3 Biotech (2012) 2:241–247

DOI 10.1007/s13205-012-0052-x

ORIGINAL ARTICLE

Marker-assisted sex differentiation in date palm using simple

sequence repeats
Khaled Elmeer • Imene Mattat

Received: 5 January 2012 / Accepted: 21 February 2012 / Published online: 6 March 2012
Ó The Author(s) 2012. This article is published with open access at Springerlink.com

Abstract Microsatellite markers containing simple Keywords Phoenix dactylifera  Sex identification 
sequence repeats (SSRs) are a valuable tool for genetic Sex marker  SSR  Microsatellite
analysis. Our objective was to identify microsatellite
markers that could be used to differentiate between male
and female date palm (Phoenix dactylifera). The date palm Introduction
is a dioecious plant whose sex cannot be determined until it
reaches a reproductive age between 5 and 10 years. An Palms (Arecaceae) are a particularly interesting family for
early selection and/or differentiation of young seedlings the study of dicliny (separate male and female trees), as they
into males and females could enhance breeding and assist display great diversity in their reproductive morphology,
research programs for genetic improvements of the date with more than 85% of the palm genera having single sex
palm. Here, we report on the use of microsatellites for flowers (Dransfield et al. 2008). Historically, breeding
determining the sex of immature date palm. Using 14 programs to maintain genetic diversity have not been
microsatellite primer pairs with 129 date palm leaves and employed because there is no easy and accurate way to
tissue culture samples from 34 cultivars which represent distinguish between male and female plants prior to first
the major date palm diversity of Qatar, 254 microsatellite flowering, which occurs between 5 and 8 years after
loci were detected, of these, 22 microsatellite loci could be planting (Aberlenc-Bertossi et al. 2011; Bendiab et al.
used to identify 9 out of 12 male date palm samples (75%). 1993). Date palm progenies consist of male and female
The data also indicated that the heterozygous allele with individuals in equal proportions, which has led to the
the size 160/190 produced by the primer mPdCIR048 hypothesis that sex is determined genetically (Daher et al.
reoccurred 4 times exclusively in the 12 individual male 2010). Based on cytological studies with chromomycin
samples but not in any of the 117 female date palm samples staining, Siljak-Yakovlev et al. (1996) proposed the exis-
tested, and hence it is a promising candidate marker to tence of sex chromosomes in the date palm. However,
detect male sex in date palm. Principal coordinate analysis neither the gene associated with sex determination has been
(PCoA) of 12 male samples with 7 female Khasab cultivars reported to date nor has the process of developmental arrest
produced 2 autonomous groups of males and females and in sterile sex organs been studied in detail. Siljak-Yakovlev
similar results were observed with 13 female Shishi culti- et al. (1996) also illustrate two other important points in
vars. Our results suggest that the SSR markers described understanding sex determination in dioecious species of
here have potential in sex identification of date palm. plants. First, there are often no obvious cytological or
genetic differences between male and female plants, and,
second, it is often difficult to study the genetic or molecular
basis of sex determination in many species of monoecious
or dioecious, agronomically important plants simply
K. Elmeer (&)  I. Mattat
because of their longevity.
Genetic Engineering Department, Biotechnology Centre,
Doha, Qatar A severe fusarium wilt of date palm, Fusarium oxy-
e-mail: [email protected] sporum, recently destroyed date palms throughout Africa.

