CLC Genomics Workbench

Manual for

CLC Genomics Workbench 4.8

Windows, Mac OS X and Linux October 13, 2011 This software is for research purposes only.

CLC bio Finlandsgade 10-12 DK-8200 Aarhus N Denmark

Contents
I Introduction 12
13 15 15 18 19 31 33 34 37 38 39 42 43 44 48 49

1 Introduction to CLC Genomics Workbench 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 Contact information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Download and installation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . System requirements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Licenses . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . About CLC Workbenches . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

When the program is installed: Getting started . . . . . . . . . . . . . . . . . . . Plug-ins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Network configuration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . The format of the user manual . . . . . . . . . . . . . . . . . . . . . . . . . . .

2 Tutorials 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 2.9 Tutorial: Getting started . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tutorial: View sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tutorial: Side Panel Settings . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tutorial: GenBank search and download . . . . . . . . . . . . . . . . . . . . . . Tutorial: De novo assembly and BLAST . . . . . . . . . . . . . . . . . . . . . . .

Resequencing tutorial: Map reads to reference followed by SNP and DIP detection 52 Map reads to reference in details . . . . . . . . . . . . . . . . . . . . . . . . . . ChIP sequencing: the basics . . . . . . . . . . . . . . . . . . . . . . . . . . . . ChIP sequencing: Understanding the details . . . . . . . . . . . . . . . . . . . . 60 68 74 77 82 90

2.10 RNA-Seq analysis part I: Getting started . . . . . . . . . . . . . . . . . . . . . . 2.11 RNA-Seq analysis part II: Non-specific matches and expression measures . . . . 2.12 RNA-Seq analysis part III: Exon discovery . . . . . . . . . . . . . . . . . . . . . . 3

CONTENTS 2.13 RNA-Seq analysis part IV: Spikes and quality control . . . . . . . . . . . . . . . . 2.14 Tutorial: Small RNA analysis using Illumina data . . . . . . . . . . . . . . . . . .

4 92 99

2.15 Tutorial: Microarray-based expression analysis part I: Getting started . . . . . . . 111 2.16 Tutorial: Microarray-based expression analysis part II: Quality control . . . . . . . 114 2.17 Tutorial: Microarray-based expression analysis part III: Differentially expressed genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 120 2.18 Tutorial: Microarray-based expression analysis part IV: Annotation test . . . . . . 124 2.19 Tutorial: Assembly . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 127 2.20 Tutorial: In silico cloning cloning work flow . . . . . . . . . . . . . . . . . . . . . 134 2.21 Tutorial: Primer design . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 139 2.22 Tutorial: BLAST search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 144 2.23 Tutorial: Tips for specialized BLAST searches . . . . . . . . . . . . . . . . . . . 146 2.24 Tutorial: Proteolytic cleavage detection . . . . . . . . . . . . . . . . . . . . . . . 151 2.25 Tutorial: Folding RNA molecules . . . . . . . . . . . . . . . . . . . . . . . . . . . 152 2.26 Tutorial: Align protein sequences . . . . . . . . . . . . . . . . . . . . . . . . . . 156 2.27 Tutorial: Create and modify a phylogenetic tree . . . . . . . . . . . . . . . . . . 158 2.28 Tutorial: Find restriction sites . . . . . . . . . . . . . . . . . . . . . . . . . . . . 159

II

Core Functionalities

162
163

3 User interface 3.1 3.2 3.3 3.4 3.5 3.6

Navigation Area . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 164 View Area . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 171 Zoom and selection in View Area . . . . . . . . . . . . . . . . . . . . . . . . . . 178 Toolbox and Status Bar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 180 Workspace . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 181 List of shortcuts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 182 185

4 Searching your data 4.1 4.2 4.3 4.4

What kind of information can be searched? . . . . . . . . . . . . . . . . . . . . 185 Quick search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 186 Advanced search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 188 Search index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 190

CONTENTS 5 User preferences and settings 5.1 5.2 5.3 5.4 5.5 5.6

5 191

General preferences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 191 Default view preferences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 192 Data preferences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 195

Advanced preferences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 195 Export/import of preferences . . . . . . . . . . . . . . . . . . . . . . . . . . . . 196 View settings for the Side Panel . . . . . . . . . . . . . . . . . . . . . . . . . . 196 200

6 Printing 6.1 6.2 6.3

Selecting which part of the view to print . . . . . . . . . . . . . . . . . . . . . . 201 Page setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 202 Print preview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 203 204

7 Import/export of data and graphics 7.1 7.2 7.3 7.4 7.5

Bioinformatic data formats . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 204 External files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 211 Export graphics to files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 211 Export graph data points to a file . . . . . . . . . . . . . . . . . . . . . . . . . . 216 Copy/paste view output . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 217 218

8 History log 8.1

Element history . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 218 220

9 Batching and result handling 9.1 9.2 Batch processing

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 220

How to handle results of analyses . . . . . . . . . . . . . . . . . . . . . . . . . 223

III

Bioinformatics

227
228

10 Viewing and editing sequences

10.1 View sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 228 10.2 Circular DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 237 10.3 Working with annotations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 239 10.4 Element information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 247

CONTENTS

10.5 View as text . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 248 10.6 Creating a new sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 249 10.7 Sequence Lists 11 Online database search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 250 254

11.1 GenBank search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 254 11.2 UniProt (Swiss-Prot/TrEMBL) search . . . . . . . . . . . . . . . . . . . . . . . . 258 11.3 Search for structures at NCBI . . . . . . . . . . . . . . . . . . . . . . . . . . . . 260 11.4 Sequence web info 12 BLAST search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 264 266

12.1 Running BLAST searches . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 267 12.2 Output from BLAST searches . . . . . . . . . . . . . . . . . . . . . . . . . . . . 273 12.3 Local BLAST databases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 278 12.4 Manage BLAST databases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 281 12.5 Bioinformatics explained: BLAST . . . . . . . . . . . . . . . . . . . . . . . . . . 282 13 3D molecule viewing 292

13.1 Importing structure files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 292 13.2 Viewing structure files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 293 13.3 Selections and display of the 3D structure . . . . . . . . . . . . . . . . . . . . . 294 13.4 3D Output . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 299 14 General sequence analyses 301

14.1 Shuffle sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 301 14.2 Dot plots . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 303 14.3 Local complexity plot . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 313

14.4 Sequence statistics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 314 14.5 Join sequences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 320 14.6 Pattern Discovery . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 322 14.7 Motif Search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 324 15 Nucleotide analyses 331

15.1 Convert DNA to RNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 331

CONTENTS

15.2 Convert RNA to DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 332 15.3 Reverse complements of sequences . . . . . . . . . . . . . . . . . . . . . . . . 333 15.4 Reverse sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 334 15.5 Translation of DNA or RNA to protein . . . . . . . . . . . . . . . . . . . . . . . . 334 15.6 Find open reading frames . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 336 16 Protein analyses 339

16.1 Signal peptide prediction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 340 16.2 Protein charge . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 346 16.3 Transmembrane helix prediction . . . . . . . . . . . . . . . . . . . . . . . . . . 347 16.4 Antigenicity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 348 16.5 Hydrophobicity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 350 16.6 Pfam domain search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 355 16.7 Secondary structure prediction . . . . . . . . . . . . . . . . . . . . . . . . . . . 357 16.8 Protein report . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 359

16.9 Reverse translation from protein into DNA . . . . . . . . . . . . . . . . . . . . . 361 16.10 Proteolytic cleavage detection . . . . . . . . . . . . . . . . . . . . . . . . . . . . 365 17 Primers 371

17.1 Primer design - an introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 372 17.2 Setting parameters for primers and probes . . . . . . . . . . . . . . . . . . . . . 374 17.3 Graphical display of primer information . . . . . . . . . . . . . . . . . . . . . . . 377 17.4 Output from primer design . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 378 17.5 Standard PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 379 17.6 Nested PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 383 17.7 TaqMan . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 385 17.8 Sequencing primers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 387 17.9 Alignment-based primer and probe design . . . . . . . . . . . . . . . . . . . . . 388 17.10 Analyze primer properties . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 392 17.11 Find binding sites and create fragments . . . . . . . . . . . . . . . . . . . . . . 394 17.12 Order primers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 398 18 Sequencing data analyses 400

CONTENTS

18.1 Importing and viewing trace data . . . . . . . . . . . . . . . . . . . . . . . . . . 400 18.2 Trim sequences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 402 18.3 Assemble sequences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 405 18.4 Assemble to reference sequence . . . . . . . . . . . . . . . . . . . . . . . . . . 407 18.5 Add sequences to an existing contig . . . . . . . . . . . . . . . . . . . . . . . . 409 18.6 View and edit read mappings . . . . . . . . . . . . . . . . . . . . . . . . . . . . 410 18.7 Reassemble contig . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 418

18.8 Secondary peak calling . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 419 19 High-throughput sequencing 421

19.1 Import high-throughput sequencing data . . . . . . . . . . . . . . . . . . . . . . 423 19.2 Multiplexing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 441 19.3 Trim sequences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 450 19.4 De novo assembly . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 460 19.5 Map reads to reference . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 468 19.6 Mapping reports . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 477 19.7 Mapping table . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 483 19.8 Color space . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 485 19.9 Interpreting genome-scale mappings . . . . . . . . . . . . . . . . . . . . . . . . 489 19.10 Merge mapping results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 498 19.11 SNP detection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 498 19.12 DIP detection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 507 19.13 ChIP sequencing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 513 19.14 RNA-Seq analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 520 19.15 Expression profiling by tags . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 535 19.16 Small RNA analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 545 20 Expression analysis 563

20.1 Experimental design . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 564 20.2 Transformation and normalization . . . . . . . . . . . . . . . . . . . . . . . . . . 576 20.3 Quality control . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 581 20.4 Statistical analysis - identifying differential expression . . . . . . . . . . . . . . . 593 20.5 Feature clustering . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 601

CONTENTS

20.6 Annotation tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 607 20.7 General plots . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 614 21 Cloning and cutting 620

21.1 Molecular cloning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 621 21.2 Gateway cloning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 631 21.3 Restriction site analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 639 21.4 Gel electrophoresis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 652 21.5 Restriction enzyme lists . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 655 22 Sequence alignment 659

22.1 Create an alignment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 660 22.2 View alignments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 665 22.3 Edit alignments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 669 22.4 Join alignments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 671 22.5 Pairwise comparison . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 673 22.6 Bioinformatics explained: Multiple alignments . . . . . . . . . . . . . . . . . . . 676 23 Phylogenetic trees 678

23.1 Inferring phylogenetic trees . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 678 23.2 Bioinformatics explained: phylogenetics . . . . . . . . . . . . . . . . . . . . . . 683 24 RNA structure 687

24.1 RNA secondary structure prediction . . . . . . . . . . . . . . . . . . . . . . . . . 688 24.2 View and edit secondary structures . . . . . . . . . . . . . . . . . . . . . . . . . 694 24.3 Evaluate structure hypothesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . 701 24.4 Structure Scanning Plot . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 704 24.5 Bioinformatics explained: RNA structure prediction by minimum free energy minimization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 706

IV

Appendix

712
713 718

A Comparison of workbenches B Graph preferences

CONTENTS C Working with tables C.1

10 720

Filtering tables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 721 723

D BLAST databases D.1 D.2 D.3

Peptide sequence databases . . . . . . . . . . . . . . . . . . . . . . . . . . . . 723 Nucleotide sequence databases . . . . . . . . . . . . . . . . . . . . . . . . . . 723 Adding more databases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 724 726 728 729 731 732 733

E Proteolytic cleavage enzymes F Restriction enzymes database configuration G Technical information about modifying Gateway cloning sites H IUPAC codes for amino acids I J IUPAC codes for nucleotides Formats for import and export J.1 J.2

List of bioinformatic data formats . . . . . . . . . . . . . . . . . . . . . . . . . . 733 List of graphics data formats . . . . . . . . . . . . . . . . . . . . . . . . . . . . 737 738

K SAM/BAM export format specification K.1 K.2 K.3 K.4 K.5 L

SAM Specification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 738 SAM Header Section . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 738 SAM Alignment Section . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 738 Flags . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 738 Optional fields in the alignment section . . . . . . . . . . . . . . . . . . . . . . 740 742

Expression data formats L.1 L.2 L.3 L.4 L.5

GEO (Gene Expression Omnibus) . . . . . . . . . . . . . . . . . . . . . . . . . . 742 Affymetrix GeneChip . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 745 Illumina BeadChip . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 746 Gene ontology annotation files . . . . . . . . . . . . . . . . . . . . . . . . . . . 748 Generic expression and annotation data file formats . . . . . . . . . . . . . . . 748 752

M Custom codon frequency tables

CONTENTS Bibliography

11 753

Index

762

Part I

Introduction

12

Chapter 1

Introduction to CLC Genomics Workbench

Contents
1.1 1.2 Contact information . . . . . . . . . . . . . . . Download and installation . . . . . . . . . . . 1.2.1 Program download . . . . . . . . . . . . . 1.2.2 Installation on Microsoft Windows . . . . 1.2.3 Installation on Mac OS X . . . . . . . . . 1.2.4 Installation on Linux with an installer . . . 1.2.5 Installation on Linux with an RPM-package 1.3 System requirements . . . . . . . . . . . . . . 1.4 Licenses . . . . . . . . . . . . . . . . . . . . . 1.4.1 Request an evaluation license . . . . . . 1.4.2 Download a license . . . . . . . . . . . . 1.4.3 Import a license from a file . . . . . . . . 1.4.4 Upgrade license . . . . . . . . . . . . . . 1.4.5 Configure license server connection . . . 1.4.6 Limited mode . . . . . . . . . . . . . . . 1.5 About CLC Workbenches . . . . . . . . . . . . 1.5.1 New program feature request . . . . . . . 1.5.2 Report program errors . . . . . . . . . . . 1.5.3 CLC Sequence Viewer vs. Workbenches . 1.6 When the program is installed: Getting started 1.6.1 Quick start . . . . . . . . . . . . . . . . . 1.6.2 Import of example data . . . . . . . . . . 1.7 Plug-ins . . . . . . . . . . . . . . . . . . . . . 1.7.1 Installing plug-ins . . . . . . . . . . . . . 1.7.2 Uninstalling plug-ins . . . . . . . . . . . . 1.7.3 Updating plug-ins . . . . . . . . . . . . . 1.7.4 Resources . . . . . . . . . . . . . . . . . 1.8 Network configuration . . . . . . . . . . . . . 1.9 The format of the user manual . . . . . . . . . 1.9.1 Text formats . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15 15 15 16 16 17 18 18 19 20 22 24 25 27 31 31 32 32 32 33 33 33 34 34 34 36 36 37 38 38

13

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH

14

Welcome to CLC Genomics Workbench --- a software package supporting your daily bioinformatics work. We strongly encourage you to read this user manual in order to get the best possible basis for working with the software package. This software is for research purposes only.

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH

15

1.1

Contact information

The CLC Genomics Workbench is developed by: CLC bio A/S Science Park Aarhus Finlandsgade 10-12 8200 Aarhus N Denmark http://www.clcbio.com VAT no.: DK 28 30 50 87 Telephone: +45 70 22 55 09 Fax: +45 70 22 55 19 E-mail: [email protected] If you have questions or comments regarding the program, you are welcome to contact our support function: E-mail: [email protected]

1.2

Download and installation

The CLC Genomics Workbench is developed for Windows, Mac OS X and Linux. The software for either platform can be downloaded from http://www.clcbio.com/download. Furthermore the program can be sent on a CD-Rom by regular mail. To receive the program by regular mail, please write an e-mail to [email protected], including your postal address.

1.2.1

Program download

The program is available for download on http://www.clcbio.com/download. Before you download the program you are asked to fill in the Download dialog. In the dialog you must choose: Which operating system you use Whether you would like to receive information about future releases Depending on your operating system and your Internet browser, you are taken through some download options. When the download of the installer (an application which facilitates the installation of the program) is complete, follow the platform specific instructions below to complete the installation procedure. 1
1

You must be connected to the Internet throughout the installation process.

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH

16

1.2.2

Installation on Microsoft Windows

Starting the installation process is done in one of the following ways: If you have downloaded an installer: Locate the downloaded installer and double-click the icon. The default location for downloaded files is your desktop. If you are installing from a CD: Insert the CD into your CD-ROM drive. Choose the "Install CLC Genomics Workbench" from the menu displayed. Installing the program is done in the following steps: On the welcome screen, click Next. Read and accept the License agreement and click Next. Choose where you would like to install the application and click Next. Choose a name for the Start Menu folder used to launch CLC Genomics Workbench and click Next. Choose if CLC Genomics Workbench should be used to open CLC files and click Next. Choose where you would like to create shortcuts for launching CLC Genomics Workbench and click Next. Choose if you would like to associate .clc files to CLC Genomics Workbench. If you check this option, double-clicking a file with a "clc" extension will open the CLC Genomics Workbench. Wait for the installation process to complete, choose whether you would like to launch CLC Genomics Workbench right away, and click Finish. When the installation is complete the program can be launched from the Start Menu or from one of the shortcuts you chose to create.

1.2.3

Installation on Mac OS X

Starting the installation process is done in one of the following ways: If you have downloaded an installer: Locate the downloaded installer and double-click the icon. The default location for downloaded files is your desktop. If you are installing from a CD: Insert the CD into your CD-ROM drive and open it by double-clicking on the CD icon on your desktop. Launch the installer by double-clicking on the "CLC Genomics Workbench" icon. Installing the program is done in the following steps:

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH On the welcome screen, click Next. Read and accept the License agreement and click Next. Choose where you would like to install the application and click Next. Choose if CLC Genomics Workbench should be used to open CLC files and click Next.

17

Choose whether you would like to create desktop icon for launching CLC Genomics Workbench and click Next. Choose if you would like to associate .clc files to CLC Genomics Workbench. If you check this option, double-clicking a file with a "clc" extension will open the CLC Genomics Workbench. Wait for the installation process to complete, choose whether you would like to launch CLC Genomics Workbench right away, and click Finish. When the installation is complete the program can be launched from your Applications folder, or from the desktop shortcut you chose to create. If you like, you can drag the application icon to the dock for easy access.

1.2.4

Installation on Linux with an installer

Navigate to the directory containing the installer and execute it. This can be done by running a command similar to:
# sh CLCGenomicsWorkbench_4_JRE.sh

If you are installing from a CD the installers are located in the "linux" directory. Installing the program is done in the following steps: On the welcome screen, click Next. Read and accept the License agreement and click Next. Choose where you would like to install the application and click Next. For a system-wide installation you can choose for example /opt or /usr/local. If you do not have root privileges you can choose to install in your home directory. Choose where you would like to create symbolic links to the program DO NOT create symbolic links in the same location as the application. Symbolic links should be installed in a location which is included in your environment PATH. For a system-wide installation you can choose for example /usr/local/bin. If you do not have root privileges you can create a 'bin' directory in your home directory and install symbolic links there. You can also choose not to create symbolic links. Wait for the installation process to complete and click Finish. If you choose to create symbolic links in a location which is included in your PATH, the program can be executed by running the command:

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH

18

# clcgenomicswb4

Otherwise you start the application by navigating to the location where you choose to install it and running the command:
# ./clcgenomicswb4

1.2.5

Installation on Linux with an RPM-package

Navigate to the directory containing the rpm-package and install it using the rpm-tool by running a command similar to:
# rpm -ivh CLCGenomicsWorkbench_4_JRE.rpm

If you are installing from a CD the rpm-packages are located in the "RPMS" directory. Installation of RPM-packages usually requires root-privileges. When the installation process is finished the program can be executed by running the command:
# clcgenomicswb4

1.3

System requirements

Windows XP, Windows Vista, or Windows 7, Windows Server 2003 or Windows Server 2008 Mac OS X 10.5 or newer. Intel CPU required. Linux: RedHat 5 or later. SuSE 10 or later. 256 MB RAM required 512 MB RAM recommended 1024 x 768 display recommended Intel or AMD CPU required Small data sets. Assembly and analysis of genomes up to 50 mega-bases and up to 10 mil. reads 2 GB RAM required, 4 GB RAM recommended Medium data sets. Assembly and analysis of larger genomes and up to 100 mil. reads 8 GB RAM required, 16 GB RAM recommended Large data sets. Assembly and analysis of larger genomes and more than 100 mil. reads 16 GB RAM required, 32 GB RAM recommended

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH

19

Special requirements for de novo assembly. De novo assembly may need more memory than stated above - this depends both on the number of reads and the complexity and size of the genome. See http://www.clcbio.com/white-paper for examples of the memory usage of various data sets. 64 bit computer and operating system required to use more than 2GB RAM

1.4

Licenses

When you have installed CLC Genomics Workbench, and start for the first time, you will meet the license assistant, shown in figure 1.1.

Figure 1.1: The license assistant showing you the options for getting started. The following options are available. They will be described in detail in the following sections. Request an evaluation license. The license is a fully functional, time-limited license (see below). Download a license. When you purchase a license, you will get a license ID from CLC bio. Using this option, you will get a license based on this ID. Import a license from a file. If CLC bio has provided a license file, or if you have downloaded a license from our web-based licensing system, you can import it using this option. Upgrade license. If you already have used a previous version of CLC Genomics Workbench, and you are entitled to upgrading to the new CLC Genomics Workbench 4.8, select this option to get a license upgrade. Configure license server connection. If your organization has a license server, select this option to connect to the server.

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH Select an appropriate option and click Next.

20

If for some reason you don't have access to getting a license, you can click the Limited Mode button (see section 1.4.6).

1.4.1

Request an evaluation license

We offer a fully functional demo version of CLC Genomics Workbench to all users, free of charge. Each user is entitled to 14 days demo of CLC Genomics Workbench. If you need more time for evaluating, another two weeks of demo can be requested. We use the concept of "quid quo pro". The last two weeks of free demo time given to you is therefore accompanied by a short-form questionnaire where you have the opportunity to give us feedback about the program. The 30 days demo is offered for each major release of CLC Genomics Workbench. You will therefore have the opportunity to try the next major version when it is released. (If you purchase CLC Genomics Workbench the first year of updates is included.) When you select to request an evaluation license, you will see the dialog shown in figure 1.2.

Figure 1.2: Choosing between direct download or download web page. In this dialog, there are two options: Direct download. The workbench will attempt to contact the online CLC Licenses Service, and download the license directly. This method requires internet access from the workbench. Go to license download web page. The workbench will open a Web Browser with the License Download web page when you click Next. From there you will be able to download your license as a file and import it. This option allows you to get a license, even though the Workbench does not have direct access to the CLC Licenses Service. If you select the first option, and it turns out that you do not have internet access from the Workbench (because of a firewall, proxy server etc.), you will be able to click Previous and use the other option instead. Direct download Selecting the first option takes you to the dialog shown in figure 1.3.

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH

21

Figure 1.3: A license has been downloaded. A progress for getting the license is shown, and when the license is downloaded, you will be able to click Next. Go to license download web page Selecting the second option, Go to license download web page, opens the license web page as shown in 1.4.

Figure 1.4: The license web page where you can download a license. Click the Request Evaluation License button, and you will be able to save the license on your computer, e.g. on the Desktop. Back in the Workbench window, you will now see the dialog shown in 1.5. Click the Choose License File button and browse to find the license file you saved before (e.g. on your Desktop). When you have selected the file, click Next. Accepting the license agreement Regardless of which option you chose above, you will now see the dialog shown in figure 1.6. Please read the License agreement carefully before clicking I accept these terms and Finish.

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH

22

Figure 1.5: Importing the license downloaded from the web site.

Figure 1.6: Read the license agreement carefully.

1.4.2

Download a license

When you purchase a license, you will get a license ID from CLC bio. Using this option, you will get a license based on this ID. When you have clicked Next, you will see the dialog shown in 1.7. At the top, enter the ID (paste using Ctrl+V or + V on Mac).

Figure 1.7: Entering a license ID provided by CLC bio (the license ID in this example is artificial). In this dialog, there are two options:

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH

23

Direct download. The workbench will attempt to contact the online CLC Licenses Service, and download the license directly. This method requires internet access from the workbench. Go to license download web page. The workbench will open a Web Browser with the License Download web page when you click Next. From there you will be able to download your license as a file and import it. This option allows you to get a license, even though the Workbench does not have direct access to the CLC Licenses Service. If you select the first option, and it turns out that you do not have internet access from the Workbench (because of a firewall, proxy server etc.), you will be able to click Previous and use the other option instead. Direct download Selecting the first option takes you to the dialog shown in figure 1.8.

Figure 1.8: A license has been downloaded. A progress for getting the license is shown, and when the license is downloaded, you will be able to click Next. Go to license download web page Selecting the second option, Go to license download web page, opens the license web page as shown in 1.9. Click the Request Evaluation License button, and you will be able to save the license on your computer, e.g. on the Desktop. Back in the Workbench window, you will now see the dialog shown in 1.10. Click the Choose License File button and browse to find the license file you saved before (e.g. on your Desktop). When you have selected the file, click Next. Accepting the license agreement Regardless of which option you chose above, you will now see the dialog shown in figure 1.11. Please read the License agreement carefully before clicking I accept these terms and Finish.

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH

24

Figure 1.9: The license web page where you can download a license.

Figure 1.10: Importing the license downloaded from the web site.

Figure 1.11: Read the license agreement carefully.

1.4.3

Import a license from a file

If you are provided a license file instead of a license ID, you will be able to import the file using this option. When you have clicked Next, you will see the dialog shown in 1.12. Click the Choose License File button and browse to find the license file provided by CLC bio. When you have selected the file, click Next.

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH

25

Figure 1.12: Selecting a license file . Accepting the license agreement Regardless of which option you chose above, you will now see the dialog shown in figure 1.13.

Figure 1.13: Read the license agreement carefully. Please read the License agreement carefully before clicking I accept these terms and Finish.

1.4.4

Upgrade license

If you already have used a previous version of CLC Genomics Workbench, and you are entitled to upgrading to the new CLC Genomics Workbench 4.8, select this option to get a license upgrade. When you click Next, the workbench will search for a previous installation of CLC Genomics Workbench. It will then locate the old license. If the Workbench succeeds to find an existing license, the next dialog will look as shown in figure 1.14. When you click Next, the Workbench checks on CLC bio's web server to see if you are entitled to upgrade your license. Note! If you should be entitled to get an upgrade, and you do not get one automatically in this process, please contact [email protected]. In this dialog, there are two options:

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH

26

Figure 1.14: An old license is detected. Direct download. The workbench will attempt to contact the online CLC Licenses Service, and download the license directly. This method requires internet access from the workbench. Go to license download web page. The workbench will open a Web Browser with the License Download web page when you click Next. From there you will be able to download your license as a file and import it. This option allows you to get a license, even though the Workbench does not have direct access to the CLC Licenses Service. If you select the first option, and it turns out that you do not have internet access from the Workbench (because of a firewall, proxy server etc.), you will be able to click Previous and use the other option instead. Direct download Selecting the first option takes you to the dialog shown in figure 1.15.

Figure 1.15: A license has been downloaded. A progress for getting the license is shown, and when the license is downloaded, you will be able to click Next.

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH Go to license download web page

27

Selecting the second option, Go to license download web page, opens the license web page as shown in 1.16.

Figure 1.16: The license web page where you can download a license. Click the Request Evaluation License button, and you will be able to save the license on your computer, e.g. on the Desktop. Back in the Workbench window, you will now see the dialog shown in 1.17.

Figure 1.17: Importing the license downloaded from the web site. Click the Choose License File button and browse to find the license file you saved before (e.g. on your Desktop). When you have selected the file, click Next. Accepting the license agreement Regardless of which option you chose above, you will now see the dialog shown in figure 1.18. Please read the License agreement carefully before clicking I accept these terms and Finish.

1.4.5

Configure license server connection

If your organization has installed a license server, you can use a floating license. The license server has a set of licenses that can be used on all computers on the network. If the server has

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH

28

Figure 1.18: Read the license agreement carefully. e.g. 10 licenses, it means that maximum 10 computers can use a license simultaneously. When you have selected this option and click Next, you will see the dialog shown in figure 1.19.

Figure 1.19: Connecting to a license server. This dialog lets you specify how to connect to the license server: Connect to a license server. Check this option if you wish to use the license server. Automatically detect license server. By checking this option you do not have to enter more information to connect to the server. Manually specify license server. There can be technical limitations which mean that the license server cannot be detected automatically, and in this case you need to specify more options manually: Host name. Enter the address for the licenser server. Port. Specify which port to use. Disable license borrowing on this computer. If you do not want users of the computer to borrow a license (see section 1.4.5), you can check this option.

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH Borrow a license

29

A floating license can only be used when you are connected to the license server. If you wish to use the CLC Genomics Workbench when you are not connected to the server, you can borrow a license. Borrowing a license means that you take one of the floating licenses available on the server and borrow it for a specified amount of time. During this time period, there will be one less floating license available on the server. At the point where you wish to borrow a license, you have to be connected to the license server. The procedure for borrowing is this: 1. Click Help | License Manager to display the dialog shown in figure 1.22. 2. Use the checkboxes to select the license(s) that you wish to borrow. 3. Select how long time you wish to borrow the license, and click Borrow Licenses. 4. You can now go offline and work with CLC Genomics Workbench. 5. When the borrow time period has elapsed, you have to connect to the license server again to use CLC Genomics Workbench. 6. When the borrow time period has elapsed, the license server will make the floating license available for other users. Note that the time period is not the period of time that you actually use the Workbench. Note! When your organization's license server is installed, license borrowing can be turned off. In that case, you will not be able to borrow licenses. No license available... If all the licenses on the server are in use, you will see a dialog as shown in figure 1.20 when you start the Workbench.

Figure 1.20: No more licenses available on the server.

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH

30

In this case, please contact your organization's license server administrator. To purchase additional licenses, contact [email protected]. You can also click the Limited Mode button (see section 1.4.6). If your connection to the license server is lost, you will see a dialog as shown in figure 1.21.

Figure 1.21: Unable to contact license server. In this case, you need to make sure that you have access to the license server, and that the server is running. However, there may be situations where you wish to use another license, or see information about the license you currently use. In this case, open the license manager: Help | License Manager ( )

The license manager is shown in figure 1.22.

Figure 1.22: The license manager. Besides letting you borrow licenses (see section 1.4.5), this dialog can be used to: See information about the license (e.g. what kind of license, when it expires) Configure how to connect to a license server (Configure License Server the button at the lower left corner). Clicking this button will display a dialog similar to figure 1.19.

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH

31

Upgrade from an evaluation license by clicking the Upgrade license button. This will display the dialog shown in figure 1.1. If you wish to switch away from using a floating license, click Configure License Server and choose not to connect to a license server in the dialog. When you restart CLC Genomics Workbench, you will be asked for a license as described in section 1.4.

1.4.6

Limited mode

We have created the limited mode to prevent a situation where you are unable to access your data because you do not have a license. When you run in limited mode, a lot of the tools in the Workbench are not available, but you still have access to your data (also when stored in a CLC Bioinformatics Database). When running in limited mode, the functionality is equivalent to the CLC Sequence Viewer (see section A). To get out of the limited mode and run the Workbench normally, restart the Workbench. When you restart the Workbench will try to find a proper license and if it does, it will start up normally. If it can't find a license, you will again have the option of running in limited mode.

1.5

About CLC Workbenches

In November 2005 CLC bio released two Workbenches: CLC Free Workbench and CLC Protein Workbench. CLC Protein Workbench is developed from the free version, giving it the well-tested user friendliness and look & feel. However, the CLC Protein Workbench includes a range of more advanced analyses. In March 2006, CLC DNA Workbench (formerly CLC Gene Workbench) and CLC Main Workbench were added to the product portfolio of CLC bio. Like CLC Protein Workbench, CLC DNA Workbench builds on CLC Free Workbench. It shares some of the advanced product features of CLC Protein Workbench, and it has additional advanced features. CLC Main Workbench holds all basic and advanced features of the CLC Workbenches. In June 2007, CLC RNA Workbench was released as a sister product of CLC Protein Workbench and CLC DNA Workbench. CLC Main Workbench now also includes all the features of CLC RNA Workbench. In March 2008, the CLC Free Workbench changed name to CLC Sequence Viewer. In June 2008, the first version of the CLC Genomics Workbench was released due to an extraordinary demand for software capable of handling sequencing data from the new highthroughput sequencing systems like 454, Illumina Genome Analyzer and SOLiD. For an overview of which features all the applications include, see http://www.clcbio.com/ features. In December 2006, CLC bio released a Software Developer Kit which makes it possible for anybody with a knowledge of programming in Java to develop plug-ins. The plug-ins are fully integrated with the CLC Workbenches and the Viewer and provide an easy way to customize and extend their functionalities. All our software will be improved continuously. If you are interested in receiving news about updates, you should register your e-mail and contact data on http://www.clcbio.com, if you

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH haven't already registered when you downloaded the program.

32

1.5.1

New program feature request

The CLC team is continuously improving the CLC Genomics Workbench with our users' interests in mind. Therefore, we welcome all requests and feedback from users, and hope suggest new features or more general improvements to the program on [email protected].

1.5.2

Report program errors

CLC bio is doing everything possible to eliminate program errors. Nevertheless, some errors might have escaped our attention. If you discover an error in the program, you can use the Report a Program Error function in the Help menu of the program to report it. In the Report a Program Error dialog you are asked to write your e-mail address (optional). This is because we would like to be able to contact you for further information about the error or for helping you with the problem. Note! No personal information is sent via the error report. Only the information which can be seen in the Program Error Submission Dialog is submitted. You can also write an e-mail to [email protected]. Remember to specify how the program error can be reproduced. All errors will be treated seriously and with gratitude. We appreciate your help. Start in safe mode If the program becomes unstable on start-up, you can start it in Safe mode. This is done by pressing and holding down the Shift button while the program starts. When starting in safe mode, the user settings (e.g. the settings in the Side Panel) are deleted and cannot be restored. Your data stored in the Navigation Area is not deleted. When started in safe mode, some of the functionalities are missing, and you will have to restart the CLC Genomics Workbench again (without pressing Shift).

1.5.3

CLC Sequence Viewer vs. Workbenches

The advanced analyses of the commercial workbenches, CLC Protein Workbench, CLC RNA Workbench and CLC DNA Workbench are not present in CLC Sequence Viewer. Likewise, some advanced analyses are available in CLC DNA Workbench but not in CLC RNA Workbench or CLC Protein Workbench, and vice versa. All types of basic and advanced analyses are available in CLC Main Workbench. However, the output of the commercial workbenches can be viewed in all other workbenches. This allows you to share the result of your advanced analyses from e.g. CLC Main Workbench, with people working with e.g. CLC Sequence Viewer. They will be able to view the results of your analyses, but not redo the analyses. The CLC Workbenches and the CLC Sequence Viewer are developed for Windows, Mac and Linux

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH

33

platforms. Data can be exported/imported between the different platforms in the same easy way as when exporting/importing between two computers with e.g. Windows.

1.6

When the program is installed: Getting started

CLC Genomics Workbench includes an extensive Help function, which can be found in the Help menu of the program's Menu bar. The Help can also be shown by pressing F1. The help topics are sorted in a table of contents and the topics can be searched. We also recommend our Online presentations where a product specialist from CLC bio demonstrates our software. This is a very easy way to get started using the program. Read more about online presentations here: http://clcbio.com/presentation.

1.6.1

Quick start

When the program opens for the first time, the background of the workspace is visible. In the background are three quick start shortcuts, which will help you getting started. These can be seen in figure 1.23.

Figure 1.23: Three available Quick start short cuts, available in the background of the workspace. The function of the three quick start shortcuts is explained here: Import data. Opens the Import dialog, which you let you browse for, and import data from your file system. New sequence. Opens a dialog which allows you to enter your own sequence. Read tutorials. Opens the tutorials menu with a number of tutorials. These are also available from the Help menu in the Menu bar.

1.6.2

Import of example data

It might be easier to understand the logic of the program by trying to do simple operations on existing data. Therefore CLC Genomics Workbench includes an example data set. When downloading CLC Genomics Workbench you are asked if you would like to import the example data set. If you accept, the data is downloaded automatically and saved in the program. If you didn't download the data, or for some other reason need to download the data again, you have two options: You can click Install Example Data ( ) in the Help menu of the program. This installs the data automatically. You can also go to http://www.clcbio.com/download and download the example data from there.

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH

34

If you download the file from the website, you need to import it into the program. See chapter 7.1 for more about importing data.

1.7

Plug-ins

When you install CLC Genomics Workbench, it has a standard set of features. However, you can upgrade and customize the program using a variety of plug-ins. As the range of plug-ins is continuously updated and expanded, they will not be listed here. Instead we refer to http://www.clcbio.com/plug-ins for a full list of plug-ins with descriptions of their functionalities.

1.7.1

Installing plug-ins
)

Plug-ins are installed using the plug-in manager2 : Help in the Menu Bar | Plug-ins and Resources... ( or Plug-ins ( ) in the Toolbar

The plug-in manager has four tabs at the top: Manage Plug-ins. This is an overview of plug-ins that are installed. Download Plug-ins. This is an overview of available plug-ins on CLC bio's server. Manage Resources. This is an overview of resources that are installed. Download Resources. This is an overview of available resources on CLC bio's server. To install a plug-in, click the Download Plug-ins tab. This will display an overview of the plug-ins that are available for download and installation (see figure 1.24). Clicking a plug-in will display additional information at the right side of the dialog. This will also display a button: Download and Install. Click the plug-in and press Download and Install. A dialog displaying progress is now shown, and the plug-in is downloaded and installed. If the plug-in is not shown on the server, and you have it on your computer (e.g. if you have downloaded it from our web-site), you can install it by clicking the Install from File button at the bottom of the dialog. This will open a dialog where you can browse for the plug-in. The plug-in file should be a file of the type ".cpa". When you close the dialog, you will be asked whether you wish to restart the CLC Genomics Workbench. The plug-in will not be ready for use before you have restarted.

1.7.2
2

Uninstalling plug-ins

Plug-ins are uninstalled using the plug-in manager:

In order to install plug-ins on Windows Vista, the Workbench must be run in administrator mode: Right-click the program shortcut and choose "Run as Administrator". Then follow the procedure described below. When you start the Workbench after installing the plug-in, it should also be run in administrator mode.

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH

35

Figure 1.24: The plug-ins that are available for download. Help in the Menu Bar | Plug-ins and Resources... ( or Plug-ins ( ) in the Toolbar )

This will open the dialog shown in figure 1.25.

Figure 1.25: The plug-in manager with plug-ins installed. The installed plug-ins are shown in this dialog. To uninstall: Click the plug-in | Uninstall If you do not wish to completely uninstall the plug-in but you don't want it to be used next time

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH you start the Workbench, click the Disable button.

36

When you close the dialog, you will be asked whether you wish to restart the workbench. The plug-in will not be uninstalled before the workbench is restarted.

1.7.3

Updating plug-ins

If a new version of a plug-in is available, you will get a notification during start-up as shown in figure 1.26.

Figure 1.26: Plug-in updates. In this list, select which plug-ins you wish to update, and click Install Updates. If you press Cancel you will be able to install the plug-ins later by clicking Check for Updates in the Plug-in manager (see figure 1.25).

1.7.4

Resources

Resources are downloaded, installed, un-installed and updated the same way as plug-ins. Click the Download Resources tab at the top of the plug-in manager, and you will see a list of available resources (see figure 1.27). Currently, the only resources available are PFAM databases (for use with CLC Protein Workbench and CLC Main Workbench). Because procedures for downloading, installation, uninstallation and updating are the same as for plug-ins see section 1.7.1 and section 1.7.2 for more information.

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH

37

Figure 1.27: Resources available for download.

1.8

Network configuration

If you use a proxy server to access the Internet you must configure CLC Genomics Workbench to use this. Otherwise you will not be able to perform any online activities (e.g. searching GenBank). CLC Genomics Workbench supports the use of a HTTP-proxy and an anonymous SOCKS-proxy.

Figure 1.28: Adjusting proxy preferences. To configure your proxy settings, open CLC Genomics Workbench, and go to the Advanced-tab of the Preferences dialog (figure 1.28) and enter the appropriate information. The Preferences dialog is opened from the Edit menu. You have the choice between a HTTP-proxy and a SOCKS-proxy. CLC Genomics Workbench only supports the use of a SOCKS-proxy that does not require authorization. Exclude hosts can be used if there are some hosts that should be contacted directly and not through the proxy server. The value can be a list of hosts, each separated by a |, and in addition a wildcard character * can be used for matching. For example: *.foo.com|localhost. If you have any problems with these settings you should contact your systems administrator.

CHAPTER 1. INTRODUCTION TO CLC GENOMICS WORKBENCH

38

1.9

The format of the user manual

This user manual offers support to Windows, Mac OS X and Linux users. The software is very similar on these operating systems. In areas where differences exist, these will be described separately. However, the term "right-click" is used throughout the manual, but some Mac users may have to use Ctrl+click in order to perform a "right-click" (if they have a single-button mouse). The most recent version of the user manuals can be downloaded from http://www.clcbio. com/usermanuals. The user manual consists of four parts. The first part includes the introduction and some tutorials showing how to apply the most significant functionalities of CLC Genomics Workbench. The second part describes in detail how to operate all the program's basic functionalities. The third part digs deeper into some of the bioinformatic features of the program. In this part, you will also find our "Bioinformatics explained" sections. These sections elaborate on the algorithms and analyses of CLC Genomics Workbench and provide more general knowledge of bioinformatic concepts. The fourth part is the Appendix and Index. Each chapter includes a short table of contents.

1.9.1

Text formats

In order to produce a clearly laid-out content in this manual, different formats are applied: A feature in the program is in bold starting with capital letters. ( Example: Navigation Area) An explanation of how a particular function is activated, is illustrated by "|" and bold. (E.g.: select the element | Edit | Rename)

Chapter 2

Tutorials
Contents
2.1 Tutorial: Getting started . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.1.1 2.1.2 2.2 2.3 Creating a a folder . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Import data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42 42 43 43 44 46 47 48 49 49 49 49 49 51 52 53 54 56 57 58 60 60 60 64 67 68 69 70 72

Tutorial: View sequence

Tutorial: Side Panel Settings . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.3.1 Saving the settings in the Side Panel . . . . . . . . . . . . . . . . . . . . 2.3.2 Applying saved settings . . . . . . . . . . . . . . . . . . . . . . . . . . . Searching for matching objects . . . . . . . . . . . . . . . . . . . . . . . Saving the sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . Importing the data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Assembly . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . BLAST the results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tutorial: GenBank search and download . . . . . . . . . . . . . . . . . . . . . 2.4.1 2.4.2

2.4

2.5

Tutorial: De novo assembly and BLAST . . . . . . . . . . . . . . . . . . . . . 2.5.1 2.5.2 2.5.3

2.6

Resequencing tutorial: Map reads to reference followed by SNP and DIP detection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.6.1 2.6.2 2.6.3 2.6.4 2.6.5 Importing the data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Mapping the reads to the E. coli reference . . . . . . . . . . . . . . . . . Interpreting the read mapping results . . . . . . . . . . . . . . . . . . . Looking for SNPs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Looking for DIPs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Importing the data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Mapping long reads . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Mapping short reads . . . . . . . . . . . . . . . . . . . . . . . . . . . . Making use of paired information . . . . . . . . . . . . . . . . . . . . . . Importing the data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Mapping the reads to the reference . . . . . . . . . . . . . . . . . . . . Running the ChIP sequencing analysis . . . . . . . . . . . . . . . . . . .

2.7

Map reads to reference in details . . . . . . . . . . . . . . . . . . . . . . . . 2.7.1 2.7.2 2.7.3 2.7.4

2.8

ChIP sequencing: the basics . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.8.1 2.8.2 2.8.3

39

CHAPTER 2. TUTORIALS

40

ChIP sequencing: Understanding the details . . . . . . . . . . . . . . . . . . 2.9.1 Data set . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.9.2 Getting the right layout . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.9.3 Looking for known genes . . . . . . . . . . . . . . . . . . . . . . . . . . 2.9.4 Going into detail with the parameters . . . . . . . . . . . . . . . . . . . 2.9.5 Extracting the peak regions . . . . . . . . . . . . . . . . . . . . . . . . . 2.10 RNA-Seq analysis part I: Getting started . . . . . . . . . . . . . . . . . . . . 2.10.1 Downloading and importing the data . . . . . . . . . . . . . . . . . . . . 2.10.2 Running the RNA-Seq analysis . . . . . . . . . . . . . . . . . . . . . . . 2.10.3 Interpreting the brain spikes analysis result . . . . . . . . . . . . . . . . 2.11 RNA-Seq analysis part II: Non-specific matches and expression measures . . 2.11.1 Running the same data set with and without non-specific matches . . . . 2.11.2 Comparing the data in a scatter plot . . . . . . . . . . . . . . . . . . . . 2.11.3 The RPKM expression measure . . . . . . . . . . . . . . . . . . . . . . . 2.12 RNA-Seq analysis part III: Exon discovery . . . . . . . . . . . . . . . . . . . . 2.12.1 Creating two samples for comparison . . . . . . . . . . . . . . . . . . . 2.12.2 Identifying new and differentially expressed splice isoforms . . . . . . . . 2.13 RNA-Seq analysis part IV: Spikes and quality control . . . . . . . . . . . . . . 2.13.1 Inspecting the spike reads . . . . . . . . . . . . . . . . . . . . . . . . . 2.13.2 Checking within and between group variability . . . . . . . . . . . . . . . 2.14 Tutorial: Small RNA analysis using Illumina data . . . . . . . . . . . . . . . . 2.14.1 Downloading and importing the raw data . . . . . . . . . . . . . . . . . . 2.14.2 Trimming adapters and counting the reads . . . . . . . . . . . . . . . . . 2.14.3 Interpreting the adapter trim report . . . . . . . . . . . . . . . . . . . . . 2.14.4 Investigating the small RNA sample . . . . . . . . . . . . . . . . . . . . 2.14.5 Downloading miRBase and annotating the sample . . . . . . . . . . . . . 2.14.6 Analyzing the annotated samples . . . . . . . . . . . . . . . . . . . . . . 2.15 Tutorial: Microarray-based expression analysis part I: Getting started . . . . 2.15.1 Importing array data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.15.2 Grouping the samples . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.15.3 The experiment table . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.16 Tutorial: Microarray-based expression analysis part II: Quality control . . . . 2.16.1 Transformation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.16.2 Comparing spread and distribution . . . . . . . . . . . . . . . . . . . . . 2.16.3 Group differentiation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.17 Tutorial: Microarray-based expression analysis part III: Differentially expressed genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.17.1 Statistical analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.17.2 Filtering p-values . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.17.3 Inspecting the volcano plot . . . . . . . . . . . . . . . . . . . . . . . . . 2.17.4 Filtering absent/present calls and fold change . . . . . . . . . . . . . . . 2.17.5 Saving the gene list . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.18 Tutorial: Microarray-based expression analysis part IV: Annotation test . . . 2.18.1 Importing and adding the annotations . . . . . . . . . . . . . . . . . . . 2.18.2 Inspecting the annotations . . . . . . . . . . . . . . . . . . . . . . . . .

2.9

74 74 74 75 75 77 77 78 78 80 82 83 84 88 90 90 91 92 92 94 99 100 101 103 103 104 107 111 111 111 113 114 114 116 117 120 120 120 121 121 123 124 124 125

CHAPTER 2. TUTORIALS

41

2.18.3 Processes that are over or under represented in the small list 2.18.4 A different approach: Gene Set Enrichment Analysis (GSEA) . 2.19 Tutorial: Assembly . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.19.1 Trimming the sequences . . . . . . . . . . . . . . . . . . . . 2.19.2 Assembling the sequencing data . . . . . . . . . . . . . . . . 2.19.3 Getting an overview of the contig . . . . . . . . . . . . . . . . 2.19.4 Finding and editing conflicts . . . . . . . . . . . . . . . . . . . 2.19.5 Including regions that have been trimmed off . . . . . . . . . 2.19.6 Inspecting the traces . . . . . . . . . . . . . . . . . . . . . . 2.19.7 Synonymous substitutions? . . . . . . . . . . . . . . . . . . . 2.19.8 Getting an overview of the conflicts . . . . . . . . . . . . . . . 2.19.9 Documenting your changes . . . . . . . . . . . . . . . . . . . 2.19.10 Using the result for further analyses . . . . . . . . . . . . . . 2.20 Tutorial: In silico cloning cloning work flow . . . . . . . . . . . . . 2.20.1 Locating the data to use . . . . . . . . . . . . . . . . . . . . 2.20.2 Add restriction sites to primers . . . . . . . . . . . . . . . . . 2.20.3 Simulate PCR to create the fragment . . . . . . . . . . . . . . 2.20.4 Specify restriction sites and perform cloning . . . . . . . . . . 2.21 Tutorial: Primer design . . . . . . . . . . . . . . . . . . . . . . . . 2.21.1 Specifying a region for the forward primer . . . . . . . . . . . 2.21.2 Examining the primer suggestions . . . . . . . . . . . . . . . 2.21.3 Calculating a primer pair . . . . . . . . . . . . . . . . . . . . 2.22 Tutorial: BLAST search . . . . . . . . . . . . . . . . . . . . . . . . 2.22.1 Performing the BLAST search . . . . . . . . . . . . . . . . . . 2.22.2 Inspecting the results . . . . . . . . . . . . . . . . . . . . . . 2.22.3 Using the BLAST table view . . . . . . . . . . . . . . . . . . . 2.23 Tutorial: Tips for specialized BLAST searches . . . . . . . . . . . . 2.23.1 Locate a protein sequence on the chromosome . . . . . . . . 2.23.2 BLAST for primer binding sites . . . . . . . . . . . . . . . . . 2.23.3 Finding remote protein homologues . . . . . . . . . . . . . . 2.23.4 Further reading . . . . . . . . . . . . . . . . . . . . . . . . . . 2.24 Tutorial: Proteolytic cleavage detection . . . . . . . . . . . . . . . 2.25 Tutorial: Folding RNA molecules . . . . . . . . . . . . . . . . . . . 2.26 Tutorial: Align protein sequences . . . . . . . . . . . . . . . . . . 2.26.1 The alignment dialog . . . . . . . . . . . . . . . . . . . . . . 2.27 Tutorial: Create and modify a phylogenetic tree . . . . . . . . . . 2.27.1 Tree layout . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.28 Tutorial: Find restriction sites . . . . . . . . . . . . . . . . . . . . 2.28.1 The Side Panel way of finding restriction sites . . . . . . . . . 2.28.2 The Toolbox way of finding restriction sites . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

125 126 127 127 129 129 130 131 131 131 132 132 133 134 134 135 137 138 139 140 140 142 144 144 145 146 146 147 150 150 150 151 152 156 156 158 159 159 159 159

This chapter contains tutorials representing some of the features of CLC Genomics Workbench. The first tutorials are meant as a short introduction to operating the program. The last tutorials give examples of how to use some of the main features of CLC Genomics Workbench. video tutorials at http://www.clcbio.com/tutorials. Watch

CHAPTER 2. TUTORIALS

42

2.1

Tutorial: Getting started

This brief tutorial will take you through the most basic steps of working with CLC Genomics Workbench. The tutorial introduces the user interface, shows how to create a folder, and demonstrates how to import your own existing data into the program. When you open CLC Genomics Workbench for the first time, the user interface looks like figure 2.1.

Figure 2.1: The user interface as it looks when you start the program for the first time. (Windows version of CLC Genomics Workbench. The interface is similar for Mac and Linux.) At this stage, the important issues are the Navigation Area and the View Area. The Navigation Area to the left is where you keep all your data for use in the program. Most analyses of CLC Genomics Workbench require that the data is saved in the Navigation Area. There are several ways to get data into the Navigation Area, and this tutorial describes how to import existing data. The View Area is the main area to the right. This is where the data can be 'viewed'. In general, a View is a display of a piece of data, and the View Area can include several Views. The Views are represented by tabs, and can be organized e.g. by using 'drag and drop'.

2.1.1

Creating a a folder

When CLC Genomics Workbench is started there is one element in the Navigation Area called CLC_Data1 . This element is a Location. A location points to a folder on your computer where your data for use with CLC Genomics Workbench is stored. The data in the location can be organized into folders. Create a folder: File | New | Folder (
1

If you have downloaded the example data, this will be placed as a folder in CLC_Data

CHAPTER 2. TUTORIALS or Ctrl + Shift + N ( + Shift + N on Mac)

43

Name the folder 'My folder' and press Enter.

