Weak binding leads to ion leaching upon loading
with strongly chelating proteins and peptides or during wash steps. This results in low
yields, impure products, and metal-ion contamination of isolated proteins.
CO
CH
O
CH2
CO
O
O N
Ni2+ CH2
H 2O CO
O
H 2O
Ni-NTA
H 2O
CH2
CO
O N
Ni2+ CH2
H 2O CO
O
H 2O
Ni-IDA
Figure 4. Comparison of the interactions of different metal chelate matrices with nickel ions.
NH
C O O
N C CH2
CH CH2 O
OH
N N
NH CH2 CH2
2+ NH CH
Ni CH2 CH CH2 CH2 CH2 CH2 O
O C
N O
C C
CH CH2 O O
N O
NH
Figure 5. Interaction between neighboring residues in the 6xHis tag and Ni-NTA matrix.
Ni-NTA Agarose
Ni-NTA Agarose is composed of Ni-NTA coupled to Sepharose® CL-6B and offers high
binding capacity and minimal nonspecific binding. This material has excellent handling
properties for batch, column, and low-pressure FPLC®. The high surface concentration of
the NTA ligand is sufficient for the binding of approximately 5–10 mg of 6xHis-tagged
protein per milliliter of resin. Ni-NTA Agarose is very stable and easy to handle.
6xHis-protein protein-6xHis
Cloning
pQE-30, -31, -32,
pQE-80L, -81L, -82L
6xHis-Factor Xa
Protease recognition
sequence-protein protein-8xHis
Xa
6xHis Met 8xHis
pQE-30 Xa pQE-TriSystem
6xHis-protein Peptide-DHFR-6xHis
DoubleTag™ construct
Polypeptides (e.g., epitopes)
6xHis-DHFR-peptide 6xHis-protein-Tag·100
q
Figure 6. QIAexpress constructs. The pQE-30 and pQE-80L vector series differ only by the lacI gene in the
pQE-80L vectors. For vector maps, see pages 32–35. Xa: Factor Xa Protease recognition sequence. i: Factor Xa
Protease cleavage site.
pQE expression vectors enables the expression of proteins in N-terminal tag constructs
2–4 times more efficiently than proteins with a C-terminal affinity tag.
For many applications, the number of amino acids added to the protein along with the
6xHis tag should be kept to a minimum. This can be achieved with pQE-60 or pQE-70,
or by cloning the insert at the 5' end of the pQE-30, pQE-31, pQE-32, pQE-80L, pQE-81L,
or pQE-82L multiple cloning site (MCS). If the number of additional amino acids is not
important, the most convenient restriction sites in the MCS may be used, but many of the
advantages conferred by the small size of the 6xHis tag will be lost. If it is desirable to
detect the protein or peptide being expressed by using the RGS·His™ Antibody (QIAexpress
Detection System), the RGS·His epitope (RGSHHHH) must be present. Vectors that encode
the RGS·His epitope include pQE-9, pQE-30–32, pQE-80–82L, and pQE-40. Penta·His™
and Tetra·His™ Antibodies can detect any 6xHis-tagged protein expressed with all
pQE vectors. For proteins intended for use in assay systems, we recommend using the
pQE-100 DoubleTag Vector which places a 6xHis tag at the N-terminus and a Tag·100
epitope at the C-terminus of the protein — see page 35 for more details.
Protein size
Very small proteins and peptides are sometimes difficult to express stably in E. coli because
they cannot fold correctly and are often subject to proteolytic degradation. These proteins
can be stabilized by expressing them fused to a large protein such as the mouse DHFR
protein encoded in a pQE-16 or pQE-40 construct. The DHFR protein is poorly immuno-
genic in mice and rats and protects the attached peptides from proteolysis after immu-
nization. DHFR enhances the general antigenicity of the peptides to which it is attached
by allowing them to fold properly.
Very long recombinant proteins may be subject to premature termination (see below).
Placing the 6xHis tag at the C-terminus will select for full-length proteins during purification.
Cloning
by deleting any Shine-Dalgarno sequence in the coding region.
Inefficient translation
Some DNA sequences contain regions which interfere with the interaction between the
E. coli ribosomes and the ribosome binding site provided by the expression vector. This
may be the result of stable stem-loop structures formed in the presence of inverted repeats.
In most cases this interference can be minimized by modifying the 5' end of the insert by
increasing the A–T content, or by constructing a fusion protein in which the sequence is
inserted at the 3' end of a fusion partner such as the DHFR protein (pQE-16 or pQE-40
construct). Placing the 6xHis-tag sequence at the 5' end of the gene often increases
expression levels.
Secretion
Secretion of proteins in E. coli is mediated by an N-terminal signal sequence that is cleaved
after protein translocation. Expression of certain gene products as secreted proteins may
in some cases be necessary to promote proper folding and disulfide bond formation or to
direct toxic proteins out of the cell. The 6xHis tag must be placed at the C-terminus to prevent
it from interfering with the signal sequence and to prevent its loss during N-terminal
processing. The location of the 6xHis tag at the C-terminus has no effect on secretion. One
major drawback of secretion into the periplasm is the lower yield that is generally obtained
due to the hydrophobic nature of the signal peptide. Expression may also be complicated
by the formation of inclusion bodies in the periplasmic space (Bowden and Georgiou 1990).
expressed from the insert. The MCS sequence of pQE-30 UA can be found on page 117
and online at www.qiagen.com/literature/vectors.asp.
PCR products generated using proofreading DNA polymerases can be used in UA cloning
procedures after the addition of a 3'-end A overhang. The QIAGEN A-Addition Kit
(cat. no. 231994) provides an easy and efficient method to modify blunt-ended PCR
products. Optimized QIAGEN A-Addition Master Mix allows fast and efficient addition
of A residues to blunt-ended PCR products in a convenient pre-mixed format.
Stop Codon
BamHI
HindIII
EcoRV
XmaI
SmaI
KpnI
BglII
SacI
PmlI
SalI
StuI
PstI
U
PT5 lac O lac O RBS ATG 6xHis MCS I U MCS II Stop Codons
li n
A m p i c il
pQE-30 UA
3.5 kb
Col E1
Figure 7. pQE-30 UA vector for direct cloning of PCR products into an expression vector. PT5: T5 promoter,
lac O: lac operator, RBS: ribosome binding site, ATG: start codon, 6xHis: His tag sequence, MCSI/MCSII: multiple
cloning sites, Stop Codons: stop codons in all three reading frames, Col E1: Col E1 origin of replication,
Ampicillin: ampicillin resistance gene.
PCR template
Prelinearized
Taq DNA polymerase
pQE-30 UA vector
U PCR product PCR product
U
A
A
QIAGEN
A-Addition Kit
Cloning
Ligation using
2x Ligation Master Mix
Figure 8. Construction of QIAexpress Expression vectors using vector pQE-30 UA and PCR products.
Table 2. Guide for the amount of PCR product to use in the ligation reaction
100 bp 7 ng 14 ng
200 bp 14 ng 28 ng
500 bp 35 ng 70 ng
1000 bp 70 ng 140 ng
1500 bp 105 ng 210 ng
2000 bp 140 ng 280 ng
3000 bp 210 ng 420 ng
Cloning
Total volume 10 µl –
* Purified PCR product. If using non-purified PCR product, do not add more than 2 µl PCR product.
†
We recommend adding the Ligation Master Mix last.
3. Briefly mix the ligation-reaction mixture and incubate the tube at 16°C, (e.g., in a
water bath or thermal cycling block), for 2 hours.
Mix gently, e.g., by pipetting the ligation-reaction mixture up and down a few times.
4. Proceed with the Transformation Protocol or store ligation-reaction mixture at –20°C
until use.
Note: If transforming cells by electroporation we recommend incubation of the ligation
reaction for 10 min at 72°C. Before electroporation the ligation reaction should be
briefly centrifuged. Heat treatment increases transformation efficiency. Heat treatment
is not necessary if transformation is carried out using other methods.
Cloning
strain is not necessary.
Vector preparation
The vector from the QIAexpress Kit is prepared by first dissolving it in TE buffer. The addition
of 10 µl TE to 5 µg of plasmid DNA is generally convenient. A 2 µl aliquot (i.e. 1 µg) can
then be linearized using the appropriate restriction enzyme according to the enzyme
manufacturer’s recommended buffer and incubation conditions. Many combinations of
enzymes are compatible when used together in the same buffer, but different enzymes cut
with different efficiencies, especially when the two sites are close together. If restriction
enzymes are sufficiently active in a given buffer and their sites are more than 10 bp apart,
they can be used in the same reaction. If this is not the case, the digestion should be carried
out separately with a clean-up step in between. QIAquick® Kits provide a very fast and efficient
method to purify DNA.
Expression vectors such as the pQE plasmids do not allow color selection of clones that
contain plasmids with inserts. Care should therefore be taken to ensure that vectors are
digested to completion before subcloning. If the insert is to be cloned into a single restriction
site, it is especially important to dephosphorylate the vector ends after digestion. In vectors
cut with two enzymes, when the sites are close together or if one of the enzymes cuts
inefficiently, dephosphorylation decreases the nonrecombinant background caused by
incomplete digestion with one of the enzymes. Following digestion it is usually worthwhile
to gel-purify the vector prior to insert ligation in order to remove residual nicked and
supercoiled plasmid. The latter will transform E. coli much more efficiently than ligated plasmids.
Positive expression clones can be detected directly on colony blots using one of the
Anti·His Antibodies or Ni-NTA Conjugates (see Protocol 4 on page 41).
R1
R1 R2
Restriction
digestion
R2
R1
Cloning
Gel purification
R2
Ligation
R1
R2
Cloning
used, we recommend that the ends of the vector be dephosphorylated to prevent religation.
The ribosome binding site (Shine-Dalgarno sequence) and the ATG initiation codon should
be removed from the fragment that is to be inserted into these vectors. Internal starts from
control sequences provided by the inserted fragment itself will result in the expression of
proteins that lack the 6xHis tag and thus cannot be purified. The endogenous stop codons
can be retained in the inserted fragment, but are not required since pQE vectors provide
translational stop codons in all three reading frames. The pQE-80L series of vectors is similar
q
to the pQE-30 series, but also encodes a cis-lacI gene — this eliminates the need to use
pREP4 for repression in trans.
pQE-30 Xa
The pQE-30 Xa vector is similar to pQE-30, but also encodes a Factor Xa Protease recog-
nition site which is bracketed by the 6xHis-tag coding region on the 5' side and the multiple
cloning site on the 3' side (Figure 10, page 32). 5'-end cloning using the blunt-end StuI
restriction site allows insertion of the gene of interest directly behind the Factor Xa Protease
recognition site, without any intervening amino acid codons. Factor Xa Protease cleaves
off the 6xHis-tag peptide behind the arginine residue of the protease recognition
site (IEGR↓). Factor Xa Protease treatment results in a recombinant protein free of any
vector-derived amino acids at the N-terminus.
HindIII
XmaI
SmaI
KpnI
SphI
SacI
SalI
StuI
PstI
PT5 lac O lac O RBS ATG 6xHis FXa recognition site MCS Stop Codons
li n
A m p i c il
pQE-30 Xa
3.5 kb
Col E1
Figure 10. pQE-30 Xa vector for the insertion of a Factor Xa Protease recognition site C-terminal of the 6xHis tag.
FXa recognition site: Factor Xa Protease recognition site.
