Lupus (2019) 0, 1–10

journals.sagepub.com/home/lup

PAPER

Effects of human umbilical cord mesenchymal stem cells on

inflammatory factors and miR-181a in T lymphocytes from
patients with systemic lupus erythematosus
B Zheng, P Zhang, L Yuan, RK Chhetri, Y Guo and D Deng
Department of Dermatology, The Second Affiliated Hospital of Kunming Medical University, Kunming, PR China

Objectives: The present study aimed to explore the effect of umbilical cord mesenchymal stem
cells (UC-MSCs) on the modulation of T lymphocytes from system lupus erythematosus
(SLE) patients and the possible mechanism. Methods: A total of 24 hospitalized SLE patients
and 28 healthy individuals were enrolled. T lymphocytes were sorted using Miltenyi magnetic
beads. After the addition of recombinant human interleukin (IL)-2 and CD3CD28 T-cell
activator, cells were loaded onto six-well plates pre-inoculated or not with UC-MSCs for 1
week of culture. The supernatants were collected for testing inflammatory factors by enzyme-
linked immunosorbent assay. Meanwhile, T lymphocytes were collected to assess the expres-
sion levels of genes, proteins in relation to SLE and miR-181a by polymerase chain reaction
and Western blot. Results: Compared with T lymphocytes cultured alone, interferon-g, IL-4,
IL-6 and IL-10 levels were significantly decreased in T lymphocytes from SLE patients co-
cultured with UC-MSCs. In addition, the gene and protein expression levels of TNF alpha,
osteopontin and nuclear factor-kappa B in T lymphocytes were significantly decreased, while
miR-181a expression was markedly elevated (p < 0.05 or 0.008). Conclusion: UC-MSCs have
showed certain immunomodulatory and inhibitory effects in vitro on T lymphocytes from
SLE patients, which could potentially be a beneficial treatment of the disease. UC-MSCs may
up-regulate miR-181a and down-regulate inflammation-related gene expression. Lupus
(2019) 0, 1–10.

Key words: Mesenchymal stem cells; systemic lupus erythematosus; T lymphocyte; miR-181a

Introduction in lupus mice and in SLE patients.4 However, the

mechanism remains to be explored. Recent evi-
Systemic lupus erythematosus (SLE) is an auto- dence reported the significant abnormality in
immune disease that affects multiple organs, of T-lymphocyte functions in SLE patients.5,6
which the aetiology, pathogenesis and treatment Meanwhile, stem-cell defects have been observed
remain to be advanced.1 Umbilical cord mesenchy- in SLE patients.7 Put together, could normal stem
mal stem cells (UC-MSCs) are highly self- cells recover T-lymphocyte dysfunctions and thus
renewable, with potentials of multi-directional improve SLE? In this in vitro study, co-culture of
differentiation, strong tissue repair and immuno- normal UC-MSCs on T lymphocytes from SLE
suppressive abilities. The therapeutic effect of patients was examined. Our present results could
stem-cell transplantation in SLE has been con- explain some of the mechanism of UC-MSCs in
firmed in animals, as well as being observed in the treatment of SLE.
some clinical experiments.2,3 Our previous study
on UC-MSCs showed a certain therapeutic effect Materials and methods

Correspondence to: D Deng, Department of Dermatology, The Second Patients

Affiliated Hospital of Kunming Medical University, 374 Dianmian
Avenue, Kunming, Yunnan 650101, PR China.
The SLE group included 24 patients hospitalized
Email: danqid128@sina.com in the Department of Dermatology, the
Received 2 August 2019; accepted 29 November 2019 Second Affiliated Hospital of Kunming Medical
! The Author(s), 2019. Article reuse guidelines: sagepub.com/journals-permissions 10.1177/0961203319896417
 UC-MSCs significantly regulate T lymphocytes
B Zheng et al.
2