123
242 3 Biotech (2012) 2:241–247

The problem was exacerbated by the lack of natural genetic Table 1 Cultivars and tissue culture samples of date palm (Phoenix
diversity in date palm populations, which may be over- dactylifer) from Qatar used in this study
come by introducing genetic variability into populations Cultivar Location Tissue culture
(especially for traits which confer disease resistance).
North East West South
The ability to type the sex of seedlings would speed this
otherwise lengthy process (Juarez and Banks 1998). Khalas 7 5 2 3 1
In recent years, there have been serious efforts to Shishi 2 5 2 3 1
understand the basis of sex determination in date palm and Barhi 2 3 1 3 1
to develop methods of identifying the gender at an early Khnaizi 1 4 2 3 1
stage using isozymes (Torres and Tisserat 1980), per- Hillali 1 3 2 1 1
oxydases (Majourhat et al. 2002), and molecular marker Khasab 1 3 1 2 0
tools using random amplified polymorphic DNA (RAPD) Gar 2 2 0 0 1
(Moghaieb et al. 2010). Jabri 1 1 1 0 1
In this paper, we have attempted to identify sex-specific Lulu 0 2 2 0 0
DNA markers for date palm cultivars using a microsatellite Rzaiz 0 0 0 3 1
molecular technique. Such a technique would not only Nabetseaf 1 1 1 0 0
facilitate the identification and selection of good male Shahil 1 0 1 1 0
pollinators for use in breeding programs but could also be Shabishi 0 1 2 0 0
used to select date palm with characteristics of high fruit Sukari 0 1 1 1 0
yield, and an improved physical and chemical character- Iraqi 0 0 1 1 0
istic of the fruits. Deqlah 0 0 0 1 0
Gher 0 1 0 0 0
Marzban 1 0 0 0 0
Materials and methods Tanazel 0 0 1 0 0
Abumaan 0 0 0 0 1
Plant material Farthabaid 0 0 0 0 1
Zamli 0 0 0 0 1
Leaves and tissue culture samples from 117 female and 12 Kathrawi 0 0 0 0 1
male date palms, comprising 34 cultivars, were collected JeshRamli 0 0 0 0 1
from different locations in Qatar (Table 1). These cultivars Nawader 0 0 0 0 1
represent the diversity of date palm genotypes in the Qatari Hiri 0 0 0 0 1
date palm plantation. Young leaves from mature trees, Madayen 0 0 0 0 1
randomly sampled, were collected and stored at -80 °C Namshi 0 0 0 0 1
until DNA extraction. Ghanami 0 0 0 0 1
UmDehan 0 0 0 0 1
DNA extraction Madjoul 0 0 0 0 1
Saaqi 0 0 0 0 1
The frozen young leaf tissues were cleaned carefully with FemaleR 0 0 1 0 0
distilled water to remove the waxy layer and then 1 g of FemaleY 0 0 1 0 0
each leaf sample was cut into small pieces and grounded Male 0 4 5 3 0
using liquid nitrogen into a fine powder. The DNA was A total of 129 date palm samples representing 34 cultivars were
extracted using the DNeasy Plant Maxi kit protocol collected
(QIAGEN), following the manufacturer’s instructions
outlined in the DNeasy Plant Handbook. The DNA samples Microsatellite amplification
obtained were quantified using NanoDropÒ ND 1000
Spectrophotometer (Thermo Fisher Scientific) and the Fourteen labeled primer pairs as described by Billotte et al.
quality was determined by electrophoresis of DNA samples (2004) were synthesized by Applied Biosystems (Belgium,
(2 lL) loaded on 0.85% agarose gels and separated at Life Technologies Europe BV) and are presented in
100 V for 30 min, following which the gel was stained Table 2. A polymerase chain reaction (PCR) was per-
with ethidium bromide and viewed under UV formed using 25 lL of a reaction mixture containing 2 lL
transilluminator. (5 ng) of total genomic DNA, 12.5 lL of AmpliTaq GoldÒ