Cloning
HindII
Sal I
Pst I
pQE-9
3.4 kb
Col E1
HindIII
XmaI
SmaI
KpnI
SphI
SacI
SalI
PstI
*
PT5 lac O lac O RBS ATG 6xHis MCS Stop Codons
* pQE-30 ––
pQE-31 AC
pQE-32 –G
li n
A m p i c il
pQE- 30, pQE- 31,
pQE-32
3.4 kb
Col E1
HindIII
XmaI
SmaI
KpnI
SphI
BglII
SalI
PstI
Cloning
PT5 lac O lac O RBS ATG 6xHis DHFR MCS Stop Codons
li n
A m p i c il
pQE-40
4.0 kb
Col E1
BamHI
HindIII
XmaI
SmaI
KpnI
SphI
SacI
SalI
PstI
*
PT5 lac O lac O RBS ATG 6xHis MCS Stop Codons
* pQE-80L – –
pQE-81L AC
pQE-82L – G
li n
A m p i c il
4.7 kb
Col E1
Figure 11. pQE vectors for N-terminal 6xHis tag constructs (see also opposite page). PT5: T5 promoter,
lac O: lac operator, RBS: ribosome-binding site, ATG: start codon, 6xHis: 6xHis tag sequence, MCS: multiple
cloning site with restriction sites indicated, Stop Codons: stop codons in all three reading frames, Col E1: Col E1
origin of replication, Ampicillin: ampicillin resistance gene, lacIq, lacIq repressor gene.
BglII
PT5 lac O lac O RBS MCS 6xHis Stop Codons
n i
cnill
ciplli
pim
AmA
pQE-60
3.4 kb
Col E1
BamHI
SphI
BglII
Cloning
pQE-70
3.4 kb
Col E1
BamHI
HindIII
BglII
pQE-16
4.0 kb
Col E1
Figure 12. pQE vectors for C-terminal 6xHis tag constructs. PT5: T5 promoter, lac O: lac operator, RBS: ribosome-
binding site, ATG: start codon, 6xHis: 6xHis tag sequence, MCS: multiple cloning site with restriction sites indicated,
Stop Codons: stop codons in all three reading frames, Col E1: Col E1 origin of replication, Ampicillin: ampicillin
resistance gene.
BamHI
Xma I
Sma I
Kpn I
Sph I
Bgl II
Sac I
Sal I
Pst I
PT5 lac O lac O RBS ATG 6xHis MCS Tag·100 Stop Codons
n i
cnill
ciplli
pim
Cloning
AmA
pQE-100
DoubleTag
3.5 kb
Col E1
Figure 13. pQE-100 DoubleTag Vector for double-tagged constructs. PT5: T5 promoter, lac O: lac operator,
RBS: ribosome-binding site, ATG: start codon, 6xHis: 6xHis tag sequence, MCS: multiple cloning site with restriction
sites indicated, Tag·100: Tag·100 epitope, Stop Codons: stop codons in all three reading frames, Col E1: Col E1
origin of replication, Ampicillin: ampicillin resistance gene.
directly for expression using the colony-blotting procedure because it allows simultaneous
screening of transformants with the correct coding fragment, expression levels, and in-frame
translation of the 6xHis tag. Clones with religated vectors that do not express a fusion protein
will not generate a false positive signal. The colony-blot protocol for detecting expressed
proteins is described on page 41. A protocol for direct screening of mini expression cultures
is presented on page 45. Information about the priming sites of appropriate sequencing primers
for the cloning region of pQE vectors can be found in the appendix on page 118.
5'-Oligo 5'- XXXXX CAT CAC CAT CAC CAT CAC X -3'
3'-Oligo 3'- X GTA GTG GTA GTG GTA GTG XXXXX -5'
His His His His His His
It should be noted that by using a modified form of these oligonucleotides (shown below),
the epitope RGS(His)4 can be incorporated with the 6xHis tag to enable detection of the
recombinant protein using the RGS·His antibody on colony, dot, or western blots and in
complex applications such as immunocytochemistry, which requires high antibody specificity.
Cloning
5'-Oligo 5'- XXXXX AGA GGA TCG CAT CAC CAT CAC CAT CAC X -3'
3'-Oligo 3'- X TCT CCT AGC GTA GTG GTA GTG GTA GTG XXXXX -5'
Arg Gly Ser His His His His His His
R1 R2
Specific sequence
R1 CATCACCATCACCATCAC R2
R1 R2
Cloning
1. Remove a trace of M15[pREP4] cells from the vial with a sterile toothpick or inoculating
loop, and streak it out on LB agar containing 25 µg/ml kanamycin.
If the host strain has already been cultured and stored as recommended on page 8,
streak out bacteria from those stocks.
2. Incubate at 37°C overnight.
3. Pick a single colony and inoculate 10 ml of LB-kanamycin (25 µg/ml). Grow
overnight at 37°C.
4. Add 1 ml overnight culture to 100 ml prewarmed LB medium containing 25 µg/ml
kanamycin in a 250 ml flask, and shake at 37°C until an OD600 of 0.5 is reached
(approximately 90–120 min).
5. Cool the culture on ice for 5 min, and transfer the culture to a sterile, round-bottom
centrifuge tube.
6. Collect the cells by centrifugation at low speed (5 min, 4000 x g, 4°C).
7. Discard the supernatant carefully. Always keep the cells on ice.
8. Resuspend the cells gently in cold (4°C) TFB1 buffer (30 ml for a 100 ml culture) and
keep the suspension on ice for an additional 90 min.
9. Collect the cells by centrifugation (5 min, 4000 x g, 4°C).
10. Discard the supernatant carefully. Always keep the cells on ice.
11. Resuspend the cells carefully in 4 ml ice-cold TFB2 buffer.
12. Prepare aliquots of 100–200 µl in sterile microcentrifuge tubes and freeze in liquid
nitrogen or a dry-ice–ethanol mix. Store the competent cells at –70°C.
Cloning
The Anti·His Antibodies are very specific and have very high binding constants. Stringent
wash steps will aid in avoiding nonspecific signals. If these persist, it is often a result of
the quality or concentration of the secondary antibody used in conjunction with the
Anti·His Antibody. To differentiate between specific and nonspecific signals, E. coli
harboring the plasmid without the insert should also be plated and treated the same way
as the transformants with inserts.
Master plate
(original transformants)
+ IPTG
– IPTG (4 h)
TBS buffer
TBS-Tween® buffer (for Ni-NTA Conjugates)
TBS-Tween/Triton® buffer (for Anti·His Antibodies or Ni-NTA Conjugates)
Blocking buffer
Alkaline phosphatase or horseradish peroxidase staining solutions
Stock solution of primary antibody (Anti·His Antibody) or Ni-NTA Conjugate
Stock solution of secondary AP- or HRP-conjugated antibody (when RGS·His Antibody is
used).
For buffer and reagent compositions, see appendix, page 111.
1. Plate the transformation mix on LB plates containing the relevant antibiotics and incu-
bate them overnight (16 h) at 30°C until the colonies are about 1–2 mm in diameter.
After spreading the transformation mix, dry the plates inverted with the lids slightly
open until small wrinkles develop on the surface of the agar. To prevent streaking,
incubation should not be started until all of the liquid has been absorbed into the agar.
To reduce expression of toxic proteins in the absence of IPTG induction (due to
“leaky” promoters) and to maintain plasmid stability, incubation should be carried
out at 30°C. If the expressed protein is not toxic and the plasmids are stable,
incubation can be carried out at 37°C, but care should be taken that the colonies do
not become too large.
2. Remove plates from the incubator, open lids slightly, and allow any condensation to
dry for 15–30 min.
Cloning
Each dish should contain a sheet of 3MM paper soaked with one of the following solutions:
SDS Solution
Denaturing solution
Neutralization solution
Neutralization solution
2x SSC
Note: discard excess fluid so that the paper is moist but not wet. Excess liquid
promotes colony swelling and diffusion which will result in blurred signals.
8. Place the nitrocellulose filters (colony side up!) on top of the paper in each of these
dishes, taking care to exclude air bubbles (colonies above air bubbles will not lyse
properly and will generate a higher level of background in the final staining step).
9. Incubate the filters at room temperature as follows:
SDS solution 10 min
Denaturing solution 5 min
Neutralization solution 5 min
Neutralization solution 5 min
2x SSC 15 min
10. Wash filters twice for 10 min with TBS buffer.
11. Incubate for 1 h in blocking buffer at room temperature.
12. Wash twice for 10 min in TBS-Tween/Triton buffer.
13. Wash for 10 min in TBS buffer.
Note: There is often only a slight difference between colonies showing a positive
signal and background signals. Staining times may differ with this procedure. 2–3 min
is usually sufficient, but it is very important to monitor color development.
20. Stop the reaction by rinsing the membrane twice with water.
If it is extremely difficult to differentiate between positive clones and background, the cause
of the high background should be determined. The following controls should be included:
Cloning
expressed with the 6xHis tag and will reflect the level of expression. The procedure is
performed under denaturing conditions, which will lead to the isolation of any tagged
protein, independent of its location within the cell.
This procedure may also be used to perform a time course. When analyzing the time
course of expression, it is best to begin with a 100 ml culture in a flask, and to take 10 ml
samples at 0, 1, 2, 3, and 4 h after induction.
Culture media should contain ampicillin at 100 µg/ml and kanamycin at 25 µg/ml.
Materials
Ni-NTA Spin Columns
LB medium
Kanamycin stock solution
Ampicillin stock solution
IPTG stock solution
Buffers A–D
5x SDS-PAGE sample buffer
For composition of buffers and solutions, see appendix, page 111.
course of expression is being taken, the t=0 sample serves as the noninduced control.
4. Grow the cultures for an additional 4–5 h, and transfer to microcentrifuge tubes.
Harvest the cells by centrifugation for 1 min at 15,000 x g, and discard supernatants.
If a time course of expression is being performed, take 2 ml samples at hourly intervals,
collect the cell pellets, and store at –20°C until all the samples are ready for processing.
5. Resuspend cells in 400 µl buffer B. Lyse cells by gently vortexing, taking care to avoid
frothing.
The solution should become translucent when lysis is complete.
The culture volume used depends on the expected expression level. When the protein
is expressed at very high levels, (50–100 mg/liter) a 5x-concentrated cell lysate
(resuspend the pellet from a 2 ml culture in 400 µl buffer B) can be used. 400 µl of
a 5x-concentrated cell lysate in buffer B will contain approximately 100–200 µg of
6xHis-tagged protein. For lower expression levels (1–5 mg/liter), 10 ml of cell culture
should be used for a 25x-concentrated cell lysate. Resuspend the pellet from a 10 ml
culture in 0.4 ml buffer B (0.4 ml cell lysate = 10–50 µg) of 6xHis-tagged protein.
6. Centrifuge the lysate for 20–30 min at 15,000 x g to remove cellular debris, and
transfer the supernatant to a fresh tube.
7. Equilibrate a Ni-NTA spin column with 600 µl buffer B. Centrifuge for 2 min at 2000 rpm
(approximately 700 x g).
8. Load the cleared lysate supernatant containing the 6xHis-tagged protein onto an
equilibrated Ni-NTA spin column.
Cloning
achieve high purity.
11. Elute the protein with 2 x 200 µl buffer E. Centrifuge for 2 min at 2000 rpm (approx-
imately 700 x g), and collect the eluates.
Most of the 6xHis-tagged protein (>80%) should elute in the first 200 µl eluate,
especially when proteins smaller than 30 kDa are purified. The remainder will elute
in the second 200 µl. If the protein should be more concentrated or if the expected
expression level is low, elute in 100–150 µl aliquots and/or do not combine eluates.
12. Add 2.5 µl of 5x SDS-PAGE sample buffer to 10 µl aliquots of all samples, including
the unbound fractions, and boil for 5 min at 95°C.
13. Analyze the samples by SDS-PAGE.
Troubleshooting: cloning
Problems encountered during the cloning steps should be addressed by consulting cloning
manuals (Ausubel et al. 1995; Sambrook et al. 1989). Check your sequences, and your
ligation and transformation steps, and refer to “Troubleshooting: expression“ on page 62
and “Troubleshooting: purification“ on page 99.
cis-Repression trans-Repression
Any E. coli host strain M15 (pREP4)
neo
25 µg/ml
Kanamycin
lacI
bla bla
q
lacI
Transformation of competent
expression host
OD600
0.6
[Protein]
time
IPTG
Expression
90% in an insoluble form in inclusion bodies, purification under denaturing conditions in
the presence of urea is recommended. However, approximately 10% of the DHFR protein
remains in a soluble form that can be purified under native conditions. The recombinant
DHFR protein migrates at 26 kDa on SDS-PAGE gels.