2.1.2

Import data

Next, we want to import a sequence called HUMDINUC.fsa (FASTA format) from our own Desktop into the new 'My folder'. (This file is chosen for demonstration purposes only - you may have another file on your desktop, which you can use to follow this tutorial. You can import all kinds of files.) In order to import the HUMDINUC.fsa file: Select 'My folder' | Import ( desktop | Select ) in the Toolbar | navigate to HUMDINUC.fsa on the

The sequence is imported into the folder that was selected in the Navigation Area, before you clicked Import. Double-click the sequence in the Navigation Area to view it. The final result looks like figure 2.2.

Figure 2.2: The HUMDINUC file is imported and opened.

2.2

Tutorial: View sequence

This brief tutorial will take you through some different ways to display a sequence in the program. The tutorial introduces zooming on a sequence, dragging tabs, and opening selection in new view. We will be working with the sequence called pcDNA3-atp8a1 located in the 'Cloning' folder in the Example data. Double-click the sequence in the Navigation Area to open it. The sequence is displayed with annotations above it. (See figure 2.3).

CHAPTER 2. TUTORIALS

44

Figure 2.3: Sequence pcDNA3-atp8a1 opened in a view. As default, CLC Genomics Workbench displays a sequence with annotations (colored arrows on the sequence like the green promoter region annotation in figure 2.3) and zoomed to see the residues. In this tutorial we want to have an overview of the whole sequence. Hence; click Zoom Out ( sequence ) in the Toolbar | click the sequence until you can see the whole

This sequence is circular, which is indicated by << and >> at the beginning and the end of the sequence. In the following we will show how the same sequence can be displayed in two different views one linear view and one circular view. First, zoom in to see the residues again by using the Zoom In ( ) or the 100% ( ). Then we make a split view by: press and hold the Ctrl-button on the keyboard ( ( ) at the bottom of the view on Mac) | click Show as Circular

This opens an additional view of the vector with a circular display, as can be seen in figure 2.4. Make a selection on the circular sequence (remember to switch to the Selection ( tool bar) and note that this selection is also reflected in the linear view above. ) tool in the

2.3

Tutorial: Side Panel Settings

This brief tutorial will show you how to use the Side Panel to change the way your sequences, alignments and other data are shown. You will also see how to save the changes that you made in the Side Panel . Open the protein alignment located under Protein orthologs in the Example data. The initial view of the alignment has colored the residues according to the Rasmol color scheme, and the

CHAPTER 2. TUTORIALS

45

Figure 2.4: The resulting two views which are split horizontally. alignment is automatically wrapped to fit the width of the view (shown in figure 2.5). Now, we are going to modify how this alignment is displayed. For this, we use the settings in the Side Panel to the right. All the settings are organized into groups, which can be expanded / collapsed by clicking the name of the group. The first group is Sequence Layout which is expanded by default. First, select No wrap in the Sequence Layout. This means that each sequence in the alignment is kept on the same line. To see more of the alignment, you now have to scroll horizontally. Next, expand the Annotation Layout group and select Show Annotations. Set the Offset to "More offset" and set the Label to "Stacked". Expand the Annotation Types group. Here you will see a list of the types annotation that are carried by the sequences in the alignment (see figure 2.6). Check the "Region" annotation type, and you will see the regions as red annotations on the sequences. Next, we will change the way the residues are colored. Click the Alignment Info group and under Conservation, check "Background color". This will use a gradient as background color for the residues. You can adjust the coloring by dragging the small arrows above the color box.

CHAPTER 2. TUTORIALS

46

Figure 2.5: The protein alignment as it looks when you open it with background color according to the Rasmol color scheme and automatically wrapped.

Figure 2.6: The Annotation Layout and the Annotation Types in the Side Panel.

2.3.1

Saving the settings in the Side Panel

Now the alignment should look similar to figure 2.7. At this point, if you just close the view, the changes made to the Side Panel will not be saved. This means that you would have to perform the changes again next time you open the alignment. To save the changes to the Side Panel, click the Save/Restore Settings button ( ) at the top of the Side Panel and click Save Settings (see figure 2.8). This will open the dialog shown in figure 2.9.

CHAPTER 2. TUTORIALS

47

Figure 2.7: The alignment when all the above settings have been changed.

Figure 2.8: Saving the settings of the Side Panel.

Figure 2.9: Dialog for saving the settings of the Side Panel. In this way you can save the current state of the settings in the Side Panel so that you can apply them to alignments later on. If you check Always apply these settings, these settings will be applied every time you open a view of the alignment. Type "My settings" in the dialog and click Save.

2.3.2

Applying saved settings

When you click the Save/Restore Settings button ( ) again and select Apply Saved Settings, you will see "My settings" in the menu together with some pre-defined settings that the CLC Genomics Workbench has created for you (see figure 2.10). Whenever you open an alignment, you will be able to apply these settings. Each kind of view has its own list of settings that can be applied. At the bottom of the list you will see the "CLC Standard Settings" which are the default settings for the view.

CHAPTER 2. TUTORIALS

48

Figure 2.10: Menu for applying saved settings.

2.4

Tutorial: GenBank search and download

The CLC Genomics Workbench allows you to search the NCBI GenBank database directly from the program, giving you the opportunity to both open, view, analyze and save the search results without using any other applications. To conduct a search in NCBI GenBank from CLC Genomics Workbench you must be connected to the Internet. This tutorial shows how to find a complete human hemoglobin DNA sequence in a situation where you do not know the accession number of the sequence. To start the search: Search | Search for Sequences at NCBI ( )

This opens the search view. We are searching for a DNA sequence, hence: Nucleotide Now we are going to adjust parameters for the search. By clicking Add search parameters you activate an additional set of fields where you can enter search criteria. Each search criterion consists of a drop down menu and a text field. In the drop down menu you choose which part of the NCBI database to search, and in the text field you enter what to search for: Click Add search parameters until three search criteria are available | choose Organism in the first drop down menu | write 'human' in the adjoining text field | choose All Fields in the second drop down menu | write 'hemoglobin' in the adjoining text field | choose All Fields in the third drop down menu | write 'complete' in the adjoining text field

Figure 2.11: NCBI search view.

CHAPTER 2. TUTORIALS Click Start search ( ) to commence the search in NCBI.

49

2.4.1

Searching for matching objects

When the search is complete, the list of hits is shown. If the desired complete human hemoglobin DNA sequence is found, the sequence can be viewed by double-clicking it in the list of hits from the search. If the desired sequence is not shown, you can click the 'More' button below the list to see more hits.

2.4.2

Saving the sequence

The sequences which are found during the search can be displayed by double-clicking in the list of hits. However, this does not save the sequence. You can save one or more sequence by selecting them and: click Download and Save or drag the sequences into the Navigation Area

2.5

Tutorial: De novo assembly and BLAST

This tutorial takes you through some of the tools for a typical de novo sequencing work flow with a data set from a high-throughput sequencing machine. As an example we use an E. coli data set consisting of a little more than 400,000 reads from a 454 sequencer. 2

2.5.1

Importing the data

If you don't already have this sample data set, download the data set from our web site: http: //download.clcbio.com/testdata/raw_data/454.zip. Unzip the file somewhere on your computer (e.g. the Desktop). Start the CLC Genomics Workbench and import the data: File | Import High-throughput Sequencing | Roche 454 This will bring up the dialog shown in figure 2.12 Select the Ecoli.FLX.fna and Ecoli.FLX.qual files that come from the downloaded zip file. Make sure the Remove adapter sequence checkbox is checked and that the Paired reads checkbox is NOT checked. The option to discard read names is not significant in this context because of the relatively small amount of reads. Click Next, choose to Save and click Finish. After a short while, the reads will be imported.

2.5.2

Assembly

The first step is to do a de novo assembly of the reads. Briefly explained, this means that we want the CLC Genomics Workbench to create longer contiguous sequences out of the relatively short reads that are on average 235 bp long:
Note that there are special system requirements for CLC Genomics Workbench, see http://www.clcbio.com/ index.php?id=72
2

CHAPTER 2. TUTORIALS

50

Figure 2.12: Choosing the file you wish to import. Toolbox | High-throughput Sequencing ( This shows the dialog in figure 2.13. ) | De Novo Assembly ( )

Figure 2.13: Select sequence list containing the reads. Select the Ecoli.FLX ( and Finish. ) sequence list and add it to the panel to the right. Click Next, Next ) button.

For information about the settings, click the Help (

The assembly will take several minutes. There are two steps in the assembly process. In the first step, contig sequences are created by assembling all the reads. Second, all the reads are

CHAPTER 2. TUTORIALS

51

mapped back using the contig sequences as references. This is done to create an alignment of all the reads (if you only wish to see the contiguous sequences without the reads, you should choose Create simple contig sequence before you clicked Finish). The result of the assembly is a mapping table as shown in figure 2.14.

Figure 2.14: A mapping table. Each row in the table represents a contig. There should be around 200 contigs (the number can vary a little from version to version). Double-clicking a row will open the contig with the mapped reads.

2.5.3

BLAST the results

One way to investigate the contigs would be to see if there are any similar sequences in public databases. This can be done using the BLAST program suite. In this tutorial we will run a BLAST search of five of our contigs against data held at the NCBI. You need to be connected to the internet to do this tutorial. First, sort the table according to the contig length by clicking the Length of consensus sequence column header. Now find the contigs that are just above 10,000 nucleotides. Select the five first as shown in figure 2.15. Then click the Open Contig button at the bottom of the table. That will create a sequence list with the five contig sequences that you have selected. To BLAST these sequences, first make sure the sequence list with the five contigs has been Saved ( ). Then: Toolbox | BLAST Search ( ) | NCBI BLAST ( )

Select the sequence list that you have saved and click Next. To be completely open in terms of what kind of data there is in the sequences, choose the Nucleotide collection database (see figure 2.16). Click Next and leave the settings at their default (to make sure the settings are back to default, click the Reset to CLC Standard Settings ( ) button). Click Next again and Finish

CHAPTER 2. TUTORIALS

52

Figure 2.15: Selecting five contigs that are just above 10,000 nucleotides long.

Figure 2.16: Selecting the Nucleotide collection (nr) database. The result is shown in figure 2.17. For each contig, you can see the description of the top hit which is E. coli str. K12 in all cases. If you wish to inspect the individual BLAST results in more detail, simply double-click the row and the BLAST result will open. If you wish to use the result for reporting, e.g. in a spread-sheet, you can Copy ( ) the contents of the table and paste into e.g. a spreadsheet for further processing. To select all the rows in the table, press Ctrl + A ( +A on Mac). You can also use the filter at the top to sort the table (e.g. to only show BLAST results with an E-value lower than a certain threshold).

2.6

Resequencing tutorial: Map reads to reference followed by SNP and DIP detection

This tutorial takes you through some of the tools for analyzing a typical resequencing data set from a high-throughput sequencing machine. As an example we use an E. coli data set consisting

CHAPTER 2. TUTORIALS

53

Figure 2.17: The overview BLAST table. of a little more than 400,000 reads from a 454 sequencer. 3

2.6.1

Importing the data

First, download the data set from our web site: http://download.clcbio.com/testdata/ raw_data/454.zip. Unzip the file somewhere on your computer (e.g. the Desktop). Start the CLC Genomics Workbench and import the data: File | Import High-throughput Sequencing | Roche 454 This will bring up the dialog shown in figure 2.18 Select the Ecoli.FLX.fna and Ecoli.FLX.qual files that come from the downloaded zip file. Make sure the Remove adapter sequence checkbox is checked and that the Paired reads checkbox is NOT checked. The option to discard read names is not significant in this context because of the relatively small amount of reads. Click Next, choose to Save and click Finish. After a short while, the reads have been imported. Next, import the reference genome sequence also included in the zip file: File | Import ( ) | Locate "NC_010473.gbk" | Select

Note that this is a genbank file imported using the "normal" import tool. Next-generation sequencing data needs to be imported using the special tool in the toolbox because they have a more complex structure (e.g. in this case two files - one with sequence and one with quality scores).
Note that there are special system requirements for CLC Genomics Workbench, see http://www.clcbio.com/ index.php?id=72
3

CHAPTER 2. TUTORIALS

54

Figure 2.18: Choosing what kind of data you wish to import.

2.6.2

Mapping the reads to the E. coli reference

)|

First step in the analysis is to map the reads to the reference genome: Select the Ecoli.FLX sequence list | Toolbox | High-throughput Sequencing ( Map Reads to Reference ( ) This shows the dialog in figure 2.19).

Figure 2.19: Select sequence list containing the reads. The reference sequence will be selected in the next step. Select the Ecoli.FLX ( ) sequence list and add it to the panel to the right. Clicking Next will

CHAPTER 2. TUTORIALS allow you to select a reference sequence as shown in figure 2.20.

55

Figure 2.20: Specifying the reference sequences and masking. At the top you select the NC_010473 ( ) by clicking the Browse and select element ( ) button. You can select either single sequences or a list of sequences as reference sequences, but in this case just select this single genome sequence. Clicking Next until you see the dialog shown in figure 2.21 (for more information about the other settings, please click the Help ( ) button).

Figure 2.21: Output options. Here you can select between different output options. Choose to Create report and Create list of non-mapped reads. Click Finish.

CHAPTER 2. TUTORIALS

56

2.6.3

Interpreting the read mapping results

You can follow the mapping progress both in the status bar at the bottom left corner and the log (if you have chosen to show the log in figure 2.21). When the process is done, you will see the following results as tabs: List of non-mapped reads ( ) These are the reads that did not match the reference sequence. You can use this list to investigate contamination in the sample or structural differences between the sequencing data and the reference sequence. Typically you will do a de novo assembly of these reads and then use BLAST to investigate the contigs (there is a separate tutorial showing how to do this). Report ( ) The report shows information about the mapping. Most importantly, it shows the number of reads that matched the reference sequence. Mapping ( ) The mapping itself shows the alignment of all the reads to the reference. We are going into details with the mapping now. Click the mapping tab ( ) The mapping (shown in figure 2.22) displays the reads including quality scores. For annotated reference sequences like this, you can display the translation of the coding regions (the yellow CDS annotations) in the Side Panel in the Nucleotide info group under Translation. (If you scroll a little to the right, you can see the first translation).

Figure 2.22: The reads mapped to the reference. You can use the zoom buttons for zooming in and out, and you can scroll along the reference (both horizontally and vertically to inspect the reads covering the region of the view). The Side

CHAPTER 2. TUTORIALS

57

panel includes a lot of settings to change the appearance of the mapping, and there are a few that are particularly good to know: Sequence layout -- Compactness This is used to determine the height of the reads (show/hide the sequence and quality information). This is very useful to get an overview when the reads themselves are not important. Alignment info -- Coverage Displays a graph of the coverage. There are more relevant graphs under the Alignment info group. The read colors are green (forward) and red (reverse) by default. Before we continue be sure to Save ( ) the results.

2.6.4

Looking for SNPs

One way of inspecting the result is of course to go through the mapping manually, guided by the annotations on the reference sequence. Given the huge amounts of data, manual inspection is only advisable if you have special loci that you are interested in. For a more systematic approach, the CLC Genomics Workbench provides two tools: SNP and DIP detection to help you get an overview of the differences between the reference sequence and the reads. We first look at SNP detection: Toolbox | High-throughput Sequencing ( ) | SNP detection ( )

This opens a dialog where you can select the mapping result ( Clicking Next will display the dialog shown in figure 2.23

) you saved before.

Figure 2.23: SNP detection parameters. The default settings work well for this data set, but it is important to notice two of the settings that you should always consider when working with your own data: If the Minimum coverage is set to 4 but you have a mapping with an average coverage of 2, a lot of potential SNPs will not

CHAPTER 2. TUTORIALS

58

be reported. The Minimum variant frequency should also be set, especially when working with mixed samples or non-haploid organisms (e.g. for diploids, it should be set below 50 % in order to report heterozygote SNPs). For this analysis we leave the setting at 35 %. For more information about the settings, click the Help ( Click Next and Finish. The result of the SNP detection will now open a table as displayed in figure 2.24 below the mapping. ) button.

Figure 2.24: A table of SNPs. By clicking in the table, you can browse through the SNPs. If you open the SNP result table and the read mapping view at the same time in a horizontally split view, the table and mapping view will be linked: double clicking on a row in the SNP table will take to that position in the read mapping view. You can Copy ( ) the contents of the table and paste into e.g. a spreadsheet for further processing. To select all the rows in the table, press Ctrl + A ( +A on Mac). You can also Export ( ) the table in Excel format. You can also use the filter at the top to sort the table, e.g. to show only nonsynonymous SNPs (filter the Amino acid change column to not being empty as shown in figure 2.25). Figure 2.25: Filtering the SNP table to only display nonsynonymous SNPs.

2.6.5

Looking for DIPs

Besides looking for SNPs, you can also do a systematic search for DIPs (Deletion-Insertion Polymorphisms). If you have high coverage in your mapping, you will often find a lot of gaps in the consensus sequence. This is because just a single insertion in one of the reads will cause

CHAPTER 2. TUTORIALS

59

a gap in all other sequences at this position. The majority of all these gaps should simply be ignored, because they are introduce by single or very few reads because of sequencing errors. The automated DIP detection can be used to find the ones that are significant. If you want to use the consensus sequence for other purposes, you can simply ignore all the gaps (they will disappear once the consensus sequence is used outside the mapping), and the significant ones can then be annotated as DIPs: Toolbox | High-throughput Sequencing ( ) | DIP detection ( )

This opens a dialog where you can select the mapping result ( Clicking Next will display the dialog shown in figure 2.26

) you saved before.

Figure 2.26: DIP detection parameters. The default settings work well for this data set. For more information about the settings, click the Help ( Click Next and Finish. The result of the DIP detection will now open a table as displayed in figure 2.27 below the mapping. By clicking in the table, you can browse through the DIPs. As with the SNP table, if you open the DIP result table and the read mapping view at the same time in a horizontally split view, the table and mapping view will be linked: double clicking on a row in the DIP table will take to that position in the read mapping view. You can Copy ( ) the contents of the table and paste into e.g. a spreadsheet for further processing. To select all the rows in the table, press Ctrl + A ( +A on Mac). You can also use the filter at the top to sort the table. Note: 454 data has an inherent flaw when it comes to homopolymer stretches. This means that the exact number of bases reported in a homopolymer stretch is not always right. This gives ) button.

CHAPTER 2. TUTORIALS

60

Figure 2.27: A table of DIPs. rise to a lot of small insertions and deletions in a data set like this. When you browse through the DIPs in the table, you will see that most of them are single-base insertions or deletions at the end of a homopolymer stretch. You can sort by length to see some of the longer and more interesting insertions/deletions.

2.7

Map reads to reference in details

This tutorial goes into detail with read mapping of the CLC Genomics Workbench. Whereas the Resequencing tutorial shows the overall work flow including read mapping, this tutorial will go into much more detail about the mapping algorithm. You will learn what the parameters mean, and you will hopefully end up being able to make better decisions about the analysis of your own data. We recommend going through the resequencing tutorial first, since it includes the basic introduction to this topic. Find it at http://www.clcbio.com/tutorials. In this tutorial we use a subset of an E. coli data set where we focus on a small part of the genome and use a combination of 454 and Illumina GA reads.

2.7.1

Importing the data

First, download the data set from our web site: http://download.clcbio.com/testdata/ Read_mapping_details_tutorial.zip. Start the CLC Genomics Workbench and Import ( ) the file. You will now have a folder structure like the one shown in figure 2.28.

2.7.2

Mapping long reads

The CLC Genomics Workbench uses two different algorithms for mapping reads to a reference depending on the read length. First, we consider long reads. Reads are defined as "long" when

CHAPTER 2. TUTORIALS

61

Figure 2.28: The data set consisting of reference sequence (subset of genome) and three sets of sequencing reads. they are longer than 55 bp. First, map the reads with standard settings using the Long reads, 454 as input and the NC_010473 subset as reference. You can set the parameters to default by clicking the button ( ) at the bottom of the dialog. You do not need to create a log in the last step before you click Finish. Deselect all Annotation types except Repeat region. To save these adjustments so that they take effect next time you open a mapping, click the Save/Restore Settings button ( ) at the top of the Side Panel and click Save Settings. Give your settings a name and make sure the check box to Always apply these settings is checked. Now under Annotation types, select the repeat region type, zoom out so that you have a view similar to the one shown in figure 2.29 and go to around position 2060.

Figure 2.29: Mapping reads to a repeat region.

CHAPTER 2. TUTORIALS

62

Note that there is something special going on just at the border between the two annotated repeat regions. If you Zoom in ( ) to see the details, you can see that for many reads, the end of the read is faded. This is because this part of the read was not aligned to the reference during mapping. On closer inspection you can see that this part of the read doesn't match the reference sequence (figure 2.30).

Figure 2.30: Unaligned ends. The reason why you see this is because the CLC Genomics Workbench performs local alignment of the reads. This means that it only aligns the part of the read that matches well -- the rest is left unaligned. Mapping long reads in CLC Genomics Workbench is a two-step process: 1. For each read, the optimal local alignment between the read and the reference sequence is found. 2. Second, all reads are filtered according to user-defined criteria for length and similarity of the local alignment To illustrate this, repeat the read mapping but this time adjust the Length fraction to 1 as shown in figure 2.31. This means that the reads will be filtered so that only reads matching in their entire length will be included in the mapping. Finish the read mapping with this setting and see how it affects the same region. As expected, all the reads with un-aligned ends are gone (see figure 2.32), and you are left with less reads (the coverage is around half compared to figure 2.29). If you go back and look at figure 2.30, you can see that besides the unaligned ends, there are also a number of mismatches in the reads. These mismatches are internal to the local alignment,

CHAPTER 2. TUTORIALS

63

Figure 2.31: Stricter alignment settings.

Figure 2.32: Stricter alignment settings result in fewer reads mapped. whereas the unaligned ends were outside the local alignment. Just as with the unaligned ends, you can control the level of similarity between reads and reference using the Similarity setting (see figure 2.31). Run the mapping again, this time with a Similarity of 1. Set the Length fraction back to 0.5. You would now expect to have removed all the reads that contain mismatches. But if you look at the result, you will see that this is not the case. Figure 2.33 shows an example around position 2250, where several reads contain mismatches. The reason why you see this is that we have set the Length fraction back to 0.5. This means that we have accepted that half the read should match perfectly to the reference. The other half is allowed to diverge from the reference.

CHAPTER 2. TUTORIALS

64

Figure 2.33: Still mismatches although similarity was set to 1. Besides the Length fraction and Similarity, you can also specify gap and mismatch costs (see figure 2.31). These determine how the initial local alignment should be performed. Setting a low mismatch cost and high insertion/deletion costs will favor mismatches over gaps in the local alignment. We are not going into details with these settings in this tutorial.

2.7.3

Mapping short reads

As mentioned in the beginning, the CLC Genomics Workbench uses two different algorithms for mapping, depending on the read length. We will now take a look at the short reads. In order to show how different settings affect the result, we are going to perform one round of read mapping with very strict settings, requiring a perfect match, and we will then take the unmapped reads and map them with more relaxed settings. First, close the open views by pressing Ctrl + Shift + W ( + Shift + W on Mac). You do not need to save the results. Select the Short single reads, Illumina GA and open the read mapping dialog. Use the same reference sequence as before. In the third step, set Limit to 1 and check the Global alignment checkbox (see figure 2.34). Note that we will come back to have a closer look at these settings later, but to summarize it means that we require a perfect match for the full read. Go to the last step and check the Create list of non-mapped reads. The result of the mapping will this time be the mapping itself and a list of the reads that didn't match the reference. Save this list and do a new round of read mapping with this list as input. This time, raise the Limit to the maximum of 11, uncheck Fast ungapped alignment (see figure 2.35) and uncheck Global alignment. This is the most relaxed setting we can make which allows mismatches, gaps and unaligned ends (explained in detail below). We now have a mapping with reads that do not match the reference perfectly. If you go to the same position on the reference sequence as we examined before (2060), you can see what this means for the alignment of the reads (see figure 2.36). First of all, this means that some reads have mismatches (see the top read in figure 2.36 which has two mismatches). Second, it means that there are un-aligned ends just like we saw when

CHAPTER 2. TUTORIALS

65

Figure 2.34: Very strict alignment settings for short reads.

Figure 2.35: Very relaxed alignment settings for short reads. aligning the long reads. With the strict mapping settings in figure 2.34, we selected the global alignment option which means that no unaligned ends are accepted, no matter how the Limit is set. But with the relaxed settings, we are doing local alignment (as you can see from figure 2.35). To explain what kind of mismatches and unaligned ends that are accepted, we need to inspect the details of the short read mapping algorithm. It is based on a scoring system where a match is rewarded one point. The other scores for mismatch, insertion and deletion can be adjusted in Match +1 (cannot be changed) Mismatch 2 the dialog (see figure 2.35). The defaults are: Deletion 3 Insertion 3 Let's take a few examples and calculate the score of an alignment. Below is a read of 20 bp

CHAPTER 2. TUTORIALS

66

Figure 2.36: Alignment of non-perfect matches. perfectly aligned to the reference. The score is thus 20. CGTATCAATCGATTACGCTATGAATG |||||||||||||||||||| ATCAATCGATTACGCTATGA

20

If we introduce a mismatch in the middle, we subtract 2 from the score. In addition, we also lose a match (we only have 19 matches left), so the score ends up at 17: CGTATCAATCGATTACGCTATGAATG |||||||| ||||||||||| ATCAATCGGTTACGCTATGA

17

If we have a mismatch near the end, we will simply exclude this base from the alignment. This means that we do not consider it as a mismatch but only one base less in the alignment. So the score ends at 19: CGTATCAATCGATTACGCTATGAATG ||||||||||||||||||| TTCAATCGATTACGCTATGA

19

As an exercise, we have listed a few alignments where you can calculate the score yourself (see answers in the foot note).4
4

Answers: A=15, B=13, C=12

CHAPTER 2. TUTORIALS

67

CGTATCAATCGATTACGCTATGAATG ||||||| |||||||||| CTCAATCGGTTACGCTATGA CGTATCAATCGATTACGCTATGAATG ||||||| |||| |||||| TTCAATCGGTTACCCTATGA CGTATCAATCGATTACGCTATGAATG ||||||| |||| ||||| TTCAATCGGTTACCCTATGC

The alignment score is then compared to the read length, and the read is accepted if the difference does not exceed the Limit you specify in the dialog (e.g. 11 in figure 2.35). Example A above with a read length of 20 and a score of 15 would be accepted if the limit is 5 or higher. With the default settings where the limit is 8, it means that up to 2 mismatches are allowed or that 8 bases can be left un-aligned.

2.7.4

Making use of paired information

Perform a new round of read mapping with the Short single reads, Illumina GA data set using default parameters. You can set the parameters to default by clicking the button ( ) at the bottom of the dialog. In the result scroll to around position 2100. Here you will see reads colored in yellow (see figure 2.37).

Figure 2.37: Alignment of non-specific hits. The yellow color means that these reads could have been matched equally well other places on

CHAPTER 2. TUTORIALS

68

the reference sequence. They are what we call Non-specific matches. We see this because the reference sequence includes repetitive regions. You can show a graph of the frequency of non-specific matches in the Side Panel under Alignment info. Zoom out and you will see a view as shown in figure 2.38.

Figure 2.38: Showing a graph of the frequency of non-specific hits. This graph shows the percentage of the aligned reads that are non-specific. You can Zoom in ( ) by dragging a rectangle around one of the peaks to see the placement of the reads. The reads in this data set are very short -- only 35 bp. Until now we have been working with the Short single reads, Illumina GA data set, but let's see what happens if we do the same thing with the paired data set. Perform a new round of mapping with default parameters with the Short paired-end reads, Illumina GA. This data set is identical to the single reads data set except for the paired information. Display the Non-specific reads graph and zoom out. Your view should now look like figure 2.39. Compared with the single reads data set, there are considerably less non-specific reads in this paired data set. This is because the Workbench now has much more information that can be used to place the reads unambiguously: The paired read has 70 bp and spans a region of approximately 215 bp of the reference sequence. Although the total number of base pairs are the same in the two data sets, the extra information in the paired read structure produces a mapping of much higher quality. The paired data can also be used to visualize genomic re-arrangements. You can read more about this in the user manual by searching for "Interpreting genomic re-arrangements".

2.8

ChIP sequencing: the basics

This tutorial takes you through a ChIP sequencing work flow using the CLC Genomics Workbench.

CHAPTER 2. TUTORIALS

69

Figure 2.39: The number of non-specific reads decreases dramatically when paired information is used. ChIP-Sequencing is used to analyze the interactions of proteins with genomic DNA. After a crossbinding step that tightly links proteins and DNA, ChIP-Seq uses chromatin immunoprecipitation (ChIP) to fish out the relevant pieces of genomic DNA. By subsequent massively parallel DNA sequencing and mapping to the reference genome it is possible to precisely identify binding sites of DNA-associated proteins. It can be used to precisely map global binding sites for any protein of interest but a practical limitation is the existence of good antibodies for the ChIP step. A natural next step bioinformatic analysis is to extract the binding regions and perform pattern discovery to learn about any conserved binding motif in the DNA. For further information, see the Wikipedia entry at http://en.wikipedia.org/wiki/Chip-Seq For this tutorial, we use an artificial data set which was used for a ChIP-seq analysis competition announced at http://seqanswers.com/forums/showthread.php?t=1039, known as the "ChIP-seq challenge". We only use a subset of the original data set for this tutorial, since the purpose is to learn the basic principles. The work flow consists of three parts: first, you import the data. Next, you map the reads to a reference. Finally, you use the ChIP sequencing tool to detect significant peaks in the sample. In this tutorial we will not go through the details of the ChIP-seq analysis. The user manual already explains the details of the algorithm: Click the Help ( ) button in the dialog (see below) to read this or go to http://www.clcbio.com/index.php?id=1330&manual= ChIP_sequencing.html.

2.8.1

Importing the data

First, download the data set from our web site: http://download.clcbio.com/testdata/ raw_data/chip-seq.zip. Unzip the file somewhere on your computer (e.g. the Desktop). Start the CLC Genomics Workbench and import the data: File | Import High-throughput Sequencing Data | Fasta This will bring up the dialog shown in figure 19.8

CHAPTER 2. TUTORIALS

70

Figure 2.40: When analyzing your own data, you would select the sequencing technology appropriate for your data. This data set consists of a fasta file, so you select Fasta. Select the ChIP-seq reads.fa file and make sure the Paired reads checkbox is NOT checked. The option to discard read names is not significant in this context because of the relatively small amount of reads. Click Next, Save the imported reads list and click Finish. After a short while, the 142,000 reads in the file have been imported. Next, import the reference genome sequence also included in the zip file: File | Import ( ) | Locate "NC_000021.gbk" | Select

Note that this is a genbank file imported using the "normal" import tool. Next-generation sequencing data needs to be imported using the special tool in the toolbox because they often have a more complex structure (in this case you could actually have used the normal import, because it is a simple fasta file).

2.8.2

Mapping the reads to the reference

) | Map Reads to Reference ( )

First step in the analysis is to map the reads to the reference genome: Toolbox | High-throughput Sequencing ( This shows the dialog in figure 2.41). Select the ChIP-seq reads ( ) sequence list and add it to the panel to the right. Clicking Next will allow you to select a reference sequence as shown in figure 2.42. At the top you select the NC_000021 ( ) by clicking the Browse and select element ( ) button. You can select either single sequences or a list of sequences as reference sequences, but in this case just select this single chromosome. Clicking Next to select the assembly settings as shown in figure 2.43.

CHAPTER 2. TUTORIALS

71

Figure 2.41: Select sequence list containing the reads. The reference sequence will be selected in the next step.

Figure 2.42: Specifying the reference sequences and masking. For ChIP-seq, we recommend stringent mapping settings as shown in figure 2.43. Setting the limit to 2 and mismatch cost to 1, you allow one mismatch per read or 2 un-aligned nucleotides at the ends. Since this data set is artificial, the settings are not important for the result of this tutorial, but when you work with your own data, this is important. For more information about the other settings, please click the Help ( ) button. Click Next and you will see the dialog shown in figure 2.44. In this dialog, select to ignore the non-specific matches. Click Next and Finish. You can follow the progress of the mapping both in the status bar at the bottom left corner and under the Processes tab. There is also a log showing the progress. Because of the quite big

CHAPTER 2. TUTORIALS

72

Figure 2.43: A stringent read matching is desired for ChIP-seq.

Figure 2.44: Selecting to ignore non-specific matches. reference sequence (Human chromosome 21, with a size of 47 Mbp), it takes a while to map5 . Save ( ) the result into a folder in the Navigation Area.

2.8.3

Running the ChIP sequencing analysis

The result of the read mapping is now used as input to the ChIP-seq function which surveys the pattern in coverage and read orientation to detect significant peaks: Toolbox | High-throughput Sequencing (
5

) | ChIP-Seq Analysis (

If you think it takes too long on your computer to finish, there is a smaller subset available at http: //download.clcbio.com/testdata/raw_data/chip-seq-subset.zip

CHAPTER 2. TUTORIALS This opens a dialog where you select the ChIP-Seq reads mapping ( ) and click Next.

73

Make sure that all parameters are set to default and click Next. You can set the parameters to default by clicking the button ( ) at the bottom of the dialog. Repeat this procedure until you can click Finish. Remember that you can get details of the ChIP-seq analysis from the user manual: Click the Help ( ) button to read this or read the advanced tutorial. As a result of the analysis, annotations are added to the reference sequence of the mapping input file where significant peaks are detected, and a table is displayed below the mapping. Click the first row in the table in order to jump to the corresponding position on the reference. Next, click Zoom out ( ) in the Toolbar and click 6-8 times in the view. Your screen should now look like figure 2.45.

Figure 2.45: A split view showing the peak table and the mapping. Note the nicely distributed green (forward) and red (reverse) reads for this peak. You can browse through all the 16 peaks found for this sample by selecting in the table. Since this is an artificial data set, we actually know what the results should be. If you go to the

CHAPTER 2. TUTORIALS

74

Side Panel and click Annotation types, you will find an annotation type called "Misc. binding". If you click that, the spiked-in peaks will be revealed on the reference sequence. You will see that all the peaks found by the CLC Genomics Workbench are covered by spike annotations (you can also see that in the table). There are a few spiked in peaks that are not found since these only contain a very small number of reads - you can browse through them by clicking the small arrow ( ) next to the checkbox.

2.9

ChIP sequencing: Understanding the details

This tutorial takes you through some of the details of the ChIP-seq analysis in the CLC Genomics Workbench. We recommend having a look at the basic ChIP-seq tutorial first (see http://www.clcbio.com/tutorials), since we will skip part of the work flow here.

2.9.1

Data set

The data set used derives from a study reported in Nielsen et al., 2008. In order to make the data set comprehendible and make the computing time and requirements low, the original full data set has been reduced. First of all, only one of the 18 samples have been used. It is the sample of PPAR on day 6. This sample has been mapped against the mouse refseq genome, and two regions of chromosome 7 have been taken out for use in this tutorial. The reference sequence used is 10 Mbp, and there are 23,600 reads of 32 bp each. The import and mapping was covered in the basic tutorial, so we proceed directly to the ChIP-seq analysis.

2.9.2

Getting the right layout

First, Import ( ) the chip-seq_pparg-subset.zip file that you can download from http: //download.clcbio.com/testdata/raw_data/chip-seq_pparg-subset.zip. Now, open the ChIP-sequencing analysis ( ) dialog from the Toolbox, select the mapping result and click Next. Make sure that all parameters are set to default. You can set the parameters to default by clicking the button ( ) at the bottom of the dialog. Uncheck the Shift reads based on fragment length setting at this step. Click Next and set parameters to default, click Next and set parameters to default, deselect the Make log checkbox, and click Finish. We will come back to learn more about the parameters later on. With these settings, you should be able to detect 14 peaks. When the result is opened, you need to do a few customizations to make it better suited for interpretation. In the Side Panel, under Text format, set the font size to small or tiny. Next, click Zoom out ( ) in the Toolbar and click 6-8 times in the view.

Your screen should now look like figure 2.46.

CHAPTER 2. TUTORIALS

75

Figure 2.46: The view has now been set up.

2.9.3

Looking for known genes

The paper comments on the gene perilipin (Plin), so we will now take a look at the binding sites surrounding that gene. In the peak table, simply type Plin into the Filter textbox, and you will now see one row in the table representing one peak located in an intron of Pex11a which sits next to Plin. Click the row to have the mapping view jump to see the peak. You can now inspect the peak and if you zoom out you will see the adjacent Plin and Pex11a genes. Note that there is also two peaks between the two genes that is not found by the ChIP-sequencing tool. We will get back to that later. Another gene commented in the paper is Pnpla2 gene. Type this into the filter, and you will see two rows. The filter is very simple - it searches all the information in the table for the text you have input. Since the Pnpla2 gene is represented in the columns for nearest gene 5' for one peak and as the nearest 3' gene in another peak, these two records are shown.

2.9.4

Going into detail with the parameters

Next, we will go through some of the settings for the ChIP-seq analysis. First, click the tab of the mapping in the upper view, and click Undo ( ). This removes the peak annotations of the mapping.

CHAPTER 2. TUTORIALS

76

Run the analysis again, but this time make sure to uncheck all check-boxes on step 3 except the Boundary refinement. All other options remain the same. The resulting table should report 110 peaks. Now sort the table on the Normalized difference column. The one with the highest difference has 2 forward reads and 13 reverse reads. Usually, a peak like that would not be trusted because you would expect roughly the same number of forward and reverse reads. When you run the ChIP-sequencing tool, you can enter a maximum limit for this value. The default is 0.4. You can see in the table that applying this setting would have excluded 14 peaks. Next, sort the table on Wilcoxon p-value. If you click the peak with a p-value of 0.75, you will see that the distribution of the reads is different from the other peaks we have seen (see figure 2.47).

Figure 2.47: A peak with a random distribution of forward and reverse reads leading to a high p-value. When the fragments from the ChIP are sequenced, they are sequenced from the ends which means that you would expect forward reads upstream of the binding site and reverse reads downstream. This peak has a very random distribution of the reads and that is the reason behind the high p-value. When we did the first round of analysis, we looked at the Plin gene and saw a peak in coverage

CHAPTER 2. TUTORIALS

77

that was not detected. Now that we have relaxed the parameters, we can go back and inspect the peaks again. Type in Plin in the filter text box. You can see that the peak just next to the start site of Plin is also detected. It has a p-value of 0.0008 and is thus above the default threshold of 0.0001 used in the first round of analysis. We recommend running the ChIP-sequencing analysis several times using different parameters to get an idea of the best setting. If you start by running an analysis with relaxed parameters (e.g. not using the Normalized difference or the distribution P-value) you will be able to do a visual inspection of the peaks that would otherwise have been excluded and by interpretation narrow down the right parameter settings.

2.9.5

Extracting the peak regions

Once you have decided on the right settings for the analysis, make sure that all existing peak annotations are removed (right-click and delete annotations of type binding site) before you run the final analysis. In this way, the annotations on the sequences are right. If you want to extract the sequence of the binding sites to do motif discovery, you can do this based on the binding site annotation. First, you need to download a plug-in to the Workbench called Extract annotations. You need to be connected to the internet to do this: Help Menu Bar | Plug-ins and Resources... ( )

Click the Download Plug-ins tab. This will display an overview of the plug-ins that are available for download. Find the Extract annotations plug-in and click Download and Install. A dialog displaying progress is now shown, and the plug-in is downloaded and installed. When you close the dialog, you will be asked whether you wish to restart the CLC Genomics Workbench. The plug-in will not be ready for use before you have restarted. When you have re-started you can now extract all the parts of your genome that are covered by a "Binding site" annotation. First, right-click the name of the reference sequence in the mapping view and click Open This Sequence. This is because annotations can only be extracted from a sequence alone - not a mapping view. Toolbox | General Sequence Analyses ( ) | Extract Annotations ( )

Click through using the default settings. You will now see a list of all the binding sites which you can e.g. Export ( ) in fasta format for use in a motif discovery tool.

2.10

RNA-Seq analysis part I: Getting started

This tutorial is the first part of a series of tutorials about RNA-Seq. The aim of the tutorials is to take you from start to end of an RNA-Seq analysis including mapping of reads, interpreting results, checking quality and finally doing statistical analysis. Along the way, we will focus on illustrating the effect of the parameters and choices made during the analysis. The data used is from a study reported in [Mortazavi et al., 2008]. The data set consists of RNA-Seq data from three types of Mouse tissue: Brain, Liver and Skeletal muscle. Each of the tissues has been sampled twice, so there are 6 samples all in all.

CHAPTER 2. TUTORIALS

78

2.10.1

Downloading and importing the data

At http://www.clcbio.com/ngsexampledata you find the following data: Subset of the full data set This file can be imported using the standard import and includes a subset of the full data set including a region of chromosome 16 for use as a reference. When running the full data set, we extracted all the reads that matched the genes of this part of chromosome 16. Download and import this data set (using the normal import) for use in these tutorials. Experiments with the full data set Later on, we will work on experiments generated from the full data set. Download and import this data set (using the normal import) for use in these tutorials. Once downloaded and imported, you should have the following folders and data in the Navigation Area (see figure 2.48).

Figure 2.48: The subset of the full data set has been imported together with the experiments generated from the full data set.

2.10.2

Running the RNA-Seq analysis

Now, you can start the actual analysis. The first step is to transform the list of reads into what we call an RNA-Seq sample. This is basically a list of genes with expression values. To do this, go to: Toolbox | High-throughput Sequencing ( ) | RNA-Seq Analysis ( )

This opens a dialog where you select the sequencing reads from the Brain spike sample, as shown in figure 2.49. Click Next when the data is listed in the right-hand side of the dialog. You are now presented with the dialog shown in figure 2.50. Since we are using (part of) the ref-seq annotated mouse genome, choose Use reference with annotations. Click ( ) to select the reference sequence NC_000082 subset. Click Next where you can set parameters for the mapping. Leave these settings at their default

CHAPTER 2. TUTORIALS

79

Figure 2.49: Selecting the Brain spikes sample for RNA-Seq analysis.

Figure 2.50: Choosing the annotated reference sequence. - we will focus on these later on. (You can set the parameters to default by clicking the button ( ) at the bottom of the dialog, but then you will have to define the reference sequence again). Clicking Next will show the dialog in figure 2.51. The choice between Prokaryote and Eukaryote is basically a matter of telling the Workbench whether you have introns in your reference. In order to select Eukaryote, you need to have reference sequences with annotations of the type mRNA (this is the way the Workbench expects exons to be defined). The reference sequence provided with this tutorial includes mRNA annotations (they are the green annotations), so you select Eukaryote in this wizard. Below you can specify settings for discovering novel exons. We will investigate this in detail later on. Clicking Next will allow you to specify the output options as shown in figure 2.52.

CHAPTER 2. TUTORIALS

80

Figure 2.51: Exon discovery.

Figure 2.52: Selecting the output of the RNA-Seq analysis. Uncheck the Create list of un-mapped reads, Create report and Make log and click Finish. The standard output is a table showing mapping statistics on each gene.

2.10.3

Interpreting the brain spikes analysis result

The result of the RNA-Seq analysis is shown in figure 2.53. The Expression values column is per default based on the RPKM. Change the measure to use Total exon reads instead by clicking at the bottom of the view (we will go into more details with expression measures in part II). Now sort the table on the new expression value by clicking the column header twice. Find the Ahsg gene (4th from the top of the list) and double-click.

CHAPTER 2. TUTORIALS

81

Figure 2.53: A table with expression values for all genes. When the result is open, you need to do a few customizations to make the view better suited for interpretation. In the Side Panel, under Text format, set the font size to small or tiny. To save these customizations so that they take effect next time you open a mapping, click the Save/Restore Settings button ( ) at the top of the Side Panel and click Save Settings. Give your settings a name and make sure the check box to Always apply these settings is checked. Double-click the tab of the view (or press Ctrl + M) to Maximize the view and click Fit Width ( ) in the tool bar to zoom out to see the full gene. You should now have a view similar to figure 2.54. You can now see distinct peaks of coverage below the exons which are marked in green. Scroll slowly down on the scroll bar at the right hand side of the view. You will begin to see reads that have been mapped across exon-exon boundaries. Click Zoom in ( ) and click-and-drag a rectangle around one of the exons. In this way you can zoom in to see more details of a particular exon. If you zoom all the way in, you will be able to see the nucleotide level and the alignment of the reads. Close the view and go back to the RNA-seq sample. In the 'Transcripts' column you can see that the Ahsg gene only has one transcript annotated. Use the Advanced filter ( ) at the upper right hand part of the RNA-seq sample table view) to identify genes with more than one transcript annotated (set the filter to Transcripts > 1 and press Apply as shown in figure 2.55). The Fetub gene has three transcripts annotated. Open the mapping for this gene and press Fit width ( ) to zoom out completely and get an overview of the mapping to this gene. One of the three transcripts annotated for Fetub uses a different first exon from the other two transcripts. There is no coverage in this exon at all, and thus no evidence for expression of the alternative first exon isoform. The other two transcripts have the same first exon but one skips the second exon of the other. You can see both reads that span from exon 2 to exon 3 and reads that span from exon 2 to exon 4. Thus, there is evidence for both of these splice variants (see

CHAPTER 2. TUTORIALS

82

Figure 2.54: The reads mapped to the Ahsg gene.

Figure 2.55: Using the advanced filter to only show genes with more than one annotated transcript. figure 2.56). Close the view and you are ready for part II: Non-specific matches and expression values.

2.11

RNA-Seq analysis part II: Non-specific matches and expression measures

This tutorial is the second part of a series of tutorials about RNA-Seq analysis. We continue working with the data set introduced in the first tutorial. In this tutorial we will first explain how non-specific matches are treated, and second we will

CHAPTER 2. TUTORIALS

83

Figure 2.56: Reads showing evidence for expression of two isoforms. explain the effect of using different expression measures.

2.11.1

Running the same data set with and without non-specific matches

Imagine a situation where you have nine reads that match equally well on two different genes. Since it is not possible to tell which transcript the reads actually came from, the Workbench has to decide where to place them. Based on other reads that are matched uniquely to the genes, the Workbench estimates the expression of each gene and use that as a weight to distribute the reads. In a situation where one of the genes have twice the number of unique matches, it will on average receive six of the nine reads whereas the other one would get three. Now, we will show the effect of including these non-specific matches in the analysis. In the analysis of the first tutorial, the Maximum number of hits for a read was set to 10. This means that all reads that match in 10 or fewer places will be included in the mapping, with multi-hitting reads being distributed as described above. Now, run a new RNA-Seq Analysis ( ) on the Brain spike sample, but this time set the Maximum number of hits for a read to 1. You find this setting in step 2 - leave the rest of the settings as they are. You will now end up with an RNA-Seq sample where all reads matching in more than one position are excluded. If you go to the History ( ) view of this new sample, you can see how many reads were not mapped. If you compare these numbers, you can see the first sample has 214631 unmapped reads whereas the second run without multihit reads has 226574 unmapped reads (figure 2.57).

CHAPTER 2. TUTORIALS

84

Figure 2.57: Comparing the history entries for the two samples. Save ( ) the two samples with meaningful names, e.g. including non-specific and only specific.

2.11.2

Comparing the data in a scatter plot

Now, we want to see what this difference means in terms of the expression values. In order to compare the two samples, we set up an experiment: Toolbox | Expression Analysis ( ) | Set Up Experiment ( )

Select the two RNA-Seq samples ( ) that you have just saved and click Next. Choose an un-paired, two-group experiment, set the Value to use in experiment to to Total exon reads and click Next. Name the groups including non-specific and only specific and click Next. Right-click each of the samples and assign it to the appropriate group. Click Finish. You will now have an experiment based on the two samples. We will go into more details with the experiment later - for now we are interested in looking at the scatter plot. Click the Scatter plot ( ) icon at the bottom of the view. At the bottom of the Side Panel you select the values to plot. Select including non-specific Total exon reads versus only specific Total exon reads, and you will see a view as shown in figure 2.58. The scatter plot now shows the expression levels of the two samples. Since the RNA-Seq analysis was run on the same data set with the only difference being the treatment of nonspecific matches, you can now see the direct effect of using and distributing the non-specific matches in this way. You can now see that many of the genes have close to identical expression measures (they are located along the x=y line in the plot), but there are some that show higher expression in the sample including non-specific matches. To see the outliers more clearly, set the Dot type under Dot properties in the Side Panel to Dot. The most outlying gene is Sept5. If you place your mouse on the dot as shown in figure 2.59,

CHAPTER 2. TUTORIALS

85

Figure 2.58: A scatter plot showing the effect of including non-specific matches in the expression measure. you can see the feature ID (gene name) and the x and y values of the dot.

Figure 2.59: Gene Sept5 is one of the genes showing a notable difference in expression. Open the including non-specific RNA-Seq sample and locate this gene by typing Sept5 in the filter at the top. Double-click to open the mapping. When you zoom out ( ) and scroll along to the end of the gene, you will see a lot of reads that are yellow. Yellow is the color used for non-specific reads. In this case, all these yellow reads are the ones contributing to a higher expression measure when you compare in the scatter plot. By looking at the gene annotations, you can also see the reason why there are so many nonspecific matches. As shown in figure 2.60, there is an overlapping gene near the end. This means that all the reads that map to this part of the Sept5 gene also map equally well to the beginning of the Gp1bb gene. These reads are then treated as non-specific matches.

CHAPTER 2. TUTORIALS

86

Figure 2.60: Gp1bb is overlapping the end of the Sept5 gene. If you opened the Gp1bb mapping you would also see the non-specific reads at the beginning where it overlaps with Sept5. Because we can see the overlap, we know why we have non-specific matches, but it could be that these reads would also match other places on the reference. It's easy to check if the same region is present other places in the reference by conducting a BLAST search: select the relevant part of the gene|right-click the selection|BLAST against Local Data ( ) This is illustrated in figure 2.61

Figure 2.61: BLAST against the reference. Close the BLAST dialog again since we are not going into details with BLAST search in this tutorial. Please read the BLAST tutorial to learn more about BLAST in CLC Genomics Workbench. The idea with BLASTing this selection would be to use the reference sequence as target and see how many hits you would find. In this case there is only one good hit, but if you have a region of non-specific matches that are not due to overlapping genes, you can use this approach to try to identify which other gene is "competing" for these reads. Close ( ) the mapping view, go back to the experiment and switch to the table view ( ). Enter Gp1bb in the filter and click with your mouse on the Gp1bb gene. Switch back to the scatter plot

CHAPTER 2. TUTORIALS ( ) and Gp1bb will now be high-lighted with a red color. Click Zoom in ( times on the gene to zoom in (see figure 2.62).

87 ) and click a couple of

Figure 2.62: Zooming in on the Gp1bb gene in the scatter plot. You can now see that this gene also exhibits differential expression between these two samples, but to a lesser degree than the Sept5 gene. Open the Gp1bb mapping from the including nonspecific sample, and you can see that there are fewer yellow reads than in the Sept5 mapping. As explained above, the non-specific reads are distributed according to the number of unique reads, and when you compare the two results, it is evident that there are many more unique reads in the Sept5 gene (you can easily see the difference in the RNA-Seq result table as shown in figure 2.63).

Figure 2.63: Comparing the number of unique reads between Gp1bb and Sept5. From the scatter plot in figure 2.58, it is obvious that the decision on whether to include non-specific matches or not is very important. For some genes, the difference in expression is highly significant. This trend becomes even more evident when looking at the full data set where the proportion of non-specific matches is even higher (with the full reference transcriptome, there is a greater chance of finding sequences that are represented more times, e.g. arising through gene duplications). It is hard to make general recommendations on how to treat non-specific matches. One of the pitfalls when including non-specific matches is that the number of unique matches can be too

CHAPTER 2. TUTORIALS

88

low to ensure a reliable distribution of the non-specific matches. One way of approaching this problem would be to run the same data set with different settings as shown in this tutorial. That will enable you to perform random checks of the genes whose expression is significantly altered, and you will be able to identify this kind of pattern. On the other hand, if you completely disregard non-specific reads, you may underestimate the expression levels of genes in gene families. We refer to [Mortazavi et al., 2008] for an in-depth discussion of this topic.

2.11.3

The RPKM expression measure

Normalizing for sample size The observations made from figure 2.58 lead to another important consideration when dealing with RNA-Seq analysis: you have to decide which expression measure you want to use. When you have several samples (as in this example with four different samples), these will have different numbers and qualities of reads. You will often see that there is quite a big difference between the samples in the number of reads that can be matched. This means that it can be hard to compare the expression of the same gene in different samples simply by looking at the number of reads matched (i.e. total exon reads). When comparing the groups including non-specific versus only specific total, you can see this effect too, since they have 213,569 and 199,189 mapped reads, respectively. This means that you have an asymmetry in the scatter plot when using total exon reads as the expression measure (see we could see in figure 2.58). There is another expression measure, RPKM (Reads Per Kilobase of exon model per Million mapped reads), which seeks to normalize for the difference in number of mapped reads between samples. We will now investigate RPKM in greater detail. Go back to the scatter plot in figure 2.58. Change the values to be plotted from total exon reads to RPKM for the two samples. You should now see a scatter plot as shown in figure 2.64.

