TEST-03

MULTIPLE CHOICE QUESTION

1. An element  l = xiˆ is placed at the origin and
carries a large current l = 10 A . The magnetic field
on the y-axis at a distance of 0.5 m from the
element x of 1 cm length is:

(Neglect the effect of earth’s magnetic field

(1) 4 3  10−4 T (2) 4 3  10−5 T
(3) 3  10−4 T (4) 3 3  10−5 T

4. A circular loop of radius r is carrying current iA.

The ratio of magnetic field at the centre of circular
(1) 4 10−8 T (2) 8 10−8 T
loop and at a distance r from the center of the loop
(3) 12 10−8 T (4) 10 10−8 T on its axis is:
(1) 1: 3 2 (2) 3 2:2
2. Find the magnetic field at the point P in figure. The
curved portion is a semicircle connected to two (3) 2 2:1 (4) 1: 2
long straight wires.
5. Match list-I with List-II
(1) Both Assertion and Reason are true, and
Reason is the correct explanation of
Assertion.

List-I List-II
Current configuration (Matnietic field at
point O)
(A) (i) I
B0 = 0   + 2
4r
0 i  2  0 i  1 
(1) 1+ (2) 1+
2r    2r    (B) (ii)
B0 =
0 I
4 r
0 i  1 1  0i  1 1 
(3) + (4) +
2r  2 2  2r  2   (C) (iii) 0 I
B0 =
2r
  − 1
3. As shown in the figure, a current of 2A flows in an
equilateral triangle of side 4 3 cm magnetic field 0 I
(D) (iv)
at the centroid O of the triangle is: B0 =
4r
  + 1
 Choose the correct answer from the options given 0 I  2
(1) x + y 2 − ( x + y )
below. 4xy  
(1) A-III, B-IV, C-I, D-II 0 I  2
(2) A-I, B-III, C-IV, D-II (2) x + y 2 + ( x + y )
4xy  
(3) A-III, B-I, C-IV, D-II
0 Ixy  2
(4) A-II, B-I, C-IV, D-III (3) x + y 2 − ( x + y )
4  
0 Ixy  2
6. Which one of the following options represents the (4) x + y 2 + ( x + y )
4  
magnetic field B at O due to the current flowing in
the given wire segments lying on the xy plane?
8. A very long wire ABDMNDC is shown in figure
carrying current I. AB and BC parts are straight,
long and at right angle. At D wire forms a circular
turn DMND of radius R. AB, BC parts are
tangential to circular turn at N and D respectively.
Magnetic field at the centre of circle is:

−0 I  3 1 ˆ
(1) B= +
L  2 4 2 
 k

−0 I  3 1 ˆ
(2) B= +
L  2 2 2 
 k

−0 I  1 ˆ 0 I 0 I  1 
(3) B= 1+ (1) (2)  − 
L  4 2 
 k
2R 2R  2
−0 I  1  0 I 0 I  1 
(4) B=  1 +  kˆ (3) (  + 1) (4)  − 
L  4  2R 2R  2

7. There are two infinitely long straight current 9. A thin ring of 10 cm radius carries a uniformly
carrying conductors and they are held at right distributed charge. The ring rotates at a constant
angles to each other so that their common ends angular speed of 40 rads–1 about its axis,
meet at the origin as shown in the figure given perpendicular to its plane. If the magnetic field at
below. The ratio of current in both conductor is 1: its centre is 3.8 10−9 T , then the charge carried by
1. The magnetic field at point P is
(
the ring is close to 0 = 410−7 N / A2 )
(1) 2 10−6 C (2) 7 10−6 C
(3) 4 10−5 C (4) 3 10−5 C

10. Two very long, straight and insulated wires are kept
at 90º angle from each other in xy-plane as shown
in the figure. These wire carry currents of equal
 magnitude I, whose directions are shown in the
figure. The net magnetic field at point P will be;

(1)
1
2
(
− ˆj + kˆ ) (2)
1
3
(
− ˆj + kˆ + iˆ )
(3)
3
(
1 ˆ ˆ ˆ
j +k +i ) (4)
2
(
1 ˆ ˆ
i +k )
+0 I
(1) Zero (2) ( zˆ ) 14. A long solenoid carrying a current produces a
d
magnetic field B along its axis. If the current is
0 I 0 I
(3) − ( xˆ + yˆ ) (4) ( xˆ + yˆ ) doubled and the number of turns per unit length is
2d 2d halved, the new value of magnetic field will be
equal to
11. In a co-axial straight cable, the central solid (A) B (B) 2B
conductor and the outer conductor carry equal
B
currents in opposite directions. The magnetic field (C) 4B (D)
2
is zero.
(1) inside the outer conductor
(2) in between the two conductors 15. The electrostatic force ( F ) and
1 magnetic force
(3) outside the cable
(4) inside the inner conductor
( F ) acting on a charge q moving with velocity V
2

can be written ( E is electric field, B is magnetic

12. A long straight wire of radius a carries a steady field).
current I. The current is uniformly distributed (1) ( )
F1 = qV .E, F2 = q BV
.
across its cross section. The ratio of the magnetic
field at a/2 and 2a from axis of the wire is: (2) F = qB. F = q ( B  V )
1 2

F = qE, F = q (V  B )
(1) 1:4 (2) 4:1
(3) 1 2
(3) 1:1 (4) 3:4
(4) F = qE, F = q ( B  V )
1 2
13. A non-planar loop of conducting wire carrying a
current I is placed as shown in the figure. Each of
16. A charge particle moving in magnetic field B. has
the straight sections of the loop is of length 2a. The
the components of velocity along B as well as
magnetic field due to this loop at the point P(a, 0,
perpendicular to B. The path of the charge particle
a) points in the direction
will be;
(1) helical path with the axis perpendicular to
the direction of magnetic field B
(2) straight along the direction of magnetic field
B
 (3) helical path with the axis along magnetic
field B
(4) circular path