Many factors may contribute to difficulties encountered when expressing foreign proteins
in E. coli. The following sections address these difficulties in more detail.
Basic principles
Culture media
The media of choice for the growth of M15 cells containing a pQE expression plasmid
and the pREP4 repressor plasmid are LB medium and its modifications, 2x YT, or Super
Broth, each containing 100 µg/ml ampicillin and 25 µg/ml kanamycin. Initially it is advisable
to try expression in all three media in parallel, and to take a time course to monitor growth
and expression after induction. Striking differences between the level of expression in
different media and at different times are often noted. Using the cis-repressed vectors
pQE-80L, pQE-81L, or pQE-82L without pREP4 kanamycin should not be included in the
growth medium.
PAGE. The use of small expression cultures, and the preparation of lysates followed by
purification by Ni-NTA affinity chromatography, provide a rapid way to judge the effects
of varied growth conditions on expression levels and solubility of recombinant proteins.
Expression levels vary between different colonies of freshly transformed cells, and small-
scale preparations permit the selection of clones featuring optimal expression rates
(see Protocol 5, page 45).
0.5 h 1h 2h 3h 4h
M C 0.5 h 1h 2h 3h 4h 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 M
Figure 17. Time course of expression using the QIAexpress System. Expression of 6xHis-tagged DHFR was
induced with 1 mM IPTG. Aliquots were removed at the times indicated and purified on Ni-NTA Agarose under
denaturing conditions. Proteins were visualized by Coomassie staining. Yields per liter culture were 2.8, 5.5,
12.3, 33.8, and 53.9 mg, respectively. ■ A Crude cell lysate; ■
B purification with Ni-NTA. 1: flow-through,
2 & 3: first and second eluates; M: markers; C: noninduced control.
Expression
Specific considerations
Low expression levels
Low-level expression can occur because the protein is toxic or unstable, or because the
expression construct is not maintained in the cells during growth. In some cases, the 5' end
of the inserted DNA sequence may encode elements that interfere with transcription or
translation (e.g., masking of the Shine-Dalgarno sequence by stem-loop structures resulting
from inverted repeats); in these instances the sequence being expressed should be
checked and modified if necessary. Modifications of growth media and different host
strains may also have an effect on expression.
Hydrophobic regions
Recombinant proteins with hydrophobic regions often have a toxic effect on host cells, most
likely due to the association of the protein with or incorporation into vital membrane systems.
Expression
Unstable proteins
Some proteins, particularly those that are smaller than 10 kDa, are not stable in E. coli,
and may be degraded rapidly by proteases. This may be overcome by:
• Reducing the growth temperature to 30°C
• Inducing for a shorter period of time
– –
• Using a host strain deficient in one or more proteases (e.g. OmpT , Lon )
• Expressing short proteins and peptides as a fusion with DHFR (plasmids pQE-16 and
pQE-40)
• Including glycerol in the purification buffers
If the protein is degraded during the purification process, it may be necessary to use one
or more protease inhibitor, such as PMSF, leupeptin, or aprotinin (Wingfield 1995a) and
to work at 4°C all times.
Expression
reduction in growth temperature following induction may be helpful. Growth temperature
often directly affects both expression levels and protein solubility, and lower temperatures
will reduce expression levels leading to a higher amount of soluble protein. Alternatively,
the culture can also be grown to a higher cell density before induction and the expression
period can be kept to a minimum. The IPTG concentration can be reduced from 1 mM to
0.005 mM, which would reduce the expression level by 90–95%. Furthermore, it may be
sufficient to change the host strain used, since certain strains tolerate some proteins better
than others and allow higher levels of expression before forming inclusion bodies. Finally,
many proteins require metal cofactors in order to remain soluble, and the addition of metal
salts to the culture media may be helpful. If the metal requirements of the protein are not
known, a number of different supplements should be tested. Note that some divalent cations
may interfere with protein binding to Ni-NTA.
Bst1107I
Ecl136II
BamHI
HindIII
EcoRV
NspV
EcoRI
SmaI
NcoI
KpnI
PvuII
EagI
XhoI
NotI
BglII
AscI
PmlI
SfbI
PstI
P CAG PT5 lac O P p10 RBS Kozak ATG MCS 8xHis Stop Codons termination region
Expression
03
le f 2 , 6
1629
pQE-TriSystem
5.8 kb
Am
c il
pi
lin
ori
pUC
Figure 18. pQE-TriSystem vector for parallel protein expression using a single construct in E. coli, insect, and
mammlian cells. PT5: T5 promoter, lac O: lac operator, RBS: ribosome binding site, ATG: start codon,
8xHis: His tag sequence, MCS: multiple cloning site, Stop Codons: stop codons in all three reading frames,
Ampicillin: ampicillin resistance gene, P CAG: CMV/actin/globin promoter, P p10: p10 promoter,
Kozak: Kozak consensus sequence, termination region: transcription terminator region,
lef2, 603/1629: flanking baculovirus sequences to permit generation of recombinant baculoviruses,
pUC: pUC origin of replication.
mammalian
56
Figure 19. pQE-TriSystem promoter region overview and sequencing primer annealing positions
GTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTT CTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGTG
Exon 1
Intron
CGCGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGCTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTTC
Exon 1
Intron
GGGCTGTAATTAGCGCTTGGTTTAATGACGGCTTGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTGAGGGGCTCCGGGAGGGCCCTTTGTGCGGGGGGAGCGGCTCGGGGCTGTCC
Intron
GCGGGGGGACGGCTGCCTTCGGGGGGGACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTGTGACCGGCGGCTCTAGAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCT
-35 -10
region lac operator region
Intron pQE-TriSystem forward primer T5 Promoter
ACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCATTTTGGCAAAGAATTGGATCGGACCGGAAATCATAAAAAATTATTTGCTTTGTGAGCGGATAACAATTATAATAGATTCA
+1 (T5P) +1 (p10P)
p10 Promoter
ATTGAGGCCTCGACCACCGGGACCTTTAATTCAACCCAACACAATATATTATAGTTAAATAAGAATTATTATCAAATCATTTGTATATTAATTAAAATACTATACTGTAAATTACATTTTATTTACAATC
Kozak 3-ORF site PstI EagI 3-ORF site
RBS NcoI EcoRV SmaI SacI BamHI EcoRI BglII AscI SfbI KpnI NspV HindIII NotI PvuII Bst 1107 I
AAAGGAGATATACCATGGCGATATCCCGGGAGCTCGTGGATCCGAATTCTCAGATCTCGGCGCGCCTGCAGGTCGACGGTACCGGTTCGAAGCTTGCGGCCGCACAGCTGTATAC
Stop Codons
The QIAexpressionist 06/2003
poly A
pQE-TriSystem reverse primer signal
GTGGCTGGTGTGGCCAATGCCCTGGCTCACAAATACCACTGAGATCGATCTTTTTCCCTCTGCCAAAAATTATGGGGACATCATGAAGCCCCTTGAGCATCTGACTTCTGGCTAATAAA
Exon 2
GGAAATTTATTTTCATTGCAATAGTGTGTTGGAATTTTTTGTGTCTCTCACTCGGAAGGACATATGGGAGGGCAAATCATTTAAAACATCAGAATGAGTTTTTG
Mammalian cells
Even though expression levels are usually low, mammalian cells are often the best host for
the expression of recombinant vertebrate proteins because they produce the same post-
translational modifications and recognize the same signals for synthesis, processing, and
secretion utilized in the organism from which the sequence was originally derived. A wide
variety of mammalian expression vectors are currently in use. In general they contain an
efficient promoter element for high-level transcription initiation, mRNA processing signals
such as mRNA cleavage and polyadenylation sequences, selectable markers to select
mammalian cells that have stably integrated the DNA into their genome, and plasmid
sequences that permit the propagation of the vectors in bacterial hosts.
pQE-TriSystem is a suitable vector for transient recombinant protein expression in mammalian
cells. The combination of the CMV immediate-early enhancer fused to the chicken β-actin
promoter results in a strong promoter for constitutive heterologous gene expression. The
polyadenylation signals of the mRNA transcript are encoded by the downstream
rabbit-globin terminator. The presence of the Kozak consensus sequence including the
ATG start codon facilitates efficient translation initiation. pQE-TriSystem vector can be
introduced into the cell by traditional transfection techniques such as calcium phosphate
or liposome mediated transfection, and electroporation. QIAGEN offers three transfection
reagents based on the latest advances in transfection technology; the non-liposomal–
lipid—based Effectene™ Transfection Reagent, and the proven activated-dendrimer–
Expression
based Superfect® Transfection Reagent and Polyfect® Transfection Reagent. A protocol for
purification of 6xHis tagged proteins from mammalian cells is given on page 86.
Yeast
Expression of recombinant proteins in yeast combines the advantages of providing most
eukaryotic post translational modifications such as phosphorylation, glycosylation, and
targeting, with expression levels ranging up to several milligrams per liter of culture (up to
30% of the expression of total yeast protein). A comprehensive review is provided by
Romanos and coworkers (1992).
The most widely used expression vectors are E. coli/yeast shuttle plasmids (Baldarini and
Cesareni 1985; Clare et al. 1991) that are mitotically stabilized by autonomously repli-
cating sequences (ARS/CEN region, 2µ locus) or by integration into the yeast genome.
The episomal expression constructs are introduced into the cells by transformation into
competent cells (Gietz et al. 1992) or by electroporation. Various strategies can be
employed to induce expression of the recombinant proteins encoded by these constructs,
but the specific method chosen depends on the physiological characteristics of the yeast
strain being used. Commonly used strategies are exemplified by the galactose-inducible
expression systems in Saccharomyces cerevisae and methanol-driven induction in the
methylotropic yeast, Pichia pastoris. Intracellular 6xHis-tagged proteins to be purified must
be released from the cells by disrupting cell walls by enzymatic, chemical, or mechanical
Culture growth
1. Inoculate 10 ml LB medium containing 100 µg/ml ampicillin and 25 µg/ml
kanamycin in a 50 ml flask. Grow the cultures overnight at 37°C with shaking.
Kanamycin should be omitted when using the cis-repressed pQE-80L series of vectors.
2. Inoculate 50 ml of prewarmed media (with antibiotics) with 2.5 ml of the overnight
cultures and grow at 37°C, with vigorous shaking (~300 rpm), until the OD600 is
Expression
0.5–0.7 (approximately 30–60 min).
3. Take a 1 ml sample immediately before induction (noninduced control), pellet cells,
and resuspend in 50 µl 1x SDS-PAGE sample buffer. Freeze the sample at –20°C until
needed for SDS-PAGE.
4. Induce expression by adding IPTG to a final concentration of 1 mM.
5. Grow the cultures for an additional 4–5 hours. Collect a second 1 ml sample (induced
control), pellet cells and resuspend in 100 µl 1x SDS-PAGE sample buffer. Freeze until use.
6. Harvest the cells by centrifugation at 4000 x g for 20 min.
Protein extraction
1. Resuspend cell pellet in 5 ml of lysis buffer for native purification.
2. Freeze sample in dry ice/ethanol, and thaw in cold water.
Alternatively, add lysozyme to 1 mg/ml and incubate on ice for 30 min.
3. Sonicate 6 x 10 s with 10 s pauses at 200–300 W. Keep lysate on ice at all times.
Use a sonicator with a microtip probe.
4. Centrifuge lysate at 10,000 x g at 4°C for 20–30 min. Decant the supernatant (crude
extract A, soluble protein) and save on ice.
5. Resuspend the pellet in 5 ml lysis buffer. This is a suspension of the insoluble matter
(crude extract B, insoluble protein).