Figure 2.64: The effect of including non-specific reads compared using RPKM. Where figure 2.58 showed either dots falling on the x = y axis or below, you now see dots falling primarily slightly above x = y axis or below. This is because the RPKM takes into account that the total number of mapped reads is higher in the including non-specific sample than in the only total exon reads specific sample. RPKM is defined as RPKM = mapped reads(millions)exon length (KB) .

CHAPTER 2. TUTORIALS

89

Let's investigate two of the genes in the scatter plot. First, identify the two genes at the top of the scatter plot --- one above the x = y axis, one below. One of them is the Sept5 gene that we have previously investigated. This still shows higher expression in the including non-specific sample because of the high number of non-specific matches. The other gene is Sst. Switch back to the experiment table ( ) and compare the total exon reads for both samples (you can deselect sample columns under Sample level in the Side Panel, that will ease the overview). The value is 6600 and 6514, respectively, so the number of total exon reads is almost identical. What is then the reason that the PRKM value is higher for the only specific sample? This is because this sample has a lower number of mapped reads, and the RPKM will thus be higher (see definition of RPKM above). Normalizing for transcript length In a sample, if two transcripts are present in the same number of copies, and the sequencing is unbiased, you would expect the same number of reads from each transcript. But if one transcript is short and the other is long, you would expect the long transcript to yield more reads. So if you wish to compare the expression of transcripts within the same sample, you need to take the transcript length into account. If you look at the definition of RPKM above, you can see that besides number of mapped reads, the exon length is also considered. The idea behind this is to make it possible to compare expression levels of different transcripts. Open the only specific sample and sort the table on total exon reads, you can see that the genes Abcc5 and Comt (number 15 and 16 from the top) have almost the same number of reads (2,916 and 2,892). However, their expression value measured in RPKM is 2,333.78 and 11,456.38, respectively (see figure 2.65).

Figure 2.65: Nearly the same number of total exon reads for two genes leads to widely different RPKM values because of the difference in transcript lengths. This is simply due to the difference in transcript length which you can also see in the table under Exon length (which sums the lengths of all the annotated exons). Close all open views, save the experiment, and you are ready for part III.

CHAPTER 2. TUTORIALS

90

2.12

RNA-Seq analysis part III: Exon discovery

This tutorial is the third part of a series of tutorials about RNA-Seq analysis. We continue working with the data set introduced in the first tutorial. In this tutorial we will focus on discovery of new putative exons.

2.12.1

Creating two samples for comparison

First, we will use two samples to find new putative exons expressed in one sample but not the other. In the previous tutorial, you have already created a sample called including non-specific. Rename this to Brain spikes. Then run three new RNA-Seq analyses with identical parameters but based on the Brain, Liver spike and Liver reads. Remember to change the Maximum number of hits for a read value back to 10. Save the results in the appropriate folders, and you should now have a folder structure like the one shown in figure 2.66.

Figure 2.66: Four samples have now been created. Now, set up an experiment with two groups, Brain and Liver and assign the four samples to the appropriate groups. Next, adjust the settings in the Side Panel and the Advanced filter ( ) to look like figure 2.67. To specify the Advanced filter, click the button ( ) at the top right corner of the view and click the Add new filter criterion ( ) button to add more criteria to the filter. Notice that we want all genes that have putative exons in at least one sample so we choose the Match any option for the filter. This view enables you to identify the patterns of putative exons across all the samples. You can see that there is not complete consistency between the replicates in each tissue - the brain spikes sample has in general more putative exons than the other brain sample. This may be due to a difference in the number of mapped reads for the two samples (213,569 vs 117,429). When there are less assembled reads, there will typically be less evidence for a putative exon, since you specify a minimum number of reads for a putative exon when you run the RNA-Seq analysis (default is 10).

CHAPTER 2. TUTORIALS

91

Figure 2.67: Comparing putative exons between the groups.

2.12.2

Identifying new and differentially expressed splice isoforms

If you take the gene at the top of the experiment, Bdh1, you can see that there is a putative exon in both of the brain samples but none in the liver samples. Now open the Brain spikes RNA-Seq result ( ) and open the Bdh1 mapping. Zoom out and you will be able to see the putative exon as shown in figure 2.68.

Figure 2.68: A putative exon in the brain sample. If you zoom more in, you can see a very clear signal with many reads mapping in this region. The coverage level is almost identical between this and the other exons in the gene, except the first one which has very low coverage. This could indicate an alternative start site of this transcript and it seems like this new isoform is prevalent in the brain tissue.

CHAPTER 2. TUTORIALS Open the liver spikes sample and look at the Bdh1 mapping (see figure 2.69).

92

Figure 2.69: In the liver sample, there is no putative exon. Notice that the peak seen in the putative exon region of the brain sample is completely absent in the liver sample (use the position on the reference sequence to guide you - the peak should have been around position 8500. You can also use the Search field in the Side Panel to find this position). In both samples there are reads spanning the junction between the first and second exons. When you look at the first exon, you can see that the liver sample has good coverage here which indicates that the splice isoform in liver is actually the one annotated, whereas, in addition to the annotated isoform, a new splice isoform may be expressed in the brain sample. Note that the reads within putative exons do not count in the total exon reads number (and as a consequence not in RPKM either). Also, reads are only mapped to exon-exon junctions of annotated mRNA transcripts. If you want to include these reads in the analysis, you need to annotate the original reference sequence with this new transcript by adding a new mRNA annotation which is identical to the existing one but with the new exon included. We cannot be sure that this is right, but judging from the coverage levels of the other exons, it would be a plausible explanation. Then run the RNA-Seq analysis again using the modified reference sequence. Close all open views, and you are ready for part IV.

2.13

RNA-Seq analysis part IV: Spikes and quality control

This tutorial is the fourth part of a series of tutorials about RNA-Seq analysis. We continue working with the data set introduced in the first tutorial, although in this tutorial we are no longer considering only a subset of the data. In this tutorial we will focus on quality control. First, we will examine spike-ins in the data set, and second you will learn about general quality control tools.

2.13.1

Inspecting the spike reads

The data set includes six samples that come from three groups corresponding to the three different types of tissue. Within each group of samples, one sample has six spike-in genes,

CHAPTER 2. TUTORIALS

93

where controlled amounts of mRNA from Arabidopsis and phage lambda templates have been introduced in the sample prior to sequencing. We will now inspect the six spike-in genes and check if they are expressed in the spiked samples only as we would expect. For this and the rest of the tutorial, we will work on the full data set. The data set is so large that on a powerful eight-core workstation computer with 32 GB RAM, it takes more than an hour to run one sample. Therefore, we have performed the analysis beforehand and included the final result with the files you downloaded in the first tutorial. The full RNA-Seq results with mappings of all the mouse genes take up too much space, so they are not included. Instead, we have set up experiments with all six samples. Open the experiment in the RPKM folder and type "spike" in the filter to only include the six spike genes (when we ran the full analysis, we made an artificial sequence called "Spike chromosome" containing the six spike genes). Next, click the IQR column header to sort the genes according to the interquartile range of expression. You should now have a view similar to figure 2.70.

Figure 2.70: Comparing the expression of the spikes. The important thing to check here is that we see expression of the spike genes in the spike samples but not in the rest. The six spike transcripts were added in different concentrations to the spike samples, and this is why we see the varying levels of expression. Select all six rows, and switch to the scatter plot ( ) to visualize this trend. Choose to compare expression value of Brain spikes and Brain, and you will be able to see some red points in the scatter plot. Change the Dot type to Dot in the Side Panel to see the red dots more clearly. The scatter plot is shown in figure 2.71. At first glance, you only see one clear outlier at the bottom, whereas the other red dot (or rather, 'dots') seem to have more similar expression in the two samples (close to zero in both). But if you Zoom in ( ) on these dots, you can see that 3 of them are outliers, although to a smaller extent (see figure 2.72).

CHAPTER 2. TUTORIALS

94

Figure 2.71: Comparing the expression of the spikes in a scatter plot.

Figure 2.72: Comparing the expression of the spikes in a scatter plot, zoomed in.

2.13.2

Checking within and between group variability

We have now confirmed that the spike controls look fine (you can check the other two groups in the scatter plot if you like). The next step in our quality control efforts is to check whether the overall variability of the samples reflect their grouping. In other words we want the samples from the same group to be relatively homogenous and distinguishable from the samples of the other groups.

CHAPTER 2. TUTORIALS Box plot

95

To examine and compare the overall distribution of the expression values in the samples you may use a Box plot ( ). Box plots can be used to get an overall impression of the locations of the distributions, and to some extend the spread of the distributions. First, create a box plot based on the RPKM-based experiment: Toolbox | Expression Analysis ( ) | Quality Control | Create Box Plot ( )

Select the experiment that is based on RPKM expression values and click Next and Finish. The box plot is shown in figure 2.73.

Figure 2.73: A box plot of the 6 samples in the experiment, colored by group. The median and mean lines (you can display the mean in the Side Panel) show the median and mean expression values in the samples and the boxes extend from the p'th to the 100-p'th percentile of the sets of expression values in the samples. Thus, the box plot view is rather sensitive to the choice of the percentile value, and you may get a better impression of how the distributions compare by trying different percentiles. The distributions of the expression values are dominated by a lot of really small values and much fewer but much larger values. To diminish the effect on the box plots of the few very high values, you can square root transform the values and create box plots for the transformed values. First, transform the values in the experiment: Toolbox | Expression Analysis ( ( ) ) | Transformation and Normalization | Transform

Select the experiment, click Next and select Square root transformation. Click Finish. Now, create a new box plot, but this time make sure to select Transformed expression values in the second step. Figure 2.74 shows the box plot before and after square root transformation.

CHAPTER 2. TUTORIALS

96

Figure 2.74: To the left: original box plot based on RPKM values. To the right: box plot based on square root transformed expression values. After square root transformation, the distributions appear more a bit more similar. Now, create similar box plots for the experiment based on total exon reads. You can see the result in figure 2.75 that again shows the box plot before and after square root transformation, this time based on total exon reads rather than RPKM.

Figure 2.75: To the left: original box plot based on total exon reads. To the right: box plot based on square root transformed expression values. Overall, the box plots indicate that the locations of the distributions of the expression values in the samples are similar both for RPKM and for Total Exon Reads, but there is considerable difference in the spread of the values. The distributions of RPKM values for samples for the same tissue are highly similar. This is expected, as the samples are technical replicates and the sample size is factored out in the RPKM (see part III of the tutorials). The high variability of the 'Total exon reads' counts is obviously related to the numbers of (mapped) reads in the samples. Principal component analysis (PCA) We continue to work with the experiment based on RPKM expression values. Next, we perform a Principal Component Analysis (PCA):

CHAPTER 2. TUTORIALS Toolbox | Expression Analysis ( ( ) ) | Quality Control | Principal Component Analysis

97

Select the experiment, click Next and Finish. This will create a PCA plot as shown in figure 2.76.

Figure 2.76: A principal component analysis colored by group. The plot shows the projection of the samples onto the two-dimensional space spanned by the first and second principal component. (These are the orthogonal directions in which the data exhibits the largest and second-largest variability). The dots are colored according to the groups, and they group very nicely in the plot (the two red red dots are on top of each other). You can display the names of the samples in the plot using the settings under Dot properties in the Side Panel to the right of the view (see the result in figure 2.77).

Figure 2.77: Displaying the sample names. This PCA was done on RPKM-based expression values. As you saw in the previous tutorial, the RPKM normalizes for the sample size. In order to show the importance of doing this for this kind of analysis, perform a new PCA on the experiment located in the total exon reads folder.

CHAPTER 2. TUTORIALS The result is shown in figure 2.78.

98

Figure 2.78: PCA plot using total exon reads. Although the replicates still group together, the grouping is not near as clear as in figure 2.77 which uses the RPKM-based expression values. Hierarchical clustering In order to complement the principal component analysis, we will also do a hierarchical clustering of the samples to see if the samples cluster in the groups we expect: Toolbox | Expression Analysis ( Samples ( ) ) | Quality Control | Hierarchical Clustering of

Select the experiment from the RPKM folder and click Next. Leave the parameters at their default and click Finish. This will display a heat map showing the clustering of samples at the bottom (see figure 2.79). The replicates cluster nicely together as expected, and it looks like the pattern of expression is more similar between brain and liver than between muscle and the other two groups. Note that the heat map is not a new element to be stored in the Navigation Area - it is just another way of looking at the experiment (note the buttons to switch between different views in figure 2.80. As a conclusion to this fourth tutorial on RNA-Seq, we can confirm that the spike signals are clear and unambiguous, and we can conclude that both the PCA and hierarchical clustering shows that the replicates are fairly homogenous. Just as in the previous tutorial, we can see the effect of using RPKM over total exon reads as expression measure. When doing this kind of quality control, it may be advisory to use the RPKM expression value as this is implicitly standardized between samples (see tutorial part II). Alternatively, you can choose to use the total exon reads counts and then normalize them before performing quality control (you find the Normalize ( ) tool here: Toolbox -> Expression Analysis -> Transformation and Normalization).

CHAPTER 2. TUTORIALS

99

Figure 2.79: Sample clustering. Adjusting the settings in the Side Panel to put the sample names at the bottom.

Figure 2.80: Different views on an experiment. One of the reasons why the samples cluster so nicely is that there is no biological variation in the samples. The two samples in each group are technical replicates, so what we are really measuring is the quality of the method. In experiments with biological replicates, you would expect to see much more intra-group variability.

2.14

Tutorial: Small RNA analysis using Illumina data

This tutorial shows how to go through the initial parts of analyzing a small RNA data set. It shows how to analyze one sample including how to trim off adapter sequences and extract the small RNAs, how to count the small RNAs, inspect and check the results and finally how to annotate the small RNAs to identify known miRNAs and other non-coding RNAs. The tutorial is based on the study published in [Stark et al., 2010]. In this study, 12 samples from melanoma cell cultures were sequenced using an Illumina Genome Analyzer II. In this tutorial, we will analyze one of these samples, the MELB sample, which represents a primary melanocyte cell.

CHAPTER 2. TUTORIALS

100

2.14.1

Downloading and importing the raw data

First, download the fastq file containing all the raw data from this sample: http://trace. ncbi.nlm.nih.gov/Traces/sra/sra.cgi?cmd=dload&run_list=SRR038853&format= fastq. Now, import the data set using the Illumina importer: File | Import High-throughput Sequencing | Illumina This will bring up the dialog shown in figure 2.81.

Figure 2.81: Selecting the fastq file for import. Select the SRR038853.fastq.gz. Make sure the Discard quality scores and Discard read names checkboxes are checked. Information about quality scores and read names are not used in this analysis anyway, so it will just take up disk space when importing the data. Click Next, choose to Save and click Finish. After a short while, the reads have been imported. Open the file you imported by double-clicking and place your mouse on the tab. After one second, you will see a small tool tip with information about the number of reads in the file as shown in figure 2.82.

Figure 2.82: This data set contains about two million reads. Close the view again.

CHAPTER 2. TUTORIALS

101

2.14.2

Trimming adapters and counting the reads

The next step in the analysis is to trim off the partial adapter sequences and subsequently to count how many copies there are of each of the resulting small RNAs. Toolbox | High-throughput Sequencing ( Count ( ) ) | Small RNA Analysis ( ) |Extract and

This opens a dialog where you select the SRR038853 sample as shown in figure 2.83.

Figure 2.83: Selecting the sample for extracting and counting the small RNAs. Click Next when the data is listed in the right-hand side of the dialog. You are now presented with the dialog shown in figure 2.84.

Figure 2.84: Choosing to trim for adapter sequence. Make sure the checkbox is selected and click Next. You will now see the dialog shown in figure 2.85.

CHAPTER 2. TUTORIALS

102

Figure 2.85: Trimming the raw data for adapter sequence. In the list of adapter sequences, select the Illumina adapter. You can see in the preview panel below how many matches that are found for this adapter among the first 1000 reads in the input file. We will see more statistics on this for the full data set later on - this preview is just intended to support the user when defining the adapter trim setting. Since the trim settings are already set right, click Next. Note that you could have changed both Strand, Alignment score and action in this panel by clicking/double-clicking the adapter. You will now see the dialog shown in figure 2.86.

Figure 2.86: Adjusting options for counting the small RNAs. The most important choices in this dialog are that you can set a minimum and maximum length on the tags that you want to include when counting, and that you can decide how many copies there have to be in order to include the tag in the output. Leave these settings at the default and click Next.

CHAPTER 2. TUTORIALS This will allow you to specify the output options as shown in figure 2.87.

103

Figure 2.87: Selecting the results to output. The default is to output a Sample which is the table of all the small RNAs and their counts, and to create a report showing summary statistics. Leave the settings at default and click Finish

2.14.3

Interpreting the adapter trim report

Once the analysis is complete, two tabs will be opened. First, we take a look at the report. The top part of the report is shown in figure 2.88. The report is meant to be used as a quality check, mainly to see that the adapter trimming worked as expected. In this example, it shows that out of 2 million reads, 1.7 million reads passed the adapter trim. The trim settings meant that if no adapter sequence was found, the read would have been discarded. So this means that (part of) the adapter sequence was found in all these 1.7 million reads. There is also a graph showing a distribution of the read lengths after trimming. In this example, there is a very nice distribution with a peak around 22 bp which is expected for miRNAs.

2.14.4

Investigating the small RNA sample

Save and close the report, and you should now see the small RNA sample as shown in figure 2.89. There are 88,460 unique small RNAs in the sample. You can filter and sort the sample, and you can extract subsets using the buttons at the bottom of the view. As an example, we will try to open the trimmed reads of one of the small RNAs: Sort the table on Length (clicking the column header) and click the row at the top. Then click the Extract Reads button and click Finish in the dialog that is opened. You should now be able to see the original read sequence with a trim annotation as shown in figure 2.90. Clicking the Double stranded checkbox in the Side Panel to the right, you can see the minus

CHAPTER 2. TUTORIALS

104

Figure 2.88: The small RNA counting report. strand as well, and you can see that the adapter sequence, CAAGCAGAAGACGGCATACGA has a perfect match here.

2.14.5

Downloading miRBase and annotating the sample

The next step in the analysis is to annotate the small RNA sample to identify known small RNAs. We use two sources for the annotation: first, miRBase is used to identify known miRNAs and second a set of other known non-coding RNAs. The Workbench lets you download the latest version of miRBase directly: Toolbox | High-throughput Sequencing ( miRBase ( ) ) | Small RNA Analysis ( ) |Download

Choose Save, Next and Finish. Next, download and Import the set of other non-coding RNAs from ftp://ftp.ensembl.org/pub/release-57/fasta/homo_sapiens/ncrna/ Homo_sapiens.GRCh37.57.ncrna.fa.gz. You should now have the two annotation files represented as sequence lists in the Workbench, and you are ready to start the annotation:

CHAPTER 2. TUTORIALS

105

Figure 2.89: The small RNA sample.

Figure 2.90: A sequencing read displaying the trim annotation. Toolbox | High-throughput Sequencing ( and Merge Counts ( ) ) | Small RNA Analysis ( ) |Annotate

This opens a dialog where you select the SRR038853 Small RNA sample as shown in figure 2.91. Click Next when the data is listed in the right-hand side of the dialog. You are now presented with the dialog shown in figure 2.92. At the top, select to use miRBase and select ( ) the miRBase file that you downloaded previously. Below, check the Use other resource and select ( ) the Homo_sapiens.GRCh37.57.ncrna file that you imported previously. The miRBase file contains a list of precursor sequences with specification of the mature and in some cases the mature * regions. This information is used to categorize the annotated small RNAs. The Other resources does not include this kind of information and is used here in order to identify known small RNAs that are not miRNAs. Note that you could include several sequence lists here if you have other sources of non-coding small RNAs. Click Next will show the dialog shown in figure 2.93.

CHAPTER 2. TUTORIALS

106

Figure 2.91: Selecting the sample for annotating the small RNAs.

Figure 2.92: Setting miRBase and the other non-coding RNAs as annotation source. Select first Homo sapiens and second Mus musculus. The sample is human, so that should be the first priority as annotation source, and mouse should be second in the list. Since there may be miRNAs that have not yet been identified in human but have an ortholog in mouse, it is interesting to include the mouse miRNAs as well. Click Next will show the dialog in figure 2.94. Leave these settings at their default and click Next to display the dialog shown in figure 2.95. Make sure all options except the unannotated sample are checked and click Finish.

CHAPTER 2. TUTORIALS

107

Figure 2.93: Prioritizing species for annotation.

Figure 2.94: Thresholds for annotating.

2.14.6

Analyzing the annotated samples

For a detailed description of the output, please have a look in the user manual (press F1 to display). In this example we focus on a few specific miRNAs that will illustrate how the annotation and grouping of samples work and show some of the possibilities you have for interacting with the data. Looking at the grouped sample Save ( ) and close all the views except for the un-grouped annotated sample ( ). We want to look at mir-29a, so type this into the filter at the top of the table as shown in figure 2.96.

CHAPTER 2. TUTORIALS

108

Figure 2.95: Select the sample grouped on mature.

Figure 2.96: Showing all tags annotated with mir29a. This will list all the tags (414 out of 31,841) that have been mapped to the mir-29a precursor sequence from miRBase. If you sort the table by Count (clicking the count column header), you can see that most of these are exact matches of the mature miRNA. The rest are variants and length variants. For expression analysis, it can make sense to look at all the variants of the same miRNA as one entity rather than 414 as it is the case here. Open the SRR038853 Small RNA sample grouped ( ) and type in mir-29a in the filter. You now have one line representing all the tags that have been annotated with mir-29a with a total count of 36,600. The number of reads in different

CHAPTER 2. TUTORIALS

109

categories are shown, e.g. 30,689 for the exact mature corresponding to the number from the ungrouped sample in figure 2.96. You also see a few tags annotated with the mouse ortholog, but this could be noise due to sequencing errors. Double-click the human mir-29a row to open the alignment of all the tags to the precursor sequence (see figure 2.97).

Figure 2.97: Showing the alignment against the mir29a precursor sequence. The tags are colored to reflect the counts which are also shown in numbers next to the name to the left. Since the exact mature is very dominant in terms of count, it is the only one standing out in a different color. Taking advantage of the RNA folding opportunities One of the advantages of CLC Genomics Workbench is the integration between various tools. We are now going to explore the RNA secondary structure prediction tool for this miRNA. First, right-click the mir-29a label in the mapping view and select Open This Sequence. This will open this sequence in a new view but it is still part of the mapping and the grouped sample (this is denoted by the square brackets around its name). We will now predict the secondary structure of this sequence: Toolbox | RNA Structure ( ) | Predict Secondary Structure ( )

Click Next and Next using the default settings, uncheck the option to add annotations and click Finish. Then switch to the Secondary Structure 2D View ( ) to see the predicted structure (see figure 2.98). If your views are not already split, drag the tabs of the views to create a set-up as shown in figure 2.99 and select using the mouse either in the secondary structure or the reference in the mapping view and you will be able to follow the selections across the views.

CHAPTER 2. TUTORIALS

110

Figure 2.98: Showing the folding of the mir-29a precursor.

Figure 2.99: A split view showing the secondary structure of the RNA together with the length variants. Close the views. You are prompted to save the changes which in this case is the adding of the secondary structure to the precursor sequence. Tracking back from the mature sample Now, open the SRR038853 Small RNA sample grouped on mature ( ) and look at the first row with let-7f-1//let-7f-2 in the Name column. The let-7f miRNA is annotated in miRBase with two different precursor sequences. This means that when the tags are annotated, they are assigned either to let-7f-1 or let-7f-2. The sample grouped on mature merges the tags from precursors sharing the same mature sequence (the sequence itself is shown in the Feature id column). Open the SRR038853 Small RNA sample grouped and enter let-7f in the filter. The two precursor variants are now displayed, and you can see that the numbers sum up compared to

CHAPTER 2. TUTORIALS

111

the mature sample: 254,122 + 254,121 = 508,243 (see the Mature column in figure 2.100).

Figure 2.100: The mature sample joins the counts of precursors sharing the same mature sequence.

2.15

Tutorial: Microarray-based expression analysis part I: Getting started

This tutorial is the first part of a series of tutorials about expression analysis. Expression analysis often requires advanced skills in statistics, but this tutorial is intended to show a straight-forward example of how to identify and interpret the differentially expressed genes in samples from two different tissues. If you are familiar with the statistical concepts and issues within expression analysis, you may find this tutorial too simplistic, but we have favored a simple and quick introduction over an exhaustive and more "correct" explanation. The data comes from a study of gene expression in tissues from cardiac left ventricle and diaphragm muscle of rats [van Lunteren et al., 2008]. During this series of tutorials, you will see how to import and set up the data in an experiment with two groups (part I), to perform quality checks on the data (part II), to perform statistics and clustering to identify and visualize differentially expressed genes (part III), and finally to use annotations to categorize and interpret patterns among the differentially expressed genes in a biological context (part IV).

2.15.1

Importing array data

First, import the data set which can be downloaded from the Gene Expression Omnibus (GEO) database at NCBI: http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc= GSE6943&targ=gsm&form=text&view=data. After download, click Import ( ) in the Tool bar and select the file. You will now have 12 arrays in your Navigation Area as shown in figure 2.101.

2.15.2

Grouping the samples

The next step is to tell the CLC Genomics Workbench how the 12 samples are related. This is done be setting up an Experiment ( ). An Experiment is the central data type when analyzing expression data in the CLC Genomics Workbench. It includes a set of samples and

CHAPTER 2. TUTORIALS

112

Figure 2.101: 12 microarrays have been imported. information about how the samples are related (which groups they belong to). The Experiment is also used to accumulate calculations like t-tests and clustering. First step is to set up the experiment: Toolbox | Expression Analysis ( ) | Set Up Experiment ( )

Select the 12 arrays that you have imported (see figure 2.102).

Figure 2.102: Select the 12 microarrays that have been imported. Note that we use "samples" as the general term for both microarray-based expression values and sequencing-based expression values. Clicking Next shows the dialog in figure 2.103. Here you define the number of groups in the experiment. Since we compare heart tissue with diaphragm tissue, we use a two-group comparison. Leave it as Unpaired. Clicking Next shows the dialog in figure 2.104. Name the first group Heart and the second group Diaphragm and click Next (see figure 2.105). Here you see a list of all the samples you chose in figure 2.102. Now select the first 6 samples (by clicking in the group column of the first sample and while holding down the mouse button you

CHAPTER 2. TUTORIALS

113

Figure 2.103: Defining the number of groups.

Figure 2.104: Naming the groups. drag and select the other five samples), right-click and select Heart. Select the last 6 samples, right-click and select Diaphragm. In this way you define which group each sample belongs to. Click Finish and the experiment will be created. Note that the information from samples located in the Navigation Area is copied into the experiment, so they now exist independently of each other.

2.15.3

The experiment table

Once it is created, the experiment will be opened in a table as shown in figure 2.106. The table includes the expression values for each sample and in addition a few extra values have been calculated such as the range, the IQR (Interquartile Range), fold change and difference values and the present counts for the whole experiment and the individual groups (note that absent/present calls are not available on all kinds of data). Save the experiment and you are ready to proceed to the expression analysis tutorial part II.

CHAPTER 2. TUTORIALS

114

Figure 2.105: Assigning the samples to groups.

Figure 2.106: The experiment table.

2.16

Tutorial: Microarray-based expression analysis part II: Quality control

This tutorial is the second part of a series of tutorials about expression analysis. We continue working with the data set introduced in the first tutorial. In this tutorial we will examine various methods to perform quality control of the data.

2.16.1

Transformation

First we inspect to what extent the variance in expression values depends on the mean. For this we create an MA Plot: Toolbox | Expression Analysis ( ) | General Plots | Create MA Plot ( )

CHAPTER 2. TUTORIALS

115

Since the MA plot compares two samples, select two of the 12 arrays and click Finish. This will show a plot similar to the one shown in figure 2.107.

Figure 2.107: MA plot before transformation. The X axis shows the mean expression level of a feature on the two arrays and the Y axis shows the difference in expression levels for a feature on the two arrays. From the plot shown in figure 20.59 it is clear that the variance increases with the mean. To remove some of the dependency, we want to transform the data: Toolbox | Expression Analysis ( ( ) ) | Transformation and Normalization | Transform

Select the same arrays used for the plot, click Next, choose Log 2 transformation and click Finish. Now create an MA plot again as described above, but when you click Next you can see that you now also have the option to choose Transformed expression values (see figure 2.108).

Figure 2.108: Select the transformed expression values. Select the transformed values. You will see that these three selection boxes; Original, Transformed and Normalized expression values are used several places when expression values are used in a calculation. Click Finish. This will result in a quite different plot as shown in figure 2.109. The much more symmetric and even spread indicates that the dependance of the variance on the mean is not as strong as it was before transformation. We have now only transformed the values of the two samples used for the MA plot. The next step is to transform the expression values within the experiment, since this is the data we are going to use in the further analysis. The procedure is similar to before - this time you just select the experiment created in the first part of this tutorial series instead of the two arrays. If you open the table, you will see that all the samples have an extra column with transformed

CHAPTER 2. TUTORIALS

116

Figure 2.109: MA plot after transformation. expression values (see figure 2.110).

Figure 2.110: Transformed expression values have been added to the table. There is also an extra column for transformed group means and transformed IQR.

2.16.2

Comparing spread and distribution

In order to perform meaningful statistical analysis and inferences from the data, you need to ensure that the samples are comparable. Systematic differences between the samples that are likely to be due to noise (e.g. differences in sample preparation and processing) rather than true biological variability should be removed. To examine and compare the overall distribution of the transformed expression values in the samples you may use a Box plot ( ): Toolbox | Expression Analysis ( ) | Quality Control | Create Box Plot ( )

Select the experiment and click Next. Choose the Transformed expression values and Finish. The box plot is shown in figure 2.111. This plot looks very good because none of the samples stands out from the rest. If you compare

CHAPTER 2. TUTORIALS

117

Figure 2.111: A box plot of the 12 samples in the experiment, colored by group. this plot to the one shown in figure 2.112 from another data set, you can see the difference.

Figure 2.112: A box plot showing one sample that stands out from the rest. The second sample from the left has a distribution that is quite different from the others. If you have a data set like this, then you should consider removing the bad quality sample.

2.16.3

Group differentiation

The next step in the quality control is to check whether the overall variability of the samples reflect their grouping. In other words we want the replicates to be relatively homogenous and distinguishable from the samples of the other group. First, we perform a Principal Component Analysis (PCA): Toolbox | Expression Analysis ( ( ) ) | Quality Control | Principal Component Analysis

Select the experiment and click Next. Finish. This will create a PCA plot as shown in figure 2.113). The plot shows the projection of the samples onto the two-dimensional space spanned by the first and second principal component. (These are the orthogonal directions in which the data

CHAPTER 2. TUTORIALS

118

Figure 2.113: A principal component analysis colored by group. exhibits the largest and second-largest variability). The dots are colored according to the groups, and they also group very nicely in the plot. There is only one outlier - to see which sample it is, place the mouse cursor on the dot for a second, and you will see that it is the GSM160090 from the Heart group. You can display this information in the plot using the settings in the Side Panel to the right of the view: Dot properties | select GSM160090 in the drop-down box | Show names In this way you can control the coloring and dot types of the different samples and groups (see figure 2.114).

Figure 2.114: Naming the outlier.

CHAPTER 2. TUTORIALS

119

In order to complement the principal component analysis, we will also do a hierarchical clustering of the samples to see if the samples cluster in the groups we expect: Toolbox | Expression Analysis ( Samples ( ) ) | Quality Control | Hierarchical Clustering of

Select the experiment and click Next. Leave the parameters at their default and click Finish. This will display a heat map showing the clustering of samples at the bottom (see figure 2.115).

Figure 2.115: Sample clustering. The two overall groups formed are identical to the grouping in the experiment. You can doublecheck by placing your mouse on the name of the sample - that will show which group it belongs to. Since both the principal component analysis and the hierarchical clustering confirms the grouping of the samples, we have no reason to be sceptical about the quality of the samples and we conclude that the data is OK. Note that the heat map is not a new element to be stored in the Navigation Area - it is just another way of looking at the experiment (note the buttons to switch between different views in figure 2.116.

Figure 2.116: Different views on an experiment. In part III of the tutorial series we will be looking into the different views in more detail. To summarize this part about quality control, it looks like the data have good quality, and we are now ready to proceed to the next step where we do some statistical analysis to see which genes are differentially expressed.

CHAPTER 2. TUTORIALS

120

2.17

Tutorial: Microarray-based expression analysis part III: Differentially expressed genes

This tutorial is the third part of a series of tutorials about expression analysis. We continue working with the data set introduced in the first tutorial. In this tutorial we will identify and investigate the genes that are differentially expressed.

2.17.1

Statistical analysis

First we will carry out some statistical tests that we will use to identify the genes that are differentially expressed between the two groups: Toolbox | Expression Analysis ( ) | Statistical Analysis | On Gaussian Data ( )

Select the experiment created in part I of the tutorials and click Next. Leave the parameters at the default and click Next again. You will now see a dialog as shown in figure 2.117.

Figure 2.117: Statistical analysis. As shown in figure 2.117 select the transformed expression values and check the two corrected p-values as well. You can read more about what they mean by clicking the Help ( ) button in the dialog. When you press Finish, a number of extra columns will be added to your experiment. For this analysis we will use the FDR p-value which is a measure that allows us to control how big a proportion of false positives (genes that we think are differentially expressed but really are not) we are willing to accept. Click the FDR p-value correction column to sort it with the lowest values at the top. If you scroll down to values around 5E-4 you can clearly see the difference between using the FDR p-value and the Bonferroni-corrected p-value which is much stricter (p-values approaching 1 - see figure 2.118).

2.17.2

Filtering p-values

To do a more refined selection of the genes that we believe to be differentially expressed, we use the advanced filter located at the top of the experiment table. Click the Advanced Filter ( )

CHAPTER 2. TUTORIALS

121

Figure 2.118: FDR p-values compared to Bonferroni-corrected p-values. button and you will see that the simple text-based filter is now replaced with a more advanced filter. Select Diaphragm vs Heart transformed - FDR p-value correction in the first drop-down box, select < in the next, and enter 0.0005 (or 0,0005 depending on your locale settings). Click Apply or press Enter. This will filter the table so that only values below 0.0005 are shown (see figure 2.119).

Figure 2.119: Filtering on FDR p-values. You can see that 1471 genes fulfilled this criterion (marked with a red circle).

2.17.3

Inspecting the volcano plot

) at the bottom of the view.

Another way of looking at this data is to click the Volcano Plot ( Press and hold the Ctrl key while you click ( on Mac).

This will make a split view of the experiment table and the volcano plot as shown in figure 2.120. The volcano plot shows the difference between the means of the two groups on the X axis and the log10 p-values on the Y axis. If you now select the genes in the table (click in the table and press Ctrl + A / + A on Mac), you can see that the corresponding dots are selected in the volcano plot (see figure 2.121).

2.17.4

Filtering absent/present calls and fold change

Besides filtering on low p-values, we may also take the absent/present status of the features into consideration. The absent/present status is assigned by the Affymetrix software. There can be a number of reasons why a gene is called absent, and sometimes it is simply because the

CHAPTER 2. TUTORIALS

122

Figure 2.120: Split view of volcano plot and experiment table. signal is very weak. When a gene is called absent, we may not wish to include it in the list of differentially expressed genes, so we want to filter these out as well. This can be done in several ways - in our approach we say that for any gene there must not be more than one absent call in each group. Thus, we add more criteria to the filter by clicking the Add search criterion ( ) button twice and enter the limit for present calls as shown in figure 2.122. Before applying this filter, 1471 genes were selected, and this list is now reduced to 1093. Often the results of microarray experiments are verified using other methods such as QPCR, and then we may want to filter out genes that exhibit differences in expression that are so small that we will not be able to verify them with another method. This is done by adding one last criterion to the filter: Difference should have an absolute value higher than 2 (as we are working with log transformed data, the group mean difference is really the fold change, so this filter means that we require a fold change above 2). This final filtering is shown in figure 2.123. Note that the abs value > is important because the difference could be negative as well as positive. The result is that we end up with a list of 142 genes that are likely candidates to exhibit differential expression in the two groups. Click one of the rows and press Ctrl + A ( +A on Mac) to select the 142 genes. You can now inspect the selection in the volcano plot below as shown in figure 2.124.

CHAPTER 2. TUTORIALS

123

Figure 2.121: Volcano plot where selected dots are colored red.

Figure 2.122: Filtering genes where at least 5 out of 6 calls in each group are present.

Figure 2.123: The absolute value of group mean difference should be larger than 2.

2.17.5

Saving the gene list

Before we proceed to the final part of the tutorials, we save the list of genes; click Create Experiment from Selection ( ) This will create a new experiment based on the selection. Save ( the old one. ) the new experiment next to

CHAPTER 2. TUTORIALS

124

Figure 2.124: 142 genes out of 15923 selected.

2.18

Tutorial: Microarray-based expression analysis part IV: Annotation test

This tutorial is the fourth and final part of a series of tutorials about expression analysis. We continue working with the data set introduced in the first tutorial and analyzed in part two and three. In this tutorial we will annotate the gene list and use the annotations to see if there is a pattern in the biological annotations of the genes in the list of candidate differentially expressed genes. We use two different methods for annotation testing: Hypergeometric Tests on Annotations and Gene Set Enrichment Analysis (GSEA).

2.18.1

Importing and adding the annotations

First step is to import an annotation file used to annotate the arrays. In this case, the data were produced using an Affymetrix chip, and the annotation file can be downloaded from the web site http://www.affymetrix.com/support/technical/annotationfilesmain.affx. You can access the file by search for RAE230A. Note that you have to sign up in order to download the file (this is a free service). To import the annotation file, click Import ( ) in the Tool bar and select the file.

Next, annotate the experiment with the annotation file: Toolbox | Expression Analysis ( ) | Annotation Test | Add Annotations ( )

CHAPTER 2. TUTORIALS Select the experiment created in the previous tutorial and the annotation file ( and Finish.

125 ) and click Next

2.18.2

Inspecting the annotations

When you look in the Side Panel of the experiment, there are a lot of options to show and hide columns in the table. This can be done on several levels. At the Annotation level you find a list of all the annotations. Some are shown per default, others you will have to click to show. An important annotation is the Gene title which describes the gene and is much more informative than the Feature ID. Further down the list you find the annotation type GO biological process. We will use this annotation in the next two analyses.

2.18.3

Processes that are over or under represented in the small list

The first annotation test will show whether any of the GO biological processes are over-represented in our small list of 142 differentially expressed genes relate to the full set of genes measured: Toolbox | Expression Analysis ( Annotations ( ) ) | Annotation Test | Hypergeometric Tests on

Select the two experiments (the original full experiment and the small subset of 142 genes) and click Next. Select GO biological process and Transformed expression values (see figure 2.125).

Figure 2.125: Testing on GO biological process. Click Next and Finish to perform the test. The result is shown in figure 2.126. This table lists the GO categories according to p-values for this test. If you take number 2, carbohydrate metabolic process, there are 104 genes in this category in the full set, if the subset was randomly chosen you would have expected 1 gene to be in the subset. But because there are 7 genes in this subset, this process is over-represented and given a p-value of 2.63E-5.

CHAPTER 2. TUTORIALS

126

Figure 2.126: The result of testing on GO biological process.

2.18.4

A different approach: Gene Set Enrichment Analysis (GSEA)

The hypergeometric tests on annotations uses a pre-defined subset of differentially expressed genes as a starting point and compares the annotations in this list to those of the genes in the full experiment. The exact limit for this subset is somewhat arbitrary - in our case we could have chosen a p-value less than 0.005 instead of 0.0005 and it would lead to a different result. Furthermore, only the most apparently differentially expressed genes are used in the subset one could easily imagine that other categories would be significant based on more genes with e.g. lower fold change or higher p-values. The Gene Set Enrichment Analysis (GSEA) does not take an a priori defined list of differentially expressed genes and compares it to the full list - it uses a single experiment. It ranks the genes on p-value and analyzes whether there are some categories that are over-represented in the top of the list. Toolbox | Expression Analysis ( (GSEA) ( ) ) | Annotation Test | Gene Set Enrichment Analysis

Select the original full experiment and click Next. In this step, make sure the GO biological process is chosen (see figure 2.127. Click Next and select the Transformed expression values. Click Finish. The result is shown in figure 2.128. The table is sorted on the lower tail so that the GO categories where up-regulated genes in the first group are over-represented are placed at the top, and the GO categories where up-regulated genes in the second group are over-represented are placed at the bottom. Note that we could have chosen to filter away genes with less reliable measurements from the experiment (as shown in the previous tutorial) before subjecting it to the GSEA analysis in order to limit noise and aim for a more robust result.

CHAPTER 2. TUTORIALS

127

Figure 2.127: Gene set enrichment analsysis based on GO biological process.

Figure 2.128: The result of a gene set enrichment analsysis based on GO biological process.

2.19

Tutorial: Assembly

In this tutorial, you will see how to assemble data from automated sequencers into a contig and how to find and inspect any conflicts that may exist between different reads. This tutorial shows how to assemble sequencing data generated by conventional "Sanger" sequencing techniques. For high-throughput sequencing data, we refer to the CLC Genomics Workbench (see http://www.clcbio.com/genomics). The data used in this tutorial are the sequence reads in the "Sequencing reads" folder in the "Sequencing data" folder of the Example data in the Navigation Area. If you do not have the example data, please go to the Help menu to import it.

2.19.1

Trimming the sequences

The first thing to do when analyzing sequencing data is to trim the sequences. Trimming serves a dual purpose: it both takes care of parts of the reads with poor quality, and it removes potential

CHAPTER 2. TUTORIALS

128

vector contamination. Trimming the sequencing data gives a better result in the further analysis. Toolbox in the Menu Bar | Sequencing Data Analyses ( Select the 9 sequences and click Next. In this dialog, you will be able to specify how this trimming should be performed. For this data, we wish to use a more stringent trimming, so we set the limit of the quality score trim to 0,02 (see figure 2.129). ) | Trim Sequences ( )

Figure 2.129: Specifying how sequences should be trimmed. A stringent trimming of 0,02 is used in this example. There is no vector contamination in these data, se we only trim for poor quality. If you place the mouse cursor on the parameters, you will see a brief explanation. Click Next and choose to Save the results. When the trimming is performed, the parts of the sequences that are trimmed are actually annotated, not removed (see figure 2.130). By choosing Save, the Trim annotations will be saved directly to the sequences, without opening them for you to view first.

Figure 2.130: Trimming creates annotations on the regions that will be ignored in the assembly process. These annotated parts of the sequences will be ignored in the subsequent assembly. A natural question is: Why not simply delete the trimmed regions instead of annotating them? In some cases, deleting the regions would do no harm, but in other cases, these regions could potentially contain valuable information, and this information would be lost if the regions were deleted instead of annotated. We will see an example of this later in this tutorial.

CHAPTER 2. TUTORIALS

129

2.19.2

Assembling the sequencing data

The next step is to assemble the sequences. This is the technical term for aligning the sequences where they overlap and reverse the reverse reads to make a contiguous sequence (also called a contig). In this tutorial, we will use assembly to a reference sequence. This can be used when you have a reference sequence that you know is similar to your sequencing data. Toolbox in the Menu Bar | Sequencing Data Analyses ( to Reference ( ) ) | Assemble Sequences

In the first dialog, select the nine sequencing reads and click Next to go to the second step of the assembly where you select the reference sequence. Click the Browse and select button ( ) and select the "ATP8a1 mRNA (reference)" from the "Sequencing data" folder (see figure 2.131). You can leave the other options in this window set to their defaults.

Figure 2.131: The "ATP8a1 mRNA (reference)" sequence selected as reference sequence for the assembly. Click Next and choose to use the trim information (that you have just added). Click Next and choose to Save your results. The next step will ask you for a location to save the results to. You can just accept the default location, or you could use the left hand icon under the "Save in folder" heading to create a new folder to save your assembly into. Click Finish and the assembly process will begins.

2.19.3

Getting an overview of the contig

The result of the assembly is a Contig which is an alignment of the nine reads to the reference sequence. Click Fit width ( ) to see an overview of the contig. To help you determine the coverage, display a coverage graph (see figure 2.132): Alignment info in Side Panel | Coverage | Graph This overview can be an aid in determining whether coverage is satisfactory, and if not, which regions a new sequencing effort should focus on. Next, we go into the details of the contig.

CHAPTER 2. TUTORIALS

130

Figure 2.132: An overview of the contig with the coverage graph.

2.19.4

Finding and editing conflicts

Click Zoom to 100% ( ) to zoom in on the residues at the beginning of the contig. Click the Find Conflict button at the top of the Side Panel or press the Space key to find the first position where there is disagreement between the reads (see figure 2.133).

Figure 2.133: Using the Find Conflict button highlights conflicts. In this example, the first read has a "T" (marked with a light-pink background color), whereas the second line has a gap. In order to determine which of the reads we should trust, we assess the quality of the read at this position. A quick look at the regularity of the peaks of read "Rev2" compared to "Rev3" indicates that we should trust the "Rev2" read. In addition, you can see that we are close to the end of the end of "Rev3", and the quality of the chromatogram traces is often low near the ends. Based on this, we decide not to trust "Rev3". To correct the read, select the "T" in the "Rev3" sequence by placing the cursor to the left of it and dragging the cursor across the T. Press Delete ( ).

CHAPTER 2. TUTORIALS This will resolve the conflict.

131

2.19.5

Including regions that have been trimmed off

Clicking the Find Conflict button again will find the next conflict. This is the beginning of a stretch of gaps in the consensus sequence. This is because the reads have been trimmed at this position. However, if you look at the read at the bottom, Fwd2, you can see that a lot of the peaks actually seem to be fine, so we could just as well include this information in the contig. If you scroll a little to the right, you can see where the trimmed region begins. To include this region in the contig, move the vertical slider at position 2073 to the left (see figure 18.11).

Figure 2.134: Dragging the edge of the trimmed region. You will now see how the gaps in the consensus sequence are replaced by real sequence information. Note that you can only move the sliders when you are zoomed in to see the sequence residues.

2.19.6

Inspecting the traces

Clicking the Find Conflict button again will find the next conflict. Here both reads are different than the reference sequence. We now inspect the traces in more detail. In order to see the details, we zoom in on this position: Zoom in in the Tool Bar ( ) | Click the selected base | Click again three times

Now you have zoomed in on the trace (see figure 2.135). This gives more space between the residues, but if we would like to inspect the peaks even more, simply drag the peaks up and down with your mouse (see figure 18.2).

2.19.7

Synonymous substitutions?

In this case we have sequenced the coding part of a gene. Often you want to know what a variation like this would mean on the protein level. To do this, show the translation along the contig: Nucleotide info in the Side Panel | Translation | Show | Select ORF/CDS in the Frame box The result is shown in figure 2.137. You can see that the variation is on the third base of the codon coding for threonine, so this is a synonymous substitution. That is why the T is colored yellow. If it was a non-synonymous substitution, it would be colored in red.

CHAPTER 2. TUTORIALS

132

Figure 2.135: Now you can see all the details of the traces.

Figure 2.136: Grab the traces to scale.

2.19.8

Getting an overview of the conflicts

Browsing the conflicts by clicking the Find Conflict button is useful in many cases, but you might also want to get an overview of all the conflicts in the entire contig. This is easily achieved by showing the contig in a table view: Press and hold the Ctrl-button ( on Mac) | Click Show Table ( ) at the bottom of the view This will open a table showing the conflicts. You can right-click the Note field and enter your own comment. In this dialog, enter a new text in the Name and click OK. When you edit a comment, this is reflected in the conflict annotation on the consensus sequence. This means that when you use this sequence later on, you will easily be able to see the comments you have entered. The comment could be e.g. your interpretation of the conflict.

2.19.9

Documenting your changes

Whenever you make a change like deleting a "T", it will be noted in the contig's history. To open the history, click the fHistory ( ) icon at the bottom of the view. In the history, you can see the details of each change (see figure 2.138).

CHAPTER 2. TUTORIALS

133

Figure 2.137: Showing the translation along the contig.

Figure 2.138: The history of the contig showing that a "T" has been deleted and that the aligned region has been moved.

2.19.10

Using the result for further analyses

When you have finished editing the contig, it can be saved, and you can also extract and save the consensus sequence: Right-click the name "Consensus" | Open Copy of Sequence | Save ( )

This will make it possible to use this sequence for further analyses in the CLC Genomics

CHAPTER 2. TUTORIALS

134

Workbench. All the conflict annotations are preserved, and in the sequence's history, you will find a reference to the original contig. As long as you also save the original contig, you will always be able to go back to it by choosing the Reference contig in the consensus sequence's history (see figure 2.139).

Figure 2.139: The history of the consensus sequence, which has been extracted from the contig. Clicking the blue text "Reference contig" will find and highlight the name of the saved contig in the Navigation Area. Clicking the blue text "history" to the right will open the history view of the earlier contig. From there, you can choose other views, such as the Read mapping view, of the contig.

2.20

Tutorial: In silico cloning cloning work flow

In this tutorial, the goal is to virtually PCR-amplify a gene using primers with restriction sites at the 5' ends, and insert the gene into a multiple cloning site of an expression vector. We start off with a set of primers, a DNA template sequence and an expression vector loaded into the Workbench. This tutorial will guide you through the following steps: 1. Adding restriction sites to the primers 2. Simulating the effect of PCR by creating the fragment to use for cloning. 3. Specifying restriction sites to use for cloning, and inserting the fragment into the vector

2.20.1

Locating the data to use

Open the Example data folder in the Navigation Area. Open the Cloning folder, and inside this folder, open the Primer folder. If you do not have the example data, please go to the Help menu to import it. The data to use in these folders is shown in figure 2.140. Double-click the ATP8a1 mRNA sequence and zoom to Fit Width ( ) and you will see the yellow annotation which is the coding part of the gene. This is the part that we want to insert into the

CHAPTER 2. TUTORIALS

135

Figure 2.140: The data to use in this tutorial. pcDNA4_TO vector. The primers have already been designed using the primer design tool in CLC Genomics Workbench (to learn more about this, please refer to the Primer design tutorial).

2.20.2

Add restriction sites to primers

First, we add restriction sites to the primers. In order to see which restriction enzymes can be used, we create a split view of the vector and the fragment to insert. In this way we can easily make a visual check to find enzymes from the multiple cloning site in the vector that do not cut in the gene of interest. To create the split view: double-click the pcDNA4_TO sequence | View | Split Horizontally ( )

Note that this can also be achieved by simply dragging the pcDNA4_TO sequence into the lower part of the open view. Switch to the Circular ( ) view at the bottom of the view.

Zoom in ( ) on the multiple cloning site downstream of the green CMV promoter annotation. You should now have a view similar to the one shown in figure 2.141.

Figure 2.141: Check cut sites. By looking at the enzymes we can see that both HindIII and XhoI cut in the multi-cloning site of the vector and not in the Atp8a1 gene. Note that you can add more enzymes to the list in the

CHAPTER 2. TUTORIALS Side Panel by clicking Manage Enzymes under the Restriction Sites group.

136

Close both views and open the ATP8a1 fwd primer sequence. When it opens, double-click the name of the sequence to make a selection of the full sequence. If you do not see the whole sequence turn purple, please make sure you have the Selection Tool chosen, and not one of the other tools available from the top right side of the Workbench (e.g. Pan, Zooming tools, etc.) Once the sequence is selected, right-click and choose to Insert Restriction Site Before Selection as shown in figure 2.142.

Figure 2.142: Adding restriction sites to a primer. In the Filter box enter HindIII and click on it. At the bottom of the dialog, add a few extra bases 5' of the cut site (this is done to increase the efficiency of the enzyme) as shown figure 21.14.

Figure 2.143: Adding restriction sites to a primer. Click OK and the sequence will be inserted at the 5' end of the primer as shown in figure figure 2.144.

Figure 2.144: Adding restriction sites to a primer.

CHAPTER 2. TUTORIALS

137

Perform the same process for the ATP8a1 rev primer, this time using XhoI instead. This time, you should also add a few bases at the 5' end as was done in figure21.14 when inserting the HindIII site. Note! The ATP8a1 rev primer is designed to match the negative strand, so the restriction site should be added at the 5' end of this sequence as well (Insert Restriction Site before Selection). Save ( ) the two primers and close the views and you are ready for next step.