17. Given below are two statements: one is labelled as

Assertion A and the other is labelled as Reason R:
Assertion A : In an uniform magnetic field, speed
(1) 1:2 (2) 1:4
and kinetic energy remains the same for a moving
(3) 1:5 (4) 1:3
charged particle.
Reason R: Moving charged particle experiences
21. A particle of mass m and charge q is in an electric
magnetic force perpendicular to its direction of
and magnetic field given by:
motion. In the light of the above statements, choose
the correct answer from the options given below: E = 2iˆ + 3 ˆj ; B = 4 ˆj + 6kˆ
(1) A is true but R is false. The charged particle is shifted from the origin to
(2) A is false but R is true. the point P ( x = 1; y = 1) very slowly along a
(3) Both A and R are true and R is the correct
straight path. The magnitude of the total work done
explanation of A.
is:
(4) Both A and R are true but R is NOT the
correct explanation of A.
(1) (0.35) q (2) 5q
(3) ( 2.5) q (4) (0.15) q
18. A charge particle is moving in a uniform magnetic 22. A moving coil galvanometer has 100 truns and each
( )
field 2iˆ + 3 ˆj T. If it has an acceleration of turn has an area of 2.0 cm². The magnetic field
produced by the magnet is 0.01 T and the deflection
( iˆ − 4 ˆj ) m / s , then the value of  is
2
in the coil is 0.05 radian when a current of 10 mA
(1) 3 (2) 6 is passed through it. The torsional constant of the
(3) 12 (4) 2 suspension wire is x × 10–5 N-m/rad. The value of
x is;
19. A proton, a deuteron and an -particle with same (1) 3 (2) 4
kinetic energy enter into a uniform magnetic field (3) 5 (4) 6
at right angle to magnetic field. The ratio of the
radii of their respective circular paths is: 23. Given below are two statements:
(1) 1: 2 : 2 (2) 1:1: 2 Statement I: If the number of turns in the coil of a
moving coil galvanometer is doubled keeping other
(3) 2:1:1 (4) 1: 2:1
factors contant then the current sensitivity becomes
double.
20. A current carrying rectangular loop PQRS is made Statement II: Increasing current sensitivity of a
of uniform wire. The length PR = QS = 5cm and moving coil galvanometer by only increasing the
PQ=RS=100 cm. If ammeter current reading number of turns in the coil will also increase its
changes from l to 2l, the ratio of magnetic forces voltage sensitivity in the same ratio:
per unit length on the wire PQ due to wire RS in In the light of the above statements, choose the
the two cases respectively f PQ
I 2I
: f PQ is: most appropriate answer from the options given
below:
(1) Statement I is correct but Statement II is
incorrect.
 (2) Statement I is incorrect but Statement II is (2) All ions deflect towards + y-direction
correct. (3) All ions deflect towards -y-direction
(3) Both Statement I and Statement II are (4) Positive ions deflect towards -y-direction
correct. and negative ions towards +y-direction
(4) Both Statement I and Statement II are
incorrect 28. Two long parallel wires are at a distance 2d apart.
They carry steady equal currents flowing out of the
24. A rigid circular loop of radius r and mass m lies in plane of the paper as shown. The variation of the
the x-y plane of a flat table and has a current i magnetic field B along the line XX’ is given by
flowing in it. At this particular place the magnetic
field B = Bxiˆ + Bz kˆ . The value of i so that the loop
start tilting is
mg mg (1)
(1) (2)
r Bx2 + Bz2 rBx
mg mg
(3) (4)
rBz r Bx Bz

25. A battery is connected between two points A and B (2)

on the circumference of a uniform conducting ring
of radius r and resistance R. One of the arcs AB of
the ring subtends an angle  at the center. The value
of the magnetic induction at the center due to the
current in the ring is
(1) Proportional to (180º–) (3)
(2) Inversely proportional to r
(3) Zero, Only if (  = 180º )
(4) Zero for all values of 

(4)
26. A charged particle is released from rest a region of
steady and uniform electric and magnetic fields
which are parallel to each other. The particle will
move in a 28. Two thin long parallel wires separated by a distance
(1) Straight line (2) Circle b are carrying a current I ampere each. The
(3) Helix (4) cycloid magnitude of the force per unit length exerted by
one wire on the other is;
27. An ionized gas contains both positive and negative  0i 2  0i 2
(1) (2)
ions. If it is subjected simultaneously to an electric b2 2 b
field along the +x-direction and a magnetic field  0i 0i
along the + z- direction. then (3) (4)
2 b 2b2
(1) Positive ions deflect towards +y-direction
and negative ions towards -y-direction
30. A massless square loop, of wire of resistance 10. a circle, carrying a current of 3 A and having radius
Supporting a mass of 1 g hangs vertically with one of 4 cm, are placed as shown in the figure. The ratio
of its sides in a uniform magnetic field of 103 G , of the magnetic fields due to the wires A and B at
directed outwards in the shaded region. A dc the common centre Ois:
voltage V is applied to the loop. For what value of
V. the magnetic force will exactly balance the
weight of the supporting mass of 1 g?
(If sides of the loop = 10 cm, g = 10ms–2)

(1) 2:5 (2) 6:5

(3) 4:6 (4) 6:4

34. A charge particle moves along circular path in a

uniform magnetic field. The kinetic energy of the
charge particle increases to 4 times its initial value.
What will be the ratio of new radius to the original
1
(1) V (2) 100 V radius of circular path of the charge particle:
10
(A) 1:1 (B) 1:2
(3) 1V (4) 10 V
(C) 2:1 (D) 1:4

31. A regular polygon of 6 sides is formed by bending

a wire of length 4 meter. If an electric current of
35. A beam of light travelling along X-axis is describe
4 3 A is flowing through the sides of the by the electric field Ey = 900sin (t − x / c ) . The
polygon, the magnetic field at the centre of the
ratio of electric force to magnetic force on a charge
polygon would be x × 10–7T. The value of x is___
q moving along Y-axis with a speed of 3
(1) 72 (2) 74
(3) 77 (4) 78 3  107 ms −1 will be:
(Given speed of light = 3  108 ms −1 )
32. The magnitude of magnetic induction at mid point (1) 1:1 (2) 1 : 10
O due to current arrangement as shown in the (3) 10 : 1 (4) 1:2
figure will be:
36. A velocity selector consists of electric field E = Ekˆ
0 I
(1) r (2) 0 and magnetic field B = Bjˆ with B = 12 mT . The
2 a
value of E required for electron of energy 728 eV
0 I 0 I
(3) (4) moving along the positive x-axis to pass
4 a a
undeflected is:
(Given, Mass of electron = 9.1 × 10–31kg)
33. A wire A, bent in the shape of an arc of a circle,
(1) 192 kVm−1 (2) 192 mVm−1
carrying a current of 2 A and having radius 2 cm
and another wire B, also bent in the shape of arc of (3) 9600 kVm−1 (4) 9600 kVm−1
37. The figure shows a region of length ‘l’ with a
uniform magnetic field of 0.3 T in it and a proton
entering the region with velocity 4×105ms–1
making an angle 60º with the field. If the proton
completes 10 revolution by the time it cross the
region shown, ‘l’ is close to (mass of proton =
1.67  10−27 kg ,charge of the proton = 1.6 10−19 C