Interpretation of results
If the protein of interest is in the insoluble matter (extract B), ensure that the cells are completely
lysed. If the protein is still insoluble, try extracting the pellet with 0.25% Tween 20,
0.1 mM EGTA a few times; often the protein is not truly insoluble but just associated with
the membrane fragments in the cell pellet. If the protein is truly insoluble under these
conditions, purify under denaturing conditions.
Expression
Expression
Protocol 8. E.coli culture growth for preparative purification (1 liter)
1. Inoculate 20 ml of LB broth containing 100 µg/ml ampicillin and 25 µg/ml
kanamycin. Grow at 37°C overnight with vigorous shaking.
Kanamycin should be omitted when using the cis-repressed pQE-80L series of vectors.
2. Inoculate a 1 liter culture (LB, 100 µg/ml ampicillin, 25 µg/ml kanamycin) 1:50 with
the noninduced overnight culture. Grow at 37°C with vigorous shaking until an OD600
of 0.6 is reached.
3. Take a 1 ml sample immediately before induction.
This sample is the noninduced control; pellet cells and resuspend in 50 µl 5x SDS-
PAGE sample buffer. Freeze until use.
4. Induce expression by adding IPTG to a final concentration of 1 mM.
5. Incubate the culture for an additional 4–5 h. Collect a second 1 ml sample.
This is the induced control; pellet cells in a microcentrifuge and resuspend in 100 µl
5x PAGE sample buffer. Freeze until use.
6. Harvest the cells by centrifugation at 4000 x g for 20 min.
7. Freeze the cells in dry ice–ethanol or liquid nitrogen, or store cell pellet overnight
at –20°C.
No or low expression
Protein is poorly expressed. Check that the protein is not found in the insoluble fraction.
Review “Specific considerations” beginning on page 51.
Culture conditions for Use the same culture conditions and host cells to check
expression are incorrect. the expression of DHFR encoded by a control plasmid
(pQE-40).
Coding sequence is ligated Sequence the ligated junctions.
into the incorrect reading
frame.
Protein is secreted. Remove all signal sequences from the coding region.
Protein is rapidly degraded. Perform a time course to check the kinetics of growth and
induction. If the protein is small (<10 kDa), consider
adding an N-terminal carrier protein such as DHFR.
If degradation occurs after cell lysis, consider adding
protease inhibitors.
Expression
Protein is highly toxic. Use E. coli M15 [pREP4] in combination with one of the
pQE-80L series of expression vectors.
Purification
Wash
Purification
Elute
pH 5.9 or pH 4.5
100–250 mM
imidazole
Concentration of
6xHis-tagged Expression Amount of 6xHis- Concentra-
protein level Culture volume tagged protein tion factor*
Denaturing conditions
Purification
50 mg/liter 40% 3 ml 150 µg 3x
10 mg/liter 8% 10 ml 100 µg 10x
2 mg/liter 1.6% 25 ml 50 µg 25x
0.5 mg/liter 0.4% 50 ml 25 µg 50x
0.1 mg/liter 0.08% 100 ml 10 µg 100x
Native conditions
>1 mg/liter >1% 50 ml >50 µg 50x
<1 mg/liter <1% 100 ml <100 µg 100x
+ _
H3 N CH COO
CH
N N
NH NH
Imidazole Histidine
Purification
Denaturing Native
NI I CL FT W E1 E2 E3 M CL FT W E1 E2 E3
Purification
Figure 22. Denaturing and native purification of heterologously expressed DHFR. NI: noninduced cells; I: cells
induced with IPTG; CL: cleared lysate; FT: flow-through; W: wash; E1–E3: eluates. 10% of DHFR is present in
soluble form, which can be effectively purified under native conditions.
CL FT W1 W2 W3 W4 W5 E1 E2
Purification
Figure 23. Purification under native conditions. Human serum response factor (SRF) was expressed from a vaccinia
virus vector in HeLa cells and purified using Ni-NTA Agarose with the indicated imidazole concentrations in the
wash and elution steps. Proteins were visualized by Coomassie staining. CL: cell lysate; FT: flow-through;
W1: 0.8-mM wash; W2 & W3: 8-mM wash; W4 & W5: 40-mM wash; E1 & E2: 80-mM elution. (Reproduced by
kind permission of H. Stunnenberg, EMBL, Heidelberg, Germany)
Purification
procedure will be maximized by reducing the potential for nonspecific binding.
6xHis-tagged proteins purified under denaturing conditions can be used directly, or may
have to be renatured and refolded. Protein renaturation and refolding can be carried out
on the Ni-NTA column itself prior to elution (Holzinger et al. 1996), or in solution
(Wingfield et al. 1995a); additional suggestions are included in this manual (see “Protein
refolding recommendations”, page 106).
Wash
Purification
Endogenous proteins with histidine residues that interact with the Ni-NTA groups can be
washed out of the matrix with stringent conditions achieved by lowering the pH to 6.3 or
by adding imidazole at a 10–50 mM concentration. In bacterial expression systems, the
recombinant proteins are usually expressed at high levels, and the level of copurifying
contaminant proteins is relatively low. Therefore it generally is not necessary to wash the
bound 6xHis-tagged protein under very stringent conditions. In lysates derived from
eukaryotic expression systems the relative abundance of proteins that may contain
neighboring histidines is higher; the resulting background problem becomes more critical
especially when nondenaturing procedures are employed. In these instances it becomes
necessary to increase the stringency of the wash steps considerably. This can be performed
most effectively by gradually decreasing the pH of the wash buffer or by slowly increasing
the concentration of imidazole in defined steps; step-gradients are preferable because
they are much more effective than linear gradients when metal affinity chromatography
methods are employed. The optimal pH and/or imidazole concentrations for the washes
will vary slightly for each protein and must be determined empirically.
Purification
the amino acid sequence Ile-Glu-Gly-Arg and cleaves the peptide bond C-terminal of the
arginine residue. The expression vector pQE-30 Xa encodes a Factor Xa Protease recognition
site between the N-terminal 6xHis-tag sequence and the multiple cloning site. If the gene
of interest is cloned blunt ended at the 5´-end using the StuI restriction site of the vector,
Factor Xa Protease cleavage of the purified recombinant protein results in a protein product
without any vector-derived amino acids at the N-terminus. After protease digestion, the
protein of interest can be repurified in two steps. Xa Removal Resin binds Factor Xa Protease
in a batch procedure, and is removed by centrifugation. Subsequently, cleaved 6xHis-tag
peptides and undigested 6xHis-tagged protein can be captured by Ni-NTA affinity
chromatography (see Protocol 20, page 93).
Tags can also be removed exoproteolytically using the TAGZyme System (Schäfer et al.
2002b). This complete system provides high-purity proteins free of vector-encoded amino
acids for use in applications that demand the use of recombinant reagents, an absence
of non-specific cleavage, and a complete removal of all contaminants. For more
information on the TAGZyme System, call QIAGEN Technical Services or your local
distributor.
Purification
Buffer reagents
Tris, HEPES, MOPS •Buffers with secondary or •Up to 100 mM has been used
tertiary amines will reduce successfully in some cases
nickel ions •Sodium phosphate or
phosphate-citrate buffer is
recommended
Chelating reagents
EDTA, EGTA •Strip nickel ions from resin •Up to 1 mM has been used
successfully in some cases, but
care must be taken
Sulfhydril reagents
β-mercaptoethanol •Prevents disulfide •Up to 20 mM
cross-linkages
•Can reduce nickel ions at
higher concentration
DTT, DTE •Low concentrations will •A maximum of 1 mM may be
reduce nickel ions used, but β-mercaptoethanol is
recommended
Detergents
Nonionic detergents •Removes background •Up to 2% can be used
Purification
Purification
to elute the 6xHis-tagged
protein from the Ni-NTA matrix
Sodium bicarbonate •Not recommended
Hemoglobin •Not recommended
Ammonium •Not recommended
Citrate •Up to 60 mM has been used
successfully
Ni-NTA Magnetic Agarose Beads are an ideal Ni-NTA matrix for micro-scale protein
7 8
purification from 10 –10 cells. The total binding capacity of the beads used (3 µg DHFR
[24 kDa] binds per 10 µl magnetic bead suspension) can be easily adjusted to the amount
7 8
of 6xHis-tagged protein expressed by 10 –10 cells allowing efficient purification even
from dilute solutions of recombinant protein. Furthermore, proteins can be eluted into very
small elution volumes allowing detection of the purified proteins using Coomassie-stained
SDS polyacrylamide gels (Wahle et al. 1999). A detailed protocol is described on pages
86–87 (Protocol 15). For large-scale purification from larger amounts of cells we recom-
Purification
mend using Ni-NTA Agarose or Ni-NTA Superflow which bind 0.5–1 mg of a 24 kDa
6xHis tagged protein per 100 µl resin. Cell lysis can be performed by simply scaling up
the micro-scale protocol.
In the hope of increasing the expression rates and of facilitating the purification of the pro-
tein of interest without having to resort to cell lysis, it is often attractive to exploit secretion
of the 6xHis-tagged protein directly into the medium. Mammalian cell culture media are
often supplemented with serum proteins which bind weakly to the Ni-NTA matrix and
compete with the 6xHis-tagged protein for binding sites. Amino acids with electron-
donating groups such as glutamine or histidine are commonly added to media and have
a similar effect.
• First try to purify the 6xHis-tagged protein directly from your medium. Experiments with
some widely used media (DMEM, DMEM+10% fetal calf serum, CHO-S-SFMII, and
RPMI 1640) showed purification recovery rates of 6xHis-tagged thioredoxin in the
range of 45–75% (Wahle et al. 1999).
We have obtained good results by adding 1/10 volume of a 10x buffer containing, for
example, 500 mM NaH2PO4, pH 8.0, 1.5 M NaCl, 100 mM imidazole to the medium.
This results in appropriate composition and pH (8.0) of the medium for binding 6xHis-
tagged proteins. The pH as well as concentrations of NaH2PO4, imidazole, and NaCl are
then similar to those in the lysis buffer recommended for purification under native conditions.
In the example, NaCl is added to increase the final concentration by 150 mM because
most media contain NaCl in physiological concentrations resulting in a final concentration
of 300 mM. Variations in the concentrations of NaCl and imidazole have to be considered
depending on the culture medium used and 6xHis-tagged protein to be purified.
Alternative methods such as dialysis of the medium against a buffer providing optimal
binding conditions, size-exclusion chromatography, or ion-exchange chromatography
can also be considered (Coligan et al. 1995; Deutscher 1990).
Purification
concentrations in media for growing insect cells than in media for growing mammalian
cells and compete with the 6xHis-tagged protein for binding sites on Ni-NTA matrices.
Grace’s medium (Life Technologies), for example, contains approximately 10 mM glutamine,
10 mM glycine, and 15 mM histidine. Table 5 summarizes the results of experiments
where we have analyzed recovery rates after purification directly from various media.
6xHis-tagged thioredoxin and 6xHis-tagged chloramphenicol acetyl transferase (CAT)
were added to some widely used insect cell media and purified with Ni-NTA Agarose.
Recovery rates were between 30 and 100%.
* Control: Purification of CAT and thioredoxin from 50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0
• First try to purify the 6xHis-tagged protein directly from your media.
• If purification efficiency is not sufficient, several options for optimizing binding
conditions can be tested as follows.
Dialysis of the medium against a buffer with the appropriate composition and pH (8.0)
similar to the lysis buffer recommended for purification under native conditions usually
Purification
restores optimal binding conditions. Note that depending on the media used a white pre-
cipitate (probably made up of insoluble salts) can occur, but normally the 6xHis-tagged
protein remains in solution. This can be tested by either protein quantitation if using a
protein-free medium or by monitoring the amount of 6xHis-tagged protein by western-blot
analysis using the QIAexpress Detection System (RGS·His, Penta·His, or Tetra·His Anti-
bodies). After centrifugation, 6xHis-tagged protein can be directly purified from the
cleared supernatant.