2.20.3

Simulate PCR to create the fragment

Now, we want to extract the PCR product from the template ATP8a1 mRNA sequence using the two primers with restriction sites: Toolbox | Primers and Probes ( ) | Find Binding Sites and Create Fragments ( )

Select the ATP8a1 mRNA sequence and click Next. In this dialog, use the Browse ( ) button to select the two primer sequences. Click Next and adjust the output options as shown in figure 2.145.

Figure 2.145: Creating the fragment table including fragments up to 4000 bp. Click Finish and you will now see the fragment table displaying the PCR product. In the Side Panel you can choose to show information about melting temperature for the primers. Right-click the fragment and select Open Fragment as shown in figure 2.146.

Figure 2.146: Opening the fragment as a sequence. This will create a new sequence representing the PCR product. Save ( ) the sequence in the Cloning folder and close the views. You do not need to save the fragment table.

CHAPTER 2. TUTORIALS

138

2.20.4

Specify restriction sites and perform cloning

) | Cloning ( )

The final step in this tutorial is to insert the fragment into the cloning vector: Toolbox in the Menu Bar | Cloning and Restriction Sites (

Select the Fragment (ATP8a1 mRNA (ATP8a1 fwd - ATP8a1 rev)) sequence you just saved and click Next. In this dialog, use the Browse ( ) button to select pcDNA4_TO cloning vector also located in the Cloning folder. Click Finish. You will now see the cloning editor where you will see the pcDNA4_TO vector in a circular view. Press and hold the Ctrl ( on Mac) key while you click first the HindIII site and next the XhoI site (see figure 2.147).

Figure 2.147: Press and hold the Ctrl key while you click first the HindIII site and next the XhoI site. At the bottom of the view you can now see information about how the vector will be cut open. Since the vector has now been split into two fragments, you can decide which one to use as the target vector. If you selected first the HindIII site and next the XhoI site, the CLC Genomics Workbench has already selected the right fragment as the target vector. If you click one of the vector fragments, the corresponding part of the sequence will be high-lighted. Next step is to cut the fragment. At the top of the view you can switch between the sequences used for cloning (at this point it says pcDNA4_TO 5.078bp circular vector). Switch to the fragment sequence and perform the same selection of cut sites as before while pressing the Ctrl ( on Mac) key. You should now see a view identical to the one shown in figure 2.148. When this is done, the Perform Cloning ( ) button at the lower right corner of the view is active because there is now a valid selection of both fragment and target vector. Click the Perform Cloning ( ) button and you will see the dialog shown in figure 2.149. This dialog lets you inspect the overhangs of the cut site, showing the vector sequence on each side and the fragment in the middle. The fragment can be reverse complemented by clicking the Reverse complement fragment ( ) but this is not necessary in this case. Click Finish and your new construct will be opened. When saving your work, there are two options:

CHAPTER 2. TUTORIALS

139

Figure 2.148: Press and hold the Ctrl key while you click first the HindIII site and next the XhoI site.

Figure 2.149: Showing the insertion point of the vector Save the Cloning Experiment. This is saved as a sequence list, including the specified cut sites. This is useful if you need to perform the same process again or double-check details. Save the construct shown in the circular view. This will only save the information on the particular sequence including details about how it was created (this can be shown in the History view). You can, of course, save both. In that case, the history of the construct will point to the sequence list in its own history. The construct is shown in figure 2.150.

2.21

Tutorial: Primer design

In this tutorial, you will see how to use the CLC Genomics Workbench to find primers for PCR amplification of a specific region. We use the pcDNA3-atp8a1 sequence from the 'Primers' folder in the Example data. This sequence is the pcDNA3 vector with the atp8a1 gene inserted. In this tutorial, we wish design primers that would allow us to generate a PCR product covering the insertion point of the gene. This would let us use PCR to check that the gene is inserted where we think it is. First, open the sequence in the Primer Designer: Select the pcDNA3-atp8a1 sequence | Show ( ) | Primer Designer ( )

Now the sequence is opened and we are ready to begin designing primers.

CHAPTER 2. TUTORIALS

140

Figure 2.150: The Atp8a1 gene inserted after the CMV promoter

2.21.1

Specifying a region for the forward primer

First zoom out to get an overview of the sequence by clicking Fit Width ( ). You can now see the blue gene annotation labeled Atp8a1, and just before that there is the green CMV promoter. This may be hidden behind restriction site annotations. Remember that you can always choose not to Show these by altering the settings in the right hand pane. In this tutorial, we want the forward primer to be in a region between positions 600 and 900 just before the gene (you may have to zoom in ( ) to make the selection). Select this region, right-click and choose "Forward primer region here" ( ) (see figure 2.151).

Figure 2.151: Right-clicking a selection and choosing "Forward primer region here". This will add an annotation to this region, and five rows of red and green dots are seen below as shown in figure 2.152:

2.21.2

Examining the primer suggestions

Each line consists of a number of dots, each representing the starting point of a possible primer. E.g. the first dot on the first line (primers of length 18) represents a primer starting at the dot's position and with a length of 18 nucleotides (shown as the white area in figure 2.153):

CHAPTER 2. TUTORIALS

141

Figure 2.152: Five lines of dots representing primer suggestions. There is a line for each primer length - 18bp through to 22 bp.

Figure 2.153: The first dot on line one represents the starting point of a primer that will anneal to the highlighted region. Position the mouse cursor over a dot. A box will appear, providing data about this primer. Clicking the dot will select the region where that primer would anneal. (See figure 2.154):

Figure 2.154: Clicking the dot will select the corresponding primer region. Hovering the cursor over the dot will bring up an information box containing details about that primer. Note that some of the dots are colored red. This indicates that the primer represented by this dot does not meet the requirements set in the Primer parameters (see figure 2.155): The default maximum melting temperature is 58. This is the reason why the primer in figure 2.154 with a melting temperature of 58.55 does not meet the requirements and is colored red. If you raise the maximum melting temperature to 59, the primer will meet the requirements and the dot becomes green. In figure 2.154 there is an asterisk (*) before the melting temperature. This indicates that this primer does not meet the requirements regarding melting temperature. In this way, you can easily see why a specific primer (represented by a dot) fails to meet the requirements.

CHAPTER 2. TUTORIALS

142

Figure 2.155: The Primer parameters. By adjusting the Primer parameters you can define primersto meet your specific needs. Since the dots are dynamically updated, you can immediately see how a change in the primer parameters affects the number of red and green dots.

2.21.3

Calculating a primer pair

Until now, we have been looking at the forward primer. To mark a region for the reverse primer, make a selection from position 1200 to 1400 and: Right-click the selection | Reverse primer region here ( )

The two regions should now be located as shown in figure 2.156:

Figure 2.156: A forward and a reverse primer region. Now, you can let CLC Genomics Workbench calculate all the possible primer pairs based on the Primer parameters that you have defined: Click the Calculate button (right hand pane) | Modify parameters regarding the combination of the primers (for now, just leave them unchanged)| Calculate This will open a table showing the possible combinations of primers. To the right, you can specify the information you want to display, e.g. showing Fragment length (see figure 2.157):

CHAPTER 2. TUTORIALS

143

Figure 2.157: A list of primers. To the right are the Side Panel showing the available choices of information to display. Clicking a primer pair in the table will make a corresponding selection on the sequence in the view above. At this point, you can either settle on a specific primer pair or save the table for later. If you want to use e.g. the first primer pair for your experiment, right-click this primer pair in the table and save the primers. You can also mark the position of the primers on the sequence by selecting Mark primer annotation on sequence in the right-click menu (see figure 2.158):

Figure 2.158: The options available in the right-click menu. Here, "Mark primer annotation on sequence" has been chosen, resulting in two annotations on the sequence above (labeled "Oligo"). This tutorial has shown some of the many options of the primer design functionalities of CLC Genomics Workbench. You can read much more using the program's Help function ( ) or in the CLC Genomics Workbench user manual, linked to on this webpage: http: //www.clcbio.com/download.

CHAPTER 2. TUTORIALS

144

2.22

Tutorial: BLAST search

BLAST is an invaluable tool in bioinformatics. It has become central to identification of homologues and similar sequences, and can also be used for many other different purposes. This tutorial takes you through the steps of running a blast search in CLC Workbenches. If you plan to use blast for your research, we highly recommend that you read further about it. Understanding how blast works is key to setting up meaningful and efficient searches. Suppose you are working with the ATP8a1 protein sequence which is a phospholipid-transporting ATPase expressed in the adult house mouse, Mus musculus. To obtain more information about this molecule you wish to query the peptides held in the Swiss-Prot* database to find homologous proteins in humans Homo sapiens, using the Basic Local Alignment Search Tool (BLAST) algorithm. This tutorial involves running BLAST remotely using databases housed at the NCBI. Your computer must be connected to the internet to complete this tutorial.

2.22.1

Performing the BLAST search

) | NCBI BLAST ( )

Start out by: select protein ATP8a1 | Toolbox | BLAST Search (

In Step 1 you can choose which sequence to use as query sequence. Since you have already chosen the sequence it is displayed in the Selected Elements list. Click Next. In Step 2 (figure 2.159), choose the default BLAST program: blastp: Protein sequence and database and select the Swiss-Prot database in the Database drop down menu.

Figure 2.159: Choosing BLAST program and database. Click Next. In the Limit by Entrez query in Step 3, choose Homo sapiens[ORGN] from the drop down menu to arrive at the search configuration seen in figure 2.160. Including this term limits the query to proteins of human origin. Choose to Open your results.

CHAPTER 2. TUTORIALS

145

Figure 2.160: The BLAST search is limited to homo sapiens[ORGN]. The remaining parameters are left as default. Click Finish to accept the parameter settings and begin the BLAST search. The computer now contacts NCBI and places your query in the BLAST search queue. After a short while the result should be received and opened in a new view.

2.22.2

Inspecting the results

The output is shown in figure 2.161 and consists of a list of potential homologs that are sorted by their BLAST match-score and shown in descending order below the query sequence.

Figure 2.161: Output of a BLAST search. By holding the mouse pointer over the lines you can get information about the sequence. Try placing your mouse cursor over a potential homologous sequence. You will see that a context box appears containing information about the sequence and the match-scores obtained from the

CHAPTER 2. TUTORIALS BLAST algorithm.

146

The lines in the BLAST view are the actual sequences which are downloaded. This means that you can zoom in and see the actual alignment: Zoom in in the Tool Bar ( ) | Click in the BLAST view a number of times until you see the residues Now we will focus our attention on sequence Q9Y2Q0 - the BLAST hit that is at the top of the list. To download the full sequence: right-click the line representing sequence Q9Y2Q0 | Download Full Hit Sequence from NCBI This opens the sequence. However, the sequence is not saved yet. Drag and drop the sequence into the Navigation Area to save it. This homologous sequence is now stored in the CLC Genomics Workbench and you can use it to gain information about the query sequence by using the various tools of the workbench, e.g. by studying its textual information, by studying its annotation or by aligning it to the query sequence.

2.22.3

Using the BLAST table view

) at the bottom.

As an alternative to the graphic BLAST view, you can click the Table View ( This will display a tabular view of the BLASt hits as shown in figure 2.162.

Figure 2.162: Output of a BLAST search shown in a table. This view provides more statistics about the hits, and you can use the filter to search for e.g. a specific type of protein etc. If you wish to download several of the hit sequences, this is easily done in this view. Simply select the relevant sequences and drag them into a folder in the Navigation Area.

2.23

Tutorial: Tips for specialized BLAST searches

Here, you will learn how to: Use BLAST to find the gene coding for a protein in a genomic sequence. Find primer binding sites on genomic sequences

CHAPTER 2. TUTORIALS Identify remote protein homologues.

147

Following through these sections of the tutorial requires some experience using the Workbench, so if you get stuck at some point, we recommend going through the more basic tutorials first.

2.23.1

Locate a protein sequence on the chromosome

If you have a protein sequence but want to see the actual location on the chromosome this is easy to do using BLAST. In this example we wish to map the protein sequence of the Human beta-globin protein to a chromosome. We know in advance that the beta-globin is located somewhere on chromosome 11. Data used in this example can be downloaded from GenBank: Search | Search for Sequences at NCBI ( )

Human chromosome 11 (NC_000011) consists of 134452384 nucleotides and the beta-globin (AAA16334) protein has 147 amino acids. BLAST configuration Next, conduct a local BLAST search: Toolbox | BLAST Search ( ) | Local BLAST ( )

Select the protein sequence as query sequence and click Next. Since you wish to BLAST a protein sequence against a nucleotide sequence, use tblastn which will automatically translate the nucleotide sequence selected as database. As Target select NC_000011 that you downloaded. If you are used to BLAST, you will know that you usually have to create a BLAST database before BLASTing, but the Workbench does this "on the fly" when you just select one or more sequences. Click Next, leave the parameters at their default, click Next again, and then Finish. Inspect BLAST result When the BLAST result appears make a split view so that both the table and graphical view is visible (see figure 2.163). This is done by pressing Ctrl ( on Mac) while clicking the table view ( ) at the bottom of the view. In the table start out by showing two additional columns; "% Positive" and "Query start". These should simply be checked in the Side Panel. Now, sort the BLAST table view by clicking the column header "% Positive". Then, press and hold the Ctrl button ( on Mac) and click the header "Query start". Now you have sorted the table first on % Positive hits and then the start position of the query sequence. Now you see that you actually have three regions with a 100% positive hit but at different locations on the chromosome sequence (see figure 2.163). Why did we find, on the protein level, three identical regions between our query protein sequence and nucleotide database?

CHAPTER 2. TUTORIALS

148

Figure 2.163: Placement of translated nucleotide sequence hits on the Human beta-globin. The beta-globin gene is known to have three exons and this is exactly what we find in the BLAST search. Each translated exon will hit the corresponding sequence on the chromosome. If you place the mouse cursor on the sequence hits in the graphical view, you can see the reading frame which is -1, -2 and -3 for the three hits, respectively. Verify the result Open NC_000011 in a view, and go to the Hit start position (5,204,729) and zoom to see the blue gene annotation. You can now see the exon structure of the Human beta-globin gene showing the three exons on the reverse strand (see figure 2.164).

Figure 2.164: Human beta-globin exon view.

CHAPTER 2. TUTORIALS

149

If you wish to verify the result, make a selection covering the gene region and open it in a new view: right-click | Open Selection in New View ( ) | Save ( )

Save the sequence, and perform a new BLAST search: Use the new sequence as query. Use BLASTx Use the protein sequence, AAA16334, as database Using the genomic sequence as query, the mapping of the protein sequence to the exons is visually very clear as shown in figure 2.165.

Figure 2.165: Verification of the result: at the top a view of the whole BLAST result. At the bottom the same view is zoomed in on exon 3 to show the amino acids. In theory you could use the chromosome sequence as query, but the performance would not be optimal: it would take a long time, and the computer might run out of memory. In this example, you have used well-annotated sequences where you could have searched for the name of the gene instead of using BLAST. However, there are other situations where you either do not know the name of the gene, or the genomic sequence is poorly annotated. In these cases, the approach described in this tutorial can be very productive.

CHAPTER 2. TUTORIALS

150

2.23.2

BLAST for primer binding sites

You can adjust the BLAST parameters so it becomes possible to match short primer sequences against a larger sequence. Then it is easy to examine whether already existing lab primers can be reused for other purposes, or if the primers you designed are specific. Purpose Standard BLAST Primer search Program blastn blastn Word size 11 7 Low complexity filter On Off Expect value 10 1000

These settings are shown in figure 2.166.

Figure 2.166: Settings for searching for primer binding sites.

2.23.3

Finding remote protein homologues

If you look for short identical peptide sequences in a database, the standard BLAST parameters will have to be reconfigured. Using the parameters described below, you are likely to be able to identify whether antigenic determinants will cross react to other proteins. Purpose Program Word size Low complexity filter Expect value Scoring matrix Standard BLAST blastp 3 On 10 BLSUM62 Remote homologues blastp 2 Off 20000 PAM30 These settings are shown in figure 2.167.

2.23.4

Further reading

A valuable source of information about BLAST can be found at http://blast.ncbi.nlm.nih. gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastDocs&DOC_TYPE=ProgSelectionGuide. Remember that BLAST is a heuristic method. This means that certain assumptions are made to allow searches to be done in a reasonable amount of time. Thus you cannot trust BLAST search results to be accurate. For very accurate results you should consider using other algorithms, such

CHAPTER 2. TUTORIALS

151

Figure 2.167: Settings for searching for remote homologues. as Smith-Waterman. You can read "Bioinformatics explained: BLAST versus Smith-Waterman" here: http://www.clcbio.com/BE.

2.24

Tutorial: Proteolytic cleavage detection

This tutorial shows you how to find cut sites and see an overview of fragments when cleaving proteins with proteolytic cleavage enzymes. Suppose you are working with protein ATP8a1 from the example data, and you wish to see where the enzyme trypsin will cleave the protein. Furthermore, you want to see details for the resulting fragments which are between 10 and 15 amino acids long. select protein ATP8a1 | Toolbox | Protein Analyses ( ) | Proteolytic Cleavage

This opens Step 1 of the Proteolytic Cleavage dialog. In this step you can choose which sequences to include in the analysis. Since you have already chosen ATP8a1, click Next. In this step you should select Trypsin. This is illustrated in figure 2.168. Click Next to go to Step 3 of the dialog. In Step 3 you can adjust the parameters for which fragments of the cleavage you want to include in the table output of the analysis. Type '10' in the Min. fragment length | Check the box: Max. fragment length | enter '15' in the corresponding text field These parameter adjustments are shown in figure 2.169: Click Finish to make the analysis. The result of the analysis can be seen in figure 2.170 Note! The output of proteolytic cleavage is two related views. The sequence view displays annotations where the sequence is cleaved. The table view shows information about the fragments satisfying the parameters set in the dialog. Subsequently, if you have restricted the

CHAPTER 2. TUTORIALS

152

Figure 2.168: Selecting trypsin as the cleaving enzyme.

Figure 2.169: Adjusting the output from the cleavage to include fragments which are between 10 and 15 amino acids long. fragment parameters, you might have more annotations on the sequence than fragments in the table. If you conduct another proteolytic cleavage on the same sequence, the output consists of: (possibly) new annotations on the original sequence and an additional table view, listing all fragments.

2.25

Tutorial: Folding RNA molecules

In this tutorial, you will learn how to predict the secondary structure of an RNA molecule. You will also learn how to use the powerful ways of viewing and interacting with graphical displays of the structure. The sequence to be folded in this tutorial is a tRNA molecule with the characteristic secondary structure as shown in figure 2.171. The goal for this tutorial is to get a nice-looking graphic result of this structure.

CHAPTER 2. TUTORIALS

153

Figure 2.170: The output of the proteolytic cleavage shows the cleavage sites as annontations in the protein sequence. The accompanying table lists all the fragments which are between 10 and 15 amino acids long.

Figure 2.171: Secondary structure of a tRNA molecule. The sequence we are working with is a mitochondrial tRNA molecule from Drosophilia melanogaster. The name is AB009835, and can be found be searching GenBank: Search | Search for Sequences at NCBI ( )

When you have downloaded the sequence from NCBI: Select the sequence AB009835 | Toolbox | RNA Structure ( Structure ( ) ) | Predict Secondary

Since the sequence is already selected, click Next. In this dialog, choose to compute a sample of sub-optimal structure and leave the rest of the settings at their default (see figure 2.172). Click Finish and you will see a linear view of the sequence with structure information for the ten structures below the sequence, and the elements of the best structure are shown as annotations above the sequence (see figure 2.173). For now, we are not interested in the linear view. Click the Show Secondary Structure 2D View ( ) button at the bottom of the view to show the secondary structure. It looks as shown in figure 2.174). This structure does not look like the one we expected (shown in figure 2.171). We now take a look at some of the other structures (we chose to compute 10 different structures) to see if we

CHAPTER 2. TUTORIALS

154

Figure 2.172: Selecting to compute 10 suboptimal structures.

Figure 2.173: The inital, linear view of the secondary structure prediction.

Figure 2.174: The inital 2D view of the secondary structure. can find the classic tRNA structure. First, open a split view of the Show Secondary Structure Table ( ): Press and hold Ctrl ( on Mac) | Show Secondary Structure Table ( )

You will now see a table displaying the ten structures. Selecting a structure in the table will display this structure in the view above. Select the second structure in the table. The views should now look like figure 2.175). The secondary structure now looks very similar to figure 2.171. By adjusting the layout, we can make it look exactly the same: in the Side Panel of the 2D view, under Secondary Structure, choose the Proportional layout strategy. You will now see that the appearance of structure changes. Next, zoom in on the structure to see the residues. This is easiest if you first close ( view at the bottom. Zoom in ( ) | Click the structure until you see the residues ) the table

CHAPTER 2. TUTORIALS

155

Figure 2.175: A split view showing the scondary structure table at the bottom and the Secondary structure 2D view at the top. (You might need to Zoom out to see the structure). If you wish to make some manual corrections of the layout of the structure, first select the Pan ( ) mode in the Tool bar. Now place the mouse cursor on the opening of a stem, and a visual indication of the anchor point for turning the substructure will be shown (see figure 24.14).

Figure 2.176: The blue circle represents the anchor point for rotating the substructure. Click and drag to rotate the part of the structure represented by the line going from the anchor point. In order to keep the bases in a relatively sequential arrangement, there is a restriction on how much the substructure can be rotated. The highlighted part of the circle represents the angle where rotating is allowed. In figure 24.15, the structure shown in figure 24.14 has been modified by dragging with the mouse. The view can of course be printed ( ) or exported as graphics ( ).

CHAPTER 2. TUTORIALS

156

Figure 2.177: The structure has now been rotated.

2.26

Tutorial: Align protein sequences

This tutorial outlines some of the alignment functionality of the CLC Genomics Workbench. In addition to creating alignments of nucleotide or peptide sequences, the software offers several ways to view alignments. The alignments can then be used for building phylogenetic trees. Sequences must be available via the Navigation Area to be included in an alignment. If you have sequences open in a View that you have not saved, then you just need to select the view tab and press Ctrl + S (or + S on Mac) to save them. In this tutorial six protein sequences from the Example data folder will be aligned. figure 2.178). (See

Figure 2.178: Six protein sequences in 'Sequences' from the 'Protein orthologs' folder of the Example data. To align the sequences: select the sequences from the 'Protein' folder under 'Sequences' | Toolbox | Alignments and Trees ( ) | Create Alignment ( )

2.26.1

The alignment dialog

This opens the dialog shown in figure 2.179. It is possible to add and remove sequences from Selected Elements list. Since we had already selected the eight proteins, just click Next to adjust parameters for the alignment. Clicking Next opens the dialog shown in figure 2.180. Leave the parameters at their default settings. An explanation of the parameters can be found

CHAPTER 2. TUTORIALS

157

Figure 2.179: The alignment dialog displaying the six protein sequences.

Figure 2.180: The alignment dialog displaying the available parameters which can be adjusted. by clicking the help button ( on the parameters. ). Alternatively, a tooltip is displayed by holding the mouse cursor

Click Finish to start the alignment process which is shown in the Toolbox under the Processes tab. When the program is finished calculating it displays the alignment (see fig. 2.181): Note! The new alignment is not saved automatically. To save the alignment, drag the tab of the alignment view into the Navigation Area. Installing the Additional Alignments plugin gives you access to other alignment algorithms: ClustalW (Windows/Mac/Linux), Muscle (Windows/Mac/Linux), T-Coffee (Mac/Linux), MAFFT (Mac/Linux), and Kalign (Mac/Linux). The Additional Alignments Module can be downloaded from http://www.clcbio.com/plugins. Note that you will need administrative privileges on your system to install it.

CHAPTER 2. TUTORIALS

158

Figure 2.181: The resulting alignment.

2.27

Tutorial: Create and modify a phylogenetic tree

You can make a phylogenetic tree from an existing alignment. (See how to create an alignment in the tutorial: "Align protein sequences"). We use the 'ATPase protein alignment' located in 'Protein orthologs' in the Example data. To create a phylogenetic tree: click the 'ATPase protein alignment' in the Navigation Area | Toolbox | Alignments and Trees ( ) | Create Tree ( ) A dialog opens where you can confirm your selection of the alignment. Click Next to move to the next step in the dialog where you can choose between the neighbor joining and the UPGMA algorithms for making trees. You also have the option of including a bootstrap analysis of the result. Leave the parameters at their default, and click Finish to start the calculation, which can be seen in the Toolbox under the Processes tab. After a short while a tree appears in the View Area (figure 2.182).

Figure 2.182: After choosing which algorithm should be used, the tree appears in the View Area. The Side panel in the right side of the view allows you to adjust the way the tree is displayed.

CHAPTER 2. TUTORIALS

159

2.27.1

Tree layout

Using the Side Panel (in the right side of the view), you can change the way the tree is displayed. Click Tree Layout and open the Layout drop down menu. Here you can choose between standard and topology layout. The topology layout can help to give an overview of the tree if some of the branches are very short. When the sequences include the appropriate annotation, it is possible to choose between the accession number and the species names at the leaves of the tree. Sequences downloaded from GenBank, for example, have this information. The Labels preferences allows these different node annotations as well as different annotation on the branches. The branch annotation includes the bootstrap value, if this was selected when the tree was calculated. It is also possible to annotate the branches with their lengths.

2.28

Tutorial: Find restriction sites

This tutorial will show you how to find restriction sites and annotate them on a sequence. There are two ways of finding and showing restriction sites. In many cases, the dynamic restriction sites found in the Side Panel of sequence views will be useful, since it is a quick and easy way of showing restriction sites. In the Toolbox you will find the other way of doing restriction site analyses. This way provides more control of the analysis and gives you more output options, e.g. a table of restriction sites and a list of restriction enzymes that can be saved for later use. In this tutorial, the first section describes how to use the Side Panel to show restriction sites, whereas the second section describes the restriction map analysis performed from the Toolbox.

2.28.1

The Side Panel way of finding restriction sites

When you open a sequence, there is a Restriction sites setting in the Side Panel. By default, 10 of the most popular restriction enzymes are shown (see figure 2.183). The restriction sites are shown on the sequence with an indication of cut site and recognition sequence. In the list of enzymes in the Side Panel, the number of cut sites is shown in parentheses for each enzyme (e.g. SalI cuts three times). If you wish to see the recognition sequence of the enzyme, place your mouse cursor on the enzyme in the list for a short moment, and a tool tip will appear. You can add or remove enzymes from the list by clicking the Manage enzymes button.

2.28.2

The Toolbox way of finding restriction sites

Suppose you are working with sequence 'ATP8a1 mRNA' from the example data, and you wish to know which restriction enzymes will cut this sequence exactly once and create a 3' overhang. Do the following: select the ATP8a1 mRNA sequence | Toolbox in the Menu Bar | Cloning and Restriction Sites ( ) | Restriction Site Analysis ( ) Click Next to set parameters for the restriction map analysis.

CHAPTER 2. TUTORIALS

160

Figure 2.183: Showing restriction sites of ten restriction enzymes. In this step first select Use existing enzyme list and click the Browse for enzyme list button ( ). Select the 'Popular enzymes' in the Cloning folder under Enzyme lists. Then write 3' into the filter below to the left. Select all the enzymes and click the Add button ( ). The result should be like in figure 2.184.

Figure 2.184: Selecting enzymes. Click Next. In this step you specify that you want to show enzymes that cut the sequence only once. This means that you should de-select the Two restriction sites checkbox. Click Next and select that you want to Add restriction sites as annotations on sequence and Create restriction map. (See figure 2.185). Click Finish to start the restriction map analysis.

CHAPTER 2. TUTORIALS

161

Figure 2.185: Selecting output for restriction map analysis. View restriction site The restriction sites are shown in two views: one view is in a tabular format and the other view displays the sites as annotations on the sequence. The result is shown in figure 2.186. The restriction map at the bottom can also be shown as

Figure 2.186: The result of the restriction map analysis is displayed in a table at the bottom and as annotations on the sequence in the view at the top. a table of fragments produced by cutting the sequence with the enzymes: Click the Fragments button ( ) at the bottom of the view

In a similar way the fragments can be shown on a virtual gel: Click the Gel button ( ) at the bottom of the view

Part II

Core Functionalities

162

Chapter 3

User interface
Contents
3.1 Navigation Area . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 164 3.1.1 3.1.2 3.1.3 3.1.4 3.1.5 3.1.6 3.1.7 3.1.8 3.2 3.2.1 3.2.2 3.2.3 3.2.4 3.2.5 3.2.6 3.2.7 3.3 3.3.1 3.3.2 3.3.3 3.3.4 3.3.5 3.3.6 3.3.7 3.4 3.4.1 3.4.2 3.4.3 3.5 Data structure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 165 Create new folders . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 167 Sorting folders . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 167 Multiselecting elements . . . . . . . . . . . . . . . . . . . . . . . . . . . 167 Moving and copying elements . . . . . . . . . . . . . . . . . . . . . . . . 167 Change element names . . . . . . . . . . . . . . . . . . . . . . . . . . . 169 Delete elements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170 Show folder elements in a table . . . . . . . . . . . . . . . . . . . . . . 170 Open view . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 172 Show element in another view . . . . . . . . . . . . . . . . . . . . . . . 173 Close views . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 173 Save changes in a view . . . . . . . . . . . . . . . . . . . . . . . . . . . 174 Undo/Redo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 175 Arrange views in View Area . . . . . . . . . . . . . . . . . . . . . . . . . 175 Side Panel . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 177 Zoom In . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 178 Zoom Out . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 178 Fit Width . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 179 Zoom to 100% . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 179 Move . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 179 Selection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 179 Changing compactness . . . . . . . . . . . . . . . . . . . . . . . . . . . 179 Processes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 180 Toolbox . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 181 Status Bar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 181

View Area . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 171

Zoom and selection in View Area . . . . . . . . . . . . . . . . . . . . . . . . 178

Toolbox and Status Bar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 180

Workspace . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 181

163

CHAPTER 3. USER INTERFACE

164

3.5.1 3.5.2 3.5.3 3.6 List

Create Workspace Select Workspace Delete Workspace of shortcuts . . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

181 181 182 182

This chapter provides an overview of the different areas in the user interface of CLC Genomics Workbench. As can be seen from figure 3.1 this includes a Navigation Area, View Area, Menu Bar, Toolbar, Status Bar and Toolbox.

Figure 3.1: The user interface consists of the Menu Bar, Toolbar, Status Bar, Navigation Area, Toolbox, and View Area.

3.1

Navigation Area

The Navigation Area is located in the left side of the screen, under the Toolbar (see figure 3.2). It is used for organizing and navigating data. Its behavior is similar to the way files and folders are usually displayed on your computer.

Figure 3.2: The Navigation Area.

CHAPTER 3. USER INTERFACE

165

3.1.1

Data structure

The data in the Navigation Area is organized into a number of Locations. When the CLC Genomics Workbench is started for the first time, there is one location called CLC_Data (unless your computer administrator has configured the installation otherwise). A location represents a folder on the computer: The data shown under a location in the Navigation Area is stored on the computer in the folder which the location points to. This is explained visually in figure 3.3.

Figure 3.3: In this example the location called 'CLC_Data' points to the folder at C:\Documents and settings\clcuser\CLC_Data. Adding locations Per default, there is one location in the Navigation Area called CLC_Data. It points to the following folder: On Windows: C:\Documents and settings\<username>\CLC_Data On Mac: /CLC_Data On Linux: /homefolder/CLC_Data You can easily add more locations to the Navigation Area: File | New | Location ( )

This will bring up a dialog where you can navigate to the folder you wish to use as your new location (see figure 3.4). When you click Open, the new location is added to the Navigation Area as shown in figure 3.5. The name of the new location will be the name of the folder selected for the location. To see where the folder is located on your computer, place your mouse cursor on the location icon ( ) for second. This will show the path to the location. Sharing data is possible of you add a location on a network drive. The procedure is similar to the one described above. When you add a location on a network drive or a removable drive, the

CHAPTER 3. USER INTERFACE

166

Figure 3.4: Navigating to a folder to use as a new location.

Figure 3.5: The new location has been added. location will appear inactive when you are not connected. Once you connect to the drive again, click Update All ( ) and it will become active (note that there will be a few seconds' delay from you connect). Opening data The elements in the Navigation Area are opened by : Double-click the element or Click the element | Show ( ) in the Toolbar | Select the desired way to view the element This will open a view in the View Area, which is described in section 3.2. Adding data Data can be added to the Navigation Area in a number of ways. Files can be imported from the file system (see chapter 7). Furthermore, an element can be added by dragging it into the Navigation Area. This could be views that are open, elements on lists, e.g. search hits or sequence lists, and files located on your computer. Finally, you can add data by adding a new location (see section 3.1.1). If a file or another element is dropped on a folder, it is placed at the bottom of the folder. If it is dropped on another element, it will be placed just below that element. If the element already exists in the Navigation Area, you will be asked whether you wish to create

CHAPTER 3. USER INTERFACE a copy.

167

3.1.2

Create new folders

In order to organize your files, they can be placed in folders. Creating a new folder can be done in two ways: right-click an element in the Navigation Area | New | Folder ( or File | New | Folder ( ) )

If a folder is selected in the Navigation Area when adding a new folder, the new folder is added at the bottom of this folder. If an element is selected, the new folder is added right above that element. You can move the folder manually by selecting it and dragging it to the desired destination.

3.1.3

Sorting folders

You can sort the elements in a folder alphabetically: right-click the folder | Sort Folder On Windows, subfolders will be placed at the top of the folder, and the rest of the elements will be listed below in alphabetical order. On Mac, both subfolders and other elements are listed together in alphabetical order.

3.1.4

Multiselecting elements

Multiselecting elements means that you select more than one element at the same time. This can be done in the following ways: Holding down the <Ctrl> key ( on Mac) while clicking on multiple elements selects the elements that have been clicked. Selecting one element, and selecting another element while holding down the <Shift> key selects all the elements listed between the two locations (the two end locations included). Selecting one element, and moving the curser with the arrow-keys while holding down the <Shift> key, enables you to increase the number of elements selected.

3.1.5

Moving and copying elements

Elements can be moved and copied in several ways: Using Copy ( Using Ctrl + C ( Using Copy ( ), Cut ( ) and Paste ( ) from the Edit menu. + X on Mac) and Ctrl + V ( ) in the Toolbar. + V on Mac).

+ C on Mac), Ctrl + X ( ), Cut ( ) and Paste (

Using drag and drop to move elements.

CHAPTER 3. USER INTERFACE Using drag and drop while pressing Ctrl / Command to copy elements.

168

In the following, all of these possibilities for moving and copying elements are described in further detail. Copy, cut and paste functions Copies of elements and folders can be made with the copy/paste function which can be applied in a number of ways: select the files to copy | right-click one of the selected files | Copy ( the location to insert files into | Paste ( ) or select the files to copy | Ctrl + C ( + P ( + P on Mac) ) | right-click

+ C on Mac) | select where to insert files | Ctrl ) | select where to insert

or select the files to copy | Edit in the Menu Bar | Copy ( files | Edit in the Menu Bar | Paste ( )

If there is already an element of that name, the pasted element will be renamed by appending a number at the end of the name. Elements can also be moved instead of copied. This is done with the cut/paste function: select the files to cut | right-click one of the selected files | Cut ( the location to insert files into | Paste ( ) or select the files to cut | Ctrl + X ( + V ( + V on Mac) ) | right-click

+ X on Mac) | select where to insert files | Ctrl

When you have cut the element, it is "greyed out" until you activate the paste function. If you change your mind, you can revert the cut command by copying another element. Note that if you move data between locations, the original data is kept. This means that you are essentially doing a copy instead of a move operation. Move using drag and drop Using drag and drop in the Navigation Area, as well as in general, is a four-step process: click the element | click on the element again, and hold left mouse button | drag the element to the desired location | let go of mouse button This allows you to: Move elements between different folders in the Navigation Area Drag from the Navigation Area to the View Area: A new view is opened in an existing View Area if the element is dragged from the Navigation Area and dropped next to the tab(s) in that View Area. Drag from the View Area to the Navigation Area: The element, e.g. a sequence, alignment, search report etc. is saved where it is dropped. If the element already exists, you are asked whether you want to save a copy. You drag from the View Area by dragging the tab of the desired element.

CHAPTER 3. USER INTERFACE

169

Use of drag and drop is supported throughout the program, also to open and re-arrange views (see section 3.2.6). Note that if you move data between locations, the original data is kept. This means that you are essentially doing a copy instead of a move operation. Copy using drag and drop To copy instead of move using drag and drop, hold the Ctrl ( on Mac) key while dragging:

click the element | click on the element again, and hold left mouse button | drag the element to the desired location | press Ctrl ( on Mac) while you let go of mouse button release the Ctrl/ button

3.1.6

Change element names

This section describes two ways of changing the names of sequences in the Navigation Area. In the first part, the sequences themselves are not changed - it's their representation that changes. The second part describes how to change the name of the element. Change how sequences are displayed Sequence elements can be displayed in the Navigation Area with different types of information: Name (this is the default information to be shown). Accession (sequences downloaded from databases like GenBank have an accession number). Latin name. Latin name (accession). Common name. Common name (accession). Whether sequences can be displayed with this information depends on their origin. Sequences that you have created yourself or imported might not include this information, and you will only be able to see them represented by their name. However, sequences downloaded from databases like GenBank will include this information. To change how sequences are displayed: right-click any element or folder in the Navigation Area | Sequence Representation | select format This will only affect sequence elements, and the display of other types of elements, e.g. alignments, trees and external files, will be not be changed. If a sequence does not have this information, there will be no text next to the sequence icon.

CHAPTER 3. USER INTERFACE Rename element

170

Renaming a folder or an element in the Navigation Area can be done in three different ways: select the element | Edit in the Menu Bar | Rename or select the element | F2 click the element once | wait one second | click the element again When you can rename the element, you can see that the text is selected and you can move the cursor back and forth in the text. When the editing of the name has finished; press Enter or select another element in the Navigation Area. If you want to discard the changes instead, press the Esc-key. For renaming annotations instead of folders or elements, see section 10.3.3.

3.1.7

Delete elements
)

Deleting a folder or an element can be done in two ways: right-click the element | Delete (

or select the element | press Delete key This will cause the element to be moved to the Recycle Bin ( ) where it is kept until the recycle bin is emptied. This means that you can recover deleted elements later on. For deleting annotations instead of folders or elements, see section 10.3.4. Restore Deleted Elements The elements in the Recycle Bin ( ) can be restored by dragging the elements with the mouse into the folder where they used to be. If you have deleted large amounts of data taking up very much disk space, you can free this disk space by emptying the Recycle Bin ( ): Edit in the Menu Bar | Empty Recycle Bin ( )

Note! This cannot be undone, and you will therefore not be able to recover the data present in the recycle bin when it was emptied.

3.1.8

Show folder elements in a table

A location or a folder might contain large amounts of elements. It is possible to view their elements in the View Area: select a folder or location | Show ( An example is shown in figure 3.6. When the elements are shown in the view, they can be sorted by clicking the heading of each of the columns. You can further refine the sorting by pressing Ctrl ( on Mac) while clicking the heading of another column. ) in the Toolbar | Contents ( )

CHAPTER 3. USER INTERFACE

171

Figure 3.6: Viewing the elements in a folder. Sorting the elements in a view does not affect the ordering of the elements in the Navigation Area. Note! The view only displays one "layer" at a time: the content of subfolders is not visible in this view. Also note that only sequences have the full span of information like organism etc. Batch edit folder elements You can select a number of elements in the table, right-click and choose Edit to batch edit the elements. In this way, you can change the e.g. the description or common name of several elements in one go. In figure 3.7 you can see an example where the common name of five sequence are renamed in one go. In this example, a dialog with a text field will be shown, letting you enter a new common name for these five sequences. Note! This information is directly saved and you cannot undo.

3.2

View Area

The View Area is the right-hand part of the screen, displaying your current work. The View Area may consist of one or more Views, represented by tabs at the top of the View Area. This is illustrated in figure 3.8. The tab concept is central to working with CLC Genomics Workbench, because several operations can be performed by dragging the tab of a view, and extended right-click menus can be activated from the tabs.

CHAPTER 3. USER INTERFACE

172

Figure 3.7: Changing the common name of five sequences.

Figure 3.8: A View Area can enclose several views, each view is indicated with a tab (see right view, which shows protein P68225). Furthermore, several views can be shown at the same time (in this example, four views are displayed). This chapter deals with the handling of views inside a View Area. Furthermore, it deals with rearranging the views. Section 3.3 deals with the zooming and selecting functions.

3.2.1

Open view

Opening a view can be done in a number of ways: double-click an element in the Navigation Area

CHAPTER 3. USER INTERFACE or select an element in the Navigation Area | File | Show | Select the desired way to view the element or select an element in the Navigation Area | Ctrl + O ( + B on Mac)

173

Opening a view while another view is already open, will show the new view in front of the other view. The view that was already open can be brought to front by clicking its tab. Note! If you right-click an open tab of any element, click Show, and then choose a different view of the same element, this new view is automatically opened in a split-view, allowing you to see both views. See section 3.1.5 for instructions on how to open a view using drag and drop.

3.2.2

Show element in another view

Each element can be shown in different ways. A sequence, for example, can be shown as linear, circular, text etc. In the following example, you want to see a sequence in a circular view. If the sequence is already open in a view, you can change the view to a circular view: Click Show As Circular ( ) at the lower left part of the view

The buttons used for switching views are shown in figure 3.9).

Figure 3.9: The buttons shown at the bottom of a view of a nucleotide sequence. You can click the buttons to change the view to e.g. a circular view or a history view. If the sequence is already open in a linear view ( linear view, you can split the views very easily: ), and you wish to see both a circular and a

Press Ctrl ( on Mac) while you | Click Show As Circular ( ) at the lower left part of the view This will open a split view with a linear view at the bottom and a circular view at the top (see 10.5). You can also show a circular view of a sequence without opening the sequence first: Select the sequence in the Navigation Area | Show ( ) | As Circular ( )

3.2.3

Close views

When a view is closed, the View Area remains open as long as there is at least one open view. A view is closed by: right-click the tab of the View | Close or select the view | Ctrl + W or hold down the Ctrl-button | Click the tab of the view while the button is pressed By right-clicking a tab, the following close options exist. See figure 3.10

CHAPTER 3. USER INTERFACE

174

Figure 3.10: By right-clicking a tab, several close options are available. Close. See above. Close Tab Area. Closes all tabs in the tab area. Close All Views. Closes all tabs, in all tab areas. Leaves an empty workspace. Close Other Tabs. Closes all other tabs in the particular tab area.

3.2.4

Save changes in a view

When changes are made in a view, the text on the tab appears bold and italic (on Mac it is indicated by an * before the name of the tab). This indicates that the changes are not saved. The Save function may be activated in two ways: Click the tab of the view you want to save | Save ( ) in the toolbar. + S on Mac)

or Click the tab of the view you want to save | Ctrl + S (

If you close a view containing an element that has been changed since you opened it, you are asked if you want to save. When saving a new view that has not been opened from the Navigation Area (e.g. when opening a sequence from a list of search hits), a save dialog appears (figure 3.11).

Figure 3.11: Save dialog.

CHAPTER 3. USER INTERFACE In the dialog you select the folder in which you want to save the element. After naming the element, press OK

175

3.2.5

Undo/Redo

If you make a change in a view, e.g. remove an annotation in a sequence or modify a tree, you can undo the action. In general, Undo applies to all changes you can make when right-clicking in a view. Undo is done by: Click undo ( or Edit | Undo ( or Ctrl + Z If you want to undo several actions, just repeat the steps above. To reverse the undo action: Click the redo icon in the Toolbar or Edit | Redo ( or Ctrl + Y Note! Actions in the Navigation Area, e.g. renaming and moving elements, cannot be undone. However, you can restore deleted elements (see section 3.1.7). You can set the number of possible undo actions in the Preferences dialog (see section 5). ) ) in the Toolbar )

3.2.6

Arrange views in View Area

Views are arranged in the View Area by their tabs. The order of the views can be changed using drag and drop. E.g. drag the tab of one view onto the tab of a another. The tab of the first view is now placed at the right side of the other tab. If a tab is dragged into a view, an area of the view is made gray (see fig. 3.12) illustrating that the view will be placed in this part of the View Area.

Figure 3.12: When dragging a view, a gray area indicates where the view will be shown.

CHAPTER 3. USER INTERFACE The results of this action is illustrated in figure 3.13.

176

Figure 3.13: A horizontal split-screen. The two views split the View Area. You can also split a View Area horizontally or vertically using the menus. Splitting horisontally may be done this way: right-click a tab of the view | View | Split Horizontally ( )

This action opens the chosen view below the existing view. (See figure 3.14). When the split is made vertically, the new view opens to the right of the existing view.

Figure 3.14: A vertical split-screen. Splitting the View Area can be undone by dragging e.g. the tab of the bottom view to the tab of the top view. This is marked by a gray area on the top of the view.

CHAPTER 3. USER INTERFACE Maximize/Restore size of view

177

The Maximize/Restore View function allows you to see a view in maximized mode, meaning a mode where no other views nor the Navigation Area is shown.

Figure 3.15: A maximized view. The function hides the Navigation Area and the Toolbox. Maximizing a view can be done in the following ways: select view | Ctrl + M or select view | View | Maximize/restore View ( ) )

or select view | right-click the tab | View | Maximize/restore View ( or double-click the tab of view The following restores the size of the view: Ctrl + M or View | Maximize/restore View ( or double-click title of view )

3.2.7

Side Panel

The Side Panel allows you to change the way the contents of a view are displayed. The options in the Side Panel depend on the kind of data in the view, and they are described in the relevant sections about sequences, alignments, trees etc. Side Panel are activated in this way: select the view | Ctrl + U ( + U on Mac) )

or right-click the tab of the view | View | Show/Hide Side Panel (

Note! Changes made to the Side Panel will not be saved when you save the view. See how to save the changes in the Side Panel in chapter 5 .

CHAPTER 3. USER INTERFACE

178

The Side Panel consists of a number of groups of preferences (depending on the kind of data being viewed), which can be expanded and collapsed by clicking the header of the group. You can also expand or collapse all the groups by clicking the icons ( )/ ( ) at the top.

3.3

Zoom and selection in View Area

The mode toolbar items in the right side of the Toolbar apply to the function of the mouse pointer. When e.g. Zoom Out is selected, you zoom out each time you click in a view where zooming is relevant (texts, tables and lists cannot be zoomed). The chosen mode is active until another mode toolbar item is selected. (Fit Width and Zoom to 100% do not apply to the mouse pointer.)

Figure 3.16: The mode toolbar items.

3.3.1

Zoom In
) in the toolbar | click the location in the view that you want to.

There are four ways of Zooming In: Click Zoom In ( zoom in on

or Click Zoom In ( ) in the toolbar | click-and-drag a box around a part of the view | the view now zooms in on the part you selected or Press '+' on your keyboard The last option for zooming in is only available if you have a mouse with a scroll wheel: or Press and hold Ctrl ( on Mac) | Move the scroll wheel on your mouse forward

When you choose the Zoom In mode, the mouse pointer changes to a magnifying glass to reflect the mouse mode. Note! You might have to click in the view before you can use the keyboard or the scroll wheel to zoom. If you press the Shift button on your keyboard while clicking in a View, the zoom function is reversed. Hence, clicking on a sequence in this way while the Zoom In mode toolbar item is selected, zooms out instead of zooming in.

3.3.2

Zoom Out

It is possible to zoom out, step by step, on a sequence: Click Zoom Out ( ) in the toolbar | click in the view until you reach a satisfying. zoomlevel or Press '-' on your keyboard The last option for zooming out is only available if you have a mouse with a scroll wheel:

CHAPTER 3. USER INTERFACE or Press and hold Ctrl ( on Mac) | Move the scroll wheel on your mouse backwards

179

When you choose the Zoom Out mode, the mouse pointer changes to a magnifying glass to reflect the mouse mode. Note! You might have to click in the view before you can use the keyboard or the scroll wheel to zoom. If you want to get a quick overview of a sequence or a tree, use the Fit Width function instead of the Zoom Out function. If you press Shift while clicking in a View, the zoom function is reversed. Hence, clicking on a sequence in this way while the Zoom Out mode toolbar item is selected, zooms in instead of zooming out.

3.3.3

Fit Width

The Fit Width ( ) function adjusts the content of the View so that both ends of the sequence, alignment, or tree is visible in the View in question. (This function does not change the mode of the mouse pointer.)

3.3.4

Zoom to 100%

The Zoom to 100% ( ) function zooms the content of the View so that it is displayed with the highest degree of detail. (This function does not change the mode of the mouse pointer.)

3.3.5

Move

The Move mode allows you to drag the content of a View. E.g. if you are studying a sequence, you can click anywhere in the sequence and hold the mouse button. By moving the mouse you move the sequence in the View.

3.3.6

Selection

The Selection mode ( ) is used for selecting in a View (selecting a part of a sequence, selecting nodes in a tree etc.). It is also used for moving e.g. branches in a tree or sequences in an alignment. When you make a selection on a sequence or in an alignment, the location is shown in the bottom right corner of the screen. E.g. '23 24' means that the selection is between two residues. '23' means that the residue at position 23 is selected, and finally '23..25' means that 23, 24 and you can make multiple selections. 25 are selected. By holding ctrl /

3.3.7

Changing compactness

There is a shortcut way of changing the compactness setting for read mappings: or Press and hold Alt key | Scroll using your mouse wheel or touchpad

CHAPTER 3. USER INTERFACE

180

3.4

Toolbox and Status Bar

The Toolbox is placed in the left side of the user interface of CLC Genomics Workbench below the Navigation Area. The Toolbox shows a Processes tab and a Toolbox tab.

3.4.1

Processes

By clicking the Processes tab, the Toolbox displays previous and running processes, e.g. an NCBI search or a calculation of an alignment. The running processes can be stopped, paused, and resumed by clicking the small icon ( ) next to the process (see figure 3.17). Running and paused processes are not deleted.

Figure 3.17: A database search and an alignment calculation are running. Clicking the small icon next to the process allow you to stop, pause and resume processes. Besides the options to stop, pause and resume processes, there are some extra options for a selected number of the tools running from the Toolbox: Show results. If you have chosen to save the results (see section 9.2), you will be able to open the results directly from the process by clicking this option. Find results. If you have chosen to save the results (see section 9.2), you will be able to high-light the results in the Navigation Area. Show Log Information. This will display a log file showing progress of the process. The log file can also be shown by clicking Show Log in the "handle results" dialog where you choose between saving and opening the results. Show Messages. Some analyses will give you a message when processing your data. The messages are the black dialogs shown in the lower left corner of the Workbench that disappear after a few seconds. You can reiterate the messages that have been shown by clicking this option. The terminated processes can be removed by: View | Remove Terminated Processes ( )

If you close the program while there are running processes, a dialog will ask if you are sure that you want to close the program. Closing the program will stop the process, and it cannot be restarted when you open the program again.

CHAPTER 3. USER INTERFACE

181

3.4.2

Toolbox

The content of the Toolbox tab in the Toolbox corresponds to Toolbox in the Menu Bar. The Toolbox can be hidden, so that the Navigation Area is enlarged and thereby displays more elements: View | Show/Hide Toolbox The tools in the toolbox can be accessed by double-clicking or by dragging elements from the Navigation Area to an item in the Toolbox.

3.4.3

Status Bar

As can be seen from figure 3.1, the Status Bar is located at the bottom of the window. In the left side of the bar is an indication of whether the computer is making calculations or whether it is idle. The right side of the Status Bar indicates the range of the selection of a sequence. (See chapter 3.3.6 for more about the Selection mode button.)

3.5

Workspace

If you are working on a project and have arranged the views for this project, you can save this arrangement using Workspaces. A Workspace remembers the way you have arranged the views, and you can switch between different workspaces. The Navigation Area always contains the same data across Workspaces. It is, however, possible to open different folders in the different Workspaces. Consequently, the program allows you to display different clusters of the data in separate Workspaces. All Workspaces are automatically saved when closing down CLC Genomics Workbench. The next time you run the program, the Workspaces are reopened exactly as you left them. Note! It is not possible to run more than one version of CLC Genomics Workbench at a time. Use two or more Workspaces instead.

3.5.1

Create Workspace

When working with large amounts of data, it might be a good idea to split the work into two or more Workspaces. As default the CLC Genomics Workbench opens one Workspace. Additional Workspaces are created in the following way: Workspace in the Menu Bar) | Create Workspace | enter name of Workspace | OK When the new Workspace is created, the heading of the program frame displays the name of the new Workspace. Initially, the selected elements in the Navigation Area is collapsed and the View Area is empty and ready to work with. (See figure 3.18).