(1) 5A (2) 3A
(3) 1A (4) 2A

41. A uniform magnetic field of 2 10−3 T acts along

positive Y-direction. A rectangular loop of sides 20
cm and 10cm with current of 5A is Y-Z plane. The
current is in anticlockwise sense with reference to
negative X axis. Magnitude and direction of the
torque is:
(1) 0.44 m (2) 0.11 m (1) 2 10−4 N − m along positive Z-direction
(3) 0.88m (4) 0.22 m (2) 2 10−4 N − m along negative Z-direction
(3) 2 10−4 N − m along positive X-direction
38. A particle of mass m and charge q has an initial (4) 2 10−4 N − m along positive Y- direction
velocity v = v0 ˆj . If an electric field E = E0iˆ and
magnetic field B = B0iˆ act on the particle, its speed 42. The current sensitivity of moving coil
galvanometer is increased by 25%. This increase is
will double after a time
achieved only by changing the number of turns of
2mv0 3mv0
(1) (2) coils and area of cross section of the wire, while
qE0 qE0
keeping the resistance of galvanometer coil
2mv0 3mv0 constant. The percentage change in the voltage
(3) (4)
qE0 qE0 sensitivity will be:
(1) +25% (2) –50%
(3) Zero (4) –25%
39. A charge Q is moving dl distance in the magnetic
field B . Find the value of work done by B .
43. Find the magnetic field at point P due to a straight
(1) 1 (2) Zero line segment AB of length 6 cm carrying a current
(3) Infinite (4) –1 of 5 A.

40. A straight wire AB of mass 40 g and length 50 cm

is suspended by a pair of flexible leads in uniform
magnetic field of magnitude 0.40 T as shown in the
figure. The magnitude of the current required in the
wire to remove the tension in the supporting leads
is
 Reason (R) : The radius of path in the
mv
perpendicular magnetic field is given by r =
qB
(A) Both Assertion A and Reason R are the true,
and Reason R is a correct explanation of
Assertion A.
(B) Both Assertion A and Reason R are the true,
but Reason R is not a correct explanation of
Assertion A.
(C) Assertion A is true, and Reason R is false.
(D) Assertion A is false, and Reason R is true

45. The magnitude of magnetic field on the axis of a

−5 −5
(1) 35.0 10 T (2) 3.0 10 T circular coil of radius r at a distance x from center
−5
2.5 10 T 1.5 10−5 T
th
(3) (4) 1
is of the magnetic field at the center. The value
8
44. Assertion (A) : The figure shows circular paths of of x is:
an electron and a proton that travel with the same r 2
(1) (2)
speed in a uniform magnetic field B , directed into 3 3
the page. The electron follows the path of smaller (3) r 3 (4) r 2
radius.
 1

Chemical Kinetics
1. The unit of the rate constant of a second order 7. In the following reaction A → B + C, rate constant is
reaction are 0.001 Ms–1. Half-life and completion time of the
(1) mol–1L–1s–1 (2) mol–1Ls–1 given reaction at initial concentration 1 M will be
(3) mol Ls –1
(4) mol L–1s–1 (1) 500 s, 1000s (2) 500s, 750 s
(3) 250s, 500 s (4) 300s, 600 s
2. The rate law for a reaction between the substances A
and B is given by rate = k[A]n[B]m. On doubling the
8. Plots shown the variation of the rate constant (k) with
concentration of A and having the concentration of B,
the ratio of the new rate to the earlier rate of the temperature (T) are given below. The plot that
reaction will be as follows Arrhenius equation is
1
(1) m+n
(2) (m + n)
2
(3) (n – m) (4) 2(n − m) (1) (2)

1
3. A graph plotted between log k versus for
T
calculating activation energy is shown by

(3) (4)

(1) (2)

9. Acid hydrolysis of sucrose is a

(1) Pseudo first order reaction
(2) Zero order reaction
(3) Second order reaction
(3) (4)
(4) Unimolecular reaction

10. For a first order reaction, how much half lives are
4. The minimum energy required for the reacting nearly required for 90% completion of reaction?
molecules to undergo reaction is (1) 2 (2) 6
(1) Potential energy (2) Kinetic energy (3) 8 (4) 10
(3) Thermal energy (4) Activation energy
11. The rate of a reaction is expressed in different ways
5. For zero order reaction the integrated rate equation is as follows
[A] 1 d[C] 1 d[D] 1 d[A] d[B]
(1) kt = (2) kt = [A] – [A]0 + =− =+ = −
[A]0 2 dt 5 dt 3 dt dt
(3) [A] = –kt + [A]0 (4) [A] = kt – [A]0 The reaction is
(1) 4A + B → 2C + 3D
6. DDT on exposure to water decomposes. Half-life is
(2) B + 5D → 3A + 2C
10 yr. How much time it will take for its
decomposition to 99% (3) 4A + 2B → 2C + 3D
(1) 50 yr (2) 70 yr 1
(4) B + D → 4A + 2C
(3) 500 yr (4) 700 yr 2
 2

12. The differential rate law for the reaction 4NH3(g) + 19. Select the correct statement(s) regarding catalyst
5O2(g) → 4NO(g) + 6H2O(g) is among the following
d[NH3 ] d[O 2 ] d[NO] d[H 2O] a. A small amount of catalyst can catalyse a large
(1) − = − = − = − amount of reactants.
dt dt dt dt
b. A catalyst does not alter Gibbs energy, ∆G of
d[NH3 ] d[O 2 ] 1 d[NO] 1 d[H 2O] a reaction.
(2) = = − =−
dt dt 4 dt 6 dt c. A catalyst can catalyse both spontaneous and
1 d[NH3 ] 1 d[O 2 ] 1 d[NO] 1 d[H 2O] non-spontaneous reactions.
(3) = = = d. A catalyst catalyses the forward reaction to the
4 dt 5 dt 4 dt 6 dt
1 d[NH3 ] 1 d[O 2 ] 1 d[NO] 1 d[H 2O] more extent than a backward reaction.
(4) − = − = = (1) a and c only (2) a and b only
4 dt 5 dt 4 dt 6 dt (3) c and d only (4) b and d only