Alternatively, the pH of the medium can be adjusted to 8.0 with a phosphate or Tris·Cl
buffer, but again salt precipitation may occur.
Other methods such as size-exclusion chromatography or ion-exchange chromatography
can also be considered (Coligan et al. 1995; Deutscher 1990).
Purification
3. Sonicate on ice using a sonicator equipped with a microtip.
Use six 10 s bursts at 200–300 W with a 10 s cooling period between each burst.
4. (Optional) If the lysate is very viscous, add RNase A (10 µg/ml) and DNase I
(5 µg/ml) and incubate on ice for 10–15 min.
Alternatively, draw the lysate through a narrow-gauge blunt-ended syringe needle
several times.
5. Centrifuge lysate at 10,000 x g for 20–30 min at 4°C to pellet the cellular debris.
Save supernatant.
A certain proportion of the cellular protein, including the 6xHis-tagged protein, may
remain insoluble and will be located in the pellet. For more complete recovery of the
tagged protein, this material must be solubilized using denaturing conditions as
described in Protocol 10 on page 80 before purification under denaturing conditions.
6. Add 5 µl 2x SDS-PAGE sample buffer to 5 µl supernatant and store at –20°C for
SDS-PAGE analysis.
7. Proceed to protocols for purification under native conditions beginning on page 81.
1. Thaw the cell pellet for 15 min on ice and resuspend in buffer B at 5 ml per gram wet
weight.
Cells can be lysed in either 6 M GuHCl or 8 M urea. It is preferable to lyse the cells
in the milder denaturant, urea, so that the cell lysate can be analyzed directly by
SDS-PAGE. GuHCl is a more efficient solubilization and cell lysis reagent, however,
and may be required to solubilize some proteins. Prior to SDS-PAGE analysis, samples
containing guanidine must be treated as described in the appendix on page 115.
The amount of cells required depends on the expression level of the 6xHis-tagged
protein and the expression system used. The binding capacity of Ni-NTA resins is
protein-dependent and normally lies between 5–10 mg/ml. For example, Ni-NTA
Agarose or Ni-NTA Superflow has a binding capacity of 0.3 µmol/ml (8.0 mg/ml)
for 6xHis-tagged DHFR (~26 kDa). Refer to Table 3 “Determination of cell culture
volume requirements” on page 65.
2. Stir cells for 15–60 min at room temperature or lyse them by gently vortexing, taking
care to avoid foaming.
Purification
Purification
4. Centrifuge at 8000 x g for 20 min at 4°C.
The supernatant is the osmotic shock fluid containing periplasmic proteins.
5. Dialyze supernatant extensively against lysis buffer before continuing with the
purification.
For purification under native conditions see below.
Lysis buffer
Wash buffer
Elution buffer
Buffer compositions are provided in the appendix on page 114.
1. Add 1 ml of the 50% Ni-NTA slurry to 4 ml cleared lysate and mix gently by shaking
(200 rpm on a rotary shaker) at 4°C for 60 min.
The 10–20 mM imidazole in the lysis buffer suppresses the binding of nontagged
contaminating proteins and leads to greater purity after fewer wash steps. If the
tagged protein does not bind under these conditions, the amount of imidazole should
be reduced to 1–5 mM.
2. Load the lysate–Ni-NTA mixture into a column with the bottom outlet capped.
3. Remove bottom cap and collect the column flow-through.
Save flow-through for SDS-PAGE analysis.
4. Wash twice with 4 ml wash buffer; collect wash fractions for SDS-PAGE analysis.
M C L F W1 W3 E E
2.0
1.2
1.0
0.8
0.5
0.4
Purification
Figure 24. FPLC purification on Ni-NTA Superflow. 6xHis-tagged phosphatase (~19 kDa) was purified from
cleared lysate (1.2 liters) derived from 18 liters induced E. coli culture on 6 ml of Ni-NTA Superflow in a 1 cm
column at 2 ml/min. Total yield was 38 mg. Left: Coomassie-stained SDS gel; right: elution profile. M: markers;
C: induced cells; L: lysate; F: flow-through; W1: 20 mM wash; W3: 100 mM wash; E: eluates. (Data kindly
provided by T. Schäfer, Institute for Biochemistry, University of Lübeck, Germany.)
Materials
Cleared lysate from a 40–200 ml culture (see Protocol 9, page 79)
Ni-NTA Superflow
Lysis buffer
Wash buffer
Elution buffer
Chromatography column
Buffer compositions are provided in the appendix on page 114.
Monitor pressure at this step. If the lysate is very viscous, the pressure may exceed
the recommended value (10 bar). Reduce flow rate accordingly.
Start with a flow rate of 0.5–1 ml/min. If the 6xHis-tagged protein does not bind, the
flow rate should be reduced. The flow rate may however be increased for protein elution.
Collect the flow-through for SDS-PAGE analysis.
7. Wash with wash buffer until the A280 is stable.
Usually 5–10 column volumes are sufficient.
Collect fractions for SDS-PAGE analysis.
8. Elute the protein with elution buffer.
If desired, a step-gradient of elution buffer in wash buffer may be used to elute the
protein. Five column volumes at each step are usually sufficient. The 6xHis-tagged
protein usually elutes in the second and third column volume.
Note: Imidazole absorbs at 280 nm, which should be considered when monitoring
protein elution. If small amounts of 6xHis-tagged proteins are purified, elution peaks
may be poorly visible.
Purification
4. Add lysozyme to 1 mg/ml and incubate on ice for 30 min.
5. Lyse cells by gently vortexing, taking care to avoid frothing.
6. Centrifuge the lysate for 10 min at 15,000 x g to remove the cellular debris, and
transfer the supernatant to a fresh tube.
7. Add 20 µl of a 50% slurry of Ni-NTA resin (10 µl resin has a capacity for 50–100 µg
6xHis-tagged protein) to each tube, and mix gently for 30 min at 4°C.
8. Centrifuge for 10 s at 1000 x g to pellet the resin, transfer 10 µl of the supernatant
to a fresh tube, and discard the remaining supernatant.
Store the supernatant sample on ice. Supernatant samples will contain any proteins
which have not bound to the resin.
9. Wash the resin twice with 100 µl wash buffer.
Centrifuge for 10 s at 1000 x g between washes and carefully remove supernatant.
10. Elute the protein 3 times with 20 µl elution buffer
Centrifuge for 10 s at 1000 x g between each elution step and carefully remove the
supernatant to a fresh tube.
1. Wash the transfected cells with phosphate-buffered saline (PBS) and collect them by
centrifugation for 5 min at 1000 x g.
2. Resuspend the cells in lysis buffer supplemented with 0.05% Tween® 20 using
7
500 µl lysis buffer per 10 cells.
The lysis buffer should always contain imidazole. For most 6xHis-tagged proteins,
up to 20 mM imidazole can be used without affecting the binding properties. However,
if the tagged protein does not bind under these conditions, the amount of imidazole
should be reduced to 5–10 mM.
If higher concentrations of non-ionic detergent are required to solubilize the 6xHis-
tagged protein, use up to 1% detergent in the lysis, wash, and elution buffers.
Compatible detergents are Tween 20, Triton® X-100, Igepal® CA-630, and CHAPS.
Purification
7. Place the tube on the QIAGEN 12-Tube Magnet for 1 min and remove the super-
natant from the separated beads using a pipet.
To collect suspension droplets from the tube caps, it is helpful to briefly centrifuge the
tubes before placing them on the 12-Tube Magnet.
8. Remove the tube from the magnet, add 1 ml of wash buffer, mix the suspension,
place the tube on the 12-Tube Magnet for 1 min, and remove wash buffer from the
separated beads using a pipet.
9. Repeat step 8 two or three times.
After the final washing step, residual buffer should be removed completely.
10. Add 50 µl of elution buffer, mix the suspension, incubate the tube for 1 min, place
on the 12-Tube Magnet for 1 min, and collect the eluate using a pipet.
To collect suspension droplets from the tube caps, it is helpful to briefly centrifuge the
tubes before placing them on the 12-Tube Magnet.
If a more concentrated protein solution is required, elute in two aliquots of 25 µl each.
Ni-NTA matrix
Empty columns
PBS, lysis buffer, wash buffer and elution buffer
Buffer compositions are provided in the appendix on pages 114–115
1. Wash the transfected cells with phosphate buffered saline (PBS) and collect them by
centrifugation for 5 min at 1000 x g.
2. Lyse the cells in lysis buffer supplemented with 1% Igepal CA-630 using 4 ml lysis
buffer per 1–2 x 107 cells. Incubate for 10 min on ice.
The lysis buffer should always contain imidazole. For most 6xHis-tagged proteins,
up to 20 mM imidazole can be used without affecting the binding properties. How-
ever, if the tagged protein does not bind under these conditions, the concentration
of imidazole should be reduced to 5–10 mM.
Purification
1. Add 1 ml of the 50% Ni-NTA slurry to 4 ml lysate and mix gently by shaking
(e.g., 200 rpm on a rotary shaker) for 15–60 min at room temperature.
The amount of lysate required depends on the expression level of the 6xHis-tagged
protein and the expression system used. The binding capacity of Ni-NTA resins is
protein-dependent and normally lies between 5–10 mg/ml. For example, Ni-NTA
Agarose or Ni-NTA Superflow has a binding capacity of 0.3 µmol/ml (8.0 mg/ml)
for 6xHis-tagged DHFR (~26 kDa).
For proteins that are expressed at very high levels (50–100 mg of 6xHis-tagged
protein per liter of cell culture), a 5x concentrated cell lysate (resuspend the pellet
from a 20 ml culture in 4 ml buffer B) can be used. 4 ml of a 5x concentrated cell
lysate in buffer B will contain approximately 1–2 mg of 6xHis-tagged protein. For
much lower expression levels (1–5 mg/liter), 200 ml of cell culture should be used
for a 50x concentrated cell lysate (4 ml cell lysate = 0.2–1 mg of 6xHis-tagged
protein).
Purification
1. Assemble the column according to the manufacturer’s instructions. Remove the top
adapter of the column and cap the bottom outlet.
2. Thoroughly resuspend a 50% Ni-NTA Superflow slurry and pour the slurry into the
column.
Avoid introducing air bubbles. Slowly pour the slurry down a thin glass rod inserted
into the empty column.
The column and bed size depends on the amount of 6xHis-tagged protein to be purified.
Generally, the binding capacity of Ni-NTA Superflow is 5–10 mg protein per ml resin.
3. Allow the resin to settle.
The packing procedure can be accelerated by allowing the buffer to flow through
by uncapping the bottom outlet. If desired, a peristaltic pump may be used, but a
flow rate of 2 ml/min should not be exceeded.
Do not allow resin to dry. If this should occur, resuspend resin in buffer B and repack
Purification
the column.
Before the bed has settled, more slurry may be added to increase bed volume.
4. Insert top adapter and adjust to top of bed.
Do not trap any air bubbles. The column can now be connected to the system.
5. Equilibrate column with 5 column volumes of buffer B.
Monitor elution at 280 nm; the baseline should be stable after washing with 5 column
volumes.
6. Apply lysate to column and wash with buffer B until the A280 is below 0.01.
Usually 5–10 column volumes are sufficient.
Begin with a flow rate of 1 ml/min. Monitor pressure at this step. If the lysate is very
viscous, the pressure may exceed the recommended value (10 bar). If necessary
reduce flow rate.
Collect the flow-through for SDS-PAGE analysis.
The solution should become translucent when lysis is complete. Most proteins are
soluble in buffer B. If the solution does not become translucent, lyse cells with buffer A.
4. Centrifuge the lysate for 10 min at 15,000 x g to remove the cellular debris, and transfer
the supernatant to a fresh tube.
5. Add 50 µl of a 50% slurry of Ni-NTA resin (25 µl resin has a capacity for 125–250 µg
6xHis-tagged protein) to each tube, and mix gently for 30 min at room temperature.