123
3 Biotech (2012) 2:241–247 243

Table 2 Forward and reverse

No. Primer code Repeat motif Primer sequences (50 –30 ) Optimal Tm ( °C)
microsatellite primers and their
Tm used in this study (Billotte 1 mPdCIR010 (GA)22 F: ACCCCGGACGTGAGGTG 55.9
et al. 2004)
R: CGTCGATCTCCTCCTTTGTCTC
2 mPdCIR015 (GA)15 F: AGCTGGCTCCTCCCTTCTTA 51.6
R: GCTCGGTTGGACTTGTTCT
3 mPdCIR016 (GA)14 F: AGCGGGAAATGAAAAGGTAT 51.7
R: ATGAAAACGTGCCAAATGTC
4 mPdCIR025 (GA)22 F: GCACGAGAAGGCTTATAGT 49.3
R: CCCCTCATTAGGATTCTAC
5 mPdCIR032 (GA)19 F: CAAATCTTTGCCGTGAG 51.5
R: GGTGTGGAGTAATCATGTAGTAG
6 mPdCIR035 (GA)15 F: ACAAACGGCGATGGGATTAC 53.9
R: CCGCAGCTCACCTCTTCTAT
7 mPdCIR044 (GA)19 F: ATGCGGACTACACTATTCTAC 51.7
R: GGTGATTGACTTTCTTTGAG
8 mPdCIR048 (GA)32 F: CGAGACCTACCTTCAACAAA 51.4
R: CCACCAACCAAATCAAACAC
9 mPdCIR057 (GA)20 F: AAGCAGCAGCCCTTCCGTAG 55.4
R: GTTCTCACTCGCCCAAAAATAC
10 mPdCIR070 (GA)17 F: CAAGACCCAAGGCTAAC 48.7
R: GGAGGTGGCTTTGTAGTAT
11 mPdCIR078 (GA)13 F: TGGATTTCCATTGTGAG 49.6
R: CCCGAAGAGACGCTATT
12 mPdCIR085 (GA)29 F: GAGAGAGGGTGGTGTTATT 50.4
R: TTCATCCAGAACCACAGTA
13 mPdCIR090 (GA)26 F: GCAGTCAGTCCCTCATA 48.6
F: GCAGTCAGTCCCTCATA
14 mPdCIR093 (GA)16 F: CCATTTATCATTCCCTCTCTTG 51.8
R: CTTGGTAGCTGCGTTTCTTG

360 Mastermix (Applied Biosystems), 1 lL (5 pmol/lL) of Data analysis

forward primer (labeled), and 1 lL of reverse primer in
addition to 8.5 lL of nuclease free water. Amplification The data were analyzed with PowerMarker software v3.0
was carried out in a Veriti 96 Well Fast Thermal cycler (Liu and Muse 2005) to determine the percentage of het-
(Applied Biosystems) under the following conditions: ini- erozygosity, major allele frequency, number of alleles,
tial denaturation at 95 °C for 10 min, 35 cycles (denatur- gene diversity, and polymorphic information content (PIC).
ation at 95 °C for 30 s, annealing temperature depending The principal coordinate analysis (PCoA) of the male
on primer for 30 s, and extension at 72 °C for 1 min), and date palm with Shishi and Khasab cultivars was analyzed
final extension at 72 °C for 7 min. and drawn using PAST software v1.91 (Hammer et al.
2001) based on the Hamming distance measures by convex
SSR fragment analysis hulls.

Simple sequence repeats (SSRs) were screened on a 3130

Genetic Analyzer (Applied Biosystems) by running 1 lL Results and discussion
of PCR product mixed with 10 lL Hi-Di formamide and
0.3 lL GS500LIZ followed by denaturation at 95 °C for The microsatellites examined were highly polymorphic,
3 min. The sample was then kept on ice for genotyping in a possessing a great number of alleles. A total of 124 alleles
3130 Genetic Analyzer. Automatic genotyping and allele with a mean of 8.86 alleles per locus were scored, however,
scoring were performed by the GeneMapperÒ software the number of alleles varied from 3 using primer mPd-
v4.0 (Applied Biosystems). CIR090 to 13 using primers mPdCIR010 and mPdCIR078

123
244 3 Biotech (2012) 2:241–247

Table 3 Genetic diversity information by locus

Primer code Allelic range Major allele Genotype no. Allele no. Gene Heterozygosity PIC
frequency diversity