13. A first order reaction is 20% complete in 10 min. 20. Which among the following is not an example of first
Calculate the time for 75% completion of the reaction order reaction?
(1) 0.233 min (2) 62.18 min (1) Decomposition of H2O2 in alkaline medium
(3) 112.12 min (4) 36.18 min catalyzed by iodide ion.
(2) Hydrogenation of ethene
14. The half-life (in seconds) for a first order reaction (3) Decomposition of N2O5
which takes 4 seconds for 30% completion is (4) Natural radioactive decay
(1) 6.65 (2) 5.45
21. For a reaction between A and B, the initial rate of
(3) 8.95 (4) 7.77
reaction is measured for various initial concentration
A and B, the data provided are
15. A hypothetical reaction A2 + B2 → 2AB follows the A B Initial Reaction rate
mechanism as given below, 1. 0.20 M 0.30 M 5 × 10–5
A2  A + A (fast) 2. 0.20 M 0.10 M 5 × 10–5
A + B2 → AB + B (slow) 3. 0.40 M 0.05 M 1 × 10–5
The overall order of the reaction is
A + B → AB (fast)
(1) One (2) Two
The order of the overall reaction is
(3) Two and half (4) Three
(1) 2 (2) 1
1 22. Consider the following statements
(3) 1 (4) 0
2 a. Order of reaction is an experimental quantity.
b. Order of reaction can be zero or fraction.
16. Modified Arrhenius equation is c. Order is applicable to elementary as well as
− Ea − Ea complex reaction.
(1) k = ZAB e RT (2) k = PZAB e RT d. For complex reaction, molecularity of the
− EaT
slowest step is same as the order of the overall
− EaT
R reaction.
Z e
(3) k = PZAB e R (4) k = AB The correct statement(s) is/are
P (1) a, b and c only (2) a and b only
(3) b and c only (4) a, b, c and d
17. The activation energy (in kJ mol–1) of a chemical
reaction whose rate become doubles on increasing the 23. A substance undergoes first order decomposition.
temperature from 298 K to 308 K will be The decomposition follows two parallel first order
(1) 46.21 (2) 61.28 reactions as
(3) 52.89 (4) 71.89

18. Half-life of a reaction becomes half when initial

concentration of reactants are made double. The The percentage distribution of B and C are
order of reaction will be: (1) 75% B and 25% C
(1) 1 (2) 2 (2) 80% B and 20% C
(3) 0 (4) 3 (3) 60% B and 40% C
(4) 76.83% B and 23.17% C
 3

24. In a first order reaction A → B, if k is rate constant 30. Consider a first order gas phase decomposition
and initial concentration of the reactant A is 0.5 M reaction given below:
then half-life is A(g) → B(g) + C(g)
log 2 log 2 The initial pressure of the system before
(1) (2) decomposition of A was pi. After lapse of time ‘t’,
k k 0.5 total pressure of the system increased by x units and
ln 2 0.693 became ‘pt’. The rate constant k for the reaction is
(3) (4)
k 0.5k given as:
2.303 p
(1) k= log i
25. Select the correct statement about average life (τ) of t pi − x
a first order reaction 2.303 pi
(2) k= log
1 t 2pi − p t
(1) τ=
k 2.303 pi
(3) k= log
(2) τ = 1.44 × t1/2 t 2pi + p t
(3) τ = time required for 63.2% completion of a 2.303 p
first order reaction (4) k= log i
t pi + x
(4) all of the above
31. The rate constant for the reaction,
26. Which of the following is correct about catalyst? 2N2O5(g) → 4NO2(g) + O2(g)
(1) It only increases the rate of a chemical is 3 × 10–5 sec–1. If the rate of reaction is 2.4 × 10–5
reaction mol litre–1 sec–1, then the concentration of N2O5 in
(2) Rate constant is unaffected by the catalyst mol litre–1 is
(3) Activation energy of reaction is altered by the (1) 1.4 (2) 1.2
catalyst (3) 0.04 (4) 0.8
(4) Amount of product increases is present of the
32. Which of the following is not for zero order reaction?
catalyst.

27. The temperature coefficient of a reaction is :

(1) The rate constant (1) (2)
(2) The rate constant at a fixed temperature
(3) The ratio of rate constant at two temperature
(4) The ratio of rate constant differing by 10°C
preferably k308/k298
(3) (4)
28. The reaction, A → B follows first order kinetics.
The time taken for 0.8 mol of A to produce 0.6 mol
of B is 1 hour. What is the time taken for conversion 33. For a first order reaction, A→ products, the rate of
of 0.9 mol of A to produce 0.675 mole of B? reaction at [A] = 0.2 M is 1.0 × 10-2 mol L-1 min-1.
The half-life period for the reaction is
(1) 0.25 hour (2) 2 hours
(1) 476 s (2) 496 s
(3) 1 hour (4) 0.5 hour (3) 832 s (4) 242 s

29. The rate law for a reaction between the substance A 34. For a reaction taking place in three steps, the rate
and B is given by the, rate = k[A]n[B]m. On doubling constants are k1, k2 and k3. The overall rate constant
the concentration of A and halving the concentration kk
k = 1 2 . If the energy of activation values for the
of B, the ratio of the new rate to the earlier rate of the k3
reaction will be as first, second, and third stages are respectively 40, 50
1 and 60 kJ mol–1, then the overall energy of activation
(1) m+n
(2) m + n
2 in kJ mol–1 is
(3) n – m (4) 2(n – m) (1) 30 (2) 40
(3) 60 (4) 50
 4

35. Compound ‘A’ and ‘B’ react according to the 40. Increase in the concentration of the reactants leads to
following chemical equation the change in
A(g) + 2B(g) → 2C(g) (1) Activation energy
Concentration of either ‘A’ or ‘B’ were changed (2) Heat of reaction
keeping the concentration of one of the reactants (3) Collision frequency
constant and rates were measured as a function of (4) Threshold energy
initial concentration. Following results were
obtained. Choose the correct option for the rate 41. In the given graph the activation energy, Ea for the
equations for this reaction. reverse reaction will be
Exp Initial Initial Initial
concentration concentration rate of
of [A]/mol L–1 of [B]/mol L–1 formation
of
[C]/mol
L–1s–1
1 0.30 0.30 0.10
2. 0.30 0.60 0.40 (1) 150 kJ (2) 50 kJ
3. 0.60 0.30 0.20 (3) 200 kJ (4) 100 kJ

(1) Rate = k[A]2[B] (2) Rate = k[A][B]2 42. For a first order reaction the graph log [A] vs t is
(3) Rate = k[A] [B] (4) Rate = k[A]2[B]0 given below