University, from January to June 2018. Diagnosis of cultured with low-glucose Dulbecco’s modified
all cases satisfied the classification criteria of the Eagle’s medium containing 10% fetal bovine
American Rheumatism Association revised in 1997. serum (FBS) and pre-incubated in six-well plates
Those subjects who had used mild- or high-dose for later use. Peripheral blood mononuclear cells
glucocorticoids (prednisone of dosage 30 mg/day) (PBMCs) were obtained from 20 ml whole blood
and/or immunosuppressants in the past 3 months individually and extracted by Ficoll density gradi-
before blood collection were excluded from our ent centrifugation. Then, T lymphocytes were
experiment. The pathological classification standard extracted by Miltenyi magnetic bead sorting based
of renal biopsy in patients with lupus nephritis (LN) on the manufacturer’s instructions. The extracted
was used which was established by the International cells were incubated with Roswell Park Memorial
Society of Nephrology/Renal Pathology Society Institute 1640 containing 10% FBS (for the purifi-
in 2003. According to the Systemic Lupus cation assay, see Results). Next, recombinant
Erythematosus Activity Index (SLEDAI), 8 patients human interleukin-2 (rhIL-2) and CD3CD28
were active (SLEDAI score 10) and 16 patients T-cell activator were supplemented at a ratio of
were inactive (SLEDAI score 9). The healthy con- 400 IU and 25 ml for 1 ml of culture medium,
trol (HC) group included 28 healthy individuals who respectively, with a gentle shake to mix. The mix-
underwent physical examination. The basic informa- ture was then placed in an incubator to be cultured
tion for all subjects is shown in Table 1. A total of for later use. When the cultured UC-MSCs were
20 ml venous blood was collected from each subject grown to 80–90% confluence, the T lymphocytes
(SLE patient or healthy control) in an anticoagula- were transferred to UC-MSC culture wells at a
tion tube containing ethylenediaminetetraacetic acid cell number ratio of 5:1. The amounts of rhIL-2
for later use. There was no significant difference in and CD3CD28 T-cell activator and the ratio of T
age between the two groups (p > 0.05). The study lymphocytes to UC-MSC were both based on
reported studies8,9 and our own experiments.
protocol was approved by the Ethics Committee of
Experimental cells were divided into four groups,
Kunming Medical University, and all subjects pro-
including co-culture of T lymphocytes from SLE
vided signed informed consent.
patients and UC-MSCs (SLE þ UC-MSCs),
mono-culture T lymphocytes from SLE patients
Cells and main reagents
(SLE), co-culture of T lymphocytes from healthy
Human UC-MSCs (Shenzhen Beike Biotechnology individuals and UC-MSCs (HC þ UC-MSCs) and
Co. Ltd, Shenzhen, PR China) were purchased, and mono-culture of T lymphocytes from healthy indi-
viduals (HC). The four groups of cells were further
Table 1 General features of subjects, along with disease cultured in a CO2 incubator for 1 week without
course and SLEDAI grade in SLE patients medium change, according to our previous opti-
SLE group HC group
mized protocol. The main reagents used in the
experiment are shown in Table 2.
Cases 24 28
Age (years), M  SD 43.46  16.47 36.65  14.39 ELISA
Sex (female/male) 24/0 28/0
Disease duration (years) 3.9  3.3 After one week of culture, supernatants from all
SLEDAI groups were collected for assessment of inter-
4 4 (16.7%) 2.75  0.96 feron-gamma (IFN-g), interleukin (IL)-4, IL-6
5, 9 12 (50%) 7.17  1.53
10, 14 6 (25%) 11.33  1.21
and IL-10 by the antibody sandwich method
15 2 (8.3%) 18  2.83 based on the instructions of specific ELISA kits.
Nephritis
Cases Pathological class Quantitative real-time reverse transcription
Yes 20 (83.3%) I: 2 (8.3%) polymerase chain reaction
II: 4 (16.7%)
III: 7 (29.1%) Total RNA was extracted from T lymphocytes
IV: 4 (16.7%); derived above from blood samples by the TRIzol
V: 3 (12.5%)
VI: 0 (0%)
method. The PrimeScriptTM RT Reagent Kit with
No 4 (16.7%) gDNA Eraser (Takara, Dalian, China) was used
Current medication for reverse transcription of the cDNA of miR-
Glucocorticoid 15 (62.5%) 181a and U6 (synthetic miR-181a, U6 RT Primer)
Other treatment 23 (95.8%) and total cDNA according to the manufacturer’s
No treatment 1 (4.2%)
instructions. Then, cDNA was used to prepare
Lupus
 UC-MSCs significantly regulate T lymphocytes
B Zheng et al.
3

Table 2 Main reagents used in the experiment

Reagent Application Manufacturer

Anti-OPN Detection the protein levels of OPN, TNF-a and Cell Signaling Technology, Beverly, MA
Anti-TNF-a NF-kB by Western blot
Anti-NF-kB
Fetal bovine serum Cell culture Gibco, Grand Island, NY
RPMI 1640
Low-glucose DMEM
Naive Pan T Cell Isolation Kit human Isolation of T lymphocytes Miltenyi Biotec, Bergisch Gladbach, Germany
LS columns and MACS separators
IFN-g kit Detection the expression levels of IFN-g, IL-4, IL-6 4A Biotech, Beijing, PR China
IL-4 kit and IL-10 by ELISA
IL-6 kit
IL-10 kit

DMEM: Dulbecco’s modified Eagle’s medium; IFN: interferon; IL: interleukin; NF-kB: nuclear factor-kB; OPN: osteopontin; RPMI 1640:
Roswell Park Memorial Institute 1640.