3.5.2

Select Workspace

When there is more than one Workspace in the CLC Genomics Workbench, there are two ways to switch between them:

CHAPTER 3. USER INTERFACE

182

Figure 3.18: An empty Workspace. Workspace ( ) in the Toolbar | Select the Workspace to activate ) | choose which Workspace

or Workspace in the Menu Bar | Select Workspace ( to activate | OK

The name of the selected Workspace is shown after "CLC Genomics Workbench" at the top left corner of the main window, in figure 3.18 it says: (default).

3.5.3

Delete Workspace

Deleting a Workspace can be done in the following way: Workspace in the Menu Bar | Delete Workspace | choose which Workspace to delete | OK Note! Be careful to select the right Workspace when deleting. The delete action cannot be undone. (However, no data is lost, because a workspace is only a representation of data.) It is not possible to delete the default workspace.

3.6

List of shortcuts

The keyboard shortcuts in CLC Genomics Workbench are listed below.

CHAPTER 3. USER INTERFACE Action Adjust selection Change between tabs1 Close Close all views Copy Cut Delete Exit Export Export graphics Find Next Conflict Find Previous Conflict Help Import Maximize/restore size of View Move gaps in alignment Navigate sequence views New Folder New Sequence View Paste Print Redo Rename Save Search local data Search within a sequence Search NCBI Search UniProt Select All Selection Mode Show/hide Side Panel Sort folder Split Horizontally Split Vertically Undo User Preferences Zoom In Mode Zoom In (without clicking) Zoom Out Mode Zoom Out (without clicking) Inverse zoom mode Windows/Linux Shift + arrow keys Ctrl + tab Ctrl + W Ctrl + Shift + W Ctrl + C Ctrl + X Delete Alt + F4 Ctrl + E Ctrl + G Space or . , F1 Ctrl + I Ctrl + M Ctrl + arrow keys arrow keys Ctrl + Shift + N Ctrl + N Ctrl + O Ctrl + V Ctrl + P Ctrl + Y F2 Ctrl + S Ctrl + F Ctrl + Shift + F Ctrl + B Ctrl + Shift + U Ctrl + A Ctrl + 2 Ctrl + U Ctrl + Shift + R Ctrl + T Ctrl + J Ctrl + Z Ctrl + K Ctrl + + (plus) + (plus) Ctrl + - (minus) - (minus) press and hold Shift Mac OS X Shift + arrow keys Ctrl + Page Up/Down +W + Shift + W +C +X Delete or + Backspace +Q +E +G Space or . , F1 +I +M + arrow keys arrow keys + Shift + N +N +O +V +P +Y F2 +S +F + Shift + F +B + Shift + U +A +2 +U + Shift + R +T +J +Z +; +3 + (plus) +4 - (minus) press and hold Shift

183

Combinations of keys and mouse movements are listed below.

1

On Linux changing tabs is accomplished using Ctrl + Page Up/Page Down

CHAPTER 3. USER INTERFACE

184

Action Windows/Linux Mac OS X Mouse movement Maximize View Double-click the tab of the View Restore View Double-click the View title "ElReverse zoom function Shift Shift Click in view Select multiple elements Ctrl Click elements Select multiple elements Shift Shift Click elements ements" in this context refers to elements and folders in the Navigation Area selections on sequences, and rows in tables.

Chapter 4

Searching your data

Contents
4.1 4.2 What kind of information can be searched? . . . . . . . . . . . . . . . . . . . 185 Quick search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 186 4.2.1 4.2.2 4.2.3 4.3 4.4 Quick search results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 186 Special search expressions . . . . . . . . . . . . . . . . . . . . . . . . . 187 Quick search history . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 188

Advanced search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 188 Search index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 190

There are two ways of doing text-based searches of your data, as described in this chapter: Quick-search directly from the search field in the Navigation Area. Advanced search which makes it easy to make more specific searches. In most cases, quick-search will find what you need, but if you need to be more specific in your search criteria, the advanced search is preferable.

4.1

What kind of information can be searched?

Below is a list of the different kinds of information that you can search for (applies to both quick-search and the advanced search). Name. The name of a sequence, an alignment or any other kind of element. The name is what is displayed in the Navigation Area per default. Length. The length of the sequence. Organism. Sequences which contain information about organism can be searched. In this way, you could search for e.g. Homo sapiens sequences. Database fields. If your data is stored in a CLC Bioinformatics Database, you will be able to search for custom defined information. Read more in the database user manual. 185

CHAPTER 4. SEARCHING YOUR DATA

186

Only the first item in the list, Name, is available for all kinds of data. The rest is only relevant for sequences. If you wish to perform a search for sequence similarity, use Local BLAST (see section 12.1.3) instead.

4.2

Quick search

At the bottom of the Navigation Area there is a text field as shown in figure 4.1).

Figure 4.1: Search simply by typing in the text field and press Enter. To search, simply enter a text to search for and press Enter.

4.2.1

Quick search results

To show the results, the search pane is expanded as shown in figure 4.2).

Figure 4.2: Search results. If there are many hits, only the 50 first hits are immediately shown. At the bottom of the pane you can click Next ( ) to see the next 50 hits (see figure 4.3). If a search gives no hits, you will be asked if you wish to search for matches that start with your search term. If you accept this, an asterisk (*) will be appended to the search term. Pressing the Alt key while you click a search result will high-light the search hit in its folder in the Navigation Area.

CHAPTER 4. SEARCHING YOUR DATA

187

Figure 4.3: Page two of the search results. In the preferences (see 5), you can specify the number of hits to be shown.

4.2.2

Special search expressions

When you write a search term in the search field, you can get help to write a more advanced search expression by pressing Shift+F1. This will reveal a list of guides as shown in figure 4.4.

Figure 4.4: Guides to help create advanced search expressions. You can select any of the guides (using mouse or keyboard arrows), and start typing. If you e.g. wish to search for sequences named BRCA1, select "Name search (name:)", and type "BRCA1". Your search expression will now look like this: "name:BRCA1". The guides available are these: Wildcard search (*). Appending an asterisk * to the search term will find matches starting with the term. E.g. searching for "brca*" will find both brca1 and brca2. Search related words ( ). If you don't know the exact spelling of a word, you can append a question mark to the search term. E.g. "brac1*" will find sequences with a brca1 gene.

CHAPTER 4. SEARCHING YOUR DATA

188

Include both terms (AND). If you write two search terms, you can define if your results have to match both search terms by combining them with AND. E.g. search for "brca1 AND human" will find sequences where both terms are present. Include either term (OR). If you write two search terms, you can define that your results have to match either of the search terms by combining them with OR. E.g. search for "brca1 OR brca2" will find sequences where either of the terms is present. Name search (name:). Search only the name of element. Organism search (organism:). For sequences, you can specify the organism to search for. This will look in the "Latin name" field which is seen in the Sequence Info view (see section 10.4). Length search (length:[START TO END]). Search for sequences of a specific length. E.g. search for sequences between 1000 and 2000 residues: "length:1000 TO 2000". If you do not use this special syntax, you will automatically search for both name, description, organism, etc., and search terms will be combined as if you had put OR between them.

4.2.3

Quick search history

) next to the search field

You can access the 10 most recent searches by clicking the icon ( (see figure 4.5).

Figure 4.5: Recent searches. Clicking one of the recent searches will conduct the search again.

4.3

Advanced search

As a supplement to the Quick search described in the previous section you can use the more advanced search: Search | Local Search ( or Ctrl + F ( + F on Mac) )

This will open the search view as shown in figure 4.6 The first thing you can choose is which location should be searched. All the active locations are shown in this list. You can also choose to search all locations. Read more about locations in section 3.1.1. Furthermore, you can specify what kind of elements should be searched:

CHAPTER 4. SEARCHING YOUR DATA

189

Figure 4.6: Advanced search. All sequences Nucleotide sequences Protein sequences All data When searching for sequences, you will also get alignments, sequence lists etc as result, if they contain a sequence which match the search criteria. Below are the search criteria. First, select a relevant search filter in the Add filter: list. For sequences you can search for Name Length Organism See section 4.2.2 for more information on individual search terms. For all other data, you can only search for name. If you use Any field, it will search all of the above plus the following: Description Keywords Common name Taxonomy name

CHAPTER 4. SEARCHING YOUR DATA To see this information for a sequence, switch to the Element Info (

190 ) view (see section 10.4).

For each search line, you can choose if you want the exact term by selecting "is equal to" or if you only enter the start of the term you wish to find (select "begins with"). An example is shown in figure 4.7.

Figure 4.7: Searching for human sequences shorter than 10,000 nucleotides. This example will find human nucleotide sequences (organism is Homo sapiens), and it will only find sequences shorter than 10,000 nucleotides. Note that a search can be saved ( ) for later use. You do not save the search results - only the search parameters. This means that you can easily conduct the same search later on when your data has changed.

4.4

Search index

This section has a technical focus and is not relevant if your search works fine. However, if you experience problems with your search results: if you do not get the hits you expect, it might be because of an index error. The CLC Genomics Workbench automatically maintains an index of all data in all locations in the Navigation Area. If this index becomes out of sync with the data, you will experience problems with strange results. In this case, you can rebuild the index: Right-click the relevant location | Location | Rebuild Index This will take a while depending on the size of your data. At any time, the process can be stopped in the process area, see section 3.4.1.

Chapter 5

User preferences and settings

Contents
5.1 5.2 General preferences . . . . . . . . . . . . . . . . . Default view preferences . . . . . . . . . . . . . . 5.2.1 Import and export Side Panel settings . . . . 5.3 Data preferences . . . . . . . . . . . . . . . . . . 5.4 Advanced preferences . . . . . . . . . . . . . . . 5.4.1 Default data location . . . . . . . . . . . . . 5.4.2 NCBI BLAST . . . . . . . . . . . . . . . . . . 5.5 Export/import of preferences . . . . . . . . . . . 5.5.1 The different options for export and importing 5.6 View settings for the Side Panel . . . . . . . . . . 5.6.1 Floating Side Panel . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 191 192 193 195 195 195 196 196 196 196 199

The first three sections in this chapter deal with the general preferences that can be set for CLC Genomics Workbench using the Preferences dialog. The next section explains how the settings in the Side Panel can be saved and applied to other views. Finally, you can learn how to import and export the preferences. The Preferences dialog offers opportunities for changing the default settings for different features of the program. The Preferences dialog is opened in one of the following ways and can be seen in figure 5.1: Edit | Preferences ( or Ctrl + K ( )

+ ; on Mac)

5.1

General preferences

The General preferences include: Undo Limit. As default the undo limit is set to 500. By writing a higher number in this field, more actions can be undone. Undo applies to all changes made on sequences, alignments or trees. See section 3.2.5 for more on this topic. 191

CHAPTER 5. USER PREFERENCES AND SETTINGS

192

Figure 5.1: Preferences include General preferences, View preferences, Colors preferences, and Advanced settings. Audit Support. If this option is checked, all manual editing of sequences will be marked with an annotation on the sequence (see figure 5.2). Placing the mouse on the annotation will reveal additional details about the change made to the sequence (see figure 5.3). Note that no matter whether Audit Support is checked or not, all changes are also recorded in the History ( ) (see section 8). Number of hits. The number of hits shown in CLC Genomics Workbench, when e.g. searching NCBI. (The sequences shown in the program are not downloaded, until they are opened or dragged/saved into the Navigation Area. Locale Setting. Specify which country you are located in. This determines how punctation is used in numbers all over the program. Show Dialogs. A lot of information dialogs have a checkbox: "Never show this dialog again". When you see a dialog and check this box in the dialog, the dialog will not be shown again. If you regret and wish to have the dialog displayed again, click the button in the General Preferences: Show Dialogs. Then all the dialogs will be shown again.

Figure 5.2: Annotations added when the sequence is edited.

Figure 5.3: Details of the editing.

5.2

Default view preferences

There are five groups of default View settings:

CHAPTER 5. USER PREFERENCES AND SETTINGS 1. Toolbar 2. Side Panel Location 3. New View 4. View Format 5. User Defined View Settings. In general, these are default settings for the user interface.

193

The Toolbar preferences let you choose the size of the toolbar icons, and you can choose whether to display names below the icons. The Side Panel Location setting lets you choose between Dock in views and Float in window. When docked in view, view preferences will be located in the right side of the view of e.g. an alignment. When floating in window, the side panel can be placed everywhere in your screen, also outside the workspace, e.g. on a different screen. See section 5.6 for more about floating side panels. The New view setting allows you to choose whether the View preferences are to be shown automatically when opening a new view. If this option is not chosen, you can press (Ctrl + U ( + U on Mac)) to see the preferences panels of an open view. The View Format allows you to change the way the elements appear in the Navigation Area. The following text can be used to describe the element: Name (this is the default information to be shown). Accession (sequences downloaded from databases like GenBank have an accession number). Latin name. Latin name (accession). Common name. Common name (accession). The User Defined View Settings gives you an overview of the different Side Panel settings that are saved for each view. See section 5.6 for more about how to create and save style sheets. If there are other settings beside CLC Standard Settings, you can use this overview to choose which of the settings should be used per default when you open a view (see an example in figure 5.4). In this example, the CLC Standard Settings is chosen as default.

5.2.1

Import and export Side Panel settings

If you have created a special set of settings in the Side Panel that you wish to share with other CLC users, you can export the settings in a file. The other user can then import the settings.

CHAPTER 5. USER PREFERENCES AND SETTINGS

194

Figure 5.4: Selecting the default view setting. To export the Side Panel settings, first select the views that you wish to export settings for. Use Ctrl+click ( + click on Mac) or Shift+click to select multiple views. Next click the Export...button. Note that there is also another export button at the very bottom of the dialog, but this will export the other settings of the Preferences dialog (see section 5.5). A dialog will be shown (see figure 5.5) that allows you to select which of the settings you wish to export.

Figure 5.5: Exporting all settings for circular views. When multiple views are selected for export, all the view settings for the views will be shown in the dialog. Click Export and you will now be able to define a save folder and name for the exported file. The settings are saved in a file with a .vsf extension (View Settings File). To import a Side Panel settings file, make sure you are at the bottom of the View panel of the Preferences dialog, and click the Import... button. Note that there is also another import button at the very bottom of the dialog, but this will import the other settings of the Preferences dialog (see section 5.5). The dialog asks if you wish to overwrite existing Side Panel settings, or if you wish to merge the imported settings into the existing ones (see figure 5.6). Note! If you choose to overwrite the existing settings, you will loose all the Side Panel settings that you have previously saved. To avoid confusion of the different import and export options, here is an overview:

CHAPTER 5. USER PREFERENCES AND SETTINGS

195

Figure 5.6: When you import settings, you are asked if you wish to overwrite existing settings or if you wish to merge the new settings into the old ones. Import and export of bioinformatics data such as sequences, alignments etc. (described in section 7.1.1). Graphics export of the views which creates image files in various formats (described in section 7.3). Import and export of Side Panel Settings as described above. Import and export of all the Preferences except the Side Panel settings. This is described in the previous section.

5.3

Data preferences

The data preferences contain preferences related to interpretation of data, e.g. linker sequences: Linkers for importing 454 data (see section 19.1.1). Predefined primer additions for Gateway cloning (see section 21.2.1). Adapter sequences for trimming (see section 19.3.2).

5.4

Advanced preferences

The Advanced settings include the possibility to set up a proxy server. This is described in section 1.8.

5.4.1

Default data location

If you have more than one location in the Navigation Area, you can choose which location should be the default data location. The default location is used when you e.g. import a file without selecting a folder or element in the Navigation Area first. Then the imported element will be placed in the default location. Note! The default location cannot be removed. You have to select another location as default first.

CHAPTER 5. USER PREFERENCES AND SETTINGS

196

5.4.2

NCBI BLAST

URL to use for BLAST It is possible to specify an alternate server URL to use for BLAST searches. The standard URL for the BLAST server at NCBI is: http://blast.ncbi.nlm.nih.gov/Blast.cgi. Note! Be careful to specify a valid URL, otherwise BLAST will not work.

5.5

Export/import of preferences

The user preferences of the CLC Genomics Workbench can be exported to other users of the program, allowing other users to display data with the same preferences as yours. You can also use the export/import preferences function to backup your preferences. To export preferences, open the Preferences dialog (Ctrl + K ( + ; on Mac)) and do the following:

Export | Select the relevant preferences | Export | Choose location for the exported file | Enter name of file | Save Note! The format of exported preferences is .cpf. This notation must be submitted to the name of the exported file in order for the exported file to work. Before exporting, you are asked about which of the different settings you want to include in the exported file. One of the items in the list is "User Defined View Settings". If you export this, only the information about which of the settings is the default setting for each view is exported. If you wish to export the Side Panel Settings themselves, see section 5.2.1. The process of importing preferences is similar to exporting: Press Ctrl + K ( + ; on Mac) to open Preferences | Import | Browse to and select the .cpf file | Import and apply preferences

5.5.1

The different options for export and importing

To avoid confusion of the different import and export options, here is an overview: Import and export of bioinformatics data such as sequences, alignments etc. (described in section 7.1.1). Graphics export of the views which creates image files in various formats (described in section 7.3). Import and export of Side Panel Settings as described in the next section. Import and export of all the Preferences except the Side Panel settings. This is described above.

5.6

View settings for the Side Panel

The Side Panel is shown to the right of all views that are opened in CLC Genomics Workbench. By using the settings in the Side Panel you can specify how the layout and contents of the view. Figure 5.7 is an example of the Side Panel of a sequence view.

CHAPTER 5. USER PREFERENCES AND SETTINGS

197

Figure 5.7: The Side Panel of a sequence contains several groups: Sequence layout, Annotation types, Annotation layout, etc. Several of these groups are present in more views. E.g. Sequence layout is also in the Side Panel of alignment views. By clicking the black triangles or the corresponding headings, the groups can be expanded or collapsed. An example is shown in figure 5.8 where the Sequence layout is expanded.

Figure 5.8: The Sequence layout is expanded. The content of the groups is described in the sections where the functionality is explained. E.g. Sequence Layout for sequences is described in chapter 10.1.1. When you have adjusted a view of e.g. a sequence, your settings in the Side Panel can be saved. When you open other sequences, which you want to display in a similar way, the saved settings

CHAPTER 5. USER PREFERENCES AND SETTINGS

198

can be applied. The options for saving and applying are available in the top of the Side Panel (see figure 5.9).

Figure 5.9: At the top of the Side Panel you can: Expand all groups, Collapse all preferences, Dock/Undock preferences, Help, and Save/Restore preferences. To save and apply the saved settings, click ( the following options are available: ) seen in figure 5.9. This opens a menu, where

Save Settings. This brings up a dialog as shown in figure 5.10 where you can enter a name for your settings. Furthermore, by clicking the checkbox Always apply these settings, you can choose to use these settings every time you open a new view of this type. If you wish to change which settings should be used per default, open the Preferences dialog (see section 5.2). Delete Settings. Opens a dialog to select which of the saved settings to delete. Apply Saved Settings. This is a submenu containing the settings that you have previously saved. By clicking one of the settings, they will be applied to the current view. You will also see a number of pre-defined view settings in this submenu. They are meant to be examples of how to use the Side Panel and provide quick ways of adjusting the view to common usages. At the bottom of the list of settings you will see CLC Standard Settings which represent the way the program was set up, when you first launched it.

Figure 5.10: The save settings dialog.

Figure 5.11: Applying saved settings. The settings are specific to the type of view. Hence, when you save settings of a circular view, they will not be available if you open the sequence in a linear view.

CHAPTER 5. USER PREFERENCES AND SETTINGS

199

If you wish to export the settings that you have saved, this can be done in the Preferences dialog under the View tab (see section 5.2.1). The remaining icons of figure 5.9 are used to; Expand all groups, Collapse all groups, and Dock/Undock Side Panel. Dock/Undock Side Panel is to make the Side Panel "floating" (see below).

5.6.1

Floating Side Panel

The Side Panel of the views can be placed in the right side of a view, or it can be floating (see figure 5.12).

Figure 5.12: The floating Side Panel can be moved out of the way, e.g. to allow for a wider view of a table. By clicking the Dock icon ( ) the floating Side Panel reappear in the right side of the view. The size of the floating Side Panel can be adjusted by dragging the hatched area in the bottom right.

Chapter 6

Printing
Contents
6.1 6.2 6.3 Selecting which part of the view to print . . . . . . . . . . . . . . . . . . . . 201 Page setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 202 6.2.1 Header and footer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 203 Print preview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 203

CLC Genomics Workbench offers different choices of printing the result of your work. This chapter deals with printing directly from CLC Genomics Workbench. Another option for using the graphical output of your work, is to export graphics (see chapter 7.3) in a graphic format, and then import it into a document or a presentation. All the kinds of data that you can view in the View Area can be printed. The CLC Genomics Workbench uses a WYSIWYG principle: What You See Is What You Get. This means that you should use the options in the Side Panel to change how your data, e.g. a sequence, looks on the screen. When you print it, it will look exactly the same way on print as on the screen. For some of the views, the layout will be slightly changed in order to be printer-friendly. It is not possible to print elements directly from the Navigation Area. They must first be opened in a view in order to be printed. To print the contents of a view: select relevant view | Print ( ) in the toolbar

This will show a print dialog (see figure 6.1). In this dialog, you can: Select which part of the view you want to print. Adjust Page Setup. See a print Preview window. These three options are described in the three following sections.

200

CHAPTER 6. PRINTING

201

Figure 6.1: The Print dialog.

6.1

Selecting which part of the view to print

In the print dialog you can choose to: Print visible area, or Print whole view These options are available for all views that can be zoomed in and out. In figure 6.2 is a view of a circular sequence which is zoomed in so that you can only see a part of it.

Figure 6.2: A circular sequence as it looks on the screen. When selecting Print visible area, your print will reflect the part of the sequence that is visible in the view. The result from printing the view from figure 6.2 and choosing Print visible area can be seen in figure 6.3.

Figure 6.3: A print of the sequence selecting Print visible area. On the other hand, if you select Print whole view, you will get a result that looks like figure 6.4. This means that you also print the part of the sequence which is not visible when you have zoomed in.

CHAPTER 6. PRINTING

202

Figure 6.4: A print of the sequence selecting Print whole view. The whole sequence is shown, even though the view is zoomed in on a part of the sequence.

6.2

Page setup

No matter whether you have chosen to print the visible area or the whole view, you can adjust page setup of the print. An example of this can be seen in figure 6.5

Figure 6.5: Page Setup. In this dialog you can adjust both the setup of the pages and specify a header and a footer by clicking the tab at the top of the dialog. You can modify the layout of the page using the following options: Orientation. Portrait. Will print with the paper oriented vertically. Landscape. Will print with the paper oriented horizontally. Paper size. Adjust the size to match the paper in your printer. Fit to pages. Can be used to control how the graphics should be split across pages (see figure 6.6 for an example). Horizontal pages. If you set the value to e.g. 2, the printed content will be broken up horizontally and split across 2 pages. This is useful for sequences that are not wrapped Vertical pages. If you set the value to e.g. 2, the printed content will be broken up vertically and split across 2 pages. Note! It is a good idea to consider adjusting view settings (e.g. Wrap for sequences), in the Side Panel before printing. As explained in the beginning of this chapter, the printed material will look like the view on the screen, and therefore these settings should also be considered when adjusting Page Setup.

CHAPTER 6. PRINTING

203

Figure 6.6: An example where Fit to pages horizontally is set to 2, and Fit to pages vertically is set to 3.

6.2.1

Header and footer

Click the Header/Footer tab to edit the header and footer text. By clicking in the text field for either Custom header text or Custom footer text you can access the auto formats for header/footer text in Insert a caret position. Click either Date, View name, or User name to include the auto format in the header/footer text. Click OK when you have adjusted the Page Setup. The settings are saved so that you do not have to adjust them again next time you print. You can also change the Page Setup from the File menu.

6.3

Print preview

The preview is shown in figure 6.7.

Figure 6.7: Print preview. The Print preview window lets you see the layout of the pages that are printed. Use the arrows in the toolbar to navigate between the pages. Click Print ( ) to show the print dialog, which lets you choose e.g. which pages to print. The Print preview window is for preview only - the layout of the pages must be adjusted in the Page setup.

Chapter 7

Import/export of data and graphics

Contents
7.1 Bioinformatic data formats . . . . . . 7.1.1 Import of bioinformatic data . . . 7.1.2 Import Vector NTI data . . . . . 7.1.3 Export of bioinformatics data . . 7.2 External files . . . . . . . . . . . . . . 7.3 Export graphics to files . . . . . . . . 7.3.1 Which part of the view to export 7.3.2 Save location and file formats . 7.3.3 Graphics export parameters . . . 7.3.4 Exporting protein reports . . . . 7.4 Export graph data points to a file . . 7.5 Copy/paste view output . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 204 205 206 209 211 211 211 213 214 215 216 217

CLC Genomics Workbench handles a large number of different data formats. All data stored in the Workbench are available in the Navigation Area. The data of the Navigation Area can be divided into two groups. The data is either one of the different bioinformatic data formats, or it can be an 'external file'. Bioinformatic data formats are those formats which the program can work with, e.g. sequences, alignments and phylogenetic trees. External files are files or links which are stored in CLC Genomics Workbench, but are opened by other applications, e.g. pdf-files, Microsoft Word files, Open Office spreadsheet files, or links to programs and web-pages etc. This chapter first deals with importing and exporting data in bioinformatic data formats and as external files. Next comes an explanation of how to export graph data points to a file, and how export graphics. For import of NGS data, please see section 19.1.

7.1

Bioinformatic data formats

The different bioinformatic data formats are imported in the same way, therefore, the following description of data import is an example which illustrates the general steps to be followed, regardless of which format you are handling. 204

CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS For import of NGS data, please see section 19.1.

205

7.1.1

Import of bioinformatic data

CLC Genomics Workbench has support for a wide range of bioinformatic data such as sequences, alignments etc. See a full list of the data formats in section J.1. The CLC Genomics Workbench offers a lot of possibilities to handle bioinformatic data. Read the next sections to get information on how to import different file formats or to import data from a Vector NTI database. For import of NGS data, please see section 19.1. Import using the import dialog Before importing a file, you must decide where you want to import it, i.e. which location or folder. The imported file ends up in the location or folder you selected in the Navigation Area. select location or folder | click Import ( ) in the Toolbar

This will show a dialog similar to figure 7.1 (depending on which platform you use). You can change which kind of file types that should be shown by selecting a file format in the Files of type box.

Figure 7.1: The import dialog. Next, select one or more files or folders to import and click Select. The imported files are placed at the location which was selected when the import was initiated. E.g. if you right-click on a file in the Navigation Area and choose import, the imported files are placed immediately below the selected file. If you right-click a folder, the imported files are placed as the last file in that folder. If you right-click a folder, the imported files are placed as the last elements in this folder.

CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS

206

If you import one or more folders, the contents of the folder is automatically imported and placed in that folder in the Navigation Area. If the folder contains subfolders, the whole folder structure is imported. In the import dialog (figure 7.1), there are three import options: Automatic import This will import the file and CLC Genomics Workbench will try to determine the format of the file. The format is determined based on the file extension (e.g. SwissProt files have .swp at the end of the file name) in combination with a detection of elements in the file that are specific to the individual file formats. If the file type is not recognized, it will be imported as an external file. In most cases, automatic import will yield a successful result, but if the import goes wrong, the next option can be helpful: Force import as type This option should be used if CLC Genomics Workbench cannot successfully determine the file format. By forcing the import as a specific type, the automatic determination of the file format is bypassed, and the file is imported as the type specified. Force import as external file This option should be used if a file is imported as a bioinformatics file when it should just have been external file. It could be an ordinary text file which is imported as a sequence. Import using drag and drop It is also possible to drag a file from e.g. the desktop into the Navigation Area of CLC Genomics Workbench. This is equivalent to importing the file using the Automatic import option described above. If the file type is not recognized, it will be imported as an external file. Import using copy/paste of text If you have e.g. a text file or a browser displaying a sequence in one of the formats that can be imported by CLC Genomics Workbench, there is a very easy way to get this sequence into the Navigation Area: Copy the text from the text file or browser | Select a folder in the Navigation Area | Paste ( ) This will create a new sequence based on the text copied. This operation is equivalent to saving the text in a text file and importing it into the CLC Genomics Workbench. If the sequence is not formatted, i.e. if you just have a text like this: "ATGACGAATAGGAGTTCTAGCTA" you can also paste this into the Navigation Area. Note! Make sure you copy all the relevant text - otherwise CLC Genomics Workbench might not be able to interpret the text.

7.1.2

Import Vector NTI data

There are several ways of importing your Vector NTI data into the CLC Workbench. The best way to go depends on how your data is currently stored in Vector NTI: Your data is stored in the Vector NTI Local Database which can be accessed through Vector NTI Explorer. This is described in the first section below.

CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS

207

Your data is stored as single files on your computer (just like Word documents etc.). This is described in the second section below. Import from the Vector NTI Local Database If your Vector NTI data are stored in a Vector NTI Local Database (as the one shown in figure 7.2), you can import all the data in one step, or you can import selected parts of it.

Figure 7.2: Data stored in the Vector NTI Local Database accessed through Vector NTI Explorer.

Importing the entire database in one step From the Workbench, there is a direct import of the whole database (see figure 7.3): File | Import Vector NTI Database

Figure 7.3: Import the whole Vector NTI Database. This will bring up a dialog letting you choose to import from the default location of the database, or you can specify another location. If the database is installed in the default folder, like e.g. C:\VNTI Database, press Yes. If not, click No and specify the database folder manually.

CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS

208

When the import has finished, the data will be listed in the Navigation Area of the Workbench as shown in figure 7.4.

Figure 7.4: The Vector NTI Data folder containing all imported sequences of the Vector NTI Database. If something goes wrong during the import process, please report the problem to [email protected]. To circumvent the problem, see the following section on how to import parts of the database. It will take a few more steps, but you will most likely be able to import this way. Importing parts of the database Instead of importing the whole database automatically, you can export parts of the database from Vector NTI Explorer and subsequently import into the Workbench. First, export a selection of files as an archive as shown in figure 7.5.

Figure 7.5: Select the relevant files and export them as an archive through the File menu. This will produce a file with a ma4-, pa4- or oa4-extension. Back in the CLC Workbench, click Import ( ) and select the file. Importing single files In Vector NTI, you can save a sequence in a file instead of in the database (see figure 7.6).

CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS

209

Figure 7.6: Saving a sequence as a file in Vector NTI. This will give you file with a .gb extension. This file can be easily imported into the CLC Workbench: Import ( ) | select the file | Select

You don't have to import one file at a time. You can simply select a bunch of files or an entire folder, and the CLC Workbench will take care of the rest. Even if the files are in different formats. You can also simply drag and drop the files into the Navigation Area of the CLC Workbench. The Vector NTI import is a plug-in which is pre-installed in the Workbench. It can be uninstalled and updated using the plug-in manager (see section 1.7).

7.1.3

Export of bioinformatics data

CLC Genomics Workbench can export bioinformatic data in most of the formats that can be imported. There are a few exceptions. See section 7.1.1. To export a file: select the element to export | Export ( 'File of type' | enter name of file | Save ) | choose where to export to | select

When exporting to CSV and tab delimited files, decimal numbers are formatted according to the Locale setting of the Workbench (see section 5.1). If you open the CSV or tab delimited file with spreadsheet software like Excel, you should make sure that both the Workbench and the spreadsheet software are using the same Locale. Note! The Export dialog decides which types of files you are allowed to export into, depending on what type of data you want to export. E.g. protein sequences can be exported into GenBank, Fasta, Swiss-Prot and CLC-formats.

CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS Export of folders and multiple elements

210

The .zip file type can be used to export all kinds of files and is therefore especially useful in these situations: Export of one or more folders including all underlying elements and folders. If you want to export two or more elements into one file. Export of folders is similar to export of single files. Exporting multiple files (of different formats) is done in .zip-format. This is how you export a folder: select the folder to export | Export ( ) | choose where to export to | enter name | Save You can export multiple files of the same type into formats other than ZIP (.zip). E.g. two DNA sequences can be exported in GenBank format: select the two sequences by <Ctrl>-click ( -click on Mac) or <Shift>-click | Export ( ) | choose where to export to | choose GenBank (.gbk) format | enter name the new file | Save Export of dependent elements When exporting e.g. an alignment, CLC Genomics Workbench can export the alignment including all the sequences that were used to create it. This way, when sending your alignment (with the dependent sequences), your colleagues can reproduce your findings with adjusted parameters, if desired. To export with dependent files: select the element in Navigation Area | File in Menu Bar | Export with Dependent Elements | enter name of of the new file | choose where to export to | Save The result is a folder containing the exported file with dependent elements, stored automatically in a folder on the desired location of your desk. Export history To export an element's history: select the element in Navigation Area Export ( choose where to export to | Save ) | select History PDF(.pdf) |

The entire history of the element is then exported in pdf format. The CLC format CLC Genomics Workbench keeps all bioinformatic data in the CLC format. Compared to other formats, the CLC format contains more information about the object, like its history and comments. The CLC format is also able to hold several elements of different types (e.g. an alignment, a graph and a phylogenetic tree). This means that if you are exporting your data to another CLC Workbench, you can use the CLC format to export several elements in one file, and you will preserve all the information. Note! CLC files can be exported from and imported into all the different CLC Workbenches.

CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS Backup

211

If you wish to secure your data from computer breakdowns, it is advisable to perform regular backups of your data. Backing up data in the CLC Genomics Workbench is done in two ways: Making a backup of each of the folders represented by the locations in the Navigation Area. Selecting all locations in the Navigation Area and export ( ) in .zip format. The resulting file will contain all the data stored in the Navigation Area and can be imported into CLC Genomics Workbench if you wish to restore from the back-up at some point. No matter which method is used for backup, you may have to re-define the locations in the Navigation Area if you restore your data from a computer breakdown.

7.2

External files

In order to help you organize your research projects, CLC Genomics Workbench lets you import all kinds of files. E.g. if you have Word, Excel or pdf-files related to your project, you can import them into the Navigation Area of CLC Genomics Workbench. Importing an external file creates a copy of the file which is stored at the location you have chosen for import. The file can now be opened by double-clicking the file in the Navigation Area. The file is opened using the default application for this file type (e.g. Microsoft Word for .doc-files and Adobe Reader for .pdf). External files are imported and exported in the same way as bioinformatics files (see section 7.1.1). Bioinformatics files not recognized by CLC Genomics Workbench are also treated as external files.

7.3

Export graphics to files

CLC Genomics Workbench supports export of graphics into a number of formats. This way, the visible output of your work can easily be saved and used in presentations, reports etc. The Export Graphics function ( ) is found in the Toolbar. CLC Genomics Workbench uses a WYSIWYG principle for graphics export: What You See Is What You Get. This means that you should use the options in the Side Panel to change how your data, e.g. a sequence, looks in the program. When you export it, the graphics file will look exactly the same way. It is not possible to export graphics of elements directly from the Navigation Area. They must first be opened in a view in order to be exported. To export graphics of the contents of a view: select tab of View | Graphics ( ) on Toolbar

This will display the dialog shown in figure 7.7.

7.3.1

Which part of the view to export

In this dialog you can choose to: Export visible area, or

CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS

212

Figure 7.7: Selecting to export whole view or to export only the visible area. Export whole view These options are available for all views that can be zoomed in and out. In figure 7.8 is a view of a circular sequence which is zoomed in so that you can only see a part of it.

Figure 7.8: A circular sequence as it looks on the screen. When selecting Export visible area, the exported file will only contain the part of the sequence that is visible in the view. The result from exporting the view from figure 7.8 and choosing Export visible area can be seen in figure 7.9.

Figure 7.9: The exported graphics file when selecting Export visible area. On the other hand, if you select Export whole view, you will get a result that looks like figure 7.10. This means that the graphics file will also include the part of the sequence which is not visible

CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS when you have zoomed in.

213

Figure 7.10: The exported graphics file when selecting Export whole view. The whole sequence is shown, even though the view is zoomed in on a part of the sequence. For 3D structures, this first step is omitted and you will always export what is shown in the view (equivalent to selecting Export visible area). Click Next when you have chosen which part of the view to export.

7.3.2

Save location and file formats

In this step, you can choose name and save location for the graphics file (see figure 7.11).

Figure 7.11: Location and name for the graphics file. CLC Genomics Workbench supports the following file formats for graphics export: Format Portable Network Graphics JPEG Tagged Image File PostScript Encapsulated PostScript Portable Document Format Scalable Vector Graphics Suffix .png .jpg .tif .ps .eps .pdf .svg Type bitmap bitmap bitmap vector graphics vector graphics vector graphics vector graphics

CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS

214

These formats can be divided into bitmap and vector graphics. The difference between these two categories is described below: Bitmap images In a bitmap image, each dot in the image has a specified color. This implies, that if you zoom in on the image there will not be enough dots, and if you zoom out there will be too many. In these cases the image viewer has to interpolate the colors to fit what is actually looked at. A bitmap image needs to have a high resolution if you want to zoom in. This format is a good choice for storing images without large shapes (e.g. dot plots). It is also appropriate if you don't have the need for resizing and editing the image after export. Vector graphics Vector graphic is a collection of shapes. Thus what is stored is e.g. information about where a line starts and ends, and the color of the line and its width. This enables a given viewer to decide how to draw the line, no matter what the zoom factor is, thereby always giving a correct image. This format is good for e.g. graphs and reports, but less usable for e.g. dot plots. If the image is to be resized or edited, vector graphics are by far the best format to store graphics. If you open a vector graphics file in an application like e.g. Adobe Illustrator, you will be able to manipulate the image in great detail. Graphics files can also be imported into the Navigation Area. However, no kinds of graphics files can be displayed in CLC Genomics Workbench. See section 7.2 for more about importing external files into CLC Genomics Workbench.

7.3.3

Graphics export parameters

When you have specified the name and location to save the graphics file, you can either click Next or Finish. Clicking Next allows you to set further parameters for the graphics export, whereas clicking Finish will export using the parameters that you have set last time you made a graphics export in that file format (if it is the first time, it will use default parameters). Parameters for bitmap formats For bitmap files, clicking Next will display the dialog shown in figure 7.12. You can adjust the size (the resolution) of the file to four standard sizes: Screen resolution Low resolution Medium resolution High resolution The actual size in pixels is displayed in parentheses. An estimate of the memory usage for exporting the file is also shown. If the image is to be used on computer screens only, a low resolution is sufficient. If the image is going to be used on printed material, a higher resolution is necessary to produce a good result.

CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS

215

Figure 7.12: Parameters for bitmap formats: size of the graphics file. Parameters for vector formats For pdf format, clicking Next will display the dialog shown in figure 7.13 (this is only the case if the graphics is using more than one page).

Figure 7.13: Page setup parameters for vector formats. The settings for the page setup are shown, and clicking the Page Setup button will display a dialog where these settings can ba adjusted. This dialog is described in section 6.2. The page setup is only available if you have selected to export the whole view - if you have chosen to export the visible area only, the graphics file will be on one page with no headers or footers.

7.3.4

Exporting protein reports

) which will generate

It is possible to export a protein report using the normal Export function ( a pdf file with a table of contents: Click the report in the Navigation Area | Export (

) in the Toolbar | select pdf ), but in

You can also choose to export a protein report using the Export graphics function ( this way you will not get the table of contents.

CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS

216

7.4

Export graph data points to a file

Data points for graphs displayed along the sequence or along an alignment, mapping or BLAST result, can be exported to a semicolon-separated text file (csv format). An example of such a graph is shown in figure 7.14. This graph shows the coverage of reads of a read mapping (produced with CLC Genomics Workbench).

Figure 7.14: A graph displayed along the mapped reads. Right-click the graph to export the data points to a file. To export the data points for the graph, right-click the graph and choose Export Graph to Comma-separated File. Depending on what kind of graph you have selected, different options will be shown: If the graph is covering a set of aligned sequences with a main sequence, such as read mappings and BLAST results, the dialog shown in figure 7.15 will be displayed. These kinds of graphs are located under Alignment info in the Side Panel. In all other cases, a normal file dialog will be shown letting you specify name and location for the file.

Figure 7.15: Choosing to include data points with gaps In this dialog, select whether you wish to include positions where the main sequence (the

CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS

217

reference sequence for read mappings and the query sequence for BLAST results) has gaps. If you are exporting e.g. coverage information from a read mapping, you would probably want to exclude gaps, if you want the positions in the exported file to match the reference (i.e. chromosome) coordinates. If you export including gaps, the data points in the file no longer corresponds to the reference coordinates, because each gap will shift the coordinates. Clicking Next will present a file dialog letting you specify name and location for the file. The output format of the file is like this: "Position";"Value"; "1";"13"; "2";"16"; "3";"23"; "4";"17"; ...

7.5

Copy/paste view output

The content of tables, e.g. in reports, folder lists, and sequence lists can be copy/pasted into different programs, where it can be edited. CLC Genomics Workbench pastes the data in tabulator separated format which is useful if you use programs like Microsoft Word and Excel. There is a huge number of programs in which the copy/paste can be applied. For simplicity, we include one example of the copy/paste function from a Folder Content view to Microsoft Excel. First step is to select the desired elements in the view: click a line in the Folder Content view | hold Shift-button | press arrow down/up key See figure 7.16.

Figure 7.16: Selected elements in a Folder Content view. When the elements are selected, do the following to copy the selected elements: right-click one of the selected elements | Edit | Copy ( Then: right-click in the cell A1 | Paste ( ) )

The outcome might appear unorganized, but with a few operations the structure of the view in CLC Genomics Workbench can be produced. (Except the icons which are replaced by file references in Excel.) Note that all tables can also be Exported ( ) directly in Excel format.

Chapter 8

History log
Contents
8.1 Element history . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 218 8.1.1 Sharing data with history . . . . . . . . . . . . . . . . . . . . . . . . . . 219

CLC Genomics Workbench keeps a log of all operations you make in the program. If e.g. you rename a sequence, align sequences, create a phylogenetic tree or translate a sequence, you can always go back and check what you have done. In this way, you are able to document and reproduce previous operations. This can be useful in several situations: It can be used for documentation purposes, where you can specify exactly how your data has been created and modified. It can also be useful if you return to a project after some time and want to refresh your memory on how the data was created. Also, if you have performed an analysis and you want to reproduce the analysis on another element, you can check the history of the analysis which will give you all parameters you set. This chapter will describe how to use the History functionality of CLC Genomics Workbench.

8.1

Element history

You can view the history of all elements in the Navigation Area except files that are opened in other programs (e.g. Word and pdf-files). The history starts when the element appears for the first time in CLC Genomics Workbench. To view the history of an element: Select the element in the Navigation Area | Show ( or If the element is already open | History ( ) in the Toolbar | History ( )

) at the bottom left part of the view

This opens a view that looks like the one in figure 8.1. When opening an element's history is opened, the newest change is submitted in the top of the view. The following information is available: Title. The action that the user performed. Date and time. Date and time for the operation. The date and time are displayed according 218

CHAPTER 8. HISTORY LOG

219

Figure 8.1: An element's history. to your locale settings (see section 5.1). User. The user who performed the operation. If you import some data created by another person in a CLC Workbench, that persons name will be shown. Parameters. Details about the action performed. This could be the parameters that was chosen for an analysis. Origins from. This information is usually shown at the bottom of an element's history. Here, you can see which elements the current element origins from. If you have e.g. created an alignment of three sequences, the three sequences are shown here. Clicking the element selects it in the Navigation Area, and clicking the 'history' link opens the element's own history. Comments. By clicking Edit you can enter your own comments regarding this entry in the history. These comments are saved.

8.1.1

Sharing data with history

The history of an element is attached to that element, which means that exporting an element in CLC format (*.clc) will export the history too. In this way, you can share folders and files with others while preserving the history. If an element's history includes source elements (i.e. if there are elements listed in 'Origins from'), they must also be exported in order to see the full history. Otherwise, the history will have entries named "Element deleted". An easy way to export an element with all its source elements is to use the Export Dependent Elements function described in section 7.1.3. The history view can be printed. To do so, click the Print icon ( exported as a pdf file: Select the element in the Navigation Area | Export ( History PDF | Save ). The history can also be

) | in "File of type" choose

Chapter 9

Batching and result handling

Contents
9.1 Batch processing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 220 9.1.1 9.1.2 9.1.3 9.1.4 9.1.5 9.2 9.2.1 9.2.2 Batch overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 221 Batch filtering and counting . . . . . . . . . . . . . . . . . . . . . . . . . 222 Setting parameters for batch runs . . . . . . . . . . . . . . . . . . . . . 222 Running the analysis and organizing the results . . . . . . . . . . . . . . 223 Running de novo assembly and read mapping in batch . . . . . . . . . . 223 Table outputs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 225 Batch log . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 225

How to handle results of analyses . . . . . . . . . . . . . . . . . . . . . . . . 223

9.1

Batch processing

Most of the analyses in the Toolbox are able to perform the same analysis on several elements in one batch. This means that analyzing large amounts of data is very easily accomplished. As an example, if you use the Find Binding Sites and Create Fragments ( ) tool, if you supply five sequences as shown in figure 9.1, the result table will present an overview of the results for all five sequences. This is because the input sequences are pooled before running the analysis. If you want individual outputs for each sequence, you would need to run the tool five times, or alternatively use the Batching mode. Batching mode is activated by clicking the Batch checkbox in dialog where the input data is selected. Batching simply means that each data set is run separately, just as if the tool has been run manually for each one. For some analyses, this simply means that each input sequence should be run separately, but in other cases it is desirable to pool sets of files together in one run. This selection of data for a batch run is defined as a batch unit. When batching is selected, the data to be added is the folder containing the data you want to batch. The content of the folder is assigned into batch units based on this concept:

220

CHAPTER 9. BATCHING AND RESULT HANDLING

221

Figure 9.1: Inputting five sequences to Find Binding Sites and Create Fragments. All subfolders are treated as individual batch units. This means that if the subfolder contains several input files, they will be pooled as one batch unit. Nested subfolders (i.e. subfolders within the subfolder) are ignored. All files that are not in subfolders are treated as individual batch units. An example of a batch run is shown in figure 9.2.

Figure 9.2: The Cloning folder includes both folders and sequences. The Cloning folder that is found in the example data (see section 1.6.2) contains two sequences ( ) and three folders ( ). If you click Batch, only folders can be added to the list of selected elements in the right-hand side of the dialog. To run the contents of the Cloning folder in batch, double-click to select it. When the Cloning folder is selected and you click Next, a batch overview is shown.

9.1.1

Batch overview

The batch overview lists the batch units to the left and the contents of the selected unit to the right (see figure 9.3).

CHAPTER 9. BATCHING AND RESULT HANDLING

222

Figure 9.3: Overview of the batch run. In this example, the two sequences are defined as separate batch units because they are located at the top level of the Cloning folder. There were also three folders in the Cloning folder (see figure 9.2), and two of them are listed as well. This means that the contents of these folders are pooled in one batch run (you can see the contents of the Cloning vector library batch run in the panel at the right-hand side of the dialog). The reason why the Enzyme lists folder is not listed as a batch unit is that it does not contain any sequences. In this overview dialog, the Workbench has filtered the data so that only the types of data accepted by the tool is shown (DNA sequences in the example above).

9.1.2

Batch filtering and counting

At the bottom of the dialog shown in figure 9.3, the Workbench counts the number of files that will be run in total (90 in this case). This is counted across all the batch units. In some situations it is useful to filter the input for the batching based on names. As an example, this could be to include only paired reads for a mapping, by only allowing names where "paired" is part of the name. This is achieved using the Only use elements containing and Exclude elements containing text fields. Note that the count is dynamically updated to reflect the number of input files based on the filtering. If a complete batch unit should be removed, you can select it, right-click and choose Remove Batch Unit. You can also remove items from the contents of each batch unit using right-click and Remove Element.

9.1.3

Setting parameters for batch runs

For some tools, the subsequent dialogs depend on the input data. In this case, one of the units is specified as parameter prototype and will be used to guide the choices in the dialogs. Per default, this will be the first batch unit (marked in bold), but this can be changed by right-clicking another batch unit and click Set as Parameter Prototype. Note that the Workbench is validating a lot of the input and parameters when running in normal

CHAPTER 9. BATCHING AND RESULT HANDLING

223

"non-batch" mode. When running in batch, this validation is not performed, and this means that some analyses will fail if combinations of input data and parameters are not right. Therefore batching should only be used when the batch units are very homogenous in terms of the type and size of data.

9.1.4

Running the analysis and organizing the results

At the last dialog before clicking Finish, it is only possible to use the Save option. When a tool is run in batch mode, it will place the result files in the same folder as the input files. In the example shown in figure 9.3, the result of the two single sequences will be placed in the Cloning folder, whereas the results for the Cloning vector library and Processed data runs will be placed inside these folders. When the batch run is started, there will be one "master" process representing the overall batch job, and there will then be a separate process for each batch unit. The behavior of this is different between Workbench and Server: When running the batch job in the Workbench, only one batch unit is run at a time. So when the first batch unit is done, the second will be started and so on. This is done in order to avoid many parallel analyses that would draw on the same compute resources and slow down the computer. When this is run on a CLC Server (see http://clcbio.com/server), all the processes are placed in the queue, and the queue is then taking care of distributing the jobs. This means that if the server set-up includes multiple nodes, the jobs can be run in parallel. If you need to stop the whole batch run, you need to stop the "master" process.

9.1.5

Running de novo assembly and read mapping in batch

De novo assembly and read mapping are special in batch mode because they usually have the option of assigning individual mapping parameters to each input file. When running in batch mode this is not possible. Instead, you can change the default parameters used for long and short reads, respectively. You can also set the paired distance for paired data. Note that this means that you cannot use a combination of paired-end and mate-pair data for batching. Figure 9.4 shows the parameter dialog when running read mapping in batch. Note that you can only specify one setting for all short reads, and one setting for all long reads. When the analysis is run, the reads are automatically categorized as either long or short, and the parameters specified in the dialog are applied. The same goes for all reads that are imported as paired where the minimum and maximum distances are applied.

9.2

How to handle results of analyses

This section will explain how results generated from tools in the Toolbox are handled by CLC Genomics Workbench. Note that this also applies to tools not running in batch mode (see above). All the analyses in the Toolbox are performed in a step-by-step procedure. First, you select

CHAPTER 9. BATCHING AND RESULT HANDLING

224

Figure 9.4: Read mapping parameters in batch. elements for analyses, and then there are a number of steps where you can specify parameters (some of the analyses have no parameters, e.g. when translating DNA to RNA). The final step concerns the handling of the results of the analysis, and it is almost identical for all the analyses so we explain it in this section in general.

Figure 9.5: The last step of the analyses exemplified by Translate DNA to RNA. In this step, shown in figure 9.5, you have two options: Open. This will open the result of the analysis in a view. This is the default setting. Save. This means that the result will not be opened but saved to a folder in the Navigation Area. If you select this option, click Next and you will see one more step where you can specify where to save the results (see figure 9.6). In this step, you also have the option of creating a new folder or adding a location by clicking the buttons ( )/ ( ) at the top of the dialog.

CHAPTER 9. BATCHING AND RESULT HANDLING

225

Figure 9.6: Specify a folder for the results of the analysis.

9.2.1

Table outputs

Some analyses also generate a table with results, and for these analyses the last step looks like figure 9.7.

Figure 9.7: Analyses which also generate tables. In addition to the Open and Save options you can also choose whether the result of the analysis should be added as annotations on the sequence or shown on a table. If both options are selected, you will be able to click the results in the table and the corresponding region on the sequence will be selected. If you choose to add annotations to the sequence, they can be removed afterwards by clicking Undo ( ) in the Toolbar.

9.2.2

Batch log

For some analyses, there is an extra option in the final step to create a log of the batch process (see e.g. figure 9.7). This log will be created in the beginning of the process and continually updated with information about the results. See an example of a log in figure 9.8. In this example, the log displays information about how many open reading frames were found.

CHAPTER 9. BATCHING AND RESULT HANDLING

226

Figure 9.8: An example of a batch log when finding open reading frames. The log will either be saved with the results of the analysis or opened in a view with the results, depending on how you chose to handle the results.