36. if the volume of the vessel in which the reaction

2NO + O2 → 2NO2 is occurring is diminished to 1/3rd
of its initial volume. The rate of the reaction will be
increases by
(1) 3 times (2) 9 times x is equal to
(3) 27 times (4) 36 times 0.693 k
(1) (2)
k 2.303
37. Give relation between half reaction time (t1/2) and k
initial concentration of reactant for (n – 1) order (3) − (4) log[A]0
2.303
reaction
(1) t1/2 ∝ [R]0 (2) t1/2 ∝ [R]02− n 43. Unit of frequency factor (A) is
(3) t1/2 ∝ [R]0n +1 (4) t1/2 ∝ [R]0n − 2 (1) mol/L
(2) mol/L × s
(3) Depends upon order of reaction
38. The rate of a reaction is doubled when temperature
(4) It does not have any unit
increases by 10 °C. If temperature is increased by
100°C, then rate of reaction will become
44. The slope in Arrhenius plot, is equal to
(1) 64 times (2) 256 times
Ea Ea
(3) 512 times (4) 1024 times (1) − (2)
2.303R R
39. The chemical reaction 2O3 → 3O2 proceeds as R
(3) − (4) None of the above
follows 2.303E a
O3  O2 + O (fast)
O + O3 → 2O2(slow) 45. A first order reaction is 75% complete after 32 min,
The rate law expression should be when was 50% of the reaction completed?
(1) r = k[O3]2 (2) r = k[O3]2 [O2]–1 (1) 16 min (2) 8 min
(3) r = k[O3][O2] (4) unpredictable (3) 4 min (4) 32 min
 TEST-03
1. dGMP consist of: (1) 1 - Positively, 2 - Negatively, 3 - Fatty acids
(1) Guanine + Ribose sugar (2) 1 - Negatively, 2 - Positively, 3 - Proteins
(2) Guanine + Ribose sugar + Phosphate (3) 1 - Negatively, 2 - Positively, 3 - Fatty acids
(3) Guanine + Deoxyribose sugar (4) 1 - Positively, 2 - Negatively, 3 - Proteins.
(4) Guanine + Deoxyribose sugar + Phosphate
5. Steps of DNA fingerprinting are given following.
2. Read the following features : Arrange them in a correct sequence:
A. 2 polynucleotide chains with parallel 1. Action of restriction endonucleases.
polarity. 2. Hybridization of DNA fragments by using
B. Backbone made up of sugar polarity and labeled VNTRs.
nitrogenous base. 3. Isolation of DNA.
C. Two polynucleotides in a chain linked by H- 4. Identification of hybridized DNA fragments
bonds. by electrophoresis.
D. Pitch of helix = 0.34 nm. 5. Separation of DNA by electrophoresis.
How many of the above features are applicable to (1) 5, 1, 2, 4, 3 (2) 3, 1, 5, 2, 4
DNA in most of organisms? (3) 5, 1, 4, 2, 3 (4) 5, 1, 3, 4, 2
(1) 3 (2) 2
(3) 1 (4) None. 6. Take 1 = Histone + DNA, 2 = Chromatin fibre, 3 =
Chromosome, 4 = Nucleosome and 5 = chromatin.
3. Read the paragraph and select the option with Which of the following sequence is correctly
correct indications – indicating the increasing level of arrangement?
t-RNA is also known as s-RNA which means (1) 1 → 4 → 5 → 2→ 3
.......1...... RNA. Secondary structure of t-RNA is (2) 1 → 4 → 2 → 5 → 3
......2...... while the actual structure is like ......3...... (3) 4 → 1 → 5 → 2 → 3
t-RNA possess two sites - ......4. [site for binding (4) 4 → 1 → 3 → 5 → 2
of amino acids] and ......5...... (having base
sequences complimentary to codons). There are 7. Read the following steps involved in DNA
......6. t-RNAs to read the stop codons. replication and answer the question following
(1) 1 - Suppliment, 3 - L - shaped, 6 - no. them.
(2) 1 - Soluble, 2 - L - shaped, 5 - Anticodon 1. Action of ligase enzyme
loop. 2. Polymerisation
(3) 2 - Clover-leaf shaped, 4 - Amino acid 3. Origin of replication
acceptor end, 6 - Three. 4. Formation of replication fork
(4) 2 - Clover-leaf shaped, 3 - L-shaped, 5 - If we arrange the above steps in sequence of
Anticodon loop. occurrence, then which step will be the third step
in sequence to occur?
4. In prokaryotes like E.coli, 1 charged DNA is (1) 1 (2) 2
present in large loops held by 2 charged 3 to (3) 3 (4) 4
form nucleoid.
8. During transcription, DNA dependent RNA 13. Match the columns -
polymerase works in direction ........1…..and the Column A Column B
polarity of coding strand is .........2........ A. Nirenberg 1. Deciphering of
1 2 genetic code
(1) 5' - 3' 5' - 3' B. George Gamow 2. Transformation
(2) 5' - 3' 3' - 5' experiments
(3) 3' - 5' 5' - 3' C. Griffith 3. Central dogma
(4) 3' - 5' 3' - 5' D. Crick 4. Genetic codon is
triplet
9. Types of non-genetic RNA in bacteria are - (1) A - 1, B - 4, C - 3, D - 2
(1) One (2) Two (2) A - 1, B - 4, C - 2, D - 3
(3) Three (4) Four. (3) A - 4, B - 1, C - 2, D - 3
(4) A - 2, B - 1, C - 4, D - 3
10. During transcription, when RNA polymerase
enzyme reaches the terminator - 14. Select the wrong statement -
(1) Only enzyme is detached from template (1) Genetic codon is nearly universal
strand not RNA. (2) AUG act as initiator codon
(2) Only RNA is detached from template strand (3) UAG act as stop codon
not enzyme. (4) All codons show degeneracy of codon
(3) Both enzyme and RNA are detached. 15. Single amino acid can be coded by more than 2
(4) Neither enzyme nor RNA are detached. codons. This is possible because of following
property of genetic codons -
11. Read the statements (A - D) regarding splicing of (1) Universal nature
m-RNA and answer the question following them (2) Unambiguous nature
A - Splicing occur in prokaryotes only. (3) Degeneracy
B - Splicing involves removal of exons and (4) Absence of punctuations.
joining of introns.
C - By splicing, active mRNA is made more 16. Ribosome is made up of-
active. (1) Structural RNAs only
D - Splicing results in formation of ssDNA on (2) Structural RNAs and lipids
RNA. (3) Structural RNAs and few proteins (up to 10
How many of the above statements are true? types)
(1) None (2) One (4) Structural RNAs and many proteins (up to
(3) Two (4) Three 80 types).
17. In bacteria, enzyme ribozyme is actually -
12. Severo Ochoa enzyme is responsible for - (1) 5 S r RNA (2) 23 S r RNA
(1) Template independent enzymatic synthesis (3) 70 S r RNA (4) 80 S r RNA.
of RNA
(2) Template dependent enzymatic synthesis of 18. Read the following steps involved in translation
RNA and arrange them in correct sequence.
(3) Template independent enzymatic synthesis A - Chain elongation
of DNA B - Initiation
(4) Template dependent enzymatic synthesis of C - Charging of t - RNA
DNA. D - Termination
E - Activation of amino acids
F - Formation of peptide bond
 (1) B→ E →A→ C→D→F .........5.......... and yeast are commonly involved
(2) E → C→A→ F→ B→D host in sequencing procedure.
(3) B→ E → F→ C→A→D (1) 1 - 1980, 4 - Sequence annotation.
(4) B→ E → C→ F→A→D (2) 2 - 13, 5 - Bacteriophage.
(3) 4 - Expressed sequence tags (ESTs), 5 -
19. What happens in translation process, when a Protozoa
release factor enters the process? (4) 4 - Sequence annotation, 5 - Bacteria.
(1) Release factor is freely released in
cytoplasm. 24. Representation of a typical mRNA is given
(2) Release factor is attached to stop codon. following -
(3) Polypeptide fails to release. (5' - end ) —A— Start codon - mRNA - Stop codon
(4) Chain elongation occurs. — A—(3' -'A' is -
(1) Intron (2) Exon
20. Which of the following structural gene is (3) Cistron (4) UTRs
responsible for transfer of acetyl group in 'lac
operon'? 25. Select the incorrect statement-
(1) Lac Z (2) LacY (1) Repetitive DNA sequences form a large
(3) Lac A (4) Both (1) and (3). portion of human genome.
(2) Chromosome 1 possess 2968 genes.
21. Which of the following condition is not a pre- (3) Polymorphism in DNA sequences play very
requisite for working of 'lac operon'? important role.
(1) Absence of glucose (4) Size of VNTRs usually ranges between 100
(2) Presence of lactose to 250 kb.
(3) Presence of galactose
(4) Presence of allolactose. 26. m-RNA formed in prokaryotes -
(1) is in active state and do not require splicing.
22. Match the columns - (2) is in active state and require splicing.
Column A Column B (3) is in inactive state and do not require
A. Lac z 1. Synthesis of splicing.