6. Centrifuge 10 sec at 15,000 x g to pellet the resin, transfer 10 µl of the supernatant to a
fresh tube, and discard the remaining supernatant. Store the supernatant samples on ice.
The supernatant samples will contain any proteins which have not bound to the resin.
7. Wash the resin twice with 250 µl of buffer C.
Centrifuge for 10 sec at 15,000 x g between each wash step and carefully remove
the supernatant.
8. Elute the protein 3 times with 25 µl buffer E.
Centrifuge for 10 sec at 15,000 x g between each elution step and carefully remove
the supernatant to a fresh tube.
Purification
5x SDS-PAGE sample buffer
Buffer compositions are provided in the appendix on pages 111–115.
1. Prepare four solutions each containing 10 µg of the protein to be cleaved, in 1x reaction
buffer. The solutions should have a protein concentration of at least 0.25 µg/µl.
Since Factor Xa Protease is sensitive to various buffer constituents we recommend
that the protein to be cleaved is prepared in 1x reaction buffer before cleavage. If
your individual protein requires other specific buffering conditions, please see the
important notes below for the compatibility of some commonly used buffer components
with Factor Xa Protease. We also recommend changing the buffer system if you have
purified your protein by Ni-NTA affinity chromatography under native conditions,
because Factor Xa Protease activity is sensitive to phosphate buffers as well as to
high imidazole and NaCl concentrations.
analyzed.
Important notes for optimization of cleavage
Protease concentration: Excess Factor Xa Protease may result in nonspecific proteolysis at
secondary sites. Optimal enzyme specificity is achieved using the lowest amount of protease
necessary to achieve complete cleavage.
Concentration of protein to be cleaved: Factor Xa Protease activity is sensitive to the
concentration of protein to be cleaved. A minimum of 10 µg protein per 40 µl reaction
(0.25 µg/µl) is recommended.
Incubation temperature: Factor Xa Protease activity increases with increasing incubation
temperature from 4°C to 37°C. However, it should be taken into account that reduced
incubation temperatures can minimize the accessibility of secondary cleavage sites.
pH: Factor Xa Protease activity decreases with increasing pH from pH 6.5 to pH 9.0.
Therefore, we recommend a pH of 6.5 for the reaction buffer. If your individual protein is
sensitive to pH, for example, with relation to protein activity or solubility, increase the pH
to 7.5.
Purification
Scaleup
Once the optimal cleavage conditions have been found, the reaction can be scaled up
proportionally. Following the above protocol, 1 mg recombinant protein would be digested
in a total volume of 4 ml. If there is a need to reduce the total reaction volume, perform
small scale experiments in which the reaction volume is varied while the protease:recombinant
protein ratio and incubation conditions are kept constant.
1. Calculate the required amount of Xa Removal Resin necessary to capture the Factor
Xa Protease present in the cleavage reaction.
50 µl bed volume (100 µl slurry) is sufficient to bind 4 Units Factor Xa Protease
enzyme in 1x reaction buffer. Use of slurry volumes of less than 25 µl is not recom-
mended due to associated handling problems. If your individual recombinant
protein requires cleavage buffer other than the recommended 1x reaction buffer,
bear in mind that the protease capture step may be sensitive to the use of other
buffers. Binding of Factor Xa Protease to the Xa Removal Resin is unaffected by
increasing the pH to 7.5, the presence of 20–100 mM Tris·HCl, and up to 1% Triton
X-100 or Nonidet P-40. High salt concentrations will reduce binding capacity. For
example, increasing NaCl concentration from 50 mM to 500 mM will result in a
20–40% reduction in binding. The recommended 1x reaction buffer (20 mM Tris·HCl,
pH 6.5; 50 mM NaCl; 1 mM CaCl2) supports high-efficiency cleavage and capture.
2. Resuspend the Xa Removal Resin completely by gentle inversion and then immediately
transfer the required amount of slurry into a centrifuge tube of appropriate size.
Purification
Note: The beads will quickly fall out of suspension. For transfer, use a wide-mouth
pipette.
3. Centrifuge the beads for 5 min at 1000 x g and discard the supernatant.
4. Resuspend the beads in ten bed-volumes of 1x reaction buffer by gently mixing,
centrifuge for 5 min at 1000 x g, and discard the supernatant.
Equilibration of the beads with 1x reaction buffer is necessary for maximum capture
efficiency and prevents contamination of the cleaved recombinant protein with resin
storage buffer. Use Xa Removal Resin immediately after equilibration.
5. Add the cleavage reaction to the equilibrated resin. Mix gently to resuspend the resin
and incubate for 10 min at room temperature. Shake on an orbital shaker or place
sealed tube on a roller-table to keep beads in suspension.
If the cleaved protein is temperature sensitive, binding can be performed at 4°C with-
out any loss of binding efficiency.
Purification
efficient binding of 6xHis tags to Ni-NTA resin.
2. Calculate the required amount of Ni-NTA Agarose needed to capture the 6xHis-
tagged contaminants.
1 ml bed volume (2 ml slurry) is sufficient to bind 5–10 mg 6xHis-tagged protein. For
optimal performance, the binding capacity of the Ni-NTA Agarose used for removal
should match the total amount of 6xHis-tagged protein that was subjected to Factor
Xa Protease cleavage.
3. Resuspend the Ni-NTA Agarose completely by gently inverting the bottle 4–6 times
and then immediately transfer the required amount of slurry into a centrifuge tube
of appropriate size.
4. Centrifuge the resin for 1 min at 1000 x g and discard the supernatant.
Optional: To prevent contamination of the recombinant protein with Ni-NTA storage
buffer, the pelleted beads can be washed with two bed volumes of 20 mM Tris·Cl,
pH 7.5, 50 mM NaCl prior to incubation with the reaction mixture.
Purification
6xHis tag is partially Reduce wash stringency. Purify under denaturing conditions.
hidden.
Buffer conditions incorrect. Check pH and composition of wash buffer.
Ensure that there are no chelating or reducing agents
present.
Discoloration of resin
Nickel ions are removed Ensure that there are no chelating compounds (resin turns
or reduced. white in color) or reducing agents (resin turns brown in
color) present in the buffers.
Purification
beads accordingly.
Binding of contaminants
Too much Ni-NTA Match the total binding capacity of the beads to the
matrix was used. amount of 6xHis-tagged protein to be purified by
simply adjusting the amount of Ni-NTA Magnetic
Agarose Beads suspension used.
Proteins that contain neighboring histidines are not
common in bacteria, but do occur in eukaryotic cells.
These proteins, as well as endogenous proteins with
metal-binding sites, normally bind with lower affinity to
the Ni-NTA matrix than do 6xHis-tagged proteins. If the
binding capacity of the amount of beads used greatly
exceeds the amount of 6xHis-tagged protein to be purified,
these proteins will bind to the Ni-NTA matrix to a
considerably higher extent, and will be subsequently
recovered in the eluate.
Binding and wash conditions Always include 10–20 mM imidazole in the binding
are not stringent enough. buffer and 20 mM imidazole in the wash buffer.
Large amount of nontagged Perform a second round of purification from the eluate
proteins in the lysate after adjusting the imidazole concentration to 10–20 mM
when purifying from cells with using binding buffer without imidazole. Significantly
a very low expression rate. smaller amounts of background proteins in the binding
step reduce the level of contaminants in the final prepa-
ration.
Purification
Purification
used. amount of 6xHis-tagged protein to be purified. Endoge-
nous proteins with metal-binding sites normally bind with
lower affinity to the Ni-NTA matrix than do 6xHis-tagged
proteins. If the binding capacity of the amount of matrix
used greatly exceeds the amount of 6xHis-tagged protein
to be purified, these proteins will bind to the Ni-NTA
matrix to a considerably higher extent, and subsequently
will be recovered in the eluate.
Binding and wash conditions Always include 10–20 mM imidazole in the binding
are not stringent enough. buffer and 20 mM imidazole in the wash buffer.
Multiple bands are observed on SDS-gel following cleavage with Factor Xa Protease
Bands derive from Factor Xa If large amounts of Factor Xa Protease are used, two
Protease. bands (approximately 17–20 kDa and 28–30 kDa) may
appear on the gel under reducing conditions. Run Factor
Xa Protease alone in an adjacent gel lane as a control.
Purification
Protease cleaves within the Check that no additional Factor Xa Protease recognition
recombinant protein. site is present in the recombinant protein. Reduce
incubation temperature (RT or 4°C) to minimize exposure
of secondary cleavage sites. Reduce amount of Factor Xa
Protease used for cleavage.
Adjust reaction conditions to obtain partial digestion
which may result in selective scission at the desired Factor
Xa Protease recognition site.
Factor Xa Removal
Factor Xa Protease not efficiently removed
Amount of Xa Removal Resin Check that you have correctly calculated the amount of
used is too low. resin necessary (see Protocol).
Perform a second capture reaction.
Buffer contains components Dialyze the cleavage reaction mixture against 1x Reaction
which affect the Factor Xa Buffer and repeat the binding protocol.
Protease binding reaction Try to eliminate incompatible buffer components during
(see protocol). the Factor Xa Protease cleavage reaction and repeat the
cleavage and capture steps.
Purification
binds to Ni-NTA resin. non-specific binding of the cleaved recombinant protein.
Purification
Ni-NTA Ni-NTA
Agarose Superflow
TCA precipitation
1. Dilute samples to 100 µl; add equal volumes of 10% TCA.
2. Leave on ice for 20 min; centrifuge for 15 min in a microcentrifuge.
3. Wash pellet with 100 µl of ice-cold ethanol, dry, and resuspend in sample buffer.
In case there are any traces of GuHCl present, samples should be loaded immediately
after boiling for 7 min at 95°C.
Appendix
Lysis buffers
Buffer A (1 liter):
100 mM NaH2PO4 13.8 g NaH2PO4·H2O (MW 137.99 g/mol)
10 mM Tris·Cl 1.2 g Tris base (MW 121.1 g/mol)
6 M GuHCl 573 g guanidine hydrochloride
Adjust pH to 8.0 using NaOH.
Buffer B (1 liter):
100 mM NaH2PO4 13.8 g NaH2PO4·H2O (MW 137.99 g/mol)
10 mM Tris·Cl 1.2 g Tris base (MW 121.1 g/mol)
8 M urea 480.5 g (MW 60.06 g/mol)
Adjust pH to 8.0 using NaOH.
Wash buffer
Buffer C (1 liter):
100 mM NaH2PO4 13.8 g NaH2PO4·H2O (MW 137.99 g/mol)
10 mM Tris·Cl 1.2 g Tris base (MW 121.1 g/mol)
8 M urea 480.5 g (MW 60.06 g/mol)
Adjust pH to 6.3 using HCl.
Elution buffers
Buffer D (1 liter):
100 mM NaH2PO4 13.8 g NaH2PO4·H2O (MW 137.99 g/mol)
10 mM Tris·Cl 1.2 g Tris base (MW 121.1 g/mol)
8 M urea 480.5 g (MW 60.06 g/mol)
Appendix
Buffer E (1 liter):
100 mM NaH2PO4 13.8 g NaH2PO4·H2O (MW 137.99 g/mol)
10 mM Tris·Cl 1.2 g Tris base (MW 121.1 g/mol)
8 M urea 480.5 g (MW 60.06 g/mol)
Adjust pH to 4.5 using HCl.
Buffers for purification from mammalian cells using Ni-NTA Magnetic Agarose Beads
under native conditions (Protocol 15)
PBS 50 mM potassium phosphate, pH 7.2; 150 mM NaCl
Lysis buffer (1 liter):
50 mM NaH2PO4 6.90 g NaH2PO4·H2O (MW 137.99 g/mol)
300 mM NaCl 17.54 g NaCl (MW 58.44 g/mol)
Appendix
Buffer for Factor Xa Protease digestion and removal of Factor Xa Protease with Xa
Removal Resin (Protocols 20 a and 20 b)
1x reaction buffer (1 liter):
20 mM Tris·Cl 2.42 g Tris base (MW 121.1 g/mol)
50 mM NaCl 2.92 NaCl (MW 58.44 g/mol)
1 mM CaCl2 0.147 g CaCl2·2H2O (MW 147.02 g/mol)
Adjust to pH 6.5 using HCl.