mPdCIR010 120–162 0.29 31.00 13.00 0.83 0.95 0.81

mPdCIR015 120–140 0.17 36.00 11.00 0.88 0.89 0.87
mPdCIR016 130–138 0.47 12.00 5.00 0.68 0.55 0.64
mPdCIR025 199–231 0.65 12.00 8.00 0.52 0.45 0.47
mPdCIR032 288–302 0.47 17.00 8.00 0.71 0.78 0.67
mPdCIR035 181–199 0.41 15.00 8.00 0.70 0.74 0.64
mPdCIR044 288–302 0.39 13.00 7.00 0.71 0.10 0.67
mPdCIR048 160–192 0.42 16.00 10.00 0.70 0.39 0.65
mPdCIR057 256–270 0.66 9.00 6.00 0.51 0.48 0.46
mPdCIR070 182–206 0.38 16.00 11.00 0.73 0.58 0.69
mPdCIR078 118–152 0.21 31.00 13.00 0.86 0.60 0.85
mPdCIR085 160–182 0.25 26.00 9.00 0.83 0.90 0.81
mPdCIR090 144–158 0.52 3.00 3.00 0.62 0.00 0.55
mPdCIR093 153–183 0.42 17.00 12.00 0.51 0.44 0.47
Mean 0.47 18.14 8.86 0.70 0.56 0.66
PIC polymorphic information content

(Table 3). The number of alleles per locus detected in this developmental (Ainsworth et al. 1998) as well as evolution
study was higher than those scored by Zehdi et al. (2004) pathways of dimorphism (Charlesworth and Charlesworth
who recognized 7.14 alleles per locus when examining 46 1978; Charlesworth 1996).
Tunisian date palm accessions using 14 microsatellite loci. Three primers (mPdCIR035, mPdCIR044, and mPd-
On the other hand, Elshibli and Korpelainen (2007) iden- CIR090) could not distinguish between male and female
tified 21.4 alleles per locus, which is more than the number samples (Table 4) whereas the remaining 11 microsatellite
of alleles per locus detected in this study. This may be a primers identified 22 loci, in only the male date palm
result of using a greater number of microsatellite loci (16) samples. Using these loci, 9 of 12 (75%) male plants tested
in addition to using different genotypes—68 Sudan and were recognized. Moreover, 82% of those loci were het-
Morocco date palm accessions. erozygous alleles (Table 4), which is in agreement with the
The 14 primers used in this study successfully produced finding of Al-Dous et al. (2011) who scanned 3.5 million
clear amplified SSR bands with sizes ranging from 118 bp SNP genotypes in the male and female genomes of date
with primer mPdCIR078 to 302 bp with primers mPd- palm to identify polymorphisms that segregate with gender.
CIR044 and mPdCIR032 (Table 3), similar to the results of They observed that all male genomes shared mainly the
Ahmed and Al-Qaradawi (2009) where the band sizes same heterozygous genotypes, whereas female genomes
ranged from 100 to 300 bp. shared mainly the same homozygous genotypes, while
Interestingly, the 14 microsatellite primers used with the primer mPdCIR010 detected only one heterozygous allele
117 female and 12 male date palm samples used in this even as the remaining three alleles were homozygous
study formed 254 microsatellite loci with a mean of 10.4 (Table 4). Sexually antagonistic polymorphisms are poly-
per primer (Table 3). The highest was 36 different micro- morphisms in which the allele is advantageous to one sex
satellite loci scored with primer mPdCIR015, but only 3 but is deleterious to the other sex. In an influential paper,
different microsatellite loci were scored with primer Rice (1984) hypothesized that such polymorphisms should
mPdCIR090. be relatively common on the X chromosome (or on the W
In a number of agriculturally important plants, such as in female-heterogametic species) but relatively rare on the
kiwi fruit, date palm, hops, papaya, and pistachio, the autosomes. Yet, Fry (2010) showed that there are plausible
females produce the commercial harvest, while in some assumptions under which the reverse is expected to be true,
others, such as asparagus, males provide the better quality and pointed out studies that gave evidence for sexually
produce. Identification of the sex of such plants at their antagonistic variation on the autosomes. Although more
early stage of growth can be of great economic potential. work is needed to resolve the issue, it is premature to
Moreover, studies on marker technology regarding dioecy conclude that the X chromosome is a ‘‘hot spot’’ for the
in general would provide a better understanding of the accumulation of sexually antagonistic variation.