repressor (4) is in inactive state and require splicing.
B. Lac a 2. Transfer of acetyl
group 27. The human chromosome with the highest and least
C. I gene 3. Synthesis of number of genes in them are respectively:
(3-galactosidase (1) Chromosome 21 and Y
D. Operator 4. Attachment of (2) Chromosome 1 and X
repressor (3) Chromosome 1 and Y
(1) A - 3, B - 2, C - 4, D - 1 (4) Chromosome X and Y
(2) A - 4, B - 1, C - 2, D - 3
(3) A - 2, B - 3, C - 1, D - 4 28. DNA is a polymer of nucleotides which are linked
(4) A - 3, B - 2, C - 1, D - 4: to each other by 3'-5' phosphodiester bond. To
prevent polymerisation of nucleotides, which of the
23. Human Genome Project (HGP) was launched in following modifications would you choose?
........1........ and completed in ........2........ years. In 1) Replace purine with pyrimidines
HGP, two important methodologies were involved 2) Remove/Replace 3' OH group in
........3........ and .........4.......... .........4......... deoxyribose
involves the sequencing of whole set of genome
 3) Remove/Replace 2' OH group with some B. Regulation of lac operon by repressor is
other group in deoxyribose referred to as positive regulation
4) Both 'B' and 'C' C. The human genome has approximately
50,000 genes
29. Regulatory proteins are the accessory proteins that D. Haemophilia is a sex-linked recessive
interact with RNA polymerase and affect its role in disease
transcription. Which of the following statements is How many of the above statements are right?
correct about regulatory protein? (1) Two (2) Three
(1) They only increase expression (3) Four (4) One
(2) They only decrease expression
(3) They interact with RNA polymerase but do 34. What is it that forms the basis of DNA
not affect the expression fingerprinting?
(4) They can act both as activators and as (1) Satellite DNA occurring as highly repeated
repressors short DNA segments
(2) The relative proportions of purines and
30. While analysing the DNA of an organism a total pyrimidines in DNA
number of 5386 nucleotides were found out of (3) The relative difference in the DNA
occurrence in blood, skin and saliva
which the proportion of different bases were:
(4) The relative amount of DNA in the ridges
Adenine = 29%, Guanine = 17%, Cytosine = 32%, and grooves of the fingerprints
Thymine = 17%. Considering the Chargaff s rule it
35. Which one of the followings is wrongly matched?
can be concluded that:
(1) Transcription- Writing information from
(1) It is a double stranded circular. DNA DNA to t-RNA
(2) It is single stranded DNA (2) Translation- Using information in m-RNA to
make protein
(3) It is a double stranded linear DNA
(3) Repressor protein- Binds to operator to stop
(4) No conclusion can be drawn enzyme synthesis
(4) Operon- Structural genes, operator and
31. If Meselson and Stahl's experiment is continued for promoter
four generations in bacteria, the ratio of 15N/15N:
15N/14N: 14N/14N containing DNA in the fourth 36. Gene regulation governing lactose operon of E.coli
generation would be : that involves the lac I gene product is
(1) 1 : 1 : 0 (2) 1 : 4 : 0 (1) Feedback inhibition because excess of -
(3) 0 : 1 : 3 (4) 0 : 1 : 7 galactosidase can switch off transcription
(2) Positive and inducible because it can be
32. The RNA polymerase holoenzyme transcribes: induced by lactose
(1) the promoter, structural gene and the (3) Negative and inducible because repressor
terminator region protein prevents transcription
(2) the promoter and the terminator regions (4) Negative and repressible because repressor
(3) the structural gene and the terminator protein prevents transcription
regions
(4) the structural gene only. 37. Satellite DNA is important because it
(1) Code for enzymes needed for DNA
33. Read the following four statements (A-D) replication
A. In transcription, adenosine pairs with uracil (2) Codes for proteins needed in cell cycle
 (3) Shows high degree of polymorphism in 41. A procedure for identifying specific sequences
population and also the same degree of of DNA, in which fragments separated on a gel
polymorphism in an individual, which is are transferred directly to a second medium on
heritable from parents to children which assay by hybridization may be carried
(4) Does not code for proteins and is same in all
out is called as:
mer of the population
(1) Radioassay
38. In an E.coli strain i gene gets mutated and its (2) Gel electrophoresis
product can not bind the inducer molecule. If (3) Ultracentrifugation
growth medium is provided with lactose, what will (4) Southern blot
be the outcome?
(1) Only z gene will get transcribed
(2) z, y, a genes will be transcribed 42. The existence of polymorphism is due to
(3) z, y, a genes will not be translated (1) mutation (2) crossing over
(4) RNA polymerase will bind the promoter (3) migration (4) both A and B
region
39. Given below is a sequence of bases in mRNA
43. A variant in sequence that is present in at least
of a bacterial cell. Identify the amino acid that
1% of a population is called a (an)
would be incorporated at codon position 3 and
(1) trait (2) autosome
codon position 5 during the process of its
translation. (3) allosome (4) polymorphism
3'AUCAGGUUUGUGAUGGUACGA5'
(1) Phenylalanine, Methionine 44. The activity of a repressor depends on
whether:
(2) Cysteine, Glycine
(1) The repressor is positioned next to the
(3) Alanine, Proline
operon
(4) Serine, Valine
(2) The repressor is positioned next to the
promoter
40. Select the two statements out of the four (A-D)
(3) A key substance in the metabolic
given below about lac oрегоп.
pathway is present
(A) Glucose or galactose may bind with
(4) There is enough RNA polymerase
the repressor and inactivate it
present
(B) In the absence of lactose, the repressor
binds with the operator region
45. If there are aaa bases in an RNA that codes for
(C) The z-gene codes for permease
a protein with 333 amino acids, and the base at
(D) This was elucidated by Francois Jacob position gol is deleted such that the length of
and Jacques Monod the RNA becomes 998 bases-
The correct statements are (1) 333 (2) 11
(1) (B) and (C) (2) (A) and (C) (3) 33 (4) 1
(3) (B) and (D) (4) (A) and (B)
 (BIOLOGY_Reproductive Health)
7. Given below are two statements.
1. In India, marriageable age for boys is ______ and Statement I: Natural methods work on the principle of
girls is ______ respectively. avoiding chances of ovum and sperms meeting.
Choose the option which fill the blanks correctly.
Statement II: In IVF, fertilisation takes place
(1) 21, 18 years (2) 15, 14 years
outside the body in almost similar conditions as
(3) 15, 18 years (4) 18, 21 years
that in the body.
2. Which of the following is a copper releasing intra In the light of the above statements, choose the
uterine device (IUDs)? most appropriate answer from the options given
(1) Cu7 (2) LNG - 20 below.
(3) Cervical caps (4) Vaults (1) Statement I is correct but Statement II is
incorrect.
3. Given below are two statements: one is labelled as
(2) Statement I is incorrect but Statement II is
Assertion A and the other is labelled as Reason R.
Assertion A: Vasectomy has no effect on the sexual correct.
life of male. (3) Both Statement I and Statement II are
Reason R: Male can ejaculate normally but there correct.
will be no sperms in semen. (4) Both Statement I and Statement II are
In the light of the above statements, choose the incorrect.
correct answer from the options given below.
(1) A is true but R is false.
8. How many technologies in the list given below
(2) A is false but R is true.
(3) Both A and R are true and R is the correct involves in-vivo fertilisation?
explanation of A. GIFT, ZIFT, ICSI, IUT, AI, IUI
(4) Both A and R are true but R is not the correct (1) Six (2) Three
explanation of A.
(3) Two (4) One