Table 3 Related information of the detected genes and the primers used for reverse transcription and RT-qPCR
Primer Sequence (50 -30 ) Position Function

TNF-a F GCTGCACTTTGGAGTGATCG 4q22.1 Positive regulation of cell–substrate adhesion, inflammatory response;

TNF-a R GAGGGTTTGCTACAACATGGG cell adhesion, response to steroid hormone, extracellular matrix
disassembly, positive regulation of bone resorption, etc.
NF-KB-mRNA-F GAAGCACGAATGACAGAGGC 4q24 Negative regulation of cytokine production, inflammatory response,
NF-KB-mRNA-R GCTTGGCGGATTAGCTCTTTT cellular response to TNF, positive regulation of gene expression,
positive regulation of canonical Wnt signalling pathway, NIK/
NF-kB signalling, response to cytokine, negative regulation of
apoptotic process, cellular response to IL-1, cellular response to
IL-6, etc.
OPN-mRNA-F GCCGAGGTGATAGTGTGGTT 6p21.33 Activation of MAPKKK activity, positive regulation of chronic
OPN-mRNA-R ACGGCTGTCCCAATCAGAAG inflammatory response to antigenic stimulus, cell surface receptor
signalling pathway, positive regulation of I-kB kinase/NF-kB sig-
nalling, activation of MAPK activity, positive regulation of cytokine
production, TNF-mediated signalling pathway, positive regulation of
NF-kB transcription factor activity, regulation of I-kB kinase/NF-kB
signalling, positive regulation of JUN kinase activity, inflammatory
response, etc.
b-Actin F CTTCCAGCCTTCCTTCCTGG 7p22.1 Regulates cell proliferation, vesicle trafficking, and secretion; an inter-
b-Actin R TTCTGCATCCTGTCGGCAAT nal reference for detecting the protein level by Western blot, etc.
181a RT GTCGTATCCAGTGCAGGGTC 9q33.3 Regulating inflammatory response, promote the survival of osteoclasts,
CGAGGTATTCGCACTGGA inhibits proliferation and promotes apoptosis, inhibit the production
TACGACACTCACCG of Th1 cells, promote regulatory T-cell differentiation, decreased pro-
181a F GCATAACATTCAACGCTGTC duction of TNF-a, IL-6 and IL-1b, inhibiting TNF-a-induced tran-
181a R GTGCAGGGTCCGAGGT scription of proinflammatory genes, down-regulating TGF-b1, etc.
U6 RT AACGCTTCACGAATTTGCGT 15q23 An important role in RNA processing, an internal reference for detect-
U6 F CTCGCTTCGGCAGCACA ing the mRNA of microRNA level by PCR, etc.
U6 R AACGCTTCACGAATTTGCGT

the reaction system with TB GreenTM Premix Ex and quantitative real-time reverse transcription
TaqTM II (Takara) based on the manufacturer’s polymerase chain reaction (RT-qPCR) are shown
instructions. The mRNA levels of osteopontin in Table 3.
(OPN), nuclear factor-kappa B (NF-kB), TNF-a
and miR-181a were detected on a 7500 Real-Time Western blot
PCR System (Applied Biosystems, Foster City, T lymphocytes from each specimen were collected
CA). Data analysis was performed by the 2

Ct for protein extraction, and the protein concentra-
method. The related information of the detected tion was measured by the bicinchoninic acid pro-
genes and the primers used for reverse transcription tein assay reagent. Equal amounts of total protein
Lupus
 UC-MSCs significantly regulate T lymphocytes
B Zheng et al.
4