123
3 Biotech (2012) 2:241–247 245

Table 4 Twenty two loci hetero and homozygous allele (base pairs) markers that identify male date palm trees
Locus code Male 1 Male 2 Male 4 Male 5 Male 6 Male 8 Male 10 Male 11 Male 12

mPdCIR010 126/128 – – – 144/144 – – 122/122 134/134

mPdCIR015 – – 124/126 – 130/134 – – – 128/134
mPdCIR016 – – – – – – – – 130/134
mPdCIR025 – – – 213/229 – – – – –
mPdCIR032 – – 290/294 – 294/298 300/300 – – –
mPdCIR048 – 160/190 160/190 – – 160/184 160/192 160/190 160/190
mPdCIR057 – – – – – – – – 260/266
mPdCIR070 – – – – – – – 198/204 –
mPdCIR078 – 122/140 – – – – 122/140 – 134/142
mPdCIR085 – – – – 160/162 – – – –
mPdCIR093 – 163/175 – – 169/175 163/175 – – –
Primers with code mPdCIR035, mPdCIR044, and mPdCIR090 could not differentiate male and female date palm samples due to no amplification
of distinguished markers in male plants therefore have been excluded from the table. For males 3, 7, and 9, no distinguished loci were detected
and hence these samples have been excluded from the table

For male 12, 6 markers were detected while just one the 12 individual male date palm trees tested. At the same
specific marker was detected for male 1. However, for time, no sign of this marker was detected in 117 individual
males 3, 7, and 9, no markers were detected (Table 4). female date palm trees. The two following alleles sized
Male associated DNA fragments have previously been 122/140 (exhibited by the primer mPdCIR078) and
identified by random amplification of polymorphic DNA 163/175 (exhibited by the primer mPdCIR093), respec-
(RAPD) in many dioecious plants. Sakamoto et al. (1995) tively, were repeated twice in the 12 individual male date
cloned a 730 bp long DNA fragment named MADCl (male palm tree tested. Again, there was no sign of these alleles in
associated DNA sequence) in Cannabis sativa. However, the 117 individual female date palm trees.
MADC1 does not include a long ORF and is not likely to The data obtained from the 14 primers combinations
correspond to a transcribed gene (Sakamoto et al. 1995). enabled the samples of the two date palm cultivars Shishi and
Using representational difference analysis, several male Khasab to be classified into the two groups according to their
sex-specific restriction fragments in Silene latifolia have sex expression compared with male trees using principal
been isolated and cloned. These male-specific restriction coordinate analysis (PCoA) (Gower 1966) using the PAST
fragments were found to be homologous to other sequences software v1.91 (Hammer et al. 2001). The Hamming dis-
shared between male and female plants (Domison et al. tance was chosen in preference to other distance measures, as
1996). it does not class a common absence of an allele as a shared
The mean of the gene diversity was 0.70 (Table 3), characteristic. It was, therefore, judged to be most appro-
ranging from 0.51 for loci mPdCIR057 and mPdCIR093 to priate for the present study, which included highly poly-
high diversity 0.88 for locus mPdCIR015, indicating that morphic microsatellite data spanning two ploidy levels.
the Qatari date palm collection is characterized by a high PCoA suggests two broad groups—one includes 7
degree of genetic diversity. This level of gene diversity is female Khasab trees (Fig. 1) while the other is made up of
similar to 0.70 reported for the Tunisian date palm germ- 12 male date palm trees which are autonomous with 21%
plasm (Zehdi et al. 2004) and less than 0.853 reported for of the variation explained by the first axis and 17% by the
the Sudanese date palm (Elshibli and Korpelainen 2007). second axis. The same two groups separate 13 female
This high level of diversity is expected because of the Shishi trees from the 12 male date palm trees (Fig. 2).
unique mechanism responsible for generating SSR allelic There is a limited overlap between the two groups. Twenty
diversity by replication slippage. Replication slippage is percent of the variation is explained by the first axis while
thought to occur more frequently than single nucleotide 13% of the variation is explained by the second axis.
mutations and insertion/deletion events, which generate the Farmers are currently faced with distinguishing between
polymorphisms detected by RAPD analysis (Powell et al. cultivars propagated by seeds. The use of vegetative and
1996). flowering characteristics (Rhouma 1994) or the isozyme
The heterozygous allele sized 160/190 exhibited by markers (Mohamed Ould et al. 2001) are less rewarding,
primer mPdCIR048 (Table 4) seems to be a distinguishing since these traits take a long time—between 5 and
marker for sex in date palm because it appeared 4 times in 7 years—to become visible. Fortunately, the SSR alleles