4. The full form of GIFT is;

(1) germ cell internal fallopian transfer. 9. Which of the following cannot be detected in a
(2) gamete inter fallopian transfer. developing foetus by amniocentesis?
(3) gamete intra fallopian transfer. (1) Sex of the foetus
(4) gamete internal fertilisation and transfer. (2) Down syndrome
(3) Jaundice
5. The given below diagram represent which of the (4) Klinefelter syndrome
following process?
10. Match the List-I with List-II.
List-I List-II
(A) RCH (I) Venereal diseases
(B) CDRI (II) Central Drug Research
Institute
(C) VD (III) World Health
Organisation
(1) Vasectomy (2) Tubectomy
(D) WHO (IV) Reproductive and Child
(3) MTP (4) IUT
Health Care
Choose the correct answer from the options given
6. Which of the following step occurs in ZIFT? below.
(1) Transfer of ovum into the fallopian tube. (1) A-IV, B-III, C-II, D-I
(2) Transfer of zygote into the fallopian tube. (2) A-I, B-II, C-III, D-IV
(3) Transfer of zygote into the uterus. (3) A-III, B-IV, C-II, D-I
(4) Transfer of embryo into the cervix. (4) A-IV, B-II, C-I, D-III
11. Read the following statements. 16. Match the List-I with List-II.
A. Contraceptive method should always be List-I List-II
undertaken in consultation with qualified (A) Diaphragms (I) Inhibit ovulation
medical professionals.
(B) Contraceptive (II) Increase
B. Contraceptives are not regular requirements
pills phagocytosis of
for the maintenance of reproductive health.
sperm within uterus
C. Spermicidal creams, jellies and foams are
(C) Intra Uterine (III) Absence of
usually used along with barriers to decrease
devices menstrual cycle
their contraceptive efficiency.
and ovulation
D. Indian population was approximately 100
million at the time of independence. following
E. LNG-20 is a type of hormone releasing IUD. parturition
Choose the most appropriate answer from the (D) Lactational (IV) They cover the
options given below. amenorrhea cervix blocking
(1) Only A and B are incorrect. the entry of
(2) Only B and C are incorrect. sperms
(3) Only C and D are incorrect. Choose the correct answer from the options given
(4) Only A and E are incorrect. below.
(1) A-IV, B-I, C-III, D-II
12. Which of the following method of contraception has
(2) A-IV, B-I, C-II, D-III
maximum chances of failure?
(3) A-II, B-IV, C-I, D-III
(1) Lactational amenorrhea
(2) Vasectomy (4) A-III, B-II, C-I, D-IV
(3) Condoms
(4) IUDs 17. Read the following statements w.r.t periodic
abstinence.
13. Chances of fertilisation are very high during A. The couple should abstain from coitus from
_________. day 10 to 17 of the menstrual cycle.
Choose the option which fills the blank correctly.
B. 10th to 17th day of the cycle is the period,
(1) fertile period
when the chances of fertilisation are low.
(2) infertile period
C. This prevents the chances of union of male
(3) sterile period
(4) menstruation period. and female gametes.
D. It is a barrier method of contraception.
14. Lactational amenorrhea is effective only up to a Choose the most appropriate answer from the
maximum period of ____ months. options given below.
Choose the option which fills the blank correctly. (1) Only A and B are correct.
(1) two (2) Only B and C are correct.
(2) four (3) Only C and D are correct.
(3) six (4) Only A and C are correct.
(4) eight