were loaded to sodium dodecyl sulphate-polyacry- the SLE þ UC-MSCs group (p < 0.05). Compared
lamide gel for electrophoresis and transferred onto with the HC group, the HC þ UC-MSCs group
polyvinyl difluoride membranes (Millipore, showed decreased IFN-g, IL4, IL6 and IL10
Kankakee, IL). The membranes were blocked levels in supernatants of T lymphocytes, but the
with Tris-buffered saline with Tween-20 solution differences were not significant (p > 0.05; Figure 2).
(TBST) containing 5% skim milk for 1 hour at The results of RT-qPCR showed that mRNA
room temperature, followed by incubation over- expression levels of TNF-a, NF-kB and OPN in
night at 4 C with primary antibodies: anti-TNF-a the SLE group were significantly higher than
(1:2000), anti-OPN (1:5000), anti-NF-kB (1:2000) those of the HC group, while miR-181a decreased
and anti-b-actin (1:2000). After washing three significantly (p < 0.008). However, compared with
times with TBST, the membranes were incubated the SLE group, the mRNA levels of TNF-a, NF-
with secondary antibodies (1:2000) for 1 hour at kB and OPN in the SLE þ UC-MSCs group
room temperature, followed by washing with decreased significantly, while miR-181a expression
TBST three times. Then, the membranes were was significantly increased (p < 0.008). Compared
placed on glass plates, and colour-developing solu- with the HC group, the NF-kB levels in T lympho-
tion was added. The data were acquired on a Bio- cytes decreased significantly in the HC þ UC-MSCs
Rad gel imaging system. group (P < 0.008). Although TNF-a and OPN
levels decreased, miR-181a expression increased in
Statistical analysis the HC þ UC-MSCs group compared with the HC
group. However, the differences were not signifi-
Comparative analysis was performed using IBM
cant (p > 0.008; Figure 3(a)–(d)).
SPSS Statistics v19.0 (IBM Corp., Armonk, NY).
The Western blot results showed that TNF-a,
Data are expressed as the mean  standard devi-
NF-kB and OPN protein levels in the SLE group
ation. Normally distributed variables were assessed
were significantly higher than those of the HC
by t-test (group pairs) or analysis of variance
group (p < 0.05). However, compared with the
(ANOVA; multiple groups). Pairwise comparison
SLE group, the SLE þ UC-MSCs group showed
used the LSD method if homogeneity of variance
significantly decreased protein levels of TNF-a,
was met after ANOVA; otherwise, Dunnett’s test
NF-kB and OPN (p < 0.05). Compared with the
was applied. A p-value of <0.05 was considered
HC group, the TNF-a, NF-kB and OPN protein
statistically significant. Comparisons among all
levels of T lymphocytes in the HC þ UC-MSCs
four groups and multiple pairwise comparisons
group decreased. However, the differences were
for PCR results were performed using the Mann–
not significant (p > 0.05; Figure 3(e)–(h)).
Whitney U-test in the rank sum test because the
On the other hand, the comparison of all indica-
data were not completely normally distributed. A
tors from T lymphocytes between SLE patients
p-value of <0.008 was considered statistically sig- according to whether they were active (flare;
nificant after adjusting the inspection level. SLEDAI score 10), medications used (treatment
with glucocorticoids or not), clinical presentation
(complicated nephritis or not), duration of illness
Results (more than two years or not). The results of ELISA
showed that IFN-g, IL-4 and IL-6 levels in the
UC-MSCs were adherent cells with a short fusiform supernatants of T lymphocytes in the active and
and polygonal shape in a spiral or woven arrange- complicated with nephritis groups were signifi-
ment (Figure 1(a)). T lymphocytes sorted by mag- cantly higher than those of the no active and no
netic beads were round and oval in shape with nephritis groups, while IL-10 levels were only sig-
equal size; the cells after proliferation were often nificantly higher in the active group (p < 0.05;
aggregated in clusters (Figure 1(b)). After cell Figure 4). The results of RT-qPCR showed that
counting, T lymphocytes in each specimen were TNF-a, NF-kB and OPN levels of T lymphocytes
co-cultured with UC-MSCs at a ratio of 5:1 in the active and complicated with nephritis groups
(Figure 1(c)). CD3 receptors on the cell surface were significantly higher than those of no active
were detected by flow cytometry, and >96% T and no nephritis groups (p < 0.05), while miR-
lymphocytes expressed CD3þ (Figure 1(d)). 181a decreased significantly (p < 0.008; Figure 5).
ELISA showed that IFN-g, IL4, IL6 and IL10 The results of Western blot showed that NF-kB
levels in the supernatants of T lymphocytes in the levels of T lymphocytes in the active and compli-
SLE group were significantly higher than those of cated with nephritis groups were significantly
the HC group, but they decreased significantly in higher than those of no active and no nephritis
Lupus
 UC-MSCs significantly regulate T lymphocytes
B Zheng et al.
5