123
246 3 Biotech (2012) 2:241–247

(ICARDA), under the scheme of Development of Sustainable Date

0.32 Palm Production Systems in the GCC Countries of the Arabian
Peninsula.
0.24
Open Access This article is distributed under the terms of the
0.16
Creative Commons Attribution License which permits any use, dis-
0.08 tribution, and reproduction in any medium, provided the original
Coordinate 2

author(s) and the source are credited.

0

-0.08

-0.16
References
-0.24

-0.32 Aberlenc-Bertossi F, Daher A, Chabrillange N, Tregear JW, Moham-

ed N (2011) Sex determination in date palm: new perspectives
-0.4
on an old theme. Plant and animal genomes XIX conference,
-0.3 -0.24 -0.18 -0.12 -0.06 0 0.06 0.12 0.18 0.24
W519: sex chromosomes and sex determination, January 15–19,
Coordinate 1 2011. Town and Country Convention Center, San Diego, CA
Ahmed TA, Al-Qaradawi A (2009) Molecular phylogeny of Qatari
Fig. 1 Scatter plot of the first and second principal coordinate date palm genotypes using simple sequence repeats markers.
analysis (PCoA) of 7 female Khasab cultivars (blue) and 12 male date Biotechnology 8:126–131
palms (red) using Hamming distance measures on convex hulls based Ainsworth C, Parker J, Buchanan-Wollaston V (1998) Sex determi-
on the SSR obtained for the 14 primer combinations nation of plants. Curr Top Dev Biol 38:167–223
Al-Dous EK, George B, Al-Mahmoud ME, Al-Jaber MY, Wang H,
Salameh YM, Al-Azwani EK, Chaluvadi S, Pontaroli AC,
0.5 DeBarry J, Arondel V, Ohlrogge J, Saie IJ, Suliman-Elmeer KM,
Bennetzen JL, Kruegger RR, Malek JA (2011) De novo genome
0.4
sequencing and comparative genomics of date palm (Phoenix
0.3 dactylifera). Nat biotechnol 29:521–528
Bendiab K, Baaziz M, Brakez Z, My Sedra H (1993) Correlation of
0.2 isoenzyme polymorphism and Bayoud-disease resistance in date
Coordinate 2

palm cultivars and progeny. Euphytica 65:23–32

0.1 Billotte N, Marseillac N, Brottier P, Noyer JL, Jacquemoud-Collet JP
et al (2004) Nuclear microsatellite marker for date palm
0
(Phoenix dactylifera): characterization and utility across the
-0.1 genus Phoenix and in other palm genera. Mol Ecol Notes
4:256–258
-0.2 Booij L, Montfort S, Ferry M (1995) Characterization of thirteen date
palm (Phoenix dactylifera L.) cultivars by enzyme electropho-
-0.3 resis using the PhastSystem. J Plant Physiol 145:62–66
Charlesworth B (1996) The evolution of chromosomal sex determi-
-0.4 nation and dosage compensation. Curr Biol 6:149–162
-0.48 -0.4 -0.32 -0.24 -0.16 -0.08 0 0.08 0.16 0.24 Charlesworth B, Charlesworth D (1978) A model for the evolution of
Coordinate 1 dioecy and gynodioecy. Am. Nature 112:975–997
Daher A, Adam H, Chabrillange N, Collin M, Mohamed N, Tregear
Fig. 2 Scatter plot of the first and second principal coordinate JW, Aberlenc-Bertossi F (2010) Cell cycle arrest characterizes
analysis (PCoA) of 13 female Shishi cultivars (blue) and 12 male date the transition from a bisexual floral bud to a unisexual flower in
palms (red) using Hamming distance measures on convex hulls based Phoenix dactylifera. Ann Bot 106:255–266
on the SSR obtained for 14 primer combinations Domison IS, Siroky J, Vyskot B, Saedler H, Grant S (1996) Isolation
of Y chromosome-specific sequences from Silene latifolia and
mapping of the male sex determining genes using representa-
revealed were successfully used to molecularly discrimi- tional difference analysis. Genetics 144:1893–1901
nate between a nearly unlimited number of date palm Dransfield J, Uhl MW, Amussen CB, Baker WJ, Harley M, Lewis CL
(2008) Genera Palmarum: the evolution and classification of
cultivars. Compared to other reported date palm studies,
palms. Kew Publishing, London
the outcome in this study is more accurate than that Elshibli S, Korpelainen H (2007) Microsatellite markers reveal high
observed using isoenzymes (Booij et al. 1995; Mohamed genetic diversity in date palm (Phoenix dactylifera L.) germ-
Ould et al. 2001) and plastid DNA haplotypes (Sakka plasm from Sudan. Genetica 134:251–260
Fry JD (2010) The genomic location of sexually antagonistic
2003). Our data provide evidence that these powerful
variation: some cautionary comments. Evolution 64:1510–1516
markers can be used as key identifiers of the sex in date Gower JC (1966) Some distance properties of latent root and vector
palm materials. methods used in multivariate analysis. Biometrika 53:325–338
Hammer Z, Harper DAT, Ryan PD (2001) PAST: Paleontological
Acknowledgments This work was supported by the grant from The statistics software package for education and data analysis.
International Center for Agricultural Research in the Dry Areas Palaeontologia Electronica 4(1):9