18. The emergency contraceptives could be used to

15. Which of the following contraceptive device is
avoid possible pregnancy due to rape or casual
inserted by the doctor or trained nurse in the uterus
unprotected intercourse within;
through the vagina?
(1) Diaphragm (1) 72 hours of coitus.
(2) Cu-T (2) 24 hours of coitus.
(3) Condom (3) 48 hours of coitus.
(4) Vaults (4) 12 hours of coitus.
19. Contraceptive pills are very effective with lesser side 24. Given below are two statements: one is labelled as
effects used by females. They work by; Assertion A and the other is labelled as Reason R:
(1) inhibiting gestation. Assertion A: Cu-T and Cu-7 provide
(2) inhibiting implantation. contraception.
(3) altering the quality of cervical mucus to Reason R: Cu ions released by them increase
prevent/retard the entry of sperms. sperm motility.
In the light of the above statements, choose the
(4) both (2) and (3)
correct answer from the options given below.
(1) A is true but R is false.
20. Given below are two statements.
(2) A is false but R is true.
Statement I: Inability to conceive or produce
(3) Both A and R are true and R is the correct
children even after 2 years of unprotected sexual
explanation of A.
cohabitation is called infertility.
(4) Both A and R are true but R is not the correct
Statement II: STIs are a major threat to a healthy explanation of A.
society.
In the light of the above statements, choose the 25. The ‘ART’ in which the semen collected either
most appropriate answer from the options given from the husband or a healthy donor are
below. artificially introduced either into the vagina or into
(1) Statement I is correct but Statement II is the uterus is;
incorrect. (1) intra uterine transfer.
(2) Statement I is incorrect but Statement II is
(2) intra uterine insemination.
correct.
(3) inter uterine insemination.
(3) Both Statement I and Statement II are
(4) intra cytoplasmic sperm injection.
correct.
(4) Both Statement I and Statement II are
26. Use of which of the following contraceptive device or
incorrect.
method has increased in recent years due to its
additional benefit of protecting the user from
21. According to the 2011 census report, the
contracting STDs and AIDS?
population growth rate was less than;
(1) Vasectomy (2) Coitus interruptus
(1) 3%. (2) 2%.
(3) Condoms (4) IUDs
(3) 4%. (4) 5%.

27. Saheli was developed by;

22. MTP (The Medical Termination of Pregnancy) (1) AIIMS, Delhi.
amendment Act, was enacted in; (2) IICB, Kolkata.
(1) 2017. (2) 2000.
(3) SGPGI, Lucknow.
(3) 1997. (4) 2012.
(4) CDRI, Lucknow.

23. Primary steps that can be taken towards attaining 28. Though all persons are vulnerable to STDs, their
reproductive health are; incidences are reported to be very high among person
A. counselling and creating awareness about in the age group of;
reproductive organs. (1) 12-18 years.
B. safe and hygienic sexual practices. (2) 40-50 years.
C. creating awareness about STDs. (3) 21-35 years.
D. ban on MTP and amniocentesis. (4) 15-24 years.
Choose the most appropriate answer from the
options given below. 29. The method of directly injecting a sperm into ovum
(1) A and B only in-vitro is assisted by a reproductive technology
(2) B and C only called;
(3) A, B and C only (1) GIFT. (2) ZIFT.
(4) A, B, C and D (3) ICSI. (4) ET.
30. Slogan “Hum Do Hamare Do” aim at; In the light of the above statements, choose the
(1) raising of marriageable age. correct answer from the options given below.
(2) family planning. (1) A is true but R is false.
(3) immunisation. (2) A is false but R is true.
(4) economic growth. (3) Both A and R are true and R is the correct
explanation of A.
31. The world population which was around 2 billion (4) Both A and R are true but R is not the correct
in 1900 rocketed to about; explanation of A.
(1) 6 billion by 2014.
(2) 9 billion by 2019. 37. Which of the following part of the male reproductive
(3) 7 billion by 2020. system is cut and tied during the sterilisation
(4) 6 billion by 2000. procedure?
(1) Epididymis (2) Vas deferens
32. Which of the following sexually transmitted (3) Vasa efferentia (4) Rete testis
diseases is not completely curable?
(1) Chlamydiasis (2) Gonorrhoea 38. Given below are two statements.
(3) Genital warts (4) Genital herpes Statement I: Medical termination of pregnancy
(MTP) is also known as induced abortion.
33. HIV can be transmitted from one person to other by; Statement II: According to the WHO,
(1) sharing of injection needles and surgical reproductive health means a total well-being in all
instruments with infected person. aspects of reproduction.
(2) transfusion of blood. In the light of the above statements, choose the
(3) placental transfer. most appropriate answer from the options given
(4) all of these below.
(1) Statement I is correct but Statement II is
34. The ‘family planning’ programmes were periodically incorrect.
assessed over the past decades. Improved (2) Statement I is incorrect but Statement II is
programmes covering wider reproductive related correct.
areas are currently in operation under the popular (3) Both Statement I and Statement II are
name; correct.
(1) RCH programmes. (4) Both Statement I and Statement II are
(2) ART programmes. incorrect.
(3) MTP programmes.
(4) test tube baby programmes. 39. In India, population crossed 1.2 billion in May 2011.
The probable reasons for this are, decline in;
35. ‘Nirodh’ is a popular brand of; A. maternal mortality rate.
(1) contraceptive pill for the female. B. infant mortality rate.
(2) IUDs for female. C. number of people in reproducible age.
(3) condoms for females. D. death rate.
(4) condoms for males. Choose the most appropriate answer from the
options given below.
(1) A and B only (2) A, B and C only
36. Given below are two statements: one is labelled as (3) A, B and D only (4) A, B, C and D
Assertion A and the other is labelled as Reason R:
Assertion A : The government laid a statutory 40. Which of the following options is correct about
ban on amniocentesis for sex-determination to the function of IUDs?
legally check decreasing menace of female (1) They alter the spermatogenesis.
foeticides. (2) They increase phagocytosis of sperms within
Reason R : In amniocentesis, some of the amniotic uterus.
fluid of the developing foetus is taken to analyse the (3) They make cervix hostile to egg.
foetal cells and dissolved substances. (4) They promote ovulation.
41. The following given diagram represents; 45. Pills have to be taken daily for a period of
____A____ starting preferably within the first
____B____ of menstrual cycle.
Choose the option which fill the blanks correctly.
A B
(1) 21 days 5 days
(2) 5 days 21 days
(1) subcutaneous implants.
(3) 21 days 7 days
(2) pills.
(4) 7 days 21 days
(3) diaphragm.
(4) vaults.

42. India was amongst the first countries in the world to

initiate action plans and programmes at national level
to attain reproductive health. The programmes called
as 'family planning' were initiated in ______ year in
India.
Choose the option which fills the blank correctly.
(1) 1951
(2) 1976
(3) 1971
(4) 1987

43. Match the List-I with List-II.

List-I List-II
(A) Hormone (I) Progestasert
releasing IUDs
(B) Copper releasing (II) Multiload 375
IUDs
(C) Non-medicated (III) Lippes loop
IUDs
(D) Barrier method for (IV) Cervical caps
females
Choose the correct answer from the options given
below.
(1) A-I, B-III, C-II, D-IV
(2) A-III, B-I, C-II, D-IV
(3) A-I, B-II, C-III, D-IV
(4) A-III, B-II, C-I, D-IV

44. Which of the following is an ideal contraceptive for

the females who want to delay pregnancy and /or
space children?
(1) Barrier method
(2) Intra uterine devices
(3) Oral contraceptive pills
(4) Surgical method