Figure 1 (a) Morphological characteristics of umbilical cord mesenchymal stem cells (UC-MSCs). (b) Morphological character-
istics of T lymphocytes sorted by magnetic beads. (c) Co-culture of UC-MSCs and T lymphocytes (magnification, 200). (d) Flow
cytograms showing that T lymphocytes expressing CD3þ sorted by magnetic beads were >96%.

groups, while OPN and TNF-a levels were only Our previous study observed that UC-MSCs can
higher significantly in the active group (p < 0.05; significantly ameliorate proteinuria, renal immune
Figure 6). complex deposition and skin ulceration, improving
survival in MRL/lpr lupus mice.4
Type 1 T helper (Th1) cells mainly secrete cyto-
kines such as IFN-g and IL-2, mediating cellular
Discussion immunity. Th2 cells mainly secrete IL-4, IL-6 and
IL-10, mediating humoral immunity.13 Studies indi-
The aetiology and mechanism of SLE have not cated that IFN-g plays a key role in the activation
been fully elucidated. It was reported that T of T lymphocytes and natural killer cells as well as
lymphocyte dysfunction can initiate activation of B lymphocyte inhibition. IFN-g combined with
autoreactive B cells and results in excessive secre- other inflammatory factors can induce immunosup-
tion of inflammatory cytokines, leading to down- pressive properties in UC-MSCs.14 In this study,
stream inflammatory damage in target organs, the ELISA results indicate that UC-MSCs have sig-
which plays a key role in the pathogenesis of nificant regulatory effects on cellular and humoral
SLE.10,11 There is evidence that MSCs can exert a immunity in patients with SLE.
wide range of immunoregulatory effects on OPN is a newly discovered pro-inflammatory
immune-active cells such as T and B lymphocytes cytokine, which acts as a Th1-type cytokine in
in vitro and in vivo.12 Studies have found that allo- autoimmune and other inflammatory processes.
geneic MSC transplantation in lupus mice and SLE The cytokine activity of OPN involves stimulating
patients is a viable and safe treatment option.2,3 the migration of macrophages and T lymphocytes,
Lupus
 UC-MSCs significantly regulate T lymphocytes
B Zheng et al.
6

Figure 2 Interferon gamma (IFN-g), interleukin (IL)-4, IL-6 and IL-10 levels in culture supernatants of samples from each group.
Data are the mean  standard deviation (x  s). A p-value of <0.05 was considered statistically significant. *p < 0.05; **p < 0.01;
***p < 0.001.

Figure 3 (a) to (d) Relative TNF-a, nuclear factor-kappa B (NF-kB), osteopontin (OPN) and miR-181a mRNA levels in T
lymphocytes from each group. Data are the mean  standard deviation (x  s). A p-value of <0.008 was considered statistically
significant. *p < 0.008; **p < 0.001. (e) to (h) Protein expression levels of TNF-a, NF-kB and OPN in T lymphocytes from each
group. Data are the mean  standard deviation (x  s). A p-value of <0.05 indicated statistical significance. *p < 0.05; **p < 0.01;
***p < 0.001.

Lupus
 UC-MSCs significantly regulate T lymphocytes
B Zheng et al.
7

Figure 4 Comparison of IFN-g, IL-4, IL-6 and IL-10 levels in culture supernatants of samples between SLE patients according to
active (flare) or not, medications used, clinical presentation and duration of illness. Data are the mean  standard deviation (x  s).
A p-value of <0.05 indicated statistical significance. *p < 0.05; **p < 0.01; ***p < 0.001.

Figure 5 Comparison of mRNA levels of TNF-a, NF-kB, OPN and miR-181a from T lymphocytes between SLE patients
according to active or not, medications used, clinical presentation and duration of illness. Data are the mean  standard deviation
(x  s). A p-value of <0.008 was considered statistically significant. *p < 0.008; **p < 0.001.

as well as inducing cell-mediated autoimmune macrophages and T lymphocytes.16 TNF-a is the

responses.15 Our previous study found that OPN most significant inflammation-inducing factor and
expression increases significantly in lupus mice, is also a precursor of tissue damage.17 In all types
and decreases significantly after the transplantation of LN renal tissue, TNF-a is highly expressed in
of UC-MSCs, suggesting that one of the mechan- glomeruli, with the expression level being asso-
isms by which UC-MSCs affect SLE may be via ciated with the activity of the renal inflammatory
regulation of OPN4. TNF-a in humans is mainly lesions.18 In primary human T lymphocytes,
secreted and produced by mononuclear NF-kB is an important factor in the initiation of
Lupus
 UC-MSCs significantly regulate T lymphocytes
B Zheng et al.
8