Appendix
pQE-9
pQE-16
pQE-30/pQE-80 L
Sma I
6xHis Bam Sph I Sac Kpn I Xma I Sal I Pst I Hind III t0
Eco RI/RBS
ATG AGAGGATCG GGATCCGCATGCGAGCTCGGTACCCCGGGTCGACCTGCAGCCAAGCTT AATTAGCTGAG
RGS·His epitope
pQE-31/pQE-81 L
Sma I
6xHis Bam Sph I Sac Kpn I Xma I Sal I Pst I Hind III t0
Eco RI/RBS
ATG AGAGGATCT AC GGATCCGCATGCGAGCTCGGTACCCCGGGTCGACCTGCAGCCAAGCTT AATTAGCTGAG
RGS·His epitope
pQE-32/pQE-82 L
Sma I
6xHis Bam Sph I Sac Kpn I Xma I Sal I Pst I Hind III t0
Eco RI/RBS
ATG AGAGGATCT G GGATCCGCATGCGAGCTCGGTACCCCGGGTCGACCTGCAGCCAAGCTT AATTAGCTGAG
RGS·His epitope
pQE-40
Sma I
6xHis Bam Bgl Sph I Kpn I Xma I Sal I Pst I Hind III t0
Eco RI/RBS DHF
ATG AGAGGATCG GGATC GGTTCC AGATCTGCATGCGGTACCCCGGGTCGACCTGCAGCCAAGCTT AATTAGCTGAG
RGS·His epitope
pQE-60
Appendix
pQE-70
pQE-100 DoubleTag
Sma I
6xHis Bam Sph I Sac Kpn I Xma I Sal I Pst I Hind III Tag·100 Bgl II Hind III t0
Eco RI/RBS
ATG AGAGGATCG GGATCCGCATGCGAGCTCGGTACCCCGGGTCGACCTGCAGCCAAGCTT TAGAGATCTAAGCTTAATTAGCTGAG
RGS·His epitope
p ot S
nodoc
BamHI Pmll EcoRV
6xHis SacI KpnI XmaI SalI StuI PstI HindIII t0
EcoRI/RBS GGATCCCACGTGATATCCTCA ATCGCTTCU PCR- GAAGCGATTGAGGAGATCTGA
ATG AGAGGATCG GCTCGGTACCCGGGTCGACAGGCCTCTGCAGCCAAGCTT AATTAGCTGAG
CCTAGGGTGCACTATAGGAGTTAGCGAAG Product UCTTCGCTAACTCCTCTAGACT
RGS·His epitope
BglII
pQE-30 Xa
SmaI
6xHis StuI BamHI SphI SacI KpnI XmaI SalI PstI HindIII t0
EcoRI/RBS
+1 (T5P)
pQE-TriSystem*
ATTGAGGCCTCGACCACCGGG
ATTGAGGCCTCGACCACCGGGACCTTTAATTCAACCCAACACAATATATTATAGTTAAATAAGAATTATTATCAAATCATTTGTATATTAATTAAAATACTATACTGTAAATTACATTTTATTTACAATC
Kozak 3-ORF site PstI EagI 3-ORF site
RBS NcoI EcoRV SmaI SacI BamHI EcoRI BglII AscI SfbI KpnI NspV HindIII NotI PvuII Bst 1107 I
AAAGGAGATATACCATGGCGATATCCCGGGAGCTCGTGGATCCGAATTCTCAGATCTCGGCGCGCCTGCAGGTCGACGGTACCGGTTCGAAGCTTGCGGCCGCACAGCTGTATAC
Stop Codons
PmlI XhoI 8xHis tag DraIII
ACGTGCAAGCCAGCCAGAACTCGCCCCGGAAGACCCCGAGGATCTCGAGCACCACCATCACCATCACCATCACTAAGTGATTAACCTCAGGTGCAGGCTGCCTATCAGAAGGTG
poly A
pQE-TriSystem reverse primer signal
GTGGCTGGTGTGGCCAATGCCCTGGCTCACAAATACCACTGAGATCGATCTTTTTCCCTCTGCCAAAAATTATGGGGACATCATGAAGCCCCTTGAGCATCTGACTTCTGGCTAATAAA
Exon 2
GGAAATTTATTTTCATTGCAATAGTGTGTTGGAATTTTTTGTGTCTCTCACTCGGAAGGACATATGGGAGGGCAAATCATTTAAAACATCAGAATGAGTTTTTG
117
*The GC-rich region upstream of the intron may cause problems in sequencing. We recommend linearization of the vector using a restriction site in the intron, eg., XbaI.
Appendix
Restriction map of pREP4
XbaI (3641)
BalI (567)
neo
pREP-4
3740 bp
NcoI (917)
lac I
Promoter Region
5 ' CC CGAAAAGTGC CACCTG 3'
Xho I
Appendix
5'CACATTTCCC CGAAAAGTGC CACCTGACGT CTAAGAAACC ATTATTATCA TGACATTAAC CTATAAAAAT AGGCGTATCA CGAGGCCCTT TCGTCTTCACCTCGAGAAAT
Type III/IV
–35 –10 5' CG GATAACAATT TCACAC A G 3'
operator I Eco RI RBS
AAT CATAAAAAAT TTAT T T G C T T TGTGAGCGGA TAACAATTAT A ATAGATTCA ATTGTGAGCG GATAACAATT TCACACA GAA TTCATTAAAG AGGAGAAATT AACT ATG
6xHis Bam HI Sph I Sac I Kpn I Sma I Sal I Pst I Hind III
ATG AGA GGA TCG CAT CAC CAT CAC CAT CAC GGA TCC GCA TGC GAG CTC GGT ACC CCG GGT CGA CCT GCA GCC AAG CTT AAT TAG CTGAGCTTG
RGS·His epitope
* Sequencing primers can be used for all pQE vectors except pQE-TriSystem.
References
Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Sedman, J.G., Smith, J.A., and Struhl, K. eds. (1995)
Current Protocols in Molecular Biology. New York: John Wiley and Sons.
Baldarini, C. and Cesareni, G. (1985) Plasmid pEMBLy: new single-stranded shuttle vectors for the recovery and
analysis of yeast DNA sequences. Gene 35, 27–32.
Bowden, G.A. and Georgiou, G. (1990) Folding and aggregation of ß-lactamase in the periplasmic space of
Escherichia coli. J. Biol. Chem. 265, 16760–16766.
Bradley, M.K. (1990) Overexpression of proteins in eukaryotes. Methods Enzymol. 182, 112–143.
Bujard, H., Gentz, R., Lanzer, M., Stüber, D. Müller, M., Ibrahimi, I. Häuptle, M.T., and Dobberstein, B. (1987)
A T5 promotor based transcription-translation system for the analysis of proteins in vivo and in vitro.
Methods Enzymol. 155, 416–433.
Bush, G.L., Tassin, A., Friden, H., and Meyer, D.I. (1991) Secretion in yeast: purification and in vitro translocation
of chemical amounts of prepro-α-factor. J. Biol. Chem. 266, 13,811–13,814.
Chang, A.C.Y. and Cohen, S.N. (1978). Construction and characterization of amplifiable multicopy DNA
cloning vehicles derived from the PI5A cryptic miniplasmid. J. Bacteriol. 134, 1141–1156.
Clare, J. J., Romanos, M. A., Rayment, F. B., Rowedder, J. E., Smith, M. A., Payne, M. M., Sreekrishna, K.,
Henwood, C. A., (1991) Production of mouse epidermal growth factor in yeast: high-level secretion
using Pichia pastoris strains containing multiple copies. Gene 105, 205–212.
Coligan, J. E., Dunn, B. M., Ploegh, H. L., Speicher, D. W., and Wingfield, P.T. eds. (1995) Current protocols in
protein science, vol. 1, John Wiley and Sons, New York.
Deutscher, M.P. ed. (1990). Methods in Enzymology. Volume 185. Guide to Protein Purification. Academic
Press, San Diego, CA, USA.
Dobeli, H., Trecziak, A., Gillessen, D., Matile, H., Srivastava, I. K., Perrin, L. H., Jakob, P. E., and Certa, U.
(1990) Expression, purification, biochemical characterization and inhibition of recombinant Plasmodium
falciparum aldolase. Molec. Biochem. Parasitol. 41, 259-268.
Farabaugh, P.J. (1978) Sequence of the Iac I gene. Nature 274, 765.
Flachmann, R. and Kühlbrandt, W. (1996) Crystallization and assembly defect of recombinant antenna
complexes produced in transgenic tobacco plants. Proc. Nat. Acad. Sci. USA 93, 14966–14971.
Gentz, R., Certa, U., Takacs, B. J., Matile, H., Dobeli, H., Pink, R., Mackay, M., Bone, N., and Scaife, J. G.
(1988) Major surface antigen pl90 of Plasmodium falciparum: detection of common epitopes present in
a variety of plasmodia isolates. EMBO J. 7, 225–230.
Gentz, R., Chen, C., and Rosen, C. A. (1989) Bioassay for trans-activation using purified immunodeficiency virus
tat-encoded protein: trans-activation requires mRNA synthesis. Proc. Natl. Acad. Sci. USA 86,
821–824.
Gietz, D., Jean, A. S., Woods, R. A., and Schiestl, R. H. (1992) Improved method for high efficiency
transformation of intact yeast cells. Nucl. Acids Res. 20, 1425.
Gottesman, S., Halpern, E., and Trisler, P. (1981) Role of sulA and sulB in filamentation by Ion mutants of
Escherichia coli K-12. J. Bacteriol. 148, 265–273.
Grosjean, H. and Fiers, W. (1982) Preferential codon usage in prokaryotic genes: the optimal codon-anticodon
interaction energy and the selective codon usage in efficiently expressed genes. Gene 18, 199–209.
Gu, J., Stephenson, C.G., and Iadarola M.J. (1994) Recombinant proteins attached to a Ni-NTA column: Use in
affinity purification of antibodies. BioTechniques 17, 257–262.
Guan, C., Li, P., Riggs,. P.D., and Inouye, H. (1988) Vectors that facilitate the expression and purification of
foreign peptides in Escherichia coli by fusion to maltose binding protein. Gene 67, 21–30.
References
Schäfer, F., Römer, U., Emmerlich, M., Blümer, J., Lubenow, H., and Steinert, K. (2002a). Automated High-
Throughput Purification of 6xHis-Tagged Proteins. J. Biomol. Tech. 13, 131.
Schäfer, F., Schäfer, A., and Steinert, K. (2002b). A Highly Specific System for Efficient Enzymatic Removal of
Tags from Recombinant Proteins. J. Biomol. Tech. 13, 158.
Schein, C.H. (1989) Production of soluble recombinant proteins in bacteria. Bio/Technology 7, 1141–1149.
Schein, C.H. and Noteborn, M.H.M. (1988) Formation of soluble recombinant proteins in Escherichia coli is
favored by low growth temperature. BioTechnology 6, 291–294.
Schmitt, J., Hess, H., and Stunneberg, H.G. (1993a) Affinity purification of histidine-tagged proteins. Molecular
Biology Reports 18, 223–230.
Schwarz, E., Scherrer, G., Hobom, G., and Kössel, H. (1978). Nucleotide sequence of cro, cII and part of the
0 gene in phage lambda DNA. Nature 272, 410–414.
Shine, J. and Dalgarno, L. (1974) The 3’-terminal sequence of Escherichia coli 16S ribosomal RNA: Complementary
to nonsense triplets and ribosome binding sites. Proc. Nat. Acad. Sci. U.S.A. 71, 1342–1346.
Smith, D.B. and Johnson, K.S. (1988) Single-step purification of polypeptides expressed in Escherichia coli as
fusions with glutathione S-transferase. Gene 67, 31–40.