Part III

Bioinformatics

227

Chapter 10

Viewing and editing sequences

Contents
10.1 View sequence . . . . . . . . . . . . . . . . . . . . . . . . 10.1.1 Sequence settings in Side Panel . . . . . . . . . . . . 10.1.2 Restriction sites in the Side Panel . . . . . . . . . . . 10.1.3 Selecting parts of the sequence . . . . . . . . . . . . 10.1.4 Editing the sequence . . . . . . . . . . . . . . . . . . 10.1.5 Sequence region types . . . . . . . . . . . . . . . . . 10.2 Circular DNA . . . . . . . . . . . . . . . . . . . . . . . . . . 10.2.1 Using split views to see details of the circular molecule 10.2.2 Mark molecule as circular and specify starting point . . 10.3 Working with annotations . . . . . . . . . . . . . . . . . . 10.3.1 Viewing annotations . . . . . . . . . . . . . . . . . . . 10.3.2 Adding annotations . . . . . . . . . . . . . . . . . . . 10.3.3 Edit annotations . . . . . . . . . . . . . . . . . . . . . 10.3.4 Removing annotations . . . . . . . . . . . . . . . . . . 10.4 Element information . . . . . . . . . . . . . . . . . . . . . . 10.5 View as text . . . . . . . . . . . . . . . . . . . . . . . . . . 10.6 Creating a new sequence . . . . . . . . . . . . . . . . . . . 10.7 Sequence Lists . . . . . . . . . . . . . . . . . . . . . . . . 10.7.1 Graphical view of sequence lists . . . . . . . . . . . . 10.7.2 Sequence list table . . . . . . . . . . . . . . . . . . . 10.7.3 Extract sequences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 228 229 235 235 236 236 237 238 238 239 239 243 245 247 247 248 249 250 251 251 252

CLC Genomics Workbench offers five different ways of viewing and editing single sequences as described in the first five sections of this chapter. Furthermore, this chapter also explains how to create a new sequence and how to gather several sequences in a sequence list.

10.1

View sequence

When you double-click a sequence in the Navigation Area, the sequence will open automatically, and you will see the nucleotides or amino acids. The zoom options described in section 3.3 allow 228

CHAPTER 10. VIEWING AND EDITING SEQUENCES

229

you to e.g. zoom out in order to see more of the sequence in one view. There are a number of options for viewing and editing the sequence which are all described in this section. All the options described in this section also apply to alignments (further described in section 22.2).

10.1.1

Sequence settings in Side Panel

Each view of a sequence has a Side Panel located at the right side of the view (see figure 10.1.

Figure 10.1: Overview of the Side Panel which is always shown to the right of a view. When you make changes in the Side Panel the view of the sequence is instantly updated. To show or hide the Side Panel: select the View | Ctrl + U or Click the ( ) at the top right corner of the Side Panel to hide | Click the gray Side Panel button to the right to show Below, each group of settings will be explained. Some of the preferences are not the same for nucleotide and protein sequences, but the differences will be explained for each group of settings. Note! When you make changes to the settings in the Side Panel, they are not automatically saved when you save the sequence. Click Save/restore Settings ( ) to save the settings (see section 5.6 for more information). Sequence Layout These preferences determine the overall layout of the sequence: Spacing. Inserts a space at a specified interval: No spacing. The sequence is shown with no spaces. Every 10 residues. There is a space every 10 residues, starting from the beginning of the sequence. Every 3 residues, frame 1. There is a space every 3 residues, corresponding to the reading frame starting at the first residue.

CHAPTER 10. VIEWING AND EDITING SEQUENCES

230

Every 3 residues, frame 2. There is a space every 3 residues, corresponding to the reading frame starting at the second residue. Every 3 residues, frame 3. There is a space every 3 residues, corresponding to the reading frame starting at the third residue. Wrap sequences. Shows the sequence on more than one line. No wrap. The sequence is displayed on one line. Auto wrap. Wraps the sequence to fit the width of the view, not matter if it is zoomed in our out (displays minimum 10 nucleotides on each line). Fixed wrap. Makes it possible to specify when the sequence should be wrapped. In the text field below, you can choose the number of residues to display on each line. Double stranded. Shows both strands of a sequence (only applies to DNA sequences). Numbers on sequences. Shows residue positions along the sequence. The starting point can be changed by setting the number in the field below. If you set it to e.g. 101, the first residue will have the position of -100. This can also be done by right-clicking an annotation and choosing Set Numbers Relative to This Annotation. Numbers on plus strand. Whether to set the numbers relative to the positive or the negative strand in a nucleotide sequence (only applies to DNA sequences). Follow selection. When viewing the same sequence in two separate views, "Follow selection" will automatically scroll the view in order to follow a selection made in the other view. Lock numbers. When you scroll vertically, the position numbers remain visible. (Only possible when the sequence is not wrapped.) Lock labels. When you scroll horizontally, the label of the sequence remains visible. Sequence label. Defines the label to the left of the sequence. Name (this is the default information to be shown). Accession (sequences downloaded from databases like GenBank have an accession number). Latin name. Latin name (accession). Common name. Common name (accession). Annotation Layout and Annotation Types See section 10.3.1. Restriction sites See section 10.1.2.

CHAPTER 10. VIEWING AND EDITING SEQUENCES Motifs See section 14.7.1. Residue coloring

231

These preferences make it possible to color both the residue letter and set a background color for the residue. Non-standard residues. For nucleotide sequences this will color the residues that are not C, G, A, T or U. For amino acids only B, Z, and X are colored as non-standard residues. Foreground color. Sets the color of the letter. Click the color box to change the color. Background color. Sets the background color of the residues. Click the color box to change the color. Rasmol colors. Colors the residues according to the Rasmol color scheme. See http://www.openrasmol.org/doc/rasmol.html Foreground color. Sets the color of the letter. Click the color box to change the color. Background color. Sets the background color of the residues. Click the color box to change the color. Polarity colors (only protein). Colors the residues according to the polarity of amino acids. Foreground color. Sets the color of the letter. Click the color box to change the color. Background color. Sets the background color of the residues. Click the color box to change the color. Trace colors (only DNA). Colors the residues according to the color conventions of chromatogram traces: A=green, C=blue, G=black, and T=red. Foreground color. Sets the color of the letter. Background color. Sets the background color of the residues. Nucleotide info These preferences only apply to nucleotide sequences. Translation. Displays a translation into protein just below the nucleotide sequence. Depending on the zoom level, the amino acids are displayed with three letters or one letter. Frame. Determines where to start the translation. ORF/CDS. If the sequence is annotated, the translation will follow the CDS or ORF annotations. If annotations overlap, only one translation will be shown. If only one annotation is visible, the Workbench will attempt to use this annotation to mark the start and stop for the translation. In cases where this is not possible, the first annotation will be used (i.e. the one closest to the 5' end of the sequence).

CHAPTER 10. VIEWING AND EDITING SEQUENCES

232

Selection. This option will only take effect when you make a selection on the sequence. The translation will start from the first nucleotide selected. Making a new selection will automatically display the corresponding translation. Read more about selecting in section 10.1.3. +1 to -1. Select one of the six reading frames. All forward/All reverse. Shows either all forward or all reverse reading frames. All. Select all reading frames at once. The translations will be displayed on top of each other. Table. The translation table to use in the translation. For more about translation tables, see section 15.5. Only AUG start codons. For most genetic codes, a number of codons can be start codons. Selecting this option only colors the AUG codons green. Single letter codes. Choose to represent the amino acids with a single letter instead of three letters. Trace data. See section 18.1. Quality scores. For sequencing data containing quality scores, the quality score information can be displayed along the sequence. Show as probabilities. Converts quality scores to error probabilities on a 0-1 scale, i.e. not log-transformed. Foreground color. Colors the letter using a gradient, where the left side color is used for low quality and the right side color is used for high quality. The sliders just above the gradient color box can be dragged to highlight relevant levels. The colors can be changed by clicking the box. This will show a list of gradients to choose from. Background color. Sets a background color of the residues using a gradient in the same way as described above. Graph. The quality score is displayed on a graph (Learn how to export the data behind the graph in section 7.4). Height. Specifies the height of the graph. Type. The graph can be displayed as Line plot, Bar plot or as a Color bar. Color box. For Line and Bar plots, the color of the plot can be set by clicking the color box. For Colors, the color box is replaced by a gradient color box as described under Foreground color. G/C content. Calculates the G/C content of a part of the sequence and shows it as a gradient of colors or as a graph below the sequence. Window length. Determines the length of the part of the sequence to calculate. A window length of 9 will calculate the G/C content for the nucleotide in question plus the 4 nucleotides to the left and the 4 nucleotides to the right. A narrow window will focus on small fluctuations in the G/C content level, whereas a wider window will show fluctuations between larger parts of the sequence. Foreground color. Colors the letter using a gradient, where the left side color is used for low levels of G/C content and the right side color is used for high levels of G/C content. The sliders just above the gradient color box can be dragged to highlight relevant levels of G/C content. The colors can be changed by clicking the box. This will show a list of gradients to choose from.

CHAPTER 10. VIEWING AND EDITING SEQUENCES

233

Background color. Sets a background color of the residues using a gradient in the same way as described above. Graph. The G/C content level is displayed on a graph (Learn how to export the data behind the graph in section 7.4). Height. Specifies the height of the graph. Type. The graph can be displayed as Line plot, Bar plot or as a Color bar. Color box. For Line and Bar plots, the color of the plot can be set by clicking the color box. For Colors, the color box is replaced by a gradient color box as described under Foreground color. Protein info These preferences only apply to proteins. The first nine items are different hydrophobicity scales and are described in section 16.5.2. Kyte-Doolittle. The Kyte-Doolittle scale is widely used for detecting hydrophobic regions in proteins. Regions with a positive value are hydrophobic. This scale can be used for identifying both surface-exposed regions as well as transmembrane regions, depending on the window size used. Short window sizes of 5-7 generally work well for predicting putative surface-exposed regions. Large window sizes of 19-21 are well suited for finding transmembrane domains if the values calculated are above 1.6 [Kyte and Doolittle, 1982]. These values should be used as a rule of thumb and deviations from the rule may occur. Cornette. Cornette et al. computed an optimal hydrophobicity scale based on 28 published scales [Cornette et al., 1987]. This optimized scale is also suitable for prediction of alpha-helices in proteins. Engelman. The Engelman hydrophobicity scale, also known as the GES-scale, is another scale which can be used for prediction of protein hydrophobicity [Engelman et al., 1986]. As the Kyte-Doolittle scale, this scale is useful for predicting transmembrane regions in proteins. Eisenberg. The Eisenberg scale is a normalized consensus hydrophobicity scale which shares many features with the other hydrophobicity scales [Eisenberg et al., 1984]. Rose. The hydrophobicity scale by Rose et al. is correlated to the average area of buried amino acids in globular proteins [Rose et al., 1985]. This results in a scale which is not showing the helices of a protein, but rather the surface accessibility. Janin. This scale also provides information about the accessible and buried amino acid residues of globular proteins [Janin, 1979]. Hopp-Woods. Hopp and Woods developed their hydrophobicity scale for identification of potentially antigenic sites in proteins. This scale is basically a hydrophilic index where apolar residues have been assigned negative values. Antigenic sites are likely to be predicted when using a window size of 7 [Hopp and Woods, 1983]. Welling. [Welling et al., 1985] Welling et al. used information on the relative occurrence of amino acids in antigenic regions to make a scale which is useful for prediction of antigenic regions. This method is better than the Hopp-Woods scale of hydrophobicity which is also used to identify antigenic regions.

CHAPTER 10. VIEWING AND EDITING SEQUENCES

234

Kolaskar-Tongaonkar. A semi-empirical method for prediction of antigenic regions has been developed [Kolaskar and Tongaonkar, 1990]. This method also includes information of surface accessibility and flexibility and at the time of publication the method was able to predict antigenic determinants with an accuracy of 75%. Surface Probability. Display of surface probability based on the algorithm by [Emini et al., 1985]. This algorithm has been used to identify antigenic determinants on the surface of proteins. Chain Flexibility. Display of backbone chain flexibility based on the algorithm by [Karplus and Schulz, 1985]. It is known that chain flexibility is an indication of a putative antigenic determinant. Find The Find function can also be invoked by pressing Ctrl + Shift + F ( + Shift + F on Mac).

The Find function can be used for searching the sequence. Clicking the find button will search for the first occurrence of the search term. Clicking the find button again will find the next occurrence and so on. If the search string is found, the corresponding part of the sequence will be selected. Search term. Enter the text to search for. The search function does not discriminate between lower and upper case characters. Sequence search. Search the nucleotides or amino acids. For amino acids, the single letter abbreviations should be used for searching. The sequence search also has a set of advanced search parameters: Include negative strand. This will search on the negative strand as well. Treat ambiguous characters as wildcards in search term. If you search for e.g. ATN, you will find both ATG and ATC. If you wish to find literally exact matches for ATN (i.e. only find ATN - not ATG), this option should not be selected. Treat ambiguous characters as wildcards in sequence. If you search for e.g. ATG, you will find both ATG and ATN. If you have large regions of Ns, this option should not be selected. Note that if you enter a position instead of a sequence, it will automatically switch to position search. Annotation search. Searches the annotations on the sequence. The search is performed both on the labels of the annotations, but also on the text appearing in the tooltip that you see when you keep the mouse cursor fixed. If the search term is found, the part of the sequence corresponding to the matching annotation is selected. Below this option you can choose to search for translations as well. Sequences annotated with coding regions often have the translation specified which can lead to undesired results. Position search. Finds a specific position on the sequence. In order to find an interval, e.g. from position 500 to 570, enter "500..570" in the search field. This will make a selection from position 500 to 570 (both included). Notice the two periods (..) between the start an end number (see section 10.3.2). You can also enter positions separated by commas or dots (like 123,345 - in this case the comma will just be ignored)

CHAPTER 10. VIEWING AND EDITING SEQUENCES

235

Include negative strand. When searching the sequence for nucleotides or amino acids, you can search on both strands. Name search. Searches for sequence names. This is useful for searching sequence lists, mapping results and BLAST results. This concludes the description of the View Preferences. Next, the options for selecting and editing sequences are described. Text format These preferences allow you to adjust the format of all the text in the view (both residue letters, sequence name and translations if they are shown). Text size. Five different sizes. Font. Shows a list of Fonts available on your computer. Bold residues. Makes the residues bold.

10.1.2

Restriction sites in the Side Panel

Please see section 21.3.1.

10.1.3

Selecting parts of the sequence

You can select parts of a sequence: Click Selection ( ) in Toolbar | Press and hold down the mouse button on the sequence where you want the selection to start | move the mouse to the end of the selection while holding the button | release the mouse button Alternatively, you can search for a specific interval using the find function described above. If you have made a selection and wish to adjust it: drag the edge of the selection (you can see the mouse cursor change to a horizontal arrow or press and hold the Shift key while using the right and left arrow keys to adjust the right side of the selection. If you wish to select the entire sequence: double-click the sequence name to the left Selecting several parts at the same time (multiselect) You can select several parts of sequence by holding down the Ctrl button while making selections. Holding down the Shift button lets you extend or reduce an existing selection to the position you clicked. To select a part of a sequence covered by an annotation:

CHAPTER 10. VIEWING AND EDITING SEQUENCES right-click the annotation | Select annotation or double-click the annotation To select a fragment between two restriction sites that are shown on the sequence: double-click the sequence between the two restriction sites (Read more about restriction sites in section 10.1.2.) Open a selection in a new view A selection can be opened in a new view and saved as a new sequence: right-click the selection | Open selection in New View ( )

236

This opens the annotated part of the sequence in a new view. The new sequence can be saved by dragging the tab of the sequence view into the Navigation Area. The process described above is also the way to manually translate coding parts of sequences (CDS) into protein. You simply translate the new sequence into protein. This is done by: right-click the tab of the new sequence | Toolbox | Nucleotide Analyses ( Translate to Protein ( ) A selection can also be copied to the clipboard and pasted into another program: make a selection | Ctrl + C ( + C on Mac) ) |

Note! The annotations covering the selection will not be copied. A selection of a sequence can be edited as described in the following section.

10.1.4

Editing the sequence

)

When you make a selection, it can be edited by: right-click the selection | Edit Selection (

A dialog appears displaying the sequence. You can add, remove or change the text and click OK. The original selected part of the sequence is now replaced by the sequence entered in the dialog. This dialog also allows you to paste text into the sequence using Ctrl + V ( + V on Mac). If you delete the text in the dialog and press OK, the selected text on the sequence will also be deleted. Another way to delete a part of the sequence is to: right-click the selection | Delete Selection ( )

If you wish to only correct only one residue, this is possible by simply making the selection only cover one residue and then type the new residue. Another way to edit the sequence is by inserting a restriction site. See section 21.1.4.

10.1.5

Sequence region types

The various annotations on sequences cover parts of the sequence. Some cover an interval, some cover intervals with unknown endpoints, some cover more than one interval etc. In the

CHAPTER 10. VIEWING AND EDITING SEQUENCES

237

following, all of these will be referred to as regions. Regions are generally illustrated by markings (often arrows) on the sequences. An arrow pointing to the right indicates that the corresponding region is located on the positive strand of the sequence. Figure 10.2 is an example of three regions with separate colors.

Figure 10.2: Three regions on a human beta globin DNA sequence (HUMHBB). Figure 10.3 shows an artificial sequence with all the different kinds of regions.

Figure 10.3: Region #1: A single residue, Region #2: A range of residues including both endpoints, Region #3: A range of residues starting somewhere before 30 and continuing up to and including 40, Region #4: A single residue somewhere between 50 and 60 inclusive, Region #5: A range of residues beginning somewhere between 70 and 80 inclusive and ending at 90 inclusive, Region #6: A range of residues beginning somewhere between 100 and 110 inclusive and ending somewhere between 120 and 130 inclusive, Region #7: A site between residues 140 and 141, Region #8: A site between two residues somewhere between 150 and 160 inclusive, Region #9: A region that covers ranges from 170 to 180 inclusive and 190 to 200 inclusive, Region #10: A region on negative strand that covers ranges from 210 to 220 inclusive, Region #11: A region on negative strand that covers ranges from 230 to 240 inclusive and 250 to 260 inclusive.

10.2

Circular DNA
)

A sequence can be shown as a circular molecule: select a sequence in the Navigation Area | Show in the Toolbar | As Circular (

or If the sequence is already open | Click Show As Circular ( ) at the lower left part of the view This will open a view of the molecule similar to the one in figure 10.4.

CHAPTER 10. VIEWING AND EDITING SEQUENCES

238

Figure 10.4: A molecule shown in a circular view. This view of the sequence shares some of the properties of the linear view of sequences as described in section 10.1, but there are some differences. The similarities and differences are listed below: Similarities: The editing options. Options for adding, editing and removing annotations. Restriction Sites, Annotation Types, Find and Text Format preferences groups. Differences: In the Sequence Layout preferences, only the following options are available in the circular view: Numbers on plus strand, Numbers on sequence and Sequence label. You cannot zoom in to see the residues in the circular molecule. If you wish to see these details, split the view with a linear view of the sequence In the Annotation Layout, you also have the option of showing the labels as Stacked. This means that there are no overlapping labels and that all labels of both annotations and restriction sites are adjusted along the left and right edges of the view.

10.2.1

Using split views to see details of the circular molecule

In order to see the nucleotides of a circular molecule you can open a new view displaying a circular view of the molecule: Press and hold the Ctrl button ( on Mac) | click Show Sequence ( ) at the bottom of the view This will open a linear view of the sequence below the circular view. When you zoom in on the linear view you can see the residues as shown in figure 10.5. Note! If you make a selection in one of the views, the other view will also make the corresponding selection, providing an easy way for you to focus on the same region in both views.

10.2.2

Mark molecule as circular and specify starting point

You can mark a DNA molecule as circular by right-clicking its name in either the sequence view or the circular view. In the right-click menu you can also make a circular molecule linear. A circular molecule displayed in the normal sequence view, will have the sequence ends marked with a .

CHAPTER 10. VIEWING AND EDITING SEQUENCES

239

Figure 10.5: Two views showing the same sequence. The bottom view is zoomed in. The starting point of a circular sequence can be changed by: make a selection starting at the position that you want to be the new starting point | right-click the selection | Move Starting Point to Selection Start Note! This can only be done for sequence that have been marked as circular.

10.3

Working with annotations

Annotations provide information about specific regions of a sequence. A typical example is the annotation of a gene on a genomic DNA sequence. Annotations derive from different sources: Sequences downloaded from databases like GenBank are annotated. In some of the data formats that can be imported into CLC Genomics Workbench, sequences can have annotations (GenBank, EMBL and Swiss-Prot format). The result of a number of analyses in CLC Genomics Workbench are annotations on the sequence (e.g. finding open reading frames and restriction map analysis). You can manually add annotations to a sequence (described in the section 10.3.2). Note! Annotations are included if you export the sequence in GenBank, Swiss-Prot, EMBL or CLC format. When exporting in other formats, annotations are not preserved in the exported file.

10.3.1

Viewing annotations

Annotations can be viewed in a number of different ways: As arrows or boxes in the sequence views: Linear and circular view of sequences ( Alignments ( ). )/ ( ).

CHAPTER 10. VIEWING AND EDITING SEQUENCES Graphical view of sequence lists ( Cloning editor ( ). )/ ( ). ). ). ) ). ).

240

BLAST views (only the query sequence at the top can have annotations) ( Primer designer (both for single sequences and alignments) ( Contig/mapping view ( In the table of annotations (

In the text view of sequences (

In the following sections, these view options will be described in more detail. In all the views except the text view ( is described in the following sections. View Annotations in sequence views Figure 10.6 shows an annotation displayed on a sequence. ), annotations can be added, modified and deleted. This

Figure 10.6: An annotation showing a coding region on a genomic dna sequence. The various sequence views listed in section 10.3.1 have different default settings for showing annotations. However, they all have two groups in the Side Panel in common: Annotation Layout Annotation Types The two groups are shown in figure 10.7. In the Annotation layout group, you can specify how the annotations should be displayed (notice that there are some minor differences between the different sequence views): Show annotations. Determines whether the annotations are shown. Position. On sequence. The annotations are placed on the sequence. The residues are visible through the annotations (if you have zoomed in to 100%). Next to sequence. The annotations are placed above the sequence. Separate layer. The annotations are placed above the sequence and above restriction sites (only applicable for nucleotide sequences).

CHAPTER 10. VIEWING AND EDITING SEQUENCES

241

Figure 10.7: Changing the layout of annotations in the Side Panel. Offset. If several annotations cover the same part of a sequence, they can be spread out. Piled. The annotations are piled on top of each other. Only the one at front is visible. Little offset. The annotations are piled on top of each other, but they have been offset a little. More offset. Same as above, but with more spreading. Most offset. The annotations are placed above each other with a little space between. This can take up a lot of space on the screen. Label. The name of the annotation can shown as a label. Additional information about the sequence is shown if you place the mouse cursor on the annotation and keep it still. No labels. No labels are displayed. On annotation. The labels are displayed in the annotation's box. Over annotation. The labels are displayed above the annotations. Before annotation. The labels are placed just to the left of the annotation. Flag. The labels are displayed as flags at the beginning of the annotation. Stacked. The labels are offset so that the text of all labels is visible. This means that there is varying distance between each sequence line to make room for the labels.

CHAPTER 10. VIEWING AND EDITING SEQUENCES

242

Show arrows. Displays the end of the annotation as an arrow. This can be useful to see the orientation of the annotation (for DNA sequences). Annotations on the negative strand will have an arrow pointing to the left. Use gradients. Fills the boxes with gradient color. In the Annotation Types group, you can choose which kinds of annotations that should be displayed. This group lists all the types of annotations that are attached to the sequence(s) in the view. For sequences with many annotations, it can be easier to get an overview if you deselect the annotation types that are not relevant. Unchecking the checkboxes in the Annotation Layout will not remove this type of annotations them from the sequence - it will just hide them from the view. Besides selecting which types of annotations that should be displayed, the Annotation Types group is also used to change the color of the annotations on the sequence. Click the colored square next to the relevant annotation type to change the color. This will display a dialog with three tabs: Swatches, HSB, and RGB. They represent three different ways of specifying colors. Apply your settings and click OK. When you click OK, the color settings cannot be reset. The Reset function only works for changes made before pressing OK. Furthermore, the Annotation Types can be used to easily browse the annotations by clicking the small button ( ) next to the type. This will display a list of the annotations of that type (see figure 10.8).

Figure 10.8: Browsing the gene annotations on a sequence. Clicking an annotation in the list will select this region on the sequence. In this way, you can quickly find a specific annotation on a long sequence. View Annotations in a table Annotations can also be viewed in a table: select the sequence in the Navigation Area | Show ( ) | Annotation Table ( )

or If the sequence is already open | Click Show Annotation Table ( left part of the view This will open a view similar to the one in figure 10.9).

) at the lower

In the Side Panel you can show or hide individual annotation types in the table. E.g. if you

CHAPTER 10. VIEWING AND EDITING SEQUENCES

243

Figure 10.9: A table showing annotations on the sequence. only wish to see "gene" annotations, de-select the other annotation types so that only "gene" is selected. Each row in the table is an annotation which is represented with the following information: Name. Type. Region. Qualifiers. The Name, Type and Region for each annotation can be edited simply by double-clicking, typing the change directly, and pressing Enter. This information corresponds to the information in the dialog when you edit and add annotations (see section 10.3.2). You can benefit from this table in several ways: It provides an intelligible overview of all the annotations on the sequence. You can use the filter at the top to search the annotations. Type e.g. "UCP" into the filter and you will find all annotations which have "UCP" in either the name, the type, the region or the qualifiers. Combined with showing or hiding the annotation types in the Side Panel, this makes it easy to find annotations or a subset of annotations. You can copy and paste annotations, e.g. from one sequence to another. If you wish to edit many annotations consecutively, the double-click editing makes this very fast (see section 10.3.2).

10.3.2

Adding annotations

Adding annotations to a sequence can be done in two ways: open the sequence in a sequence view (double-click in the Navigation Area) | make a selection covering the part of the sequence you want to annotate1 | right-click the selection | Add Annotation ( )

CHAPTER 10. VIEWING AND EDITING SEQUENCES or select the sequence in the Navigation Area | Show ( Annotation ( ) This will display a dialog like the one in figure 10.10. ) | Annotations ( ) | Add

244

Figure 10.10: The Add Annotation dialog. The left-hand part of the dialog lists a number of Annotation types. When you have selected an annotation type, it appears in Type to the right. You can also select an annotation directly in this list. Choosing an annotation type is mandatory. If you wish to use an annotation type which is not present in the list, simply enter this type into the Type field 2 . The right-hand part of the dialog contains the following text fields: Name. The name of the annotation which can be shown on the label in the sequence views. (Whether the name is actually shown depends on the Annotation Layout preferences, see section 10.3.1). Type. Reflects the left-hand part of the dialog as described above. You can also choose directly in this list or type your own annotation type. Region. If you have already made a selection, this field will show the positions of the selection. You can modify the region further using the conventions of DDBJ, EMBL and GenBank. The following are examples of how to use the syntax (based on http: //www.ncbi.nlm.nih.gov/collab/FT/): 467. Points to a single residue in the presented sequence. 340..565. Points to a continuous range of residues bounded by and including the starting and ending residues. <345..500. Indicates that the exact lower boundary point of a region is unknown. The location begins at some residue previous to the first residue specified (which is not
Note that your own annotation types will be converted to "unsure" when exporting in GenBank format. As long as you use the sequence in CLC format, you own annotation type will be preserved
2

CHAPTER 10. VIEWING AND EDITING SEQUENCES

245

necessarily contained in the presented sequence) and continues up to and including the ending residue. <1..888. The region starts before the first sequenced residue and continues up to and including residue 888. 1..>888. The region starts at the first sequenced residue and continues beyond residue 888. (102.110). Indicates that the exact location is unknown, but that it is one of the residues between residues 102 and 110, inclusive. 123 124. Points to a site between residues 123 and 124. join(12..78,134..202). Regions 12 to 78 and 134 to 202 should be joined to form one contiguous sequence. complement(34..126) Start at the residue complementary to 126 and finish at the residue complementary to residue 34 (the region is on the strand complementary to the presented strand). complement(join(2691..4571,4918..5163)). Joins regions 2691 to 4571 and 4918 to 5163, then complements the joined segments (the region is on the strand complementary to the presented strand). join(complement(4918..5163),complement(2691..4571)). Complements regions 4918 to 5163 and 2691 to 4571, then joins the complemented segments (the region is on the strand complementary to the presented strand). Annotations. In this field, you can add more information about the annotation like comments and links. Click the Add qualifier/key button to enter information. Select a qualifier which describes the kind of information you wish to add. If an appropriate qualifier is not present in the list, you can type your own qualifier. The pre-defined qualifiers are derived from the GenBank format. You can add as many qualifier/key lines as you wish by clicking the button. Redundant lines can be removed by clicking the delete icon ( ). The information entered on these lines is shown in the annotation table (see section 10.3.1) and in the yellow box which appears when you place the mouse cursor on the annotation. If you write a hyperlink in the Key text field, like e.g. "www.clcbio.com", it will be recognized as a hyperlink. Clicking the link in the annotation table will open a web browser. Click OK to add the annotation. Note! The annotation will be included if you export the sequence in GenBank, Swiss-Prot or CLC format. When exporting in other formats, annotations are not preserved in the exported file.

10.3.3

Edit annotations
)

To edit an existing annotation from within a sequence view: right-click the annotation | Edit Annotation (

This will show the same dialog as in figure 10.10, with the exception that some of the fields are filled out depending on how much information the annotation contains. There is another way of quickly editing annotations which is particularly useful when you wish to edit several annotations.

CHAPTER 10. VIEWING AND EDITING SEQUENCES

246

To edit the information, simply double-click and you will be able to edit e.g. the name or the annotation type. If you wish to edit the qualifiers and double-click in this column, you will see the dialog for editing annotations. Advanced editing of annotations Sometimes you end up with annotations which do not have a meaningful name. In that case there is an advanced batch rename functionality: Open the Annotation Table ( ) | select the annotations that you want to rename | right-click the selection | Advanced Rename This will bring up the dialog shown in figure 10.11.

Figure 10.11: The Advanced Rename dialog. In this dialog, you have two options: Use this qualifier. Use one of the qualifiers as name. A list of all qualifiers of all the selected annotations is shown. Note that if one of the annotations do not have the qualifier you have chosen, it will not be renamed. If an annotation has multiple qualifiers of the same type, the first is used for naming. Use annotation type as name. The annotation's type will be used as name (e.g. if you have an annotation of type "Promoter", it will get "Promoter" as its name by using this option). A similar functionality is available for batch re-typing annotations is available in the right-click menu as well, in case your annotations are not typed correctly: Open the Annotation Table ( ) | select the annotations that you want to retype | right-click the selection | Advanced Retype This will bring up the dialog shown in figure 10.12. In this dialog, you have two options: Use this qualifier. Use one of the qualifiers as type. A list of all qualifiers of all the selected annotations is shown. Note that if one of the annotations do not have the qualifier you have chosen, it will not be retyped. If an annotation has multiple qualifiers of the same type, the first is used for the new type. New type. You can select from a list of all the pre-defined types as well as enter your own annotation type. All the selected annotations will then get this type.

CHAPTER 10. VIEWING AND EDITING SEQUENCES

247

Figure 10.12: The Advanced Retype dialog. Use annotation name as type. The annotation's name will be used as type (e.g. if you have an annotation named "Promoter", it will get "Promoter" as its type by using this option).

10.3.4

Removing annotations

Annotations can be hidden using the Annotation Types preferences in the Side Panel to the right of the view (see section 10.3.1). In order to completely remove the annotation: right-click the annotation | Delete | Delete Annotation ( If you want to remove all annotations of one type: right-click an annotation of the type you want to remove | Delete | Delete Annotations of Type "type" If you want to remove all annotations from a sequence: right-click an annotation | Delete | Delete All Annotations The removal of annotations can be undone using Ctrl + Z or Undo ( ) in the Toolbar. )

If you have more sequences (e.g. in a sequence list, alignment or contig), you have two additional options: right-click an annotation | Delete | Delete All Annotations from All Sequences right-click an annotation | Delete | Delete Annotations of Type "type" from All Sequences

10.4

Element information

The normal view of a sequence (by double-clicking) shows the annotations as boxes along the sequence, but often there is more information available about sequences. This information is available through the Element info view. To view the sequence information: select a sequence in the Navigation Area | Show ( ( ) This will display a view similar to fig 10.13. All the lines in the view are headings, and the corresponding text can be shown by clicking the text. ) in the Toolbar | Element info

CHAPTER 10. VIEWING AND EDITING SEQUENCES

248

Figure 10.13: The initial display of sequence info for the HUMHBB DNA sequence from the Example data. Name. The name of the sequence which is also shown in sequence views and in the Navigation Area. Description. A description of the sequence. Comments. The author's comments about the sequence. Keywords. Keywords describing the sequence. Db source. Accession numbers in other databases concerning the same sequence. Gb Division. Abbreviation of GenBank divisions. See section 3.3 in the GenBank release notes for a full list of GenBank divisions. Length. The length of the sequence. Modification date. Modification date from the database. This means that this date does not reflect your own changes to the sequence. See the history (section 8) for information about the latest changes to the sequence after it was downloaded from the database. Organism. Scientific name of the organism (first line) and taxonomic classification levels (second and subsequent lines). The information available depends on the origin of the sequence. Sequences downloaded from database like NCBI and UniProt (see section 11) have this information. On the other hand, some sequence formats like fasta format do not contain this information. Some of the information can be edited by clicking the blue Edit text. This means that you can add your own information to sequences that do not derive from databases. Note that for other kinds of data, the Element info will only have Name and Description.

10.5

View as text

A sequence can be viewed as text without any layout and text formatting. This displays all the information about the sequence in the GenBank file format. To view a sequence as text:

CHAPTER 10. VIEWING AND EDITING SEQUENCES select a sequence in the Navigation Area | Show in the Toolbar | As text

249

This way it is possible to see background information about e.g. the authors and the origin of DNA and protein sequences. Selections or the entire text of the Sequence Text View can be copied and pasted into other programs: Much of the information is also displayed in the Sequence info, where it is easier to get an overview (see section 10.4.) In the Side Panel, you find a search field for searching the text in the view.

10.6

Creating a new sequence

A sequence can either be imported, downloaded from an online database or created in the CLC Genomics Workbench. This section explains how to create a new sequence: New ( ) in the toolbar

Figure 10.14: Creating a sequence. The Create Sequence dialog (figure 10.14) reflects the information needed in the GenBank format, but you are free to enter anything into the fields. The following description is a guideline for entering information about a sequence: Name. The name of the sequence. This is used for saving the sequence. Common name. A common name for the species. Latin name. The Latin name for the species. Type. Select between DNA, RNA and protein. Circular. Specifies whether the sequence is circular. This will open the sequence in a circular view as default. (applies only to nucleotide sequences). Description. A description of the sequence. Keywords. A set of keywords separated by semicolons (;).

CHAPTER 10. VIEWING AND EDITING SEQUENCES Comments. Your own comments to the sequence.

250

Sequence. Depending on the type chosen, this field accepts nucleotides or amino acids. Spaces and numbers can be entered, but they are ignored when the sequence is created. This allows you to paste (Ctrl + V on Windows and + V on Mac) in a sequence directly from a different source, even if the residue numbers are included. Characters that are not part of the IUPAC codes cannot be entered. At the top right corner of the field, the number of residues are counted. The counter does not count spaces or numbers. Clicking Finish opens the sequence. It can be saved by clicking Save ( of the sequence view into the Navigation Area. ) or by dragging the tab

10.7

Sequence Lists

The Sequence List shows a number of sequences in a tabular format or it can show the sequences together in a normal sequence view. Having sequences in a sequence list can help organizing sequence data. The sequence list may originate from an NCBI search (chapter 11.1). Moreover, if a multiple sequence fasta file is imported, it is possible to store the data in a sequences list. A Sequence List can also be generated using a dialog, which is described here: select two or more sequences | right-click the elements | New | Sequence List ( This action opens a Sequence List dialog: )

Figure 10.15: A Sequence List dialog. The dialog allows you to select more sequences to include in the list, or to remove already chosen sequences from the list. Clicking Finish opens the sequence list. It can be saved by clicking Save ( tab of the view into the Navigation Area. Opening a Sequence list is done by: right-click the sequence list in the Navigation Area | Show ( List ( ) OR Table ( ) ) | Graphical Sequence ) or by dragging the

CHAPTER 10. VIEWING AND EDITING SEQUENCES The two different views of the same sequence list are shown in split screen in figure 10.16.

251

Figure 10.16: A sequence list containing multiple sequences can be viewed in either a table or in a graphical sequence list. The graphical view is useful for viewing annotations and the sequence itself, while the table view provides other information like sequence lengths, and the number of sequences in the list (number of Rows reported).

10.7.1

Graphical view of sequence lists

The graphical view of sequence lists is almost identical to the view of single sequences (see section 10.1). The main difference is that you now can see more than one sequence in the same view. However, you also have a few extra options for sorting, deleting and adding sequences: To add extra sequences to the list, right-click an empty (white) space in the view, and select Add Sequences. To delete a sequence from the list, right-click the sequence's name and select Delete Sequence. To sort the sequences in the list, right-click the name of one of the sequences and select Sort Sequence List by Name or Sort Sequence List by Length. To rename a sequence, right-click the name of the sequence and select Rename Sequence.

10.7.2

Sequence list table

Each sequence in the table sequence list is displayed with: Name.

CHAPTER 10. VIEWING AND EDITING SEQUENCES Accession. Description. Modification date. Length.

252

The number of sequences in the list is reported as the number of Rows at the top of the table view. Learn more about tables in section C. Adding and removing sequences from the list is easy: adding is done by dragging the sequence from another list or from the Navigation Area and drop it in the table. To delete sequences, simply select them and press Delete ( ). You can also create a subset of the sequence list: select the relevant sequences | right-click | Create New Sequence List This will create a new sequence list which only includes the selected sequences.

10.7.3

Extract sequences

It is possible to extract individual sequences from a sequence list in two ways. If the sequence list is opened in the tabular view, it is possible to drag (with the mouse) one or more sequences into the Navigation Area. This allows you to extract specific sequences from the entire list. Another option is to extract all sequences found in the list. This can also be done for: Alignments ( ) )

Contigs and read mappings ( Read mapping tables ( BLAST result ( ) ) )

BLAST overview tables ( RNA-Seq samples ( )

and of course sequence lists (

For mappings and BLAST results, the main sequences (i.e. reference/consensus and query sequence) will not be extracted. To extract the sequences: Toolbox | General Sequence Analyses ( ) | Extract Sequences ( )

This will allow you to select the elements that you want to extract sequences from (see the list above). Clicking Next displays the dialog shown in 10.17. Here you can choose whether the extracted sequences should be placed in a new list or extracted as single sequences. For sequence lists, only the last option makes sense, but for alignments, mappings and BLAST results, it would make sense to place the sequences in a list.

CHAPTER 10. VIEWING AND EDITING SEQUENCES

253

Figure 10.17: Choosing whether the extracted sequences should be placed in a new list or as single sequences. Below these options you can see the number of sequences that will be extracted. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish.

Chapter 11

Online database search

Contents
11.1 GenBank search . . . . . . . . . . . . . . . . . 11.1.1 GenBank search options . . . . . . . . . 11.1.2 Handling of GenBank search results . . . 11.1.3 Save GenBank search parameters . . . . 11.2 UniProt (Swiss-Prot/TrEMBL) search . . . . . 11.2.1 UniProt search options . . . . . . . . . . 11.2.2 Handling of UniProt search results . . . . 11.2.3 Save UniProt search parameters . . . . . 11.3 Search for structures at NCBI . . . . . . . . . 11.3.1 Structure search options . . . . . . . . . 11.3.2 Handling of NCBI structure search results 11.3.3 Save structure search parameters . . . . 11.4 Sequence web info . . . . . . . . . . . . . . . 11.4.1 Google sequence . . . . . . . . . . . . . 11.4.2 NCBI . . . . . . . . . . . . . . . . . . . . 11.4.3 PubMed References . . . . . . . . . . . . 11.4.4 UniProt . . . . . . . . . . . . . . . . . . . 11.4.5 Additional annotation information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 254 255 256 257 258 258 259 260 260 261 262 263 264 264 264 265 265 265

CLC Genomics Workbench offers different ways of searching data on the Internet. You must be online when initiating and performing the following searches:

11.1

GenBank search
The

This section describes searches for sequences in GenBank - the NCBI Entrez database. NCBI search view is opened in this way (figure 11.1): Search | Search for Sequences at NCBI ( or Ctrl + B ( + B on Mac) )

This opens the following view: 254

CHAPTER 11. ONLINE DATABASE SEARCH

255

Figure 11.1: The GenBank search view.

11.1.1

GenBank search options

Conducting a search in the NCBI Database from CLC Genomics Workbench corresponds to conducting the search on NCBI's website. When conducting the search from CLC Genomics Workbench, the results are available and ready to work with straight away. You can choose whether you want to search for nucleotide sequences or protein sequences. As default, CLC Genomics Workbench offers one text field where the search parameters can be entered. Click Add search parameters to add more parameters to your search. Note! The search is a "and" search, meaning that when adding search parameters to your search, you search for both (or all) text strings rather than "any" of the text strings. You can append a wildcard character by checking the checkbox at the bottom. This means that you only have to enter the first part of the search text, e.g. searching for "genom" will find both "genomic" and "genome". The following parameters can be added to the search: All fields. Text, searches in all parameters in the NCBI database at the same time. Organism. Text. Description. Text. Modified Since. Between 30 days and 10 years. Gene Location. Genomic DNA/RNA, Mitochondrion, or Chloroplast. Molecule. Genomic DNA/RNA, mRNA or rRNA. Sequence Length. Number for maximum or minimum length of the sequence.

CHAPTER 11. ONLINE DATABASE SEARCH Gene Name. Text.

256

The search parameters are the most recently used. The All fields allows searches in all parameters in the NCBI database at the same time. All fields also provide an opportunity to restrict a search to parameters which are not listed in the dialog. E.g. writing gene[Feature key] AND mouse in All fields generates hits in the GenBank database which contains one or more genes and where 'mouse' appears somewhere in GenBank file. You can also write e.g. CD9 NOT homo sapiens in All fields.

Note! The 'Feature Key' option is only available in GenBank when searching for nucleotide sequences. For more information about how to use this syntax, see http://www.ncbi.nlm. nih.gov/entrez/query/static/help/helpdoc.html#Writing_Advanced_Search_Statements When you are satisfied with the parameters you have entered, click Start search. Note! When conducting a search, no files are downloaded. Instead, the program produces a list of links to the files in the NCBI database. This ensures a much faster search.

11.1.2

Handling of GenBank search results

The search result is presented as a list of links to the files in the NCBI database. The View displays 50 hits at a time. This can be changed in the Preferences (see chapter 5). More hits can be displayed by clicking the More... button at the bottom right of the View. Each sequence hit is represented by text in three columns: Accession. Description. Modification date. Length. It is possible to exclude one or more of these columns by adjust the View preferences for the database search view. Furthermore, your changes in the View preferences can be saved. See section 5.6. Several sequences can be selected, and by clicking the buttons in the bottom of the search view, you can do the following: Download and open, doesn't save the sequence. Download and save, lets you choose location for saving sequence. Open at NCBI, searches the sequence at NCBI's web page. Double-clicking a hit will download and open the sequence. The hits can also be copied into the View Area or the Navigation Area from the search results by drag and drop, copy/paste or by using the right-click menu as described below.

CHAPTER 11. ONLINE DATABASE SEARCH Drag and drop from GenBank search results

257

The sequences from the search results can be opened by dragging them into a position in the View Area. Note! A sequence is not saved until the View displaying the sequence is closed. When that happens, a dialog opens: Save changes of sequence x? (Yes or No). The sequence can also be saved by dragging it into the Navigation Area. It is possible to select more sequences and drag all of them into the Navigation Area at the same time. Download GenBank search results using right-click menu You may also select one or more sequences from the list and download using the right-click menu (see figure 11.2). Choosing Download and Save lets you select a folder where the sequences are saved when they are downloaded. Choosing Download and Open opens a new view for each of the selected sequences.

Figure 11.2: By right-clicking a search result, it is possible to choose how to handle the relevant sequence.

Copy/paste from GenBank search results When using copy/paste to bring the search results into the Navigation Area, the actual files are downloaded from GenBank. To copy/paste files into the Navigation Area: select one or more of the search results | Ctrl + C ( in the Navigation Area | Ctrl + V + C on Mac) | select a folder

Note! Search results are downloaded before they are saved. Downloading and saving several files may take some time. However, since the process runs in the background (displayed in the Status bar) it is possible to continue other tasks in the program. Like the search process, the download process can be stopped. This is done in the Toolbox in the Processes tab.

11.1.3

Save GenBank search parameters

The search view can be saved either using dragging the search tab and and dropping it in the Navigation Area or by clicking Save ( ). When saving the search, only the parameters are saved - not the results of the search. This is useful if you have a special search that you perform from time to time.

CHAPTER 11. ONLINE DATABASE SEARCH

258

Even if you don't save the search, the next time you open the search view, it will remember the parameters from the last time you did a search.

11.2

UniProt (Swiss-Prot/TrEMBL) search

This section describes searches in UniProt and the handling of search results. UniProt is a global database of protein sequences. The UniProt search view (figure 11.3) is opened in this way: Search | Search for Sequences in UniProt ( )

Figure 11.3: The UniProt search view.

11.2.1

UniProt search options

Conducting a search in UniProt from CLC Genomics Workbench corresponds to conducting the search on UniProt's website. When conducting the search from CLC Genomics Workbench, the results are available and ready to work with straight away. Above the search fields, you can choose which database to search: Swiss-Prot This is believed to be the most accurate and best quality protein database available. All entries in the database has been currated manually and data are entered according to the original research paper. TrEMBL This database contain computer annotated protein sequences, thus the quality of the annotations is not as good as the Swiss-Prot database. As default, CLC Genomics Workbench offers one text field where the search parameters can be entered. Click Add search parameters to add more parameters to your search. Note! The search is a "and" search, meaning that when adding search parameters to your search, you search for both (or all) text strings rather than "any" of the text strings. You can append a wildcard character by checking the checkbox at the bottom. This means that you only have to enter the first part of the search text, e.g. searching for "genom" will find both "genomic" and "genome".

CHAPTER 11. ONLINE DATABASE SEARCH The following parameters can be added to the search: All fields. Text, searches in all parameters in the UniProt database at the same time. Organism. Text. Description. Text. Created Since. Between 30 days and 10 years. Feature. Text.

259

The search parameters listed in the dialog are the most recently used. The All fields allows searches in all parameters in the UniProt database at the same time. When you are satisfied with the parameters you have entered, click Start search. Note! When conducting a search, no files are downloaded. Instead, the program produces a list of links to the files in the UniProt database. This ensures a much faster search.

11.2.2

Handling of UniProt search results

The search result is presented as a list of links to the files in the UniProt database. The View displays 50 hits at a time (can be changed in the Preferences (see chapter 5). More hits can be displayed by clicking the More... button at the bottom right of the View. More hits can be displayed by clicking the More... button at the bottom left of the View. Each sequence hit is represented by text in three columns: Accession Name Description Organism Length. It is possible to exclude one or more of these columns by adjust the View preferences for the database search view. Furthermore, your changes in the View preferences can be saved. See section 5.6. Several sequences can be selected, and by clicking the buttons in the bottom of the search view, you can do the following: Download and open, does not save the sequence. Download and save, lets you choose location for saving sequence. Open at UniProt, searches the sequence at UniProt's web page. Double-clicking a hit will download and open the sequence. The hits can also be copied into the View Area or the Navigation Area from the search results by drag and drop, copy/paste or by using the right-click menu as described below.

CHAPTER 11. ONLINE DATABASE SEARCH Drag and drop from UniProt search results

260

The sequences from the search results can be opened by dragging them into a position in the View Area. Note! A sequence is not saved until the View displaying the sequence is closed. When that happens, a dialog opens: Save changes of sequence x? (Yes or No). The sequence can also be saved by dragging it into the Navigation Area. It is possible to select more sequences and drag all of them into the Navigation Area at the same time. Download UniProt search results using right-click menu You may also select one or more sequences from the list and download using the right-click menu (see figure 11.2). Choosing Download and Save lets you select a folder or location where the sequences are saved when they are downloaded. Choosing Download and Open opens a new view for each of the selected sequences. Copy/paste from UniProt search results When using copy/paste to bring the search results into the Navigation Area, the actual files are downloaded from UniProt. To copy/paste files into the Navigation Area: select one or more of the search results | Ctrl + C ( or folder in the Navigation Area | Ctrl + V + C on Mac) | select location

Note! Search results are downloaded before they are saved. Downloading and saving several files may take some time. However, since the process runs in the background (displayed in the Toolbox under the Processes tab) it is possible to continue other tasks in the program. Like the search process, the download process can be stopped, paused, and resumed.

11.2.3

Save UniProt search parameters

The search view can be saved either using dragging the search tab and and dropping it in the Navigation Area or by clicking Save ( ). When saving the search, only the parameters are saved - not the results of the search. This is useful if you have a special search that you perform from time to time. Even if you don't save the search, the next time you open the search view, it will remember the parameters from the last time you did a search.

11.3

Search for structures at NCBI

This section describes searches for three dimensional structures from the NCBI structure database http://www.ncbi.nlm.nih.gov/Structure/MMDB/mmdb.shtml. For manipulating and visualization of the downloaded structures see section 13. The NCBI search view is opened in this way: Search | Search for structures at NCBI ( )

CHAPTER 11. ONLINE DATABASE SEARCH or Ctrl + B ( + B on Mac)

261

This opens the view shown in figure 11.4:

Figure 11.4: The structure search view.

11.3.1

Structure search options

Conducting a search in the NCBI Database from CLC Genomics Workbench corresponds to conducting search for structures on the NCBI's Entrez website. When conducting the search from CLC Genomics Workbench, the results are available and ready to work with straight away. As default, CLC Genomics Workbench offers one text field where the search parameters can be entered. Click Add search parameters to add more parameters to your search. Note! The search is a "AND" search, meaning that when adding search parameters to your search, you search for both (or all) text strings rather than "any" of the text strings. You can append a wildcard character by clicking the checkbox at the bottom. This means that you only have to enter the first part of the search text, e.g. searching for "prot" will find both "protein" and "protease". The following parameters can be added to the search: All fields. Text, searches in all parameters in the NCBI structure database at the same time. Organism. Text. Author. Text. PdbAcc. The accession number of the structure in the PDB database.

CHAPTER 11. ONLINE DATABASE SEARCH The search parameters are the most recently used. parameters in the database at the same time.

262 The All fields allows searches in all

All fields also provide an opportunity to restrict a search to parameters which are not listed in the dialog. E.g. writing 'gene[Feature key] AND mouse' in All fields generates hits in the GenBank database which contains one or more genes and where 'mouse' appears somewhere in GenBank file. NB: the 'Feature Key' option is only available in GenBank when searching for nucleotide structures. For more information about how to use this syntax, see http://www.ncbi.nlm.nih.gov/entrez/query/static/help/Summary_ Matrices.html#Search_Fields_and_Qualifiers When you are satisfied with the parameters you have entered click Start search. Note! When conducting a search, no files are downloaded. Instead, the program produces a list of links to the files in the NCBI database. This ensures a much faster search.

11.3.2

Handling of NCBI structure search results

The search result is presented as a list of links to the files in the NCBI database. The View displays 50 hits at a time (can be changed in the Preferences (see chapter 5). More hits can be displayed by clicking the More... button at the bottom right of the View. Each structure hit is represented by text in three columns: Accession. Description. Resolution. Method. Protein chains Release date. It is possible to exclude one or more of these columns by adjust the View preferences for the database search view. Furthermore, your changes in the View preferences can be saved. See section 5.6. Several structures can be selected, and by clicking the buttons in the bottom of the search view, you can do the following: Download and open. Download and open immediately. Download and save. Download and save lets you choose location for saving structure. Open at NCBI. Open additional information on the selected structure at NCBI's web page. Double-clicking a hit will download and open the structure. The hits can also be copied into the View Area or the Navigation Area from the search results by drag and drop, copy/paste or by using the right-click menu as described below.

CHAPTER 11. ONLINE DATABASE SEARCH Drag and drop from structure search results

263

The structures from the search results can be opened by dragging them into a position in the View Area. Note! A structure is not saved until the View displaying the structure is closed. When that happens, a dialog opens: Save changes of structure x? (Yes or No). The structure can also be saved by dragging it into the Navigation Area. It is possible to select more structures and drag all of them into the Navigation Area at the same time. Download structure search results using right-click menu You may also select one or more structures from the list and download using the right-click menu (see figure 11.5). Choosing Download and Save lets you select a folder or location where the structures are saved when they are downloaded. Choosing Download and Open opens a new view for each of the selected structures.