Figure 6 Comparison of TNF-a, NF-kB and OPN protein levels in T lymphocytes between SLE patients according to active or
not, medications used, clinical presentation and duration of illness. Data are the mean  standard deviation (x  s). A p-value of
<0.05 indicated statistical significance. *p < 0.05; **p < 0.01; ***p < 0.001.

transcriptional responses of TCR expression and OPN, TNF-a and NF-kB in the T lymphocytes of
CD28 linkage as well as IL-2 up-regulation.19 It is SLE patients.
widely recognized that NF-kB plays a crucial role Recent studies have revealed the unique role of
in regulating various inflammatory markers, cyto- abnormal miRNA expression in the progression of
kines and chemokines.20,21 At present, it has been SLE, especially in LN.24 Mature miRNAs interact
confirmed that there is an abnormal increase in with the 30 -UTR end of a specific mRNA through a
NF-kB activity in SLE patients.22 Activation of complementary series, inhibiting the transcription
NF-kB would further promote downstream inflam- of target genes.25 MiR-181a inhibits proliferation
matory cytokines such as TNF-a, leading to tran- and promotes apoptosis in a variety of cells, and
scription and expression of pathogenic factors.23 is differentially expressed in various tissue cells.26
Moreover, cytokines in the TNF-a family can Ghorbani and colleagues27 reported that miR-
also activate the non-classical pathway of NF-kB.22 181a and miR-181b inhibit the production of Th1
Our experimental results showed that UC-MSCs cells and promote regulatory T-cell differentiation,
down-regulate inflammatory factors such as OPN, thus inhibiting inflammatory responses. Our study
TNF-a and NF-kB in T lymphocytes. This trend demonstrated that miR-181a expression was
was particularly evident in SLE patients. These decreased significantly in T lymphocytes from
results suggest that UC-MSCs may play a thera- SLE patients, suggesting that UC-MSCs exert
peutic effect in clinical practice by inhibition of therapeutic effects by increasing miR-181a level in
Lupus
 UC-MSCs significantly regulate T lymphocytes
B Zheng et al.
9

Table 4 The main finding of our study and previous studies examining miR-181a in SLE
Title Published journal Outcomes Published date

Expression signature of microRNA-181-a Clin Exp Rheumatol The expression level of miR-181a was significantly 2011
reveals its crucial role in the pathogenesis down-regulated in the peripheral blood of SLE
of paediatric systemic lupus erythematosus paediatrics compared with healthy controls and
negatively correlated with SLEDAI score.
Circulating microRNA expression profiles Arthritis Rheum The expression of miR-181a was increased in plasma 2013
associated with systemic lupus from patients with SLE.
erythematosus
MicroRNA-21, microRNA-181a and Chem Biol Interact The expression levels of miR-181a were significantly 2016
microRNA-196a as potential biomarkers increased in plasma of SLE patients compared
in adult Egyptian patients with systemic with healthy controls.
lupus erythematosus
Expression and clinical significance of Eur Rev Med SLE patients had significantly higher serum levels of 2017
miR-181a and miR-203 in systemic lupus Pharmacol Sci miR-181a, which was correlated with SLE
erythematosus patients activity.
Association of MTMR3 rs12537 at miR- Sci Rep Serum miR-181a expression levels were over- 2019
181a binding site with rheumatoid arthritis expressed in TT genotype of rs12537 carriers
and systemic lupus erythematosus risk in compared with CT, CC þ CT and CC genotypes.
Egyptian patients
a
Effects of human umbilical cord mesenchy- Lupus Our study showed that miR-181a expression was
mal stem cells on inflammatory factors decreased significantly in T lymphocytes from
and miR-181a in T lymphocytes from SLE patients. The T lymphocytes of SLE patients
patients with systemic lupus co-cultured with UC-MSCs increased miR-181a
erythematosus mRNA significantly, suggesting that UC-MSCs
exert therapeutic effects by increasing miR-181a
amounts in T lymphocytes.
a
Our own study results.