Stüber, D., Bannwarth, W., Pink, J. R. L., Meloen, R. H., and Matile, H. (1990) New B-cell epitopes in the
Plasmodium falciparum malaria circumsporozoite protein. Eur. J. Immunol. 20, 819–824.
Stüber, D., Matile, H., and Garotta, G. (1990) System for high-level production in Escherichia coli and rapid
purification of recombinant proteins: application to epitope mapping, preparation of antibodies, and
structure-function analysis. In: Immunological Methods, Lefkovits, I. and Pernis, B., eds., vol. IV,
Academic Press, New York, pp. 121–152.
Studier, F.W., Rosenberg, A.H., Dunn, J.J., and Dubendorff, J.W. (1990) Use of T7 RNA polymerase to direct
expression of cloned genes. Methods Enzymol. 185, 60–89.
Sulkowski, E. (1985) Purification of proteins by IMAC. Trends Biotechnol. 3, 1–7.
Sutcliffe, J.G. (1979). Complete nucleotide sequence of the E. coli plasmid pBR322. Cold Spring Harbor Symp.
Quant. Biol. 43, 77–90.
Takacs, B. J. (1979) Immunological methods, Lefkovits, I. and Pernis, B., eds., vol. 1, Academic Press, New York, p. 81.
Takacs, B. J. and Girard, M.-F. (1991) Preparation of clinical grade proteins produced by recombinant DNA
technologies. J. Immunol. Methods 143, 231–240.
Waeber, U., Buhr, A., Schunk, T., and Erni, B. (1993) The glucose transporter of Escherichia coli: purification
and characterization by Ni+2 chelate affinity chromatography of the IIBCGlc subunit. FEBS Letters 324,
109–112.
Wahle, S., Rohweder, H., Ribbe, J., and Steinert, K. (1999) Purification of 6xHis-tagged proteins from mam-
malian expression systems using Ni-NTA Magnetic Agarose Beads. QIAGEN News 1999 No. 4, 3.
Wingfield, P. T. (1995a) Overview of the purification of recombinant proteins produced in Escherichia coli. In:
Current protocols in protein science, vol. 1, Coligan, J. E., Dunn, B. M., Ploegh, H. L., Speicher, D. W.,
and Wingfield, P.T. eds. John Wiley and Sons, New York, pp. 6.1.1–6.1.22.
Wingfield, P. T. (1995b) Preparation of soluble proteins from Escherichia coli. In: Current protocols in protein
science, vol. 1, Coligan, J. E., Dunn, B. M., Ploegh, H. L., Speicher, D. W., and Wingfield, P.T., eds.
Wiley and Sons, New York, pp. 6.2.1–6.2.15.
Wingfield, P. T., Palmer, I., and Liang, S.-M. (1995) Folding and purification of insoluble (inclusion-body)
proteins from Escherichia coli. In: Current protocols in protein science, vol. 1, Coligan, J. E., Dunn, B.
M., Ploegh, H. L., Speicher, D. W., and Wingfield, P.T. eds. Wiley and Sons, Inc. New York,
pp. 6.5.1–6.5.27.
QIAexpress Kits
QIAexpress Type IV Kit pQE-30, pQE-31, pQE-32 32149
(N-terminal 6xHis)
QIAexpress Type ATG Kit pQE-60, pQE-70 (C-terminal 6xHis) 32169
pQE expression vectors
C-Terminus pQE Vector Set 25 µg each: pQE-16, pQE-60, pQE-70 32903
N-Terminus pQE Vector Set 25 µg each: pQE-9, pQE-30, pQE-31, 32915
pQE-32, pQE-40
cis-Repressed pQE Vector Set 25 µg each: pQE-80L, pQE-81L, pQE-82L 32923
pQE-100 DoubleTag 25 µg pQE-100 (lyophilized) 33003
Vector DNA
pQE Sequencing-Primer Set 0.1 A260 unit each: Primer - Promoter 34051
Region, Primer - Type III/IV, Primer -
Reverse Sequencing (3.0, 2.8, 3.1 µg,
respectively; lyophilized)
E. coli Host Strains One stab culture each: 34210
E. coli M15[pREP4],
SG13009[pREP4]
pQE-30 Xa Vector 25 µg pQE-30 Xa Vector DNA 33203
pQE-TriSystem Vector 25 µg pQE-TriSystem Vector DNA 33903
QIAexpress UA Cloning Kit 100 µl 2x Ligation Master Mix, 32179
1 µg pQE-30 UA Vector DNA (50 ng/µl),
distilled water
QIAGEN A-Addition Kit (40) For 40 A-addition reactions: 231994
5x QIAGEN A-Addition Master Mix,
distilled water (1.7 ml)
PCR-product cleanup kits
MinElute PCR Purification Kit 50 MinElute Spin Columns, Buffers, 28004
(50) Collection Tubes (2 ml)
QIAquick PCR Purification Kit For purification of 50 PCR reactions: 28104
(50) 50 QIAquick Spin Columns, Buffers,
Collection Tubes (2 ml)
Ni-NTA Matrices
Ni-NTA Agarose (25 ml) 25 ml nickel-charged resin 30210
(max. pressure: 2.8 psi)
Ni-NTA Agarose (100 ml) 100 ml nickel-charged resin 30230
(max. pressure: 2.8 psi)
Ni-NTA Agarose (500 ml) 500 ml nickel-charged resin 30250
(max. pressure: 2.8 psi)
Anti·His Antibodies
RGS·His Antibody (100 µg) 100 µg mouse anti-RGS(His)4 34610
(lyophilized, with BSA,
for 1000 ml working solution)
RGS·His Antibody, 100 µg mouse anti-RGS(His)4 34650
BSA-free (100 µg) (lyophilized, BSA-free,
for 1000 ml working solution)
RGS·His Antibody, 1 mg mouse anti-RGS(His)4 antibody Inquire
BSA-free (1 mg) (lyophilized, BSA-free)
Penta·His Antibody, 100 µg mouse anti-(His)5 34660
BSA-free (100 µg) (lyophilized, BSA-free,
for 1000 ml working solution)
Penta·His Antibody, 1 mg mouse anti-(His)5 antibody Inquire
BSA-free (1 mg) (lyophilized, BSA-free)
Tetra·His Antibody, 100 µg mouse anti-(His)4 34670
BSA-free (100 µg) (lyophilized, BSA-free,
for 1000 ml working solution)
Tetra·His Antibody, 1 mg mouse anti-(His)4 antibody Inquire
BSA-free (1 mg) (lyophilized, BSA-free)
Anti·His Antibody Selector Kit RGS·His Antibody, Penta·His Antibody, 34698
Tetra·His Antibody, all BSA-free,
3 µg each
Trademarks
Patented or patent-pending and/or registered or registration-pending trademarks of QIAGEN: QIAGEN®,
QIAexpress®, QIAexpressionist ™, QIAquick®, BioRobot®, Effectene™, HisSorb™, Ni-NTA, MinElute™,
Penta·His™, PolyFect®, RGS·His™, SuperFect™, Tetra·His™.
Hoffmann-La Roche owns patents and patent applications pertaining to the application of Ni-NTA resin (Patent series:
RAN 4100/63: USP 4.877.830, USP 5.047.513, EP 253 303 B1), and to 6xHis-coding vectors and His-labeled
proteins (Patent series: USP 5.284.933, USP 5.310.663, EP 282 042 B1). All purification of recombinant
proteins by Ni-NTA chromatography for commercial purposes, and the commercial use of proteins so purified,
require a license from Hoffmann-La Roche.
ABTS is a registered trademark of Boehringer Mannheim GmbH. BaculoGold is a trademark of Becton, Dickinson
and Company. BacVector is a registered trademark of Novagen, Inc. CDP-Star is a trademark of Tropix, Inc.
Coomassie is a trademark of ICI Organics Inc. DAPase, pGAPase, Qcyclase, and TAGZyme are trademarks of
UNIZYME. FPLC is a registered trademark of Pharmacia Biotech AB. High Five is a trademark of Invitrogen
Corporation Igepal is a registered trademark of Rhone-Poulenc, Inc. Macintosh is a registered trademark of Apple
Computer, Inc. Microsoft is a registered trademark of Microsoft Corporation. Superflow is a trademark of Sterogene
Bioseparations Inc. Triton is a registered trademark of Union Carbide Inc. Tween is a registered trademark of ICI
Americas Inc. Registered names, trademarks, etc. used in this document, even when not specifically marked as
such, are not to be considered unprotected by law.
The PCR process is covered by U.S. Patents 4,683,195 and 4,683,202 and foreign equivalents owned by
Hoffmann-La Roche AG.
QIAGEN Distributors
Argentina Egypt New Zealand Taiwan
Tecnolab S.A. Clinilab Biolab Ltd TAIGEN Bioscience Corporation
Tel: (011) 4555 0010 Tel: 52 57 212 Tel: (09) 980 6700 Tel: (02) 2880 2913
Fax: (011) 4553 3331 Fax: 52 57 210 or 0800 933 966 Fax: (02) 2880 2916
E-mail: [email protected] E-mail: [email protected] Fax: (09) 980 6788 E-mail: [email protected]
Web site: www.tecnolab.com.ar E-mail:
[email protected]
Finland Web site: www.biolabgroup.com/nzl Thailand
VWR International Oy Theera Trading Co. Ltd.
Austria
Tel: (09) 804 551 Tel: (02) 412-5672
VWR International GmbH
Fax: (09) 8045 5200 Norway Fax: (02) 412-3244
Tel: (01) 576 00 0
E-mail: [email protected] VWR International AS E-mail: [email protected]
Fax: (01) 576 00 600
E-mail: [email protected] Web site: www.vwr.com Tel: 22 90 00 00
Web site: www.vwr.com Fax: 22 90 00 40
E-mail: [email protected] Turkey
Greece Web site: www.vwr.com Medek Medikal Ürünler
BioAnalytica S.A. ve Saglik Hizmetleri A. S.
Belgium/Luxemburg Tel: (210)-640 03 18 Tel: (216) 302 15 80
Westburg b.v. Fax: (210)-646 27 48 Poland Fax: (216) 302 15 88
Tel: 0800-1-9815 E-mail: [email protected] Syngen Biotech Sp.z.o.o. E-mail: [email protected]
Fax: (31) 33-4951222 Tel: (071) 351 41 06
E-mail: [email protected] or 0601 70 60 07
Web site: www.westburg.nl Hungary Fax: (071) 351 04 88 All other countries
Kasztel-Med Co. Ltd. E-mail: [email protected] QIAGEN GmbH, Germany
Tel: (01) 385 3887 Web site: www.syngen.pl
Brazil Fax: (01) 381 0695
Uniscience do Brasil E-mail: [email protected]
Tel: 011 3622 2320 Web site: www.kasztel.hu Portugal
Fax: 011 3622 2323 IZASA PORTUGAL, LDA
E-mail: [email protected] Tel: (21) 424 7312
Web site: www.uniscience.com India Fax: (21) 417 2674
Genetix
Tel: (011)-2542 1714
or (011)-2515 9346 Singapore
China
Fax: (011)-2546 7637 Research Biolabs Pte Ltd
Gene Company Limited
E-mail: [email protected] Tel: 62731066
Tel: (852)2896-6283
Fax: 62734914
Fax: (852)2515-9371
E-mail: [email protected]
E-mail:
Israel
Hong Kong:[email protected]
Westburg (Israel) Ltd.
Beijing: [email protected]
Tel: 08-6650813/4 Slovak Republic
Shanghai: [email protected]
or 1-800 20 22 20 (toll free) BIO-CONSULT Slovakia spol. s.r.o.
Chengdu: [email protected]
Fax: 08-6650934 Tel/Fax: (02) 5022 1336
Guangzhou:
E-mail: [email protected] E-mail: [email protected]
[email protected]
Web site: www.westburg.co.il Web site: www.bio-consult.cz