123
3 Biotech (2012) 2:241–247 247

Juarez C, Banks J-A (1998) Sex determination in plants. Curr Opin Rhouma A (1994) Le palmier dattier en Tunisie. I: le patrimoine
Plant Biol 1:68–72 génétique. Arabesque, Tunis, Tunisie
Liu K, Muse SV (2005) PowerMarker: an integrated analysis Rice WR (1984) Sex-chromosomes and the evolution of sexual
environment for genetic marker analysis. Bioinformatics dimorphism. Evolution 38:735–742
21(9):2128–2129 Sakamoto K, Shmomura K, Komeda Y, Kamada H, Satoh S (1995) A
Majourhat K, Bendiab K, Medraoui L, Baaziz M (2002) Diversity of male associated DNA sequence in a dioecious plant, Cannabis
leaf peroxidases in date palm (Phoenix dactylifera L.) as sativa L. Plant Cell Physiol. 36(1549):1554
revealed in an example of marginal (seedling derived) palm Sakka H (2003) Analyse de la diversité génétique chez le palmier
groves. Sci Hortic 95:31–38 dattier (Phoenix dactylifera L.): polymorphisme de l’ADN
Moghaieb REA, Abdel-Hadi AA, Ahmed MRA, Hassan AGM (2010) chloroplastique. PhD thesis, Université de Tunis El Manar,
Genetic diversity and sex determination in date palms (Phoenix Faculté de Science, Tunis, Tunisie
dactylifera L.) based on DNA markers. Arab J Biotech Siljak-Yakovlev S, Benmalek S, Cerbah M, Coba de la Peña T,
13:143–156 Bounaga N, Brown S, Sarr A (1996) Chromosomal sex
Mohamed Ould, Salem A, Trifi M, Sakka H, Rhouma A, Marrakchi determination and heterochromatin structure in date palm. Sex
M (2001) Genetic inheritance analysis of four enzymes in date Plant Reprod 9:127–132
palm (Phoenix dactylifera L.). Genet Resour Crop Evol Torres AM, Tisserat B (1980) Leaf isozymes as genetic marker in
48:361–368 date palm. Amer J Bot 67:162–167
Powell W, Morgante MAC, Hanafey M, Vogel J, Tingey S, Rafalski Zehdi S, Trifi M, Billotte N, Marrakchi M, Pintaud JC (2004) Genetic
A (1996) The comparison of RFLP, RAPD, AFLP, and SSR diversity of Tunisian date palms (Phoenix dactylifera L.)
(microsatellite) markers for germplasm analysis. Mol Breeding revealed by nuclear microsatellite polymorphism. Hereditas
2:225–238 141:278–287

123