T lymphocytes. In recent years, some studies have patients who were treated with immunosuppressive
reported the relationship between miR-181a and agents or mild- and high-dose glucocorticoids
SLE.28–32 We summarize these research results (30 mg prednisone).
and our findings in Table 4. The study from Our study showed preliminary results in vitro,
Lashine and colleagues28 shows that miR-181a which cannot fully reflect the in vivo efficacy of
expression is significantly reduced in PBMCs of UC-MSCs in SLE and the impact on SLE-related
children with SLE and negatively correlated with factors. Obviously, we cannot conclude that the
SLEDAI score, which is similar to our findings. changes we observed were directly from lympho-
However, some studies have shown that the expres- cytes or UC-MSC in limited data. It could be pos-
sion levels of miR-181a are increased significantly sible that the co-culture modified or triggered
in serum or plasma from patients with SLE.29–32 differentiation in UC-MSC, which may have the
We speculate that miR-181a is differentially potential to affect co-cultured T lymphocytes and
expressed inside and outside immune cells, or feed- thus interfere with the final experimental results.
back increase of miR-181a in serum and plasma Further evidence is needed to explore this possibil-
from SLE patients. More research is needed to con- ity. We are yet to explain how miR-181a affects the
firm this argument further. expression of inflammatory factors, and their inter-
Meanwhile, our results showed that some inflam- actions remain not fully understood.
matory indicators were significantly increased in
SLE patients with disease activity and complicated
with nephritis, while miR-181a was significantly Conclusions
decreased. This suggests that the over-expression
of related inflammatory factors, pathway protein
and reduction of miR-181a may exert SLE disease In summary, the present experimental data demon-
activity and lead to kidney damage. However, the strate that UC-MSCs exert significant regulatory
differences seem to be absent between patients with effects on cellular and humoral immunity in the T
different disease durations and depending on lymphocytes of SLE patients. Though limited to
whether they were treated with glucocorticoids. in vitro results, UC-MSCs have showed a potential
We speculate this may be related to the fewer therapeutic pathway in SLE by down-regulating
number of patients enrolled and the exclusion of OPN, TNF-a and NF-kB and up-regulating

