0% found this document useful (0 votes)
50 views7 pages

Mega Bioinformatics Internship Report

The document outlines a multi-day project focused on gene annotation, phylogenetics, molecular docking, and homology modeling related to the ACE2 protein and HER2 receptor. It includes specific details such as protein functions, nucleotide sequences, and experimental results from BLAST and molecular docking studies. Additionally, it provides a GitHub link for further reference and documentation of the project work.
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
50 views7 pages

Mega Bioinformatics Internship Report

The document outlines a multi-day project focused on gene annotation, phylogenetics, molecular docking, and homology modeling related to the ACE2 protein and HER2 receptor. It includes specific details such as protein functions, nucleotide sequences, and experimental results from BLAST and molecular docking studies. Additionally, it provides a GitHub link for further reference and documentation of the project work.
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 7

SUBMITTED BY:

SUDHANVA D DIXIT
Day 2:
Gene Annotation

Protein Name: angiotensin converting enzyme 2


Protein ID – NP_001376331.1

Find the following Gene function details


Location- Start and end, Family, Clan, Domain, Motif, E value and Description of function

Description of function – The ACE2 protein is encoded by ACE2 gene that belongs to the angiotensin-
converting enzyme family of dipeptidyl carboxydipeptidases. ACE2 catalyzes the cleavage of angiotensin I
into angiotensin 1-9, and angiotensin II into the vasodilator angiotensin 1-7. ACE2 plays a role in the
regulation of cardiovascular and renal function, as well as fertility. In addition, this protein is a functional
receptor for the spike glycoprotein of the human coronavirus HCoV-NL63 and the human severe acute
respiratory syndrome coronaviruses, SARS-CoV and SARS-CoV-2, the latter is the causative agent of
coronavirus disease-2019 (COVID-19).

Day 3: Phylogenetics

Construct a Phylogenetic tree for components of Corona virus.


You can choose any gene/protein/component associated with Corona virus for atleast 5 different
species/variants. Add the screenshot of the tree here.
ace2 receptor protein – Phylogenetic tree construction
Day 4:

Genome name( the one of your interest): AY274119.3 SARS coronavirus Tor2, complete genome

From RAST results:


Mention the desired nucleotide sequence that you choose to perform BLAST on and fill in the following:

1) Nucleotide sequence –

atgtctgataatggaccccaatcaaaccaacgtagtgccccccgcattacatttggtggacccacagattcaactgacaataaccagaatg
gaggacgcaatggggcaaggccaaaacagcgccgaccccaaggtttacccaataatactgcgtcttggttcacagctctcactcagcatg
gcaaggaggaacttagattccctcgaggccagggcgttccaatcaacaccaatagtggtccagatgaccaaattggctactaccgaagag
ctacccgacgagttcgtggtggtgacggcaaaatgaaagagctcagccccagatggtacttctattacctaggaactggcccagaagcttc
acttccctacggcgctaacaaagaaggcatcgtatgggttgcaactgagggagccttgaatacacccaaagaccacattggcacccgca
atcctaataacaatgctgccaccgtgctacaacttcctcaaggaacaacattgccaaaaggcttctacgcagagggaagcagaggcggc
agtcaagcctcttctcgctcctcatcacgtagtcgcggtaattcaagaaattcaactcctggcagcagtaggggaaattctcctgctcgaatgg
ctagcggaggtggtgaaactgccctcgcgctattgctgctagacagattgaaccagcttgagagcaaagtttctggtaaaggccaacaaca
acaaggccaaactgtcactaagaaatctgctgctgaggcatctaaaaagcctcgccaaaaacgtactgccacaaaacagtacaacgtca
ctcaagcatttgggagacgtggtccagaacaaacccaaggaaatttcggggaccaagacctaatcagacaaggaactgattacaaacat
tggccgcaaattgcacaatttgctccaagtgcctctgcattctttggaatgtcacgcattggcatggaagtcacaccttcgggaacatggctga
cttatcatggagccattaaattggatgacaaagatccacaattcaaagacaacgtcatactgctgaacaagcacattgacgcatacaaaac
attcccaccaacagagcctaaaaaggacaaaaagaaaaagactgatgaagctcagcctttgccgcagagacaaaagaagcagccca
ctgtgactcttcttcctgcggctgacatggatgatttctccagacaacttcaaaattccatgagtggagcttctgctgattcaactcaggcataa

2) Location on the genome - AY274119.3_28120_29388


3) Start and end nucleotide – Start: 28120, End: 29388
4) Function - hypothetical protein

Perform a BLAST on the nucleotide sequence and paste a screenshot of the obtained BLAST
results:
DESCRIPTIONS:

GRAPHIC SUMMARY
ALIGNMENTS

TAXONOMY
Day 5 & 6:

Molecular Docking
Protein Name: Human HER2 (erbB2)
Protein ID – 3PP0

Ligand Name Ligand ID Follows Energy Dock Image


Lipinski value
Rule?

216326 Yes – 7.7


Lenalidomide

Palbociclib 5330286 Yes – 8.2

Ibrutinib Yes –8
24821094
Day 7: Heat Map Generation

Day 8 & 9: Homology Modelling:


You can choose any protein which is involved in any Pathogenesis pathway or cancer (Eg: ACE2 receptor,
Any protein) and can take at least 2 homologous sequences with sequence similarity >30%. Try to develop
an hypothesis around it (Like Why you want to use Homology modelling for your protein of interest,
Purpose and outcome of it) and more importantly how it is going to add value to your hypothesis.

Problem statement: Develop a precise homology modelling approach to visualize and predict the 3D
structure of HER2 receptor and to investigate the therapeutic actions of Drug X.

Protein: Receptor tyrosine-protein kinase erbB-2


Gene: HER2
PDB: P04626 (First Isoform)

Target Sequence Result

Day 10:

Please paste your GitHub account link:


https://github.com/SudhanvaDD

You might also like