Figure 11.5: By right-clicking a search result, it is possible to choose how to handle the relevant structure. The selected structures are not downloaded from the NCBI website but is downloaded from the RCSB Protein Data Bank http://www.rcsb.org/pdb/home/home.do in mmCIF format. Copy/paste from structure search results When using copy/paste to bring the search results into the Navigation Area, the actual files are downloaded. To copy/paste files into the Navigation Area: select one or more of the search results | Ctrl + C ( or folder in the Navigation Area | Ctrl + V + C on Mac) | select location

Note! Search results are downloaded before they are saved. Downloading and saving several files may take some time. However, since the process runs in the background (displayed in the Status bar) it is possible to continue other tasks in the program. Like the search process, the download process can be stopped. This is done in the Toolbox in the Processes tab.

11.3.3

Save structure search parameters

The search view can be saved either using dragging the search tab and and dropping it in the Navigation Area or by clicking Save ( ). When saving the search, only the parameters are saved

CHAPTER 11. ONLINE DATABASE SEARCH

264

- not the results of the search. This is useful if you have a special search that you perform from time to time. Even if you don't save the search, the next time you open the search view, it will remember the parameters from the last time you did a search.

11.4

Sequence web info

CLC Genomics Workbench provides direct access to web-based search in various databases and on the Internet using your computer's default browser. You can look up a sequence in the databases of NCBI and UniProt, search for a sequence on the Internet using Google and search for Pubmed references at NCBI. This is useful for quickly obtaining updated and additional information about a sequence. The functionality of these search functions depends on the information that the sequence contains. You can see this information by viewing the sequence as text (see section 10.5). In the following sections, we will explain this in further detail. The procedure for searching is identical for all four search options (see also figure 11.6): Open a sequence or a sequence list | Right-click the name of the sequence | Web Info ( ) | select the desired search function

Figure 11.6: Open webpages with information about this sequence. This will open your computer's default browser searching for the sequence that you selected.

11.4.1

Google sequence

The Google search function uses the accession number of the sequence which is used as search term on http://www.google.com. The resulting web page is equivalent to typing the accession number of the sequence into the search field on http://www.google.com.

11.4.2

NCBI

The NCBI search function searches in GenBank at NCBI (http://www.ncbi.nlm.nih.gov) using an identification number (when you view the sequence as text it is the "GI" number). Therefore, the sequence file must contain this number in order to look it up at NCBI. All sequences downloaded from NCBI have this number.

CHAPTER 11. ONLINE DATABASE SEARCH

265

11.4.3

PubMed References

The PubMed references search option lets you look up Pubmed articles based on references contained in the sequence file (when you view the sequence as text it contains a number of "PUBMED" lines). Not all sequence have these PubMed references, but in this case you will se a dialog and the browser will not open.

11.4.4

UniProt

The UniProt search function searches in the UniProt database (http://www.ebi.uniprot. org) using the accession number. Furthermore, it checks whether the sequence was indeed downloaded from UniProt.

11.4.5

Additional annotation information

When sequences are downloaded from GenBank they often link to additional information on taxonomy, conserved domains etc. If such information is available for a sequence it is possible to access additional accurate online information. If the db_xref identifier line is found as part of the annotation information in the downloaded GenBank file, it is possible to easily look up additional information on the NCBI web-site. To access this feature, simply right click an annotation and see which databases are available.

Chapter 12

BLAST search
Contents
12.1 Running BLAST searches . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 267 12.1.1 12.1.2 12.1.3 BLAST at NCBI . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 268 BLAST a partial sequence against NCBI . . . . . . . . . . . . . . . . . . 271 BLAST against local data . . . . . . . . . . . . . . . . . . . . . . . . . . 271

12.1.4 BLAST a partial sequence against a local database . . . . . . . . . . . . 273 12.2 Output from BLAST searches . . . . . . . . . . . . . . . . . . . . . . . . . . . 273 12.2.1 12.2.2 12.2.3 12.2.4 12.3.1 12.3.2 12.3.3 12.4.1 12.5.1 12.5.2 12.5.3 12.5.4 12.5.5 12.5.6 12.5.7 12.5.8 12.5.9 Graphical overview for each query sequence . . . . . . . . . . . . . . . . 273 Overview BLAST table . . . . . . . . . . . . . . . . . . . . . . . . . . . . 273 BLAST graphics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 275 BLAST table . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 276 Make pre-formatted BLAST databases available . . . . . . . . . . . . . . 279 Download NCBI pre-formatted BLAST databases . . . . . . . . . . . . . . 279 Create local BLAST databases . . . . . . . . . . . . . . . . . . . . . . . 280 Migrating from a previous version of the Workbench . . . . . . . . . . . . 282 Examples of BLAST usage . . . . . . . . . . . . . . . . . . . . . . . . . . 283 Searching for homology . . . . . . . . . . . . . . . . . . . . . . . . . . . 283 How does BLAST work? . . . . . . . . . . . . . . . . . . . . . . . . . . . 283 Which BLAST program should I use? . . . . . . . . . . . . . . . . . . . . 285 Which BLAST options should I change? . . . . . . . . . . . . . . . . . . 286 Explanation of the BLAST output . . . . . . . . . . . . . . . . . . . . . . 287 I want to BLAST against my own sequence database, is this possible? . 289 What you cannot get out of BLAST . . . . . . . . . . . . . . . . . . . . . 290 Other useful resources . . . . . . . . . . . . . . . . . . . . . . . . . . . 290

12.3 Local BLAST databases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 278

12.4 Manage BLAST databases . . . . . . . . . . . . . . . . . . . . . . . . . . . . 281 12.5 Bioinformatics explained: BLAST . . . . . . . . . . . . . . . . . . . . . . . . . 282

CLC Genomics Workbench offers to conduct BLAST searches on protein and DNA sequences. In short, a BLAST search identifies homologous sequences between your input (query) query sequence and a database of sequences [McGinnis and Madden, 2004]. BLAST (Basic Local 266

CHAPTER 12. BLAST SEARCH

267

Alignment Search Tool), identifies homologous sequences using a heuristic method which finds short matches between two sequences. After initial match BLAST attempts to start local alignments from these initial matches. If you are interested in the bioinformatics behind BLAST, there is an easy-to-read explanation of this in section 12.5. With CLC Genomics Workbench there are two ways of performing BLAST searches: You can either have the BLAST process run on NCBI's BLAST servers (http://www.ncbi.nlm.nih.gov/) or perform the BLAST search on your own computer. The advantage of running the BLAST search on NCBI servers is that you have readily access to the most popular BLAST databases without having to download them to your own computer. The advantage of running BLAST on your own computer is that you can use your own sequence data, and that this can sometimes be faster and more reliable for big batch BLAST jobs Figure 12.8 shows an example of a BLAST result in the CLC Genomics Workbench.

Figure 12.1: Display of the output of a BLAST search. At the top is there a graphical representation of BLAST hits with tool-tips showing additional information on individual hits. Below is a tabular form of the BLAST results.

12.1

Running BLAST searches

With the CLC Genomics Workbench there are two ways of performing BLAST searches: You can either have the BLAST process run on NCBI's BLAST servers (http://www.ncbi.nlm.nih. gov/) or you can perform the BLAST search on your own computer. The advantage of running the BLAST search on NCBI servers is that you have readily access to the popular, and often very large, BLAST databases without having to download them to your own computer. The advantages of running BLAST on your own computer include that you can use your own sequence collections as blast databases, and that running big batch BLAST jobs can be faster and more reliable when done locally.

CHAPTER 12. BLAST SEARCH

268

12.1.1

BLAST at NCBI

When running a BLAST search at the NCBI, the Workbench sends the sequences you select to the NCBI's BLAST servers. When the results are ready, they will be automatically downloaded and displayed in the Workbench. When you enter a large number of sequences for searching with BLAST, the Workbench automatically splits the sequences up into smaller subsets and sends one subset at the time to NCBI. This is to avoid exceeding any internal limits the NCBI places on the number of sequences that can be submitted to them for BLAST searching. The size of the subset created in the CLC software depends both on the number and size of the sequences. To start a BLAST job to search your sequences against databases held at the NCBI: Toolbox | BLAST ( ) | NCBI BLAST ( ) +Shift+B on Mac OS.

Alternatively, use the keyboard shortcut: Ctrl+Shift+B for Windows and This opens the dialog seen in figure 12.2

Figure 12.2: Choose one or more sequences to conduct a BLAST search with. Select one or more sequences of the same type (either DNA or protein) and click Next. In this dialog, you choose which type of BLAST search to conduct, and which database to search against. See figure 12.3. The databases at the NCBI listed in the dropdown box will correspond to the query sequence type you have, DNA or protein, and the type of blast search you have chosen to run. A complete list of these databases can be found in Appendix D. Here you can also read how to add additional databases available the NCBI to the list provided in the dropdown menu.

Figure 12.3: Choose a BLAST Program and a database for the search. BLAST programs for DNA query sequences:

CHAPTER 12. BLAST SEARCH

269

BLASTn: DNA sequence against a DNA database. Used to look for DNA sequences with homologous regions to your nucleotide query sequence. BLASTx: Translated DNA sequence against a Protein database. Automatic translation of your DNA query sequence in six frames; these translated sequences are then used to search a protein database. tBLASTx: Translated DNA sequence against a Translated DNA database. Automatic translation of your DNA query sequence and the DNA database, in six frames. The resulting peptide query sequences are used to search the resulting peptide database. Note that this type of search is computationally intensive. BLAST programs for protein query sequences: BLASTp: Protein sequence against Protein database. Used to look for peptide sequences with homologous regions to your peptide query sequence. tBLASTn: Protein sequence against Translated DNA database. Peptide query sequences are searched against an automatically translated, in six frames, DNA database. If you search against the Protein Data Bank protein database homologous sequences are found to the query sequence, these can be downloaded and opened with the 3D view. Click Next. This window, see figure 12.4, allows you to choose parameters to tune your BLAST search, to meet your requirements.

Figure 12.4: Parameters that can be set before submitting a BLAST search. When choosing BLASTx or tBLASTx to conduct a search, you get the option of selecting a translation table for the genetic code. The standard genetic code is set as default. This setting is particularly useful when working with organisms or organelles that have a genetic code different from the standard genetic code. The following description of BLAST search parameters is based on information from http: //www.ncbi.nlm.nih.gov/BLAST/blastcgihelp.shtml. Limit by Entrez query BLAST searches can be limited to the results of an Entrez query against the database chosen. This can be used to limit searches to subsets of entries in the BLAST databases. Any terms can be entered that would normally be allowed in an Entrez search

CHAPTER 12. BLAST SEARCH

270

session. More information about Entrez queries can be found at http://www.ncbi. nlm.nih.gov/books/NBK3837/#EntrezHelp.Entrez_Searching_Options. The syntax described there is the same as would be accepted in the CLC interface. Some commonly used Entrez queries are pre-entered and can be chosen in the drop down menu. Choose filter Low-complexity. Mask off segments of the query sequence that have low compositional complexity. Filtering can eliminate statistically significant, but biologically uninteresting reports from the BLAST output (e.g. hits against common acidic-, basicor proline-rich regions), leaving the more biologically interesting regions of the query sequence available for specific matching against database sequences. Mask lower case. If you have a sequence with regions denoted in lower case, and other regions in upper case, then choosing this option would keep any of the regions in lower case from being considered in your BLAST search. Expect. The threshold for reporting matches against database sequences: the default value is 10, meaning that under the circumstances of this search, 10 matches are expected to be found merely by chance according to the stochastic model of Karlin and Altschul (1990). Details of how E-values are calculated can be found at the NCBI: http://www. ncbi.nlm.nih.gov/BLAST/tutorial/Altschul-1.html If the E-value ascribed to a match is greater than the EXPECT threshold, the match will not be reported. Lower EXPECT thresholds are more stringent, leading to fewer chance matches being reported. Increasing the threshold results in more matches being reported, but many may just matching by chance, not due to any biological similarity. Values of E less than one can be entered as decimals, or in scientific notiation. For example, 0.001, 1e-3 and 10e-4 would be equivalent and acceptable values. Word Size. BLAST is a heuristic that works by finding word-matches between the query and database sequences. You may think of this process as finding "hot-spots" that BLAST can then use to initiate extensions that might lead to full-blown alignments. For nucleotidenucleotide searches (i.e. "BLASTn") an exact match of the entire word is required before an extension is initiated, so that you normally regulate the sensitivity and speed of the search by increasing or decreasing the wordsize. For other BLAST searches non-exact word matches are taken into account based upon the similarity between words. The amount of similarity can be varied so that you normally uses just the wordsizes 2 and 3 for these searches. Matrix. A key element in evaluating the quality of a pairwise sequence alignment is the "substitution matrix", which assigns a score for aligning any possible pair of residues. The matrix used in a BLAST search can be changed depending on the type of sequences you are searching with (see the BLAST Frequently Asked Questions). Only applicable for protein sequences or translated DNA sequences. Gap Cost. The pull down menu shows the Gap Costs (Penalty to open Gap and penalty to extend Gap). Increasing the Gap Costs and Lambda ratio will result in alignments which decrease the number of Gaps introduced. Max number of hit sequences. The maximum number of database sequences, where BLAST found matches to your query sequence, to be included in the BLAST report.

CHAPTER 12. BLAST SEARCH

271

The parameters you choose will affect how long BLAST takes to run. A search of a small database, requesting only hits that meet stringent criteria will generally be quite quick. Searching large databases, or allowing for very remote matches, will of course take longer. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish.

12.1.2

BLAST a partial sequence against NCBI

You can search a database using only a part of a sequence directly from the sequence view: select the sequence region to send to BLAST | right-click the selection | BLAST Selection Against NCBI ( ) This will go directly to the dialog shown in figure 12.3 and the rest of the options are the same as when performing a BLAST search with a full sequence.

12.1.3

BLAST against local data

Running BLAST searches on your local machine can have several advantages over running the searches remotely at the NCBI: It can be faster. It does not rely on having a stable internet connection. It does not depend on the availability of the NCBI BLAST blast servers. You can use longer query sequences. You use your own data sets to search against. On a technical level, the CLC Genomics Workbench uses the NCBI's blast+ software (see ftp: //ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/). Thus, the results of using a particular data set to search the same database, with the same search parameters, would give the same results, whether run locally or at the NCBI. There are a number of options for what you can search against: You create a database based on data already imported into your Workbench (see section 12.3.3) You can add pre-formatted databases (see section 12.3.1) You can use sequence data from the Navigation Area directly, without creating a database first. To conduct a BLAST search: or Toolbox | BLAST ( ) | Local BLAST ( )

This opens the dialog seen in figure 12.5: Select one or more sequences of the same type (DNA or protein) and click Next.

CHAPTER 12. BLAST SEARCH

272

Figure 12.5: Choose one or more sequences to conduct a BLAST search.

Figure 12.6: Choose a BLAST program and a target database. This opens the dialog seen in figure 12.6: At the top, you can choose between different BLAST programs. See section 12.1.1 for information about these methods. You then specify the target database to use: Sequences. When you choose this option, you can use sequence data from the Navigation Area as database by clicking the Browse and select icon ( ). A temporary BLAST database will be created from these sequences and used for the BLAST search. It is deleted afterwards. If you want to be able to click in the BLAST result to retrieve the hit sequences from the BLAST database at a later point, you should not use this option; create a create a BLAST database first, see section 12.3.3. BLAST Database. Select a database already available in one of your designated BLAST database folders. Read more in section 12.4. When a database or a set of sequences has been selected, click Next. This opens the dialog seen in figure 12.7: See section 12.1.1 for information about these limitations. There is one setting available for local BLAST jobs that is not relevant for remote searches at the NCBI: Number of processors. You can specify the number of processors which should be used if your Workbench is installed on a multi-processor system.

CHAPTER 12. BLAST SEARCH

273

Figure 12.7: Examples of parameters that can be set before submitting a BLAST search.

12.1.4

BLAST a partial sequence against a local database

You can search a database using only a part of a sequence directly from the sequence view: select the region that you wish to BLAST | right-click the selection | BLAST Selection Against Local Database ( ) This will go directly to the dialog shown in figure 12.6 and the rest of the options are the same as when performing a BLAST search with a full sequence.

12.2

Output from BLAST searches

The output of a BLAST search is similar whether you have chosen to run your search locally or at the NCBI. If a single query sequence was used, then the results will show the hits found in that database with that single sequence. If more than one sequence was used to query a database, the default view of the results is a summary table, showing the description of the top database hit against each query sequence, and the number of hits found.

12.2.1

Graphical overview for each query sequence

Double clicking on a given row of a tabular blast table opens a graphical overview of the blast results for a particular query sequence, as shown in figure figure 12.8. In cases where only one sequence was entered into a BLAST search, such a graphical overview is the default output. Figure 12.8 shows an example of a BLAST result for an individual query sequence in the CLC Genomics Workbench. Detailed descriptions of the overview BLAST table and the graphical BLAST results view are described below.

12.2.2

Overview BLAST table

In the overview BLAST table for a multi-sequence blast search, as shown in figure 12.9, there is one row for each query sequence. Each row represents the BLAST result for this query sequence. Double-clicking a row will open the BLAST result for this query sequence, allowing more detailed investigation of the result. You can also select one or more rows and click the Open BLAST Output button at the bottom of the view. Clicking the Open Query Sequence will open a sequence

CHAPTER 12. BLAST SEARCH

274

Figure 12.8: Default display of the output of a BLAST search for one query sequence. At the top is there a graphical representation of BLAST hits with tool-tips showing additional information on individual hits.

Figure 12.9: An overview BLAST table summarizing the results for a number of query sequences. list with the selected query sequences. This can be useful in work flows where BLAST is used as a filtering mechanism where you can filter the table to include e.g. sequences that have a certain top hit and then extract those. In the overview table, the following information is shown: Query: Since this table displays information about several query sequences, the first column is the name of the query sequence. Number of hits: The number of hits for this query sequence. For the following list, the value of the best hit is displayed together with accession number

CHAPTER 12. BLAST SEARCH and description of this hit. Lowest E-value Greatest identity % Greatest positive % Greatest hit length Greatest bit score

275

If you wish to save some of the BLAST results as individual elements in the Navigation Area, open them and click Save As in the File menu.

12.2.3

BLAST graphics

The BLAST editor shows the sequences hits which were found in the BLAST search. The hit sequences are represented by colored horizontal lines, and when hovering the mouse pointer over a BLAST hit sequence, a tooltip appears, listing the characteristics of the sequence. As default, the query sequence is fitted to the window width, but it is possible to zoom in the windows and see the actual sequence alignments returned from the BLAST server. There are several settings available in the BLAST Graphics view. BLAST Layout. You can choose to Gather sequences at top. Enabling this option affects the view that is shown when scrolling horizontally along a BLAST result. If selected, the sequence hits which did not contribute to the visible part of the BLAST graphics will be omitted whereas the found BLAST hits will automatically be placed right below the query sequence. Compactness: You can control the level of sequence detail to be displayed: Not compact. Full detail and spaces between the sequences. Low. The normal settings where the residues are visible (when zoomed in) but with no extra spaces between. Medium. The sequences are represented as lines and the residues are not visible. There is some space between the sequences. Compact. Even less space between the sequences. BLAST hit coloring. You can choose whether to color hit sequences and you can adjust the coloring. Coverage: In the Alignment info in the Side Panel, you can visualize the number of hit sequences at a given position on the query sequence. The level of coverage is relative to the overall number of hits included in the result. Foreground color. Colors the letters using a gradient, where the left side color is used for low coverage and the right side is used for maximum coverage. Background color. Colors the background of the letters using a gradient, where the left side color is used for low coverage and the right side is used for maximum coverage Graph. The coverage is displayed as a graph beneath the query sequence (Learn how to export the data behind the graph in section 7.4).

CHAPTER 12. BLAST SEARCH

276

Height. Specifies the height of the graph. Type. The graph can be displayed as Line plot, Bar plot or as a Color bar. Color box. For Line and Bar plots, the color of the plot can be set by clicking the color box. If a Color bar is chosen, the color box is replaced by a gradient color box as described under Foreground color. The remaining View preferences for BLAST Graphics are the same as those of alignments. See section 22.2. Some of the information available in the tooltips is: Name of sequence. Here is shown some additional information of the sequence which was found. This line corresponds to the description line in GenBank (if the search was conducted on the nr database). Score. This shows the bit score of the local alignment generated through the BLAST search. Expect. Also known as the E-value. A low value indicates a homologous sequence. Higher E-values indicate that BLAST found a less homologous sequence. Identities. This number shows the number of identical residues or nucleotides in the obtained alignment. Gaps. This number shows whether the alignment has gaps or not. Strand. This is only valid for nucleotide sequences and show the direction of the aligned strands. Minus indicate a complementary strand. Query. This is the sequence (or part of the sequence) which you have used for the BLAST search. Sbjct (subject). This is the sequence found in the database. The numbers of the query and subject sequences refer to the sequence positions in the submitted and found sequences. If the subject sequence has number 59 in front of the sequence, this means that 58 residues are found upstream of this position, but these are not included in the alignment. By right clicking the sequence name in the Graphical BLAST output it is possible to download the full hits sequence from NCBI with accompanying annotations and information. It is also possible to just open the actual hit sequence in a new view.

12.2.4

BLAST table

In addition to the graphical display of a BLAST result, it is possible to view the BLAST results in a tabular view. In the tabular view, one can get a quick and fast overview of the results. Here you can also select multiple sequences and download or open all of these in one single step. Moreover, there is a link from each sequence to the sequence at NCBI. These possibilities are either available through a right-click with the mouse or by using the buttons below the table. If the BLAST table view was not selected in Step 4 of the BLAST search, the table can be shown in the following way:

CHAPTER 12. BLAST SEARCH Click the Show BLAST Table button ( Figure 12.10 is an example of a BLAST Table. ) at the bottom of the view

277

Figure 12.10: Display of the output of a BLAST search in the tabular view. The hits can be sorted by the different columns, simply by clicking the column heading. The BLAST Table includes the following information: Query sequence. The sequence which was used for the search. Hit. The Name of the sequences found in the BLAST search. Id. GenBank ID. Description. Text from NCBI describing the sequence. E-value. Measure of quality of the match. Higher E-values indicate that BLAST found a less homologous sequence. Score. This shows the score of the local alignment generated through the BLAST search. Bit score. This shows the bit score of the local alignment generated through the BLAST search. Bit scores are normalized, which means that the bit scores from different alignments can be compared, even if different scoring matrices have been used. Hit start. Shows the start position in the hit sequence Hit end. Shows the end position in the hit sequence. Hit length. The length of the hit. Query start. Shows the start position in the query sequence. Query end. Shows the end position in the query sequence. Overlap. Display a percentage value for the overlap of the query sequence and hit sequence. Only the length of the local alignment is taken into account and not the full length query sequence. Identity. Shows the number of identical residues in the query and hit sequence. %Identity. Shows the percentage of identical residues in the query and hit sequence.

CHAPTER 12. BLAST SEARCH

278

Positive. Shows the number of similar but not necessarily identical residues in the query and hit sequence. %Positive. Shows the percentage of similar but not necessarily identical residues in the query and hit sequence. Gaps. Shows the number of gaps in the query and hit sequence. %Gaps. Shows the percentage of gaps in the query and hit sequence. Query Frame/Strand. Shows the frame or strand of the query sequence. Hit Frame/Strand. Shows the frame or strand of the hit sequence. In the BLAST table view you can handle the hit sequences. Select one or more sequences from the table, and apply one of the following functions. Download and Open. Download the full sequence from NCBI and opens it. If multiple sequences are selected, they will all open (if the same sequence is listed several times, only one copy of the sequence is downloaded and opened). Download and Save. Download the full sequence from NCBI and save it. When you click the button, there will be a save dialog letting you specify a folder to save the sequences. If multiple sequences are selected, they will all open (if the same sequence is listed several times, only one copy of the sequence is downloaded and opened). Open at NCBI. Opens the corresponding sequence(s) at GenBank at NCBI. Here is stored additional information regarding the selected sequence(s). The default Internet browser is used for this purpose. Open structure. If the hit sequence contain structure information, the sequence is opened in a text view or a 3D view (3D view in CLC Protein Workbench and CLC Main Workbench). You can do a text-based search in the information in the BLAST table by using the filter at the upper right part of the view. In this way you can search for e.g. species or other information which is typically included in the "Description" field. The table is integrated with the graphical view described in section 12.2.3 so that selecting a hit in the table will make a selection on the corresponding sequence in the graphical view.

12.3

Local BLAST databases

BLAST databases on your local system can be made available for searches via your CLC Genomics Workbench, (section 12.3.1). To make adding databases even easier, you can download preformatted BLAST databases from the NCBI from within your CLC Genomics Workbench, (section 12.3.2). You can also easily create your own local blast databases from sequences within your CLC Genomics Workbench, (section 12.3.3).

CHAPTER 12. BLAST SEARCH

279

12.3.1

Make pre-formatted BLAST databases available

To use databases that have been downloaded or created outside the Workbench, you can either Put the database files in one of the locations defined in the BLAST database manager (see section 12.4) Add the location where your BLAST databases are stored using the BLAST database manager (see section 12.4). See figure 12.14.

12.3.2

Download NCBI pre-formatted BLAST databases

Many popular pre-formatted databases are available for download from the NCBI. You can download any of the databases available from the list at ftp://ftp.ncbi.nih.gov/blast/ db/ from within your CLC Genomics Workbench. You must be connected to the internet to use this tool. If you choose: or Toolbox | BLAST ( ) | Download BLAST Databases ( )

a window like the one in figure 12.11 pops up showing you the list of databases available for download.

Figure 12.11: Choose from pre-formatted BLAST databases at the NCBI available for download. In this window, you can see the names of the databases, the date they were made available for download on the NCBI site, the size of the files associated with that database, and a brief description of each database. You can also see whether the database has any dependencies. This aspect is described below. You can also specify which of your database locations you would like to store the files in. Please see the Manage BLAST Databases section for more on this (section 12.4). There are two very important things to note if you wish to take advantage of this tool. Many of the databases listed are very large. Please make sure you have room for them. If you are working on a shared system, we recommend you discuss your plans with your system administrator and fellow users. Some of the databases listed are dependent on others. This will be listed in the Dependencies column of the Download BLAST Databases window. This means that while

CHAPTER 12. BLAST SEARCH

280

the database your are interested in may seem very small, it may require that you also download a very big database on which it depends. An example of the second item above is Swissprot. To download a database from the NCBI that would allow you to search just Swissprot entries, you need to download the whole nr database in addition to the entry for Swissprot.

12.3.3

Create local BLAST databases

In the CLC Genomics Workbench you can create a local database that you can use for local BLAST searches. You can specify a location on your computer to save the BLAST database files to. The Workbench will list the BLAST databases found in these locations when you set up a local BLAST search (see section 12.1.3). DNA, RNA, and protein sequences located in the Navigation Area can be used to create BLAST databases from. Any given BLAST database can only include one molecule type. If you wish to use a pre-formatted BLAST database instead, see section 12.3.1. To create a BLAST database, go to: Toolbox | BLAST ( ) | Create BLAST Database ( )

This opens the dialog seen in figure 12.12.

Figure 12.12: Add sequences for the BLAST database. Select sequences or sequence lists you wish to include in your database and click Next. In the next dialog, shown in figure 12.13, you provide the following information: Name. The name of the BLAST database. This name will be used when running BLAST searches and also as the base file name for the BLAST database files. Description. You can add more details to describe the contents of the database. Location. You can select the location to save the BLAST database files to. You can add or change the locations in this list using the Manage BLAST Databases tool, see section 12.4.

CHAPTER 12. BLAST SEARCH

281

Figure 12.13: Providing a name and description for the database, and the location to save the files to. Click Finish to create the BLAST database. Once the process is complete, the new database will be available in the Manage BLAST Databases dialog, see section 12.4, and when running local BLAST (see section 12.1.3).

12.4

Manage BLAST databases

The BLAST database available as targets for running local BLAST searches (see section 12.1.3) can be managed through the Manage BLAST Databases dialog (see figure 12.14): Toolbox | BLAST ( ) | Manage BLAST Databases ( )

Figure 12.14: Overview of available BLAST databases. At the top of the dialog, there is a list of the BLAST database locations. These locations are folders where the Workbench will look for valid BLAST databases. These can either be created from within the Workbench using the Create BLAST Database tool, see section 12.3.3, or they can be pre-formatted BLAST databases. The list of locations can be modified using the Add Location and Remove Location buttons. Once the Workbench has scanned the locations, it will keep a cache of the databases (in order

CHAPTER 12. BLAST SEARCH

282

to improve performance). If you have added new databases that are not listed, you can press Refresh Locations to clear the cache and search the database locations again. By default a BLAST database location will be added under your home area in a folder called CLCdatabases. This folder is scanned recursively, through all subfolders, to look for valid databases. All other folderlocations are scanned only at the top level. Below the list of locations, all the BLAST databases are listed with the following information: Name. The name of the BLAST database. Description. Detailed description of the contents of the database. Date. The date the database was created. Sequences. The number of sequences in the database. Type. The type can be either nucleotide (DNA) or protein. Total size (1000 residues). The number of residues in the database, either bases or amino acid. Location. The location of the database. Below the list of BLAST databases, there is a button to Remove Database. This option will delete the database files belonging to the database selected.

12.4.1

Migrating from a previous version of the Workbench

In versions released before 2011, the BLAST database management was very different from this. In order to migrate from the older versions, please add the folders of the old BLAST databases as locations in the BLAST database manager (see section 12.4). The old representations of the BLAST databases in the Navigation Area can be deleted. If you have saved the BLAST databases in the default folder, they will automatically appear because the default database location used in CLC Genomics Workbench 4.8 is the same as the default folder specified for saving BLAST databases in the old version.

12.5

Bioinformatics explained: BLAST

BLAST (Basic Local Alignment Search Tool) has become the defacto standard in search and alignment tools [Altschul et al., 1990]. The BLAST algorithm is still actively being developed and is one of the most cited papers ever written in this field of biology. Many researchers use BLAST as an initial screening of their sequence data from the laboratory and to get an idea of what they are working on. BLAST is far from being basic as the name indicates; it is a highly advanced algorithm which has become very popular due to availability, speed, and accuracy. In short, a BLAST search identifies homologous sequences by searching one or more databases usually hosted by NCBI (http://www.ncbi.nlm.nih.gov/), on the query sequence of interest [McGinnis and Madden, 2004]. BLAST is an open source program and anyone can download and change the program code. This has also given rise to a number of BLAST derivatives; WU-BLAST is probably the most commonly used [Altschul and Gish, 1996].

CHAPTER 12. BLAST SEARCH

283

BLAST is highly scalable and comes in a number of different computer platform configurations which makes usage on both small desktop computers and large computer clusters possible.

12.5.1

Examples of BLAST usage

BLAST can be used for a lot of different purposes. A few of them are mentioned below. Looking for species. If you are sequencing DNA from unknown species, BLAST may help identify the correct species or homologous species. Looking for domains. If you BLAST a protein sequence (or a translated nucleotide sequence) BLAST will look for known domains in the query sequence. Looking at phylogeny. You can use the BLAST web pages to generate a phylogenetic tree of the BLAST result. Mapping DNA to a known chromosome. If you are sequencing a gene from a known species but have no idea of the chromosome location, BLAST can help you. BLAST will show you the position of the query sequence in relation to the hit sequences. Annotations. BLAST can also be used to map annotations from one organism to another or look for common genes in two related species.

12.5.2

Searching for homology

Most research projects involving sequencing of either DNA or protein have a requirement for obtaining biological information of the newly sequenced and maybe unknown sequence. If the researchers have no prior information of the sequence and biological content, valuable information can often be obtained using BLAST. The BLAST algorithm will search for homologous sequences in predefined and annotated databases of the users choice. In an easy and fast way the researcher can gain knowledge of gene or protein function and find evolutionary relations between the newly sequenced DNA and well established data. After the BLAST search the user will receive a report specifying found homologous sequences and their local alignments to the query sequence.

12.5.3

How does BLAST work?

BLAST identifies homologous sequences using a heuristic method which initially finds short matches between two sequences; thus, the method does not take the entire sequence space into account. After initial match, BLAST attempts to start local alignments from these initial matches. This also means that BLAST does not guarantee the optimal alignment, thus some sequence hits may be missed. In order to find optimal alignments, the Smith-Waterman algorithm should be used (see below). In the following, the BLAST algorithm is described in more detail. Seeding When finding a match between a query sequence and a hit sequence, the starting point is the words that the two sequences have in common. A word is simply defined as a number of letters.

CHAPTER 12. BLAST SEARCH

284

For blastp the default word size is 3 W=3. If a query sequence has a QWRTG, the searched words are QWR, WRT, RTG. See figure 12.15 for an illustration of words in a protein sequence.

Figure 12.15: Generation of exact BLAST words with a word size of W=3. During the initial BLAST seeding, the algorithm finds all common words between the query sequence and the hit sequence(s). Only regions with a word hit will be used to build on an alignment. BLAST will start out by making words for the entire query sequence (see figure 12.15). For each word in the query sequence, a compilation of neighborhood words, which exceed the threshold of T, is also generated. A neighborhood word is a word obtaining a score of at least T when comparing, using a selected scoring matrix (see figure 12.16). The default scoring matrix for blastp is BLOSUM62 (for explanation of scoring matrices, see www.clcbio.com/be). The compilation of exact words and neighborhood words is then used to match against the database sequences.

Figure 12.16: Neighborhood BLAST words based on the BLOSUM62 matrix. Only words where the threshold T exceeds 13 are included in the initial seeding. After initial finding of words (seeding), the BLAST algorithm will extend the (only 3 residues long) alignment in both directions (see figure 12.17). Each time the alignment is extended, an alignment score is increases/decreased. When the alignment score drops below a predefined threshold, the extension of the alignment stops. This ensures that the alignment is not extended to regions where only very poor alignment between the query and hit sequence is possible. If the obtained alignment receives a score above a certain threshold, it will be included in the final BLAST result. By tweaking the word size W and the neighborhood word threshold T, it is possible to limit the search space. E.g. by increasing T, the number of neighboring words will drop and thus limit the search space as shown in figure 12.18. This will increase the speed of BLAST significantly but may result in loss of sensitivity. Increasing the word size W will also increase the speed but again with a loss of sensitivity.

CHAPTER 12. BLAST SEARCH

285

Figure 12.17: Blast aligning in both directions. The initial word match is marked green.

Figure 12.18: Each dot represents a word match. Increasing the threshold of T limits the search space significantly.

12.5.4

Which BLAST program should I use?

Depending on the nature of the sequence it is possible to use different BLAST programs for the database search. There are five versions of the BLAST program, blastn, blastp, blastx, tblastn, tblastx: Option blastn blastp tblastn blastx Query Type Nucleotide Protein Protein Nucleotide DB Type Nucleotide Protein Nucleotide Protein Nucleotide Comparison Nucleotide-Nucleotide Protein-Protein Protein-Protein Protein-Protein Protein-Protein Note

tblastx Nucleotide

The database is translated into protein The queries are translated into protein The queries and database are translated into protein

The most commonly used method is to BLAST a nucleotide sequence against a nucleotide database (blastn) or a protein sequence against a protein database (blastp). But often another BLAST program will produce more interesting hits. E.g. if a nucleotide sequence is translated

CHAPTER 12. BLAST SEARCH

286

before the search, it is more likely to find better and more accurate hits than just a blastn search. One of the reasons for this is that protein sequences are evolutionarily more conserved than nucleotide sequences. Another good reason for translating the query sequence before the search is that you get protein hits which are likely to be annotated. Thus you can directly see the protein function of the sequenced gene.

12.5.5

Which BLAST options should I change?

The NCBI BLAST web pages and the BLAST command line tool offer a number of different options which can be changed in order to obtain the best possible result. Changing these parameters can have a great impact on the search result. It is not the scope of this document to comment on all of the options available but merely the options which can be changed with a direct impact on the search result. The E-value The expect value(E-value) can be changed in order to limit the number of hits to the most significant ones. The lower the E-value, the better the hit. The E-value is dependent on the length of the query sequence and the size of the database. For example, an alignment obtaining an E-value of 0.05 means that there is a 5 in 100 chance of occurring by chance alone. E-values are very dependent on the query sequence length and the database size. Short identical sequence may have a high E-value and may be regarded as "false positive" hits. This is often seen if one searches for short primer regions, small domain regions etc. The default threshold for the E-value on the BLAST web page is 10. Increasing this value will most likely generate more hits. Below are some rules of thumb which can be used as a guide but should be considered with common sense. E-value < 10e-100 Identical sequences. You will get long alignments across the entire query and hit sequence. 10e-100 < E-value < 10e-50 Almost identical sequences. A long stretch of the query protein is matched to the database. 10e-50 < E-value < 10e-10 Closely related sequences, could be a domain match or similar. 10e-10 < E-value < 1 Could be a true homologue but it is a gray area. E-value > 1 Proteins are most likely not related E-value > 10 Hits are most likely junk unless the query sequence is very short. Gap costs For blastp it is possible to specify gap cost for the chosen substitution matrix. There is only a limited number of options for these parameters. The open gap cost is the price of introducing gaps in the alignment, and extension gap cost is the price of every extension past the initial opening gap. Increasing the gap costs will result in alignments with fewer gaps.

CHAPTER 12. BLAST SEARCH Filters

287

It is possible to set different filter options before running the BLAST search. Low-complexity regions have a very simple composition compared to the rest of the sequence and may result in problems during the BLAST search [Wootton and Federhen, 1993]. A low complexity region of a protein can for example look like this 'fftfflllsss', which in this case is a region as part of a signal peptide. In the output of the BLAST search, low-complexity regions will be marked in lowercase gray characters (default setting). The low complexity region cannot be thought of as a significant match; thus, disabling the low complexity filter is likely to generate more hits to sequences which are not truly related. Word size Change of the word size has a great impact on the seeded sequence space as described above. But one can change the word size to find sequence matches which would otherwise not be found using the default parameters. For instance the word size can be decreased when searching for primers or short nucleotides. For blastn a suitable setting would be to decrease the default word size of 11 to 7, increase the E-value significantly (1000) and turn off the complexity filtering. For blastp a similar approach can be used. Decrease the word size to 2, increase the E-value and use a more stringent substitution matrix, e.g. a PAM30 matrix. Fortunately, the optimal search options for finding short, nearly exact matches can already be found on the BLAST web pages http://www.ncbi.nlm.nih.gov/BLAST/. Substitution matrix For protein BLAST searches, a default substitution matrix is provided. If you are looking at distantly related proteins, you should either choose a high-numbered PAM matrix or a low-numbered BLOSUM matrix. See Bioinformatics Explained on scoring matrices on http: //www.clcbio.com/be/. The default scoring matrix for blastp is BLOSUM62.

12.5.6

Explanation of the BLAST output

The BLAST output comes in different flavors. On the NCBI web page the default output is html, and the following description will use the html output as example. Ordinary text and xml output for easy computational parsing is also available. The default layout of the NCBI BLAST result is a graphical representation of the hits found, a table of sequence identifiers of the hits together with scoring information, and alignments of the query sequence and the hits. The graphical output (shown in figure 12.19) gives a quick overview of the query sequence and the resulting hit sequences. The hits are colored according to the obtained alignment scores. The table view (shown in figure 12.20) provides more detailed information on each hit and furthermore acts as a hyperlink to the corresponding sequence in GenBank. In the alignment view one can manually inspect the individual alignments generated by the BLAST algorithm. This is particularly useful for detailed inspection of the sequence hit found(sbjct) and the corresponding alignment. In the alignment view, all scores are described for each alignment,

CHAPTER 12. BLAST SEARCH

288

Figure 12.19: BLAST graphical view. A simple graphical overview of the hits found aligned to the query sequence. The alignments are color coded ranging from black to red as indicated in the color label at the top.

Figure 12.20: BLAST table view. A table view with one row per hit, showing the accession number and description field from the sequence file together with BLAST output scores. and the start and stop positions for the query and hit sequence are listed. The strand and orientation for query sequence and hits are also found here. In most cases, the table view of the results will be easier to interpret than tens of sequence alignments.

CHAPTER 12. BLAST SEARCH

289

Figure 12.21: Alignment view of BLAST results. Individual alignments are represented together with BLAST scores and more.

12.5.7

I want to BLAST against my own sequence database, is this possible?

It is possible to download the entire BLAST program package and use it on your own computer, institution computer cluster or similar. This is preferred if you want to search in proprietary sequences or sequences unavailable in the public databases stored at NCBI. The downloadable BLAST package can either be installed as a web-based tool or as a command line tool. It is available for a wide range of different operating systems. The BLAST package can be downloaded free of charge from the following location http: //www.ncbi.nlm.nih.gov/BLAST/download.shtml Pre-formatted databases are available from a dedicated BLAST ftp site ftp://ftp.ncbi.nlm. nih.gov/blast/db/. Moreover, it is possible to download programs/scripts from the same site enabling automatic download of changed BLAST databases. Thus it is possible to schedule a nightly update of changed databases and have the updated BLAST database stored locally or on a shared network drive at all times. Most BLAST databases on the NCBI site are updated on a daily basis to include all recent sequence submissions to GenBank. A few commercial software packages are available for searching your own data. The advantage of using a commercial program is obvious when BLAST is integrated with the existing tools of these programs. Furthermore, they let you perform BLAST searches and retain annotations on the query sequence (see figure 12.22). It is also much easier to batch download a selection of hit sequences for further inspection.

CHAPTER 12. BLAST SEARCH

290

Figure 12.22: Snippet of alignment view of BLAST results from CLC Main Workbench. Individual alignments are represented directly in a graphical view. The top sequence is the query sequence and is shown with a selection of annotations.

12.5.8

What you cannot get out of BLAST

Don't expect BLAST to produce the best available alignment. BLAST is a heuristic method which does not guarantee the best results, and therefore you cannot rely on BLAST if you wish to find all the hits in the database. Instead, use the Smith-Waterman algorithm for obtaining the best possible local alignments [Smith and Waterman, 1981]. BLAST only makes local alignments. This means that a great but short hit in another sequence may not at all be related to the query sequence even though the sequences align well in a small region. It may be a domain or similar. It is always a good idea to be cautious of the material in the database. For instance, the sequences may be wrongly annotated; hypothetical proteins are often simple translations of a found ORF on a sequenced nucleotide sequence and may not represent a true protein. Don't expect to see the best result using the default settings. As described above, the settings should be adjusted according to the what kind of query sequence is used, and what kind of results you want. It is a good idea to perform the same BLAST search with different settings to get an idea of how they work. There is not a final answer on how to adjust the settings for your particular sequence.

12.5.9

Other useful resources

The BLAST web page hosted at NCBI http://www.ncbi.nlm.nih.gov/BLAST Download pages for the BLAST programs http://www.ncbi.nlm.nih.gov/BLAST/download.shtml Download pages for pre-formatted BLAST databases ftp://ftp.ncbi.nlm.nih.gov/blast/db/ O'Reilly book on BLAST http://www.oreilly.com/catalog/blast/ Explanation of scoring/substitution matrices and more http://www.clcbio.com/be/

CHAPTER 12. BLAST SEARCH

291

Creative Commons License

All CLC bio's scientific articles are licensed under a Creative Commons Attribution-NonCommercialNoDerivs 2.5 License. You are free to copy, distribute, display, and use the work for educational purposes, under the following conditions: You must attribute the work in its original form and "CLC bio" has to be clearly labeled as author and provider of the work. You may not use this work for commercial purposes. You may not alter, transform, nor build upon this work.

See http://creativecommons.org/licenses/by-nc-nd/2.5/ for more information on how to use the contents.

Chapter 13

3D molecule viewing
Contents
13.1 Importing structure files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 292 13.2 Viewing structure files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 293 13.2.1 13.3.1 13.3.2 Moving and rotating . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 293 Coloring of the 3D structure . . . . . . . . . . . . . . . . . . . . . . . . . 294 Hierarchical view - changing how selections of the structure are displayed 295 13.3 Selections and display of the 3D structure . . . . . . . . . . . . . . . . . . . 294

13.4 3D Output . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 299

In order to understand protein function it is often valuable to see the actual three dimensional structure of the protein. This is of course only possible if the structure of the protein has been resolved and published. CLC Genomics Workbench has an integrated viewer of structure files. Structure files are usually deposited at the Protein DataBank (PDB) www.rcsb.org, where protein structure files can be searched and downloaded.

13.1

Importing structure files

In order to view the three dimensional structure files there are different ways to import these. The supported file formats are PDB and mmCIF which both can be downloaded from the Protein DataBank (http://www.rcsb.org) and imported through the import menu (see section 7.1.1). Another way to import structure files is if a structure file is found through a direct search at the GenBank structure database ( http://www.ncbi.nlm.nih.gov/entrez/query. fcgi?db=Structure). Read more about search for structures in section 11.3. It is also possible to make a BLAST search against the PDB database. In the latter case, structure files can be directly downloaded to the navigation area by clicking the Open structure button below all the BLAST hits. Downloading structure files from a conducted BLAST search is only possible if the results are shown in a BLAST table. (See figure 13.1). How to conduct a BLAST search can be seen in section 12.1.1.

292

CHAPTER 13. 3D MOLECULE VIEWING

293

Figure 13.1: It is possible to open a structure file directly from the output of a conducted BLAST search by clicking the Open Structure button.

13.2

Viewing structure files

An example of a 3D structure is shown in figure 13.2.

Figure 13.2: 3D view. Structure files can be opened, viewed and edited in several ways. Structures can be rotated and moved using the mouse and keyboard. Pan mode ( enabled in order to rotate and move the sequence. ) must be

Note! It is only possible to view one structure file at a time, in order to limit the amount of memory used.

13.2.1

Moving and rotating

Structure files are simply rotated by holding down the left mouse button while moving the mouse. This will rotate the structure in the direction the mouse is moved. The structures can be freely rotated in all directions. Holding down the Ctrl on Windows or on Mac key on the keyboard while dragging the mouse

CHAPTER 13. 3D MOLECULE VIEWING

294

moves the structure in the direction the mouse is moved. This is particularly useful if the view is zoomed to cover only a small region of the protein structure. Zoom in ( ) and zoom out ( ) on the structure is done by selecting the appropriate zoom tool in the toolbar and clicking with the mouse on the view area. Alternatively, click and hold the left mouse button while using either zoom tool and move the mouse up or down to zoom out or in respectively. The view can be restored to display the entire structure by clicking the Fit width ( ) button on the toolbar (read more about zooming in section 3.3). Rotate mode The structure is rotated when the "Pan mode" ( ) is selected in the toolbar. If the "pan mode" is not enabled on the first view of a structure a warning is shown. Zoom mode Use the zoom buttons on the toolbar to enable zoom mode. A single click with the mouse will zoom slightly on the structure. Moreover, it is possible to zoom in and out on the structure by keeping the left mouse button pressed while moving the mouse up and down. Move mode It is possible to move the structure from side to side if the Ctrl key on Windows and on Mac is pressed while dragging with the mouse. key

13.3

Selections and display of the 3D structure

The view of the structure can be changed in several ways. All graphical changes are carried out through the Side Panel. At the top, you can change the default coloring (Default colors and Settings), and at the bottom you can change the representation of specific parts of the structure in order to high-light e.g. an active site.

13.3.1

Coloring of the 3D structure

The default colors apply if nothing else has been specified in the Hierarchical view below (see section 13.3.2): Atom type. Colors the atoms individually. Carbon: Light grey Oxygen: Red Hydrogen: White Nitrogen: Light blue Sulphur: Yellow Chlorine, Boron: Green Phosphorus, Iron, Barium: Orange Sodium: Blue Magnesium: Forest green Zn, Cu, Ni, Br: Brown Ca, Mn, Al, Ti, Cr, Ag: Dark grey

CHAPTER 13. 3D MOLECULE VIEWING F, Si, Au: Goldenrod Iodine: Purple Lithium: firebrick Helium: Pink Other: Deep pink

295

Entities. This will color protein subunits and additional structures individually. Using the view table, the user may select which colors are used to color subunits. Rainbow. This color mode will color the structure with rainbow colors along the sequence. Residue hydrophobicity. Colors the residues according to hydrophobicity. In the Settings group, you can specify the background color to use. Default is black.

13.3.2

Hierarchical view - changing how selections of the structure are displayed

In the bottom of the Side Panel, you see the hierarchical view of the 3D structure (see an example in figure 13.3).

Figure 13.3: Hierarchy view in the Side Panel. The hierarchical view shows the structure in a detailed manner. Individual structure subunits, residues, active sites, disulfide bridges or even down to the atom level can be selected individually and colored accordingly.

CHAPTER 13. 3D MOLECULE VIEWING

296

You can show additional information from the hierarchical view by holding your mouse still for one second (see an example in figure 13.4).

Figure 13.4: Details shown by holding the mouse cursor on a subunit. For each item in the hierarchy view, you can apply special view settings. Simply click an item in the hierarchy view and click the Settings button above. This will display the settings dialog as shown in figure 13.5.

Figure 13.5: Customize appearance.

CHAPTER 13. 3D MOLECULE VIEWING

297

There are four tabs at the top. You can specify settings for each tab and then click OK to apply and close the dialog. You can also click Apply which will keep the settings dialog visible. You will then be able to select another item in the hierarchical view and apply settings for this also. Atoms The Atoms tab is shown in figure 13.5. At the top, you can choose to show atoms, and below you can specify their appearance: Color. Clicking the color box allows you to select a color. Opacity. Determines the level of opacity. Atom size. The size of the atoms measured by vdW radius. Bonds The Bonds tab is shown in figure 13.6.

Figure 13.6: Customize appearance for bonds. At the top, you can choose to show bonds, and below you can specify their appearance: Color. Clicking the color box allows you to select a color. Opacity. Determines the level of opacity. Representations The Representations tab is shown in figure 13.7. At the top, you can choose to between four display models: Secondary structure.

CHAPTER 13. 3D MOLECULE VIEWING

298

Figure 13.7: Customize appearance for representations. Stick model. Both. Displaying both secondary structure and stick model. None. Will not display representations. Color. Clicking the color box allows you to select a color. Opacity. Determines the level of opacity. Models The Models tab is shown in figure 13.8. At the top, you can choose to between three display

Figure 13.8: Customize appearance for models. modes. This functionality is only applicable to NMR structures which have multiple resolved structures, for X-ray structures only one structure is available:

CHAPTER 13. 3D MOLECULE VIEWING Selected model. All models. None. Will not display models. Color. Clicking the color box allows you to select a color. Opacity. Determines the level of opacity.

299

13.4

3D Output

The output of the 3D view is rendered on the screen in real time and changes to the preferences are visible immediately. From CLC Genomics Workbench you can export the visible part of the 3D view to different graphic formats, by pressing the Graphics button ( ) on the Menu bar. This will allow you to export in the following formats: Format Portable Network Graphics JPEG Tagged Image File PostScript Encapsulated PostScript Portable Document Format Scalable Vector Graphics Suffix .png .jpg .tif .ps .eps .pdf .svg Type bitmap bitmap bitmap vector graphics vector graphics vector graphics vector graphics

Printing is not fully implemented with the 3D editor. Should you wish to print a 3D view, this can be done by either exporting to a graphics format and printing that or use the scheme below. Windows: Adjust your 3D view in CLC Genomics Workbench Press Print Screen on your keyboard (or Alt + Print Screen) Paste the result into an 'image editor' e.g. Paint or GIMP http://www.gimp.org/ Crop (edit the screen shot) Save in your preferred file format and/or print Mac: Set up your 3D view Press + shift + 3 (or + shift + 4) (to take screen shot)

Open the saved file (.pdf or .png) in a 'image editor' e.g. GIMP http://www.gimp.org/ Crop (edit the screen shot) Save in your preferred file format and/or print

CHAPTER 13. 3D MOLECULE VIEWING Linux: Set up your 3D view e.g. use GIMP to take the screen shot http://www.gimp.org/ Crop (edit the screen shot) Save in your preferred file format and/or print

300

Chapter 14

General sequence analyses

Contents
14.1 Shuffle sequence . . . . . . . . . . . . . . . . . 14.2 Dot plots . . . . . . . . . . . . . . . . . . . . . . 14.2.1 Create dot plots . . . . . . . . . . . . . . . 14.2.2 View dot plots . . . . . . . . . . . . . . . . 14.2.3 Bioinformatics explained: Dot plots . . . . . 14.2.4 Bioinformatics explained: Scoring matrices 14.3 Local complexity plot . . . . . . . . . . . . . . . 14.4 Sequence statistics . . . . . . . . . . . . . . . . 14.4.1 Bioinformatics explained: Protein statistics 14.5 Join sequences . . . . . . . . . . . . . . . . . . 14.6 Pattern Discovery . . . . . . . . . . . . . . . . . 14.6.1 Pattern discovery search parameters . . . . 14.6.2 Pattern search output . . . . . . . . . . . . 14.7 Motif Search . . . . . . . . . . . . . . . . . . . . 14.7.1 Dynamic motifs . . . . . . . . . . . . . . . 14.7.2 Motif search from the Toolbox . . . . . . . 14.7.3 Java regular expressions . . . . . . . . . . 14.7.4 Create motif list . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 301 303 303 305 306 310 313 314 317 320 322 322 323 324 324 325 328 329

CLC Genomics Workbench offers different kinds of sequence analyses, which apply to both protein and DNA. The analyses are described in this chapter.