Lupus
 UC-MSCs significantly regulate T lymphocytes
B Zheng et al.
10

miR-181a in T lymphocytes. The intrinsic mechan- 11 Lewis JE, Fu SM, Gaskin F. Autoimmunity, end organ damage,
and the origin of autoantibodies and autoreactive T cells in sys-
isms of UC-MSCs in the treatment of SLE require temic lupus erythematosus. Discov Med 2013; 15: 85–92.
further investigation. 12 Deng W, Han Q, Liao L, You S, Deng H, Zhao RC. Effects of
allogeneic bone marrow-derived mesenchymal stem cells on T and
B lymphocytes from BXSB mice. DNA Cell Biol 2005; 24: 458–463.
13 Maggi E, Biswas P, Del Prete G, et al. Accumulation of Th-2-like
Declaration of conflicting interests helper T cells in the conjunctiva of patients with vernal conjunc-
tivitis. J Immunol 1991; 146: 1169–1174.
14 Krampera M, Cosmi L, Angeli R, et al. Role for interferon-gamma
The authors declared no potential conflicts of inter- in the immunomodulatory activity of human bone marrow mesen-
est with respect to the research, authorship and/or chymal stem cells. Stem Cells 2006; 24: 386–398.
publication of this article. 15 Gigante A, Amoroso D, Ferri F, et al. Systemic lupus erythema-
tosus and renal involvement: which role of citokines expression?
Eur Rev Med Pharmacol Sci 2006; 10: 223–228.
16 Borish L, Rosenwasser LJ. Update on cytokines. J Allergy Clin
Funding Immunol 1996; 97: 719–733; quiz 34.
17 Andreakos ET, Foxwell BM, Brennan FM, Maini RN, Feldmann
M. Cytokines and anti-cytokine biologicals in autoimmunity: pre-
The authors disclosed receipt of the following sent and future. Cytokine Growth Factor Rev 2002; 13: 299–313.
financial support for the research, authorship and/ 18 Herrera-Esparza R, Barbosa-Cisneros O, Villalobos-Hurtado R,
Avalos-Diaz E. Renal expression of IL-6 and TNFalpha genes in
or publication of this article: This work was lupus nephritis. Lupus 1998; 7: 154–158.
supported by the National Natural Science 19 McGuire KL, Iacobelli M. Involvement of Rel, Fos, and Jun pro-
Foundation of China (grant number 81660517). teins in binding activity to the IL-2 promoter CD28 response elem-
ent/AP-1 sequence in human T cells. J Immunol 1997; 159:
1319–1327.
20 Shannon MF, Himes SR, Coles LS. GM-CSF and IL-2 share
ORCID iD common control mechanisms in response to costimulatory signals
in T cells. J Leukoc Biol 1995; 57: 767–773.
21 Liu J, Zhu L, Xie GL, Bao JF, Yu Q. Let-7 miRNAs modulate the
D Deng https://orcid.org/0000-0001-5853-162X activation of NF-kappaB by targeting TNFAIP3 and are involved
in the pathogenesis of lupus nephritis. PLoS One 2015; 10:
e0121256.
22 Zubair A, Frieri M. NF-kappaB and systemic lupus erythemato-
References sus: examining the link. J Nephrol 2013; 26: 953–959.
23 Gottipati S, Rao NL, Fung-Leung WP. IRAK1: a critical signaling
mediator of innate immunity. Cell Signal 2008; 20: 269–276.
1 Rothfield N. Clinical aspects and treatment of systemic lupus ery- 24 Chen JQ, Papp G, Szodoray P, Zeher M. The role of microRNAs
thematosus. Curr Opin Rheumatol 1989; 1: 327–331. in the pathogenesis of autoimmune diseases. Autoimmun Rev 2016;
2 Liang J, Zhang H, Hua B, et al. Allogenic mesenchymal stem cells 15: 1171–1180.
transplantation in refractory systemic lupus erythematosus: a pilot 25 Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and
clinical study. Ann Rheum Dis 2010; 69: 1423–1429. function. Cell 2004; 116: 281–297.
3 Zhang H, Zeng X, Sun L. Allogenic bone-marrow-derived mesen- 26 Zou C, Chen J, Chen K, et al. Functional analysis of miR-181a and
chymal stem cells transplantation as a novel therapy for systemic Fas involved in hepatitis B virus-related hepatocellular carcinoma
lupus erythematosus. Exp Opin Biol Ther 2010; 10: 701–709. pathogenesis. Exp Cell Res 2015; 331: 352–361.
4 Yang J. Transplantation of human umbilical cord mesenchymal 27 Ghorbani S, Talebi F, Chan WF, et al. MicroRNA-181 variants
stem cell relieves the symptoms of lupus nephritis by inhibiting regulate T cell phenotype in the context of autoimmune neuroin-
osteopontin expression. Int J Clin Exp Med 2017; 10: 6586–6594. flammation. Front Immunol 2017; 8: 758.
5 Liossis SN, Sfikakis PP, Tsokos GC. Immune cell signaling aber- 28 Lashine YA, Seoudi AM, Salah S, Abdelaziz AI. Expression sig-
rations in human lupus. Immunol Res 1998; 18: 27–39. nature of microRNA-181-a reveals its crucial role in the pathogen-
6 Kasper IR, Apostolidis SA, Sharabi A, Tsokos GC. Empowering esis of paediatric systemic lupus erythematosus. Clin Exp
regulatory T cells in autoimmunity. Trends Mol Med 2016; 22: Rheumatol 2011; 29: 351–357.
784–797. 29 Carlsen AL, Schetter AJ, Nielsen CT, et al. Circulating microRNA
7 Gu Z, Tan W, Feng G, et al. Wnt/beta-catenin signaling mediates expression profiles associated with systemic lupus erythematosus.
the senescence of bone marrow-mesenchymal stem cells from sys- Arthritis Rheum 2013; 65: 1324–1334.
temic lupus erythematosus patients through the p53/p21 pathway. 30 Senousy MA, Helmy HS, Fathy N, Shaker OG, Ayeldeen GM.
Mol Cell Biochem 2014; 387: 27–37. Association of MTMR3 rs12537 at miR-181a binding site with
8 Yang X, Yang J, Li X, Ma W, Zou H. Bone marrow-derived mes- rheumatoid arthritis and systemic lupus erythematosus risk in
enchymal stem cells inhibit T follicular helper cell in lupus-prone Egyptian patients. Sci Rep 2019; 9: 12299.
mice. Lupus 2018; 27: 49–59. 31 Li HS, Ning Y, Li SB, et al. Expression and clinical significance of
9 Chen C, Liang J, Yao G, et al. Mesenchymal stem cells upregulate miR-181a and miR-203 in systemic lupus erythematosus patients.
Treg cells via sHLA-G in SLE patients. Int Immunopharmacol Eur Rev Med Pharmacol Sci 2017; 21: 4790–4796.
2017; 44: 234–241. 32 Motawi TK, Mohsen DA, El-Maraghy SA, Kortam MA.
10 Zhao H, Wang L, Luo H, Li QZ, Zuo X. TNFAIP3 downregula- MicroRNA-21, microRNA-181a and microRNA-196a as potential
tion mediated by histone modification contributes to T-cell dys- biomarkers in adult Egyptian patients with systemic lupus erythe-
function in systemic lupus erythematosus. Rheumatology (Oxford) matosus. Chem Biol Interact 2016; 260: 110–116.
2017; 56: 835–843.

Lupus