14.1

Shuffle sequence

In some cases, it is beneficial to shuffle a sequence. This is an option in the Toolbox menu under General Sequence Analyses. It is normally used for statistical analyses, e.g. when comparing an alignment score with the distribution of scores of shuffled sequences. Shuffling a sequence removes all annotations that relate to the residues. select sequence | Toolbox in the Menu Bar | General Sequence Analyses ( Shuffle Sequence ( ) 301 ) |

CHAPTER 14. GENERAL SEQUENCE ANALYSES or right-click a sequence | Toolbox | General Sequence Analyses ( Sequence ( ) This opens the dialog displayed in figure 14.1: ) | Shuffle

302

Figure 14.1: Choosing sequence for shuffling. If a sequence was selected before choosing the Toolbox action, this sequence is now listed in the Selected Elements window of the dialog. Use the arrows to add or remove sequences or sequence lists from the selected elements. Click Next to determine how the shuffling should be performed. In this step, shown in figure 14.2: For nucleotides, the following parameters can be set:

Figure 14.2: Parameters for shuffling. Mononucleotide shuffling. Shuffle method generating a sequence of the exact same mononucleotide frequency Dinucleotide shuffling. Shuffle method generating a sequence of the exact same dinucleotide frequency Mononucleotide sampling from zero order Markov chain. Resampling method generating a sequence of the same expected mononucleotide frequency.

CHAPTER 14. GENERAL SEQUENCE ANALYSES

303

Dinucleotide sampling from first order Markov chain. Resampling method generating a sequence of the same expected dinucleotide frequency. For proteins, the following parameters can be set: Single amino acid shuffling. Shuffle method generating a sequence of the exact same amino acid frequency. Single amino acid sampling from zero order Markov chain. Resampling method generating a sequence of the same expected single amino acid frequency. Dipeptide shuffling. Shuffle method generating a sequence of the exact same dipeptide frequency. Dipeptide sampling from first order Markov chain. Resampling method generating a sequence of the same expected dipeptide frequency. For further details of these algorithms, see [Clote et al., 2005]. In addition to the shuffle method, you can specify the number of randomized sequences to output. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. This will open a new view in the View Area displaying the shuffled sequence. The new sequence is not saved automatically. To save the sequence, drag it into the Navigation Area or press ctrl + S ( + S on Mac) to activate a save dialog.

14.2

Dot plots

Dot plots provide a powerful visual comparison of two sequences. Dot plots can also be used to compare regions of similarity within a sequence. This chapter first describes how to create and second how to adjust the view of the plot.

14.2.1

Create dot plots

A dot plot is a simple, yet intuitive way of comparing two sequences, either DNA or protein, and is probably the oldest way of comparing two sequences [Maizel and Lenk, 1981]. A dot plot is a 2 dimensional matrix where each axis of the plot represents one sequence. By sliding a fixed size window over the sequences and making a sequence match by a dot in the matrix, a diagonal line will emerge if two identical (or very homologous) sequences are plotted against each other. Dot plots can also be used to visually inspect sequences for direct or inverted repeats or regions with low sequence complexity. Various smoothing algorithms can be applied to the dot plot calculation to avoid noisy background of the plot. Moreover, can various substitution matrices be applied in order to take the evolutionary distance of the two sequences into account. To create a dot plot: Toolbox | General Sequence Analyses ( ) | Create Dot Plot ( )

or Select one or two sequences in the Navigation Area | Toolbox in the Menu Bar | General Sequence Analyses ( ) | Create Dot Plot ( )

CHAPTER 14. GENERAL SEQUENCE ANALYSES or Select one or two sequences in the Navigation Area | right-click in the Navigation Area | Toolbox | General Sequence Analyses ( ) | Create Dot Plot ( ) This opens the dialog shown in figure 14.3.

304

Figure 14.3: Selecting sequences for the dot plot. If a sequence was selected before choosing the Toolbox action, this sequence is now listed in the Selected Elements window of the dialog. Use the arrows to add or remove elements from the selected elements. Click Next to adjust dot plot parameters. Clicking Next opens the dialog shown in figure 14.4. Notice! Calculating dot plots take up a considerable amount of memory in the computer. Therefore, you see a warning if the sum of the number of nucleotides/amino acids in the sequences is higher than 8000. If you insist on calculating a dot plot with more residues the Workbench may shut down, allowing you to save your work first. However, this depends on your computer's memory configuration. Adjust dot plot parameters There are two parameters for calculating the dot plot: Distance correction (only valid for protein sequences) In order to treat evolutionary transitions of amino acids, a distance correction measure can be used when calculating the dot plot. These distance correction matrices (substitution matrices) take into account the likeliness of one amino acid changing to another. Window size A residue by residue comparison (window size = 1) would undoubtedly result in a very noisy background due to a lot of similarities between the two sequences of interest. For DNA sequences the background noise will be even more dominant as a match between only four nucleotide is very likely to happen. Moreover, a residue by residue comparison (window size = 1) can be very time consuming and computationally demanding. Increasing the window size will make the dot plot more 'smooth'. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish.

CHAPTER 14. GENERAL SEQUENCE ANALYSES

305

Figure 14.4: Setting the dot plot parameters.

14.2.2

View dot plots

) in the Toolbar and

A view of a dot plot can be seen in figure 14.5. You can select Zoom in ( click the dot plot to zoom in to see the details of particular areas.

Figure 14.5: A view is opened showing the dot plot. The Side Panel to the right let you specify the dot plot preferences. The gradient color box can be adjusted to get the appropriate result by dragging the small pointers at the top of the box. Moving the slider from the right to the left lowers the thresholds which can be directly seen in the dot plot, where more diagonal lines will emerge. You can also choose another color gradient by clicking on the gradient box and choose from the list. Adjusting the sliders above the gradient box is also practical, when producing an output for printing. (Too much background color might not be desirable). By crossing one slider over the other (the two sliders change side) the colors are inverted, allowing for a white background. (If you choose a color gradient, which includes white). Se figure 14.5.

CHAPTER 14. GENERAL SEQUENCE ANALYSES

306

Figure 14.6: Dot plot with inverted colors, practical for printing.

14.2.3

Bioinformatics explained: Dot plots

Realization of dot plots Dot plots are two-dimensional plots where the x-axis and y-axis each represents a sequence and the plot itself shows a comparison of these two sequences by a calculated score for each position of the sequence. If a window of fixed size on one sequence (one axis) match to the other sequence a dot is drawn at the plot. Dot plots are one of the oldest methods for comparing two sequences [Maizel and Lenk, 1981]. The scores that are drawn on the plot are affected by several issues. Scoring matrix for distance correction. Scoring matrices (BLOSUM and PAM) contain substitution scores for every combination of two amino acids. Thus, these matrices can only be used for dot plots of protein sequences. Window size The single residue comparison (bit by bit comparison(window size = 1)) in dot plots will undoubtedly result in a noisy background of the plot. You can imagine that there are many successes in the comparison if you only have four possible residues like in nucleotide sequences. Therefore you can set a window size which is smoothing the dot plot. Instead of comparing single residues it compares subsequences of length set as window size. The score is now calculated with respect to aligning the subsequences. Threshold The dot plot shows the calculated scores with colored threshold. Hence you can better recognize the most important similarities. Examples and interpretations of dot plots Contrary to simple sequence alignments dot plots can be a very useful tool for spotting various evolutionary events which may have happened to the sequences of interest.

CHAPTER 14. GENERAL SEQUENCE ANALYSES

307

Below is shown some examples of dot plots where sequence insertions, low complexity regions, inverted repeats etc. can be identified visually. Similar sequences The most simple example of a dot plot is obtained by plotting two homologous sequences of interest. If very similar or identical sequences are plotted against each other a diagonal line will occur. The dot plot in figure 14.7 shows two related sequences of the Influenza A virus nucleoproteins infecting ducks and chickens. Accession numbers from the two sequences are: DQ232610 and DQ023146. Both sequences can be retrieved directly from http://www.ncbi.nlm.nih. gov/gquery/gquery.fcgi.

Figure 14.7: Dot plot of DQ232610 vs. DQ023146 (Influenza A virus nucleoproteins) showing and overall similarity Repeated regions Sequence repeats can also be identified using dot plots. A repeat region will typically show up as lines parallel to the diagonal line. If the dot plot shows more than one diagonal in the same region of a sequence, the regions depending to the other sequence are repeated. In figure 14.9 you can see a sequence with repeats.

CHAPTER 14. GENERAL SEQUENCE ANALYSES

308

Figure 14.8: Direct and inverted repeats shown on an amino acid sequence generated for demonstration purposes.

Figure 14.9: The dot plot of a sequence showing repeated elements. See also figure 14.8. Frame shifts Frame shifts in a nucleotide sequence can occur due to insertions, deletions or mutations. Such frame shifts can be visualized in a dot plot as seen in figure 14.10. In this figure, three frame shifts for the sequence on the y-axis are found. 1. Deletion of nucleotides 2. Insertion of nucleotides 3. Mutation (out of frame) Sequence inversions

CHAPTER 14. GENERAL SEQUENCE ANALYSES

309

Figure 14.10: This dot plot show various frame shifts in the sequence. See text for details. In dot plots you can see an inversion of sequence as contrary diagonal to the diagonal showing similarity. In figure 14.11 you can see a dot plot (window length is 3) with an inversion. Low-complexity regions Low-complexity regions in sequences can be found as regions around the diagonal all obtaining a high score. Low complexity regions are calculated from the redundancy of amino acids within a limited region [Wootton and Federhen, 1993]. These are most often seen as short regions of only a few different amino acids. In the middle of figure 14.12 is a square shows the low-complexity region of this sequence. Creative Commons License All CLC bio's scientific articles are licensed under a Creative Commons Attribution-NonCommercialNoDerivs 2.5 License. You are free to copy, distribute, display, and use the work for educational purposes, under the following conditions: You must attribute the work in its original form and "CLC bio" has to be clearly labeled as author and provider of the work. You may not use this work for commercial purposes. You may not alter, transform, nor build upon this work.

CHAPTER 14. GENERAL SEQUENCE ANALYSES

310

Figure 14.11: The dot plot showing a inversion in a sequence. See also figure 14.8.

See http://creativecommons.org/licenses/by-nc-nd/2.5/ for more information on how to use the contents.

14.2.4

Bioinformatics explained: Scoring matrices

Biological sequences have evolved throughout time and evolution has shown that not all changes to a biological sequence is equally likely to happen. Certain amino acid substitutions (change of one amino acid to another) happen often, whereas other substitutions are very rare. For instance, tryptophan (W) which is a relatively rare amino acid, will only --- on very rare occasions --- mutate into a leucine (L). Based on evolution of proteins it became apparent that these changes or substitutions of amino acids can be modeled by a scoring matrix also refereed to as a substitution matrix. See an example of a scoring matrix in table 14.1. This matrix lists the substitution scores of every single amino acid. A score for an aligned amino acid pair is found at the intersection of the corresponding column and row. For example, the substitution score from an arginine (R) to a lysine (K) is 2. The diagonal show scores for amino acids which have not changed. Most substitutions changes have a negative score. Only rounded numbers are found in this matrix. The two most used matrices are the BLOSUM [Henikoff and Henikoff, 1992] and PAM [Dayhoff and Schwartz, 1978].

CHAPTER 14. GENERAL SEQUENCE ANALYSES

311

Figure 14.12: The dot plot showing a low-complexity region in the sequence. The sequence is artificial and low complexity regions does not always show as a square. Different scoring matrices PAM The first PAM matrix (Point Accepted Mutation) was published in 1978 by Dayhoff et al. The PAM matrix was build through a global alignment of related sequences all having sequence similarity above 85% [Dayhoff and Schwartz, 1978]. A PAM matrix shows the probability that any given amino acid will mutate into another in a given time interval. As an example, PAM1 gives that one amino acid out of a 100 will mutate in a given time interval. In the other end of the scale, a PAM256 matrix, gives the probability of 256 mutations in a 100 amino acids (see figure 14.13). There are some limitation to the PAM matrices which makes the BLOSUM matrices somewhat more attractive. The dataset on which the initial PAM matrices were build is very old by now, and the PAM matrices assume that all amino acids mutate at the same rate - this is not a correct assumption. BLOSUM In 1992, 14 years after the PAM matrices were published, the BLOSUM matrices (BLOcks SUbstitution Matrix) were developed and published [Henikoff and Henikoff, 1992]. Henikoff et al. wanted to model more divergent proteins, thus they used locally aligned sequences where none of the aligned sequences share less than 62% identity. This resulted

CHAPTER 14. GENERAL SEQUENCE ANALYSES

A 4 -1 -2 -2 0 -1 -1 0 -2 -1 -1 -1 -1 -2 -1 1 0 -3 -2 0 R -1 5 0 -2 -3 1 0 -2 0 -3 -2 2 -1 -3 -2 -1 -1 -3 -2 -3 N -2 0 6 1 -3 0 0 0 1 -3 -3 0 -2 -3 -2 1 0 -4 -2 -3 D -2 -2 1 6 -3 0 2 -1 -1 -3 -4 -1 -3 -3 -1 0 -1 -4 -3 -3 C 0 -3 -3 -3 9 -3 -4 -3 -3 -1 -1 -3 -1 -2 -3 -1 -1 -2 -2 -1 Q -1 1 0 0 -3 5 2 -2 0 -3 -2 1 0 -3 -1 0 -1 -2 -1 -2 E -1 0 0 2 -4 2 5 -2 0 -3 -3 1 -2 -3 -1 0 -1 -3 -2 -2 G 0 -2 0 -1 -3 -2 -2 6 -2 -4 -4 -2 -3 -3 -2 0 -2 -2 -3 -3 H -2 0 1 -1 -3 0 0 -2 8 -3 -3 -1 -2 -1 -2 -1 -2 -2 2 -3 I -1 -3 -3 -3 -1 -3 -3 -4 -3 4 2 -3 1 0 -3 -2 -1 -3 -1 3 L -1 -2 -3 -4 -1 -2 -3 -4 -3 2 4 -2 2 0 -3 -2 -1 -2 -1 1 K -1 2 0 -1 -3 1 1 -2 -1 -3 -2 5 -1 -3 -1 0 -1 -3 -2 -2 M -1 -1 -2 -3 -1 0 -2 -3 -2 1 2 -1 5 0 -2 -1 -1 -1 -1 1 F -2 -3 -3 -3 -2 -3 -3 -3 -1 0 0 -3 0 6 -4 -2 -2 1 3 -1 P -1 -2 -2 -1 -3 -1 -1 -2 -2 -3 -3 -1 -2 -4 7 -1 -1 -4 -3 -2 S 1 -1 1 0 -1 0 0 0 -1 -2 -2 0 -1 -2 -1 4 1 -3 -2 -2 T 0 -1 0 -1 -1 -1 -1 -2 -2 -1 -1 -1 -1 -2 -1 1 5 -2 -2 0 W -3 -3 -4 -4 -2 -2 -3 -2 -2 -3 -2 -3 -1 1 -4 -3 -2 11 2 -3 Y -2 -2 -2 -3 -2 -1 -2 -3 2 -1 -1 -2 -1 3 -3 -2 -2 2 7 -1

312
V 0 -3 -3 -3 -1 -2 -2 -3 -3 3 1 -2 1 -1 -2 -2 0 -3 -1 4

A R N D C Q E G H I L K M F P S T W Y V

Table 14.1: The BLOSUM62 matrix. A tabular view of the BLOSUM62 matrix containing all possible substitution scores [Henikoff and Henikoff, 1992]. in a scoring matrix called BLOSUM62. In contrast to the PAM matrices the BLOSUM matrices are calculated from alignments without gaps emerging from the BLOCKS database http: //blocks.fhcrc.org/. Sean Eddy recently wrote a paper reviewing the BLOSUM62 substitution matrix and how to calculate the scores [Eddy, 2004]. Use of scoring matrices Deciding which scoring matrix you should use in order of obtain the best alignment results is a difficult task. If you have no prior knowledge on the sequence the BLOSUM62 is probably the best choice. This matrix has become the de facto standard for scoring matrices and is also used as the default matrix in BLAST searches. The selection of a "wrong" scoring matrix will most probable strongly influence on the outcome of the analysis. In general a few rules apply to the selection of scoring matrices. For closely related sequences choose BLOSUM matrices created for highly similar alignments, like BLOSUM80. You can also select low PAM matrices such as PAM1. For distant related sequences, select low BLOSUM matrices (for example BLOSUM45) or high PAM matrices such as PAM250. The BLOSUM matrices with low numbers correspond to PAM matrices with high numbers. (See figure 14.13) for correlations between the PAM and BLOSUM matrices. To summarize, if you want to find distant related proteins to a sequence of interest using BLAST, you could benefit of using BLOSUM45 or similar matrices. Other useful resources

CHAPTER 14. GENERAL SEQUENCE ANALYSES

313

Figure 14.13: Relationship between scoring matrices. The BLOSUM62 has become a de facto standard scoring matrix for a wide range of alignment programs. It is the default matrix in BLAST. Calculate your own PAM matrix http://www.bioinformatics.nl/tools/pam.html BLOKS database http://blocks.fhcrc.org/ NCBI help site http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/Scoring2.html Creative Commons License All CLC bio's scientific articles are licensed under a Creative Commons Attribution-NonCommercialNoDerivs 2.5 License. You are free to copy, distribute, display, and use the work for educational purposes, under the following conditions: You must attribute the work in its original form and "CLC bio" has to be clearly labeled as author and provider of the work. You may not use this work for commercial purposes. You may not alter, transform, nor build upon this work.

See http://creativecommons.org/licenses/by-nc-nd/2.5/ for more information on how to use the contents.

14.3

Local complexity plot

In CLC Genomics Workbench it is possible to calculate local complexity for both DNA and protein sequences. The local complexity is a measure of the diversity in the composition of amino acids within a given range (window) of the sequence. The K2 algorithm is used for calculating local complexity [Wootton and Federhen, 1993]. To conduct a complexity calculation do the following: Select sequences in Navigation Area | Toolbox in Menu Bar | General Sequence Analyses ( ) | Create Complexity Plot ( ) This opens a dialog. In Step 1 you can change, remove and add DNA and protein sequences. When the relevant sequences are selected, clicking Next takes you to Step 2. This step allows you to adjust the window size from which the complexity plot is calculated. Default is set to 11 amino acids and the number should always be odd. The higher the number, the less volatile the graph. Figure 14.14 shows an example of a local complexity plot.

CHAPTER 14. GENERAL SEQUENCE ANALYSES

314

Figure 14.14: An example of a local complexity plot. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. The values of the complexity plot approaches 1.0 as the distribution of amino acids become more complex. See section B in the appendix for information about the graph view.

14.4

Sequence statistics

CLC Genomics Workbench can produce an output with many relevant statistics for protein sequences. Some of the statistics are also relevant to produce for DNA sequences. Therefore, this section deals with both types of statistics. The required steps for producing the statistics are the same. To create a statistic for the sequence, do the following: select sequence(s) | Toolbox in the Menu Bar | General Sequence Analyses ( Create Sequence Statistics ( ) )|

This opens a dialog where you can alter your choice of sequences which you want to create statistics for. You can also add sequence lists. Note! You cannot create statistics for DNA and protein sequences at the same time. When the sequences are selected, click Next. This opens the dialog displayed in figure 14.15. The dialog offers to adjust the following parameters: Individual statistics layout. If more sequences were selected in Step 1, this function generates separate statistics for each sequence. Comparative statistics layout. If more sequences were selected in Step 1, this function

CHAPTER 14. GENERAL SEQUENCE ANALYSES

315

Figure 14.15: Setting parameters for the sequence statistics. generates statistics with comparisons between the sequences. You can also choose to include Background distribution of amino acids. If this box is ticked, an extra column with amino acid distribution of the chosen species, is included in the table output. (The distributions are calculated from UniProt www.uniprot.org version 6.0, dated September 13 2005.) Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. An example of protein sequence statistics is shown in figure 14.16.

Figure 14.16: Comparative sequence statistics. Nucleotide sequence statistics are generated using the same dialog as used for protein sequence statistics. However, the output of Nucleotide sequence statistics is less extensive than that of the protein sequence statistics. Note! The headings of the tables change depending on whether you calculate 'individual' or 'comparative' sequence statistics. The output of comparative protein sequence statistics include: Sequence information: Sequence type

CHAPTER 14. GENERAL SEQUENCE ANALYSES Length Organism Name Description Modification Date

316

Weight. This is calculated like this: sumunitsinsequence (weight(unit)) links weight(H2O) where links is the sequence length minus one and units are amino acids. The atomic composition is defined the same way. Isoelectric point Aliphatic index Half-life Extinction coefficient Counts of Atoms Frequency of Atoms Count of hydrophobic and hydrophilic residues Frequencies of hydrophobic and hydrophilic residues Count of charged residues Frequencies of charged residues Amino acid distribution Histogram of amino acid distribution Annotation table Counts of di-peptides Frequency of di-peptides The output of nucleotide sequence statistics include: General statistics: Sequence type Length Organism Name Description Modification Date

CHAPTER 14. GENERAL SEQUENCE ANALYSES

317

Weight. This is calculated like this: sumunitsinsequence (weight(unit)) links weight(H2O) where links is the sequence length minus one for linear sequences and sequence length for circular molecules. The units are monophosphates. Both the weight for single- and double stranded molecules are includes. The atomic composition is defined the same way. Atomic composition Nucleotide distribution table Nucleotide distribution histogram Annotation table Counts of di-nucleotides Frequency of di-nucleotides A short description of the different areas of the statistical output is given in section 14.4.1.

14.4.1

Bioinformatics explained: Protein statistics

Every protein holds specific and individual features which are unique to that particular protein. Features such as isoelectric point or amino acid composition can reveal important information of a novel protein. Many of the features described below are calculated in a simple way. Molecular weight The molecular weight is the mass of a protein or molecule. The molecular weight is simply calculated as the sum of the atomic mass of all the atoms in the molecule. The weight of a protein is usually represented in Daltons (Da). A calculation of the molecular weight of a protein does not usually include additional posttranslational modifications. For native and unknown proteins it tends to be difficult to assess whether posttranslational modifications such as glycosylations are present on the protein, making a calculation based solely on the amino acid sequence inaccurate. The molecular weight can be determined very accurately by mass-spectrometry in a laboratory. Isoelectric point The isoelectric point (pI) of a protein is the pH where the proteins has no net charge. The pI is calculated from the pKa values for 20 different amino acids. At a pH below the pI, the protein carries a positive charge, whereas if the pH is above pI the proteins carry a negative charge. In other words, pI is high for basic proteins and low for acidic proteins. This information can be used in the laboratory when running electrophoretic gels. Here the proteins can be separated, based on their isoelectric point. Aliphatic index The aliphatic index of a protein is a measure of the relative volume occupied by aliphatic side chain of the following amino acids: alanine, valine, leucine and isoleucine. An increase in the

CHAPTER 14. GENERAL SEQUENCE ANALYSES Amino acid Ala (A) Cys (C) Asp (D) Glu (E) Phe (F) Gly (G) His (H) Ile (I) Lys (K) Leu (L) Met (M) Asn (N) Pro (P) Gln (Q) Arg (R) Ser (S) Thr (T) Val (V) Trp (W) Tyr (Y) Mammalian 4.4 hour 1.2 hours 1.1 hours 1 hour 1.1 hours 30 hours 3.5 hours 20 hours 1.3 hours 5.5 hours 30 hours 1.4 hours >20 hours 0.8 hour 1 hour 1.9 hours 7.2 hours 100 hours 2.8 hours 2.8 hours Yeast >20 hours >20 hours 3 min 30 min 3 min >20 hours 10 min 30 min 3 min 3 min >20 hours 3 min >20 hours 10 min 2 min >20 hours >20 hours >20 hours 3 min 10 min

318 E. coli >10 hours >10 hours >10 hours >10 hours 2 min >10 hours >10 hours >10 hours 2 min 2 min >10 hours >10 hours ? >10 hours 2 min >10 hours >10 hours >10 hours 2 min 2 min

Table 14.2: Estimated half life. Half life of proteins where the N-terminal residue is listed in the first column and the half-life in the subsequent columns for mammals, yeast and E. coli. aliphatic index increases the thermostability of globular proteins. The index is calculated by the following formula. Aliphaticindex = X(Ala) + a X(V al) + b X(Leu) + b (X)Ile X(Ala), X(Val), X(Ile) and X(Leu) are the amino acid compositional fractions. The constants a and b are the relative volume of valine (a=2.9) and leucine/isoleucine (b=3.9) side chains compared to the side chain of alanine [Ikai, 1980]. Estimated half-life The half life of a protein is the time it takes for the protein pool of that particular protein to be reduced to the half. The half life of proteins is highly dependent on the presence of the N-terminal amino acid, thus overall protein stability [Bachmair et al., 1986, Gonda et al., 1989, Tobias et al., 1991]. The importance of the N-terminal residues is generally known as the 'N-end rule'. The N-end rule and consequently the N-terminal amino acid, simply determines the half-life of proteins. The estimated half-life of proteins have been investigated in mammals, yeast and E. coli (see Table 14.2). If leucine is found N-terminally in mammalian proteins the estimated half-life is 5.5 hours. Extinction coefficient This measure indicates how much light is absorbed by a protein at a particular wavelength. The extinction coefficient is measured by UV spectrophotometry, but can also be calculated. The

CHAPTER 14. GENERAL SEQUENCE ANALYSES

319

amino acid composition is important when calculating the extinction coefficient. The extinction coefficient is calculated from the absorbance of cysteine, tyrosine and tryptophan using the following equation: Ext(P rotein) = count(Cystine)Ext(Cystine)+count(T yr)Ext(T yr)+count(T rp)Ext(T rp) where Ext is the extinction coefficient of amino acid in question. At 280nm the extinction coefficients are: Cys=120, Tyr=1280 and Trp=5690. This equation is only valid under the following conditions: pH 6.5 6.0 M guanidium hydrochloride 0.02 M phosphate buffer The extinction coefficient values of the three important amino acids at different wavelengths are found in [Gill and von Hippel, 1989]. Knowing the extinction coefficient, the absorbance (optical density) can be calculated using the following formula: Absorbance(P rotein) = Ext(P rotein) M olecular weight

Two values are reported. The first value is computed assuming that all cysteine residues appear as half cystines, meaning they form di-sulfide bridges to other cysteines. The second number assumes that no di-sulfide bonds are formed. Atomic composition Amino acids are indeed very simple compounds. All 20 amino acids consist of combinations of only five different atoms. The atoms which can be found in these simple structures are: Carbon, Nitrogen, Hydrogen, Sulfur, Oxygen. The atomic composition of a protein can for example be used to calculate the precise molecular weight of the entire protein. Total number of negatively charged residues (Asp+Glu) At neutral pH, the fraction of negatively charged residues provides information about the location of the protein. Intracellular proteins tend to have a higher fraction of negatively charged residues than extracellular proteins. Total number of positively charged residues (Arg+Lys) At neutral pH, nuclear proteins have a high relative percentage of positively charged amino acids. Nuclear proteins often bind to the negatively charged DNA, which may regulate gene expression or help to fold the DNA. Nuclear proteins often have a low percentage of aromatic residues [Andrade et al., 1998].

CHAPTER 14. GENERAL SEQUENCE ANALYSES Amino acid distribution

320

Amino acids are the basic components of proteins. The amino acid distribution in a protein is simply the percentage of the different amino acids represented in a particular protein of interest. Amino acid composition is generally conserved through family-classes in different organisms which can be useful when studying a particular protein or enzymes across species borders. Another interesting observation is that amino acid composition variate slightly between proteins from different subcellular localizations. This fact has been used in several computational methods, used for prediction of subcellular localization. Annotation table This table provides an overview of all the different annotations associated with the sequence and their incidence. Dipeptide distribution This measure is simply a count, or frequency, of all the observed adjacent pairs of amino acids (dipeptides) found in the protein. It is only possible to report neighboring amino acids. Knowledge on dipeptide composition have previously been used for prediction of subcellular localization. Creative Commons License All CLC bio's scientific articles are licensed under a Creative Commons Attribution-NonCommercialNoDerivs 2.5 License. You are free to copy, distribute, display, and use the work for educational purposes, under the following conditions: You must attribute the work in its original form and "CLC bio" has to be clearly labeled as author and provider of the work. You may not use this work for commercial purposes. You may not alter, transform, nor build upon this work.

See http://creativecommons.org/licenses/by-nc-nd/2.5/ for more information on how to use the contents.

14.5

Join sequences

CLC Genomics Workbench can join several nucleotide or protein sequences into one sequence. This feature can for example be used to construct "supergenes" for phylogenetic inference by joining several disjoint genes into one. Note, that when sequences are joined, all their annotations are carried over to the new spliced sequence. Two (or more) sequences can be joined by: select sequences to join | Toolbox in the Menu Bar | General Sequence Analyses | Join sequences ( ) or select sequences to join | right-click any selected sequence | Toolbox | General Sequence Analyses | Join sequences ( ) This opens the dialog shown in figure 14.17.

CHAPTER 14. GENERAL SEQUENCE ANALYSES

321

Figure 14.17: Selecting two sequences to be joined. If you have selected some sequences before choosing the Toolbox action, they are now listed in the Selected Elements window of the dialog. Use the arrows to add or remove sequences from the selected elements. Click Next opens the dialog shown in figure 14.18.

Figure 14.18: Setting the order in which sequences are joined. In step 2 you can change the order in which the sequences will be joined. Select a sequence and use the arrows to move the selected sequence up or down. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. The result is shown in figure 14.19.

Figure 14.19: The result of joining sequences is a new sequence containing the annotations of the joined sequences (they each had a HBB annotation).

CHAPTER 14. GENERAL SEQUENCE ANALYSES

322

14.6

Pattern Discovery

With CLC Genomics Workbench you can perform pattern discovery on both DNA and protein sequences. Advanced hidden Markov models can help to identify unknown sequence patterns across single or even multiple sequences. In order to search for unknown patterns: Select DNA or protein sequence(s) | Toolbox in the Menu Bar | General Sequence Analyses ( ) | Pattern Discovery ( ) or right-click DNA or protein sequence(s) | Toolbox | General Sequence Analyses ( | Pattern Discovery ( ) )

If a sequence was selected before choosing the Toolbox action, the sequence is now listed in the Selected Elements window of the dialog. Use the arrows to add or remove sequences or sequence lists from the selected elements. You can perform the analysis on several DNA or several protein sequences at a time. If the analysis is performed on several sequences at a time the method will search for patterns which is common between all the sequences. Annotations will be added to all the sequences and a view is opened for each sequence. Click Next to adjust parameters (see figure 14.20).

Figure 14.20: Setting parameters for the pattern discovery. See text for details. In order to search unknown sequences with an already existing model: Select to use an already existing model which is seen in figure 14.20. Models are represented with the following icon in the navigation area ( ).

14.6.1

Pattern discovery search parameters

Various parameters can be set prior to the pattern discovery. The parameters are listed below and a screen shot of the parameter settings can be seen in figure 14.20. Create and search with new model. This will create a new HMM model based on the selected sequences. The found model will be opened after the run and presented in a table

CHAPTER 14. GENERAL SEQUENCE ANALYSES view. It can be saved and used later if desired.

323

Use existing model. It is possible to use already created models to search for the same pattern in new sequences. Minimum pattern length. Here, the minimum length of patterns to search for, can be specified. Maximum pattern length. Here, the maximum length of patterns to search for, can be specified. Noise (%). Specify noise-level of the model. This parameter has influence on the level of degeneracy of patterns in the sequence(s). The noise parameter can be 1,2,5 or 10 percent. Number of different kinds of patterns to predict. Number of iterations the algorithm goes through. After the first iteration, we force predicted pattern-positions in the first run to be member of the background: In that way, the algorithm finds new patterns in the second iteration. Patterns marked 'Pattern1' have the highest confidence. The maximal iterations to go through is 3. Include background distribution. For protein sequences it is possible to include information on the background distribution of amino acids from a range of organisms. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. This will open a view showing the patterns found as annotations on the original sequence (see figure 14.21). If you have selected several sequences, a corresponding number of views will be opened.

Figure 14.21: Sequence view displaying two discovered patterns.

14.6.2

Pattern search output

If the analysis is performed on several sequences at a time the method will search for patterns in the sequences and open a new view for each of the sequences, in which a pattern was discovered. Each novel pattern will be represented as an annotation of the type Region. More information on each found pattern is available through the tool-tip, including detailed information on the position of the pattern and quality scores. It is also possible to get a tabular view of all found patterns in one combined table. Then each found pattern will be represented with various information on obtained scores, quality of the pattern and position in the sequence. A table view of emission values of the actual used HMM model is presented in a table view. This model can be saved and used to search for a similar pattern in new or unknown sequences.

CHAPTER 14. GENERAL SEQUENCE ANALYSES

324

14.7

Motif Search

CLC Genomics Workbench offers advanced and versatile options to search for known motifs represented either by a simple sequence or a more advanced regular expression. These advanced search capabilities are available for use in both DNA and protein sequences. There are two ways to access this functionality: When viewing sequences, it is possible to have motifs calculated and shown on the sequence in a similar way as restriction sites (see section 21.3.1). This approach is called Dynamic motifs and is an easy way to spot known sequence motifs when working with sequences for cloning etc. For more refined and systematic search for motifs can be performed through the Toolbox. This will generate a table and optionally add annotations to the sequences. The two approaches are described below.

14.7.1

Dynamic motifs

In the Side Panel of sequence views, there is a group called Motifs (see figure 14.22).

Figure 14.22: Dynamic motifs in the Side Panel. The Workbench will look for the listed motifs in the sequence that is open and by clicking the check box next to the motif it will be shown in the view as illustrated in figure 14.23. This case shows the CMV promoter primer sequence which is one of the pre-defined motifs in CLC Genomics Workbench. The motif is per default shown as a faded arrow with no text. The direction of the arrow indicates the strand of the motif. Placing the mouse cursor on the arrow will display additional information about the motif as illustrated in figure 14.24.

CHAPTER 14. GENERAL SEQUENCE ANALYSES

325

Figure 14.23: Showing dynamic motifs on the sequence.

Figure 14.24: Showing dynamic motifs on the sequence. To add Labels to the motif, select the Flag or Stacked option. They will put the name of the motif as a flag above the sequence. The stacked option will stack the labels when there is more than one motif so that all labels are shown. Below the labels option there are two options for controlling the way the sequence should be searched for motifs: Include reverse motifs. This will also find motifs on the negative strand (only available for nucleotide sequences) Exclude unknown regions. The motif search handles ambiguous characters in the way that two residues are different if they do not have any residues in common. For example: For nucleotides, N matches any character and R matches A,G. For proteins, X matches any character and Z matches E,Q. Genome sequence often have large regions with unknown sequence. These regions are very often padded with N's. Ticking this checkbox will not display hits found in N-regions. The list of motifs shown in figure 14.22 is a pre-defined list that is included with the CLC Genomics Workbench. You can define your own set of motifs to use instead. In order to do this, you first need to create a Motif list ( ) (see section 14.7.4) and then click the Manage Motifs button. This will bring up the dialog shown in figure 14.25. At the top, select a motif list by clicking the Browse ( ) button. When the motif list is selected, its motifs are listed in the panel in the left-hand side of the dialog. The right-hand side panel contains the motifs that will be listed in the Side Panel when you click Finish.

14.7.2

Motif search from the Toolbox

The dynamic motifs described in section 14.7.1 provide a quick way of routinely scanning a sequence for commonly used motifs, but in some cases a more systematic approach is needed. The motif search in the Toolbox provides an option to search for motifs with a user-specified similarity to the target sequence, and furthermore the motifs found can be displayed in an overview table. This is particularly useful when searching for motifs on many sequences. To start the Toolbox motif search: Toolbox | General Sequence Analyses ( ) | Motif Search ( )

CHAPTER 14. GENERAL SEQUENCE ANALYSES

326

Figure 14.25: Managing the motifs to be shown. Use the arrows to add or remove sequences or sequence lists from the selected elements. You can perform the analysis on several DNA or several protein sequences at a time. If the analysis is performed on several sequences at a time the method will search for patterns in the sequences and create an overview table of the motifs found in all sequences. Click Next to adjust parameters (see figure 14.26).

Figure 14.26: Setting parameters for the motif search. The options for the motif search are: Motif types. Choose what kind of motif to be used: Simple motif. Choosing this option means that you enter a simple motif, e.g. ATGATGNNATG. Java regular expression. See section 14.7.3. Prosite regular expression. For proteins, you can enter different protein patterns from the PROSITE database (protein patterns using regular expressions and describing

CHAPTER 14. GENERAL SEQUENCE ANALYSES

327

specific amino acid sequences). The PROSITE database contains a great number of patterns and have been used to identify related proteins (see http://www.expasy. org/cgi-bin/prosite-list.pl). Use motif list. Clicking the small button ( (see section 14.7.4). ) will allow you to select a saved motif list

Motif. If you choose to search with a simple motif, you should enter a literal string as your motif. Ambiguous amino acids and nucleotides are allowed. Example; ATGATGNNATG. If your motif type is Java regular expression, you should enter a regular expression according to the syntax rules described in section 14.7.3. Press Shift + F1 key for options. For proteins, you can search with a Prosite regular expression and you should enter a protein pattern from the PROSITE database. Accuracy. If you search with a simple motif, you can adjust the accuracy of the motif to the match on the sequence. If you type in a simple motif and let the accuracy be 80%, the motif search algorithm runs through the input sequence and finds all subsequences of the same length as the simple motif such that the fraction of identity between the subsequence and the simple motif is at least 80%. A motif match is added to the sequence as an annotation with the exact fraction of identity between the subsequence and the simple motif. If you use a list of motifs, the accuracy applies only to the simple motifs in the list. Search for reverse motif. This enables searching on the negative strand on nucleotide sequences. Exclude unknown regions. Genome sequence often have large regions with unknown sequence. These regions are very often padded with N's. Ticking this checkbox will not display hits found in N-regions.Motif search handles ambiguous characters in the way that two residues are different if they do not have any residues in common. For example: For nucleotides, N matches any character and R matches A,G. For proteins, X matches any character and Z matches E,Q. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. There are two types of results that can be produced: Add annotations. This will add an annotation to the sequence when a motif is found (an example is shown in figure 14.27. Create table. This will create an overview table of all the motifs found for all the input sequences.

Figure 14.27: Sequence view displaying the pattern found. The search string was 'tataaa'.

CHAPTER 14. GENERAL SEQUENCE ANALYSES

328

14.7.3

Java regular expressions

A regular expressions is a string that describes or matches a set of strings, according to certain syntax rules. They are usually used to give a concise description of a set, without having to list all elements. The simplest form of a regular expression is a literal string. The syntax used for the regular expressions is the Java regular expression syntax (see http: //java.sun.com/docs/books/tutorial/essential/regex/index.html). Below is listed some of the most important syntax rules which are also shown in the help pop-up when you press Shift + F1: [A-Z] will match the characters A through Z (Range). You can also put single characters between the brackets: The expression [AGT] matches the characters A, G or T. [A-D[M-P]] will match the characters A through D and M through P (Union). You can also put single characters between the brackets: The expression [AG[M-P]] matches the characters A, G and M through P. [A-M&&[H-P]] will match the characters between A and M lying between H and P (Intersection). You can also put single characters between the brackets. The expression [A-M&&[HGTDA]] matches the characters A through M which is H, G, T, D or A. [ A-M] will match any character except those between A and M (Excluding). You can also put single characters between the brackets: The expression [ AG] matches any character except A and G. [A-Z&&[ M-P]] will match any character A through Z except those between M and P (Subtraction). You can also put single characters between the brackets: The expression [A-P&&[ CG]] matches any character between A and P except C and G. The symbol . matches any character. X{n} will match a repetition of an element indicated by following that element with a numerical value or a numerical range between the curly brackets. For example, ACG{2} matches the string ACGG and (ACG){2} matches ACGACG. X{n,m} will match a certain number of repetitions of an element indicated by following that element with two numerical values between the curly brackets. The first number is a lower limit on the number of repetitions and the second number is an upper limit on the number of repetitions. For example, ACT{1,3} matches ACT, ACTT and ACTTT. X{n,} represents a repetition of an element at least n times. For example, (AC){2,} matches all strings ACAC, ACACAC, ACACACAC,... The symbol restricts the search to the beginning of your sequence. For example, if you search through a sequence with the regular expression AC, the algorithm will find a match if AC occurs in the beginning of the sequence. The symbol $ restricts the search to the end of your sequence. For example, if you search through a sequence with the regular expression GT$, the algorithm will find a match if GT occurs in the end of the sequence. Examples The expression [ACG][ AC]G{2} matches all strings of length 4, where the first character is A,C

CHAPTER 14. GENERAL SEQUENCE ANALYSES

329

or G and the second is any character except A,C and the third and fourth character is G. The expression G.[ A]$ matches all strings of length 3 in the end of your sequence, where the first character is C, the second any character and the third any character except A.

14.7.4

Create motif list

CLC Genomics Workbench offers advanced and versatile options to create lists of sequence patterns or known motifs represented either by a literal string or a regular expression. A motif list is created from the Toolbox: Toolbox | General Sequence Analyses | Create Motif List ( ) ) button at the

This will open an empty list where you can add motifs by clicking the Add ( bottom of the view. This will open a dialog shown in figure 14.28.

Figure 14.28: Entering a new motif in the list. In this dialog, you can enter the following information: Name. The name of the motif. In the result of a motif search, this name will appear as the name of the annotation and in the result table. Motif. The actual motif. See section 14.7.2 for more information about the syntax of motifs. Description. You can enter a description of the motif. In the result of a motif search, the description will appear in the result table and added as a note to the annotation on the sequence (visible in the Annotation table ( ) or by placing the mouse cursor on the annotation). Type. You can enter three different types of motifs: Simple motifs, java regular expressions or PROSITE regular expression. Read more in section 14.7.2. The motif list can contain a mix of different types of motifs. This is practical because some motifs can be described with the simple syntax, whereas others need the more advanced regular expression syntax.

CHAPTER 14. GENERAL SEQUENCE ANALYSES

330

Instead of manually adding motifs, you can Import From Fasta File ( ). This will show a dialog where you can select a fasta file on your computer and use this to create motifs. This will automatically take the name, description and sequence information from the fasta file, and put it into the motif list. The motif type will be "simple". Besides adding new motifs, you can also edit and delete existing motifs in the list. To edit a motif, either double-click the motif in the list, or select and click the Edit ( ) button at the bottom of the view. To delete a motif, select it and press the Delete key on the keyboard. Alternatively, click Delete ( ) in the Tool bar. Save the motif list in the Navigation Area, and you will be able to use for Motif Search ( section 14.7). ) (see

Chapter 15

Nucleotide analyses
Contents
15.1 Convert DNA to RNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 331 15.2 Convert RNA to DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 332 15.3 Reverse complements of sequences . . . . . . . . . . . . . . . . . . . . . . . 333 15.4 Reverse sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 334 15.5 Translation of DNA or RNA to protein . . . . . . . . . . . . . . . . . . . . . . 334 15.5.1 15.6.1 Translate part of a nucleotide sequence . . . . . . . . . . . . . . . . . . 336 Open reading frame parameters . . . . . . . . . . . . . . . . . . . . . . 336 15.6 Find open reading frames . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 336

CLC Genomics Workbench offers different kinds of sequence analyses, which only apply to DNA and RNA.

15.1

Convert DNA to RNA

CLC Genomics Workbench lets you convert a DNA sequence into RNA, substituting the T residues (Thymine) for U residues (Urasil): select a DNA sequence in the Navigation Area | Toolbox in the Menu Bar | Nucleotide Analyses ( ) | Convert DNA to RNA ( ) or right-click a sequence in Navigation Area | Toolbox | Nucleotide Analyses ( Convert DNA to RNA ( ) This opens the dialog displayed in figure 15.1: If a sequence was selected before choosing the Toolbox action, this sequence is now listed in the Selected Elements window of the dialog. Use the arrows to add or remove sequences or sequence lists from the selected elements. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. Note! You can select multiple DNA sequences and sequence lists at a time. If the sequence list contains RNA sequences as well, they will not be converted. )|

331

CHAPTER 15. NUCLEOTIDE ANALYSES

332

Figure 15.1: Translating DNA to RNA.

15.2

Convert RNA to DNA

CLC Genomics Workbench lets you convert an RNA sequence into DNA, substituting the U residues (Urasil) for T residues (Thymine): select an RNA sequence in the Navigation Area | Toolbox in the Menu Bar | Nucleotide Analyses ( ) | Convert RNA to DNA ( ) or right-click a sequence in Navigation Area | Toolbox | Nucleotide Analyses ( Convert RNA to DNA ( ) This opens the dialog displayed in figure 15.2: )|

Figure 15.2: Translating RNA to DNA. If a sequence was selected before choosing the Toolbox action, this sequence is now listed in the Selected Elements window of the dialog. Use the arrows to add or remove sequences or sequence lists from the selected elements. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. This will open a new view in the View Area displaying the new DNA sequence. The new sequence is not saved automatically. To save the sequence, drag it into the Navigation Area or press Ctrl

CHAPTER 15. NUCLEOTIDE ANALYSES +S( + S on Mac) to activate a save dialog.

333

Note! You can select multiple RNA sequences and sequence lists at a time. If the sequence list contains DNA sequences as well, they will not be converted.

15.3

Reverse complements of sequences

CLC Genomics Workbench is able to create the reverse complement of a nucleotide sequence. By doing that, a new sequence is created which also has all the annotations reversed since they now occupy the opposite strand of their previous location. To quickly obtain the reverse complement of a sequence or part of a sequence, you may select a region on the negative strand and open it in a new view: right-click a selection on the negative strand | Open selection in New View ( )

By doing that, the sequence will be reversed. This is only possible when the double stranded view option is enabled. It is possible to copy the selection and paste it in a word processing program or an e-mail. To obtain a reverse complement of an entire sequence: select a sequence in the Navigation Area | Toolbox in the Menu Bar | Nucleotide Analyses ( ) | Reverse Complement ( ) or right-click a sequence in Navigation Area | Toolbox | Nucleotide Analyses ( Reverse Complement ( ) This opens the dialog displayed in figure 15.3: )|

Figure 15.3: Creating a reverse complement sequence. If a sequence was selected before choosing the Toolbox action, the sequence is now listed in the Selected Elements window of the dialog. Use the arrows to add or remove sequences or sequence lists from the selected elements. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. This will open a new view in the View Area displaying the reverse complement of the selected sequence. The new sequence is not saved automatically. To save the sequence, drag it into the Navigation Area or press Ctrl + S ( + S on Mac) to activate a save dialog.

CHAPTER 15. NUCLEOTIDE ANALYSES

334

15.4

Reverse sequence

CLC Genomics Workbench is able to create the reverse of a nucleotide sequence. By doing that, a new sequence is created which also has all the annotations reversed since they now occupy the opposite strand of their previous location. Note! This is not the same as a reverse complement. If you wish to create the reverse complement, please refer to section 15.3. select a sequence in the Navigation Area | Toolbox in the Menu Bar | Nucleotide Analyses ( ) | Reverse Sequence ( ) This opens the dialog displayed in figure 15.4:

Figure 15.4: Reversing a sequence. If a sequence was selected before choosing the Toolbox action, the sequence is now listed in the Selected Elements window of the dialog. Use the arrows to add or remove sequences or sequence lists from the selected elements. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. Note! This is not the same as a reverse complement. If you wish to create the reverse complement, please refer to section 15.3.

15.5

Translation of DNA or RNA to protein

In CLC Genomics Workbench you can translate a nucleotide sequence into a protein sequence using the Toolbox tools. Usually, you use the +1 reading frame which means that the translation starts from the first nucleotide. Stop codons result in an asterisk being inserted in the protein sequence at the corresponding position. It is possible to translate in any combination of the six reading frames in one analysis. To translate: select a nucleotide sequence | Toolbox in the Menu Bar | Nucleotide Analyses ( | Translate to Protein ( ) or right-click a nucleotide sequence | Toolbox | Nucleotide Analyses ( to Protein ( ) )

) | Translate

CHAPTER 15. NUCLEOTIDE ANALYSES This opens the dialog displayed in figure 15.5:

335

Figure 15.5: Choosing sequences for translation. If a sequence was selected before choosing the Toolbox action, the sequence is now listed in the Selected Elements window of the dialog. Use the arrows to add or remove sequences or sequence lists from the selected elements. Clicking Next generates the dialog seen in figure 15.6:

Figure 15.6: Choosing +1 and +3 reading frames, and the standard translation table. Here you have the following options: Reading frames If you wish to translate the whole sequence, you must specify the reading frame for the translation. If you select e.g. two reading frames, two protein sequences are generated. Translate coding regions You can choose to translate regions marked by and CDS or ORF annotation. This will generate a protein sequence for each CDS or ORF annotation on the sequence. Genetic code translation table Lets you specify the genetic code for the translation. The translation tables are occasionally updated from NCBI. The tables are not available in this

CHAPTER 15. NUCLEOTIDE ANALYSES

336

printable version of the user manual. Instead, the tables are included in the Help-menu in the Menu Bar (in the appendix). Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. The newly created protein is shown, but is not saved automatically. To save a protein sequence, drag it into the Navigation Area or press Ctrl + S ( activate a save dialog. + S on Mac) to

15.5.1

Translate part of a nucleotide sequence

If you want to make separate translations of all the coding regions of a nucleotide sequence, you can check the option: "Translate CDS and ORF" in the translation dialog (see figure 15.6). If you want to translate a specific coding region, which is annotated on the sequence, use the following procedure: Open the nucleotide sequence | right-click the ORF or CDS annotation | Translate CDS/ORF ( ) | choose a translation table | OK If the annotation contains information about the translation, this information will be used, and you do not have to specify a translation table. The CDS and ORF annotations are colored yellow as default.

15.6

Find open reading frames

The CLC Genomics Workbench Find Open Reading Frames function can be used to find all open reading frames (ORF) in a sequence, or, by choosing particular start codons to use, it can be used as a rudimentary gene finder. ORFs identified will be shown as annotations on the sequence. You have the option of choosing a translation table, the start codons to use, minimum ORF length as well as a few other parameters. These choices are explained in this section. To find open reading frames: select a nucleotide sequence | Toolbox in the Menu Bar | Nucleotide Analyses ( | Find Open Reading Frames ( ) or right-click a nucleotide sequence | Toolbox | Nucleotide Analyses ( Reading Frames ( ) This opens the dialog displayed in figure 15.7: If a sequence was selected before choosing the Toolbox action, the sequence is now listed in the Selected Elements window of the dialog. Use the arrows to add or remove sequences or sequence lists from the selected elements. If you want to adjust the parameters for finding open reading frames click Next. )

) | Find Open

15.6.1

Open reading frame parameters

This opens the dialog displayed in figure 15.8: The adjustable parameters for the search are:

CHAPTER 15. NUCLEOTIDE ANALYSES

337

Figure 15.7: Create Reading Frame dialog.

Figure 15.8: Create Reading Frame dialog. Start codon: AUG. Most commonly used start codon. Any. Find all open reading frames. All start codons in genetic code. Other. Here you can specify a number of start codons separated by commas. Both strands. Finds reading frames on both strands. Open-ended Sequence. Allows the ORF to start or end outside the sequence. If the sequence studied is a part of a larger sequence, it may be advantageous to allow the ORF to start or end outside the sequence. Genetic code translation table. Include stop codon in result The ORFs will be shown as annotations which can include the stop codon if this option is checked. The translation tables are occasionally updated from NCBI. The tables are not available in this printable version of the user manual. Instead, the tables are included in the Help-menu in the Menu Bar (in the appendix).

CHAPTER 15. NUCLEOTIDE ANALYSES

338

Minimum Length. Specifies the minimum length for the ORFs to be found. The length is specified as number of codons. Using open reading frames for gene finding is a fairly simple approach which is likely to predict genes which are not real. Setting a relatively high minimum length of the ORFs will reduce the number of false positive predictions, but at the same time short genes may be missed (see figure 15.9).

Figure 15.9: The first 12,000 positions of the E. coli sequence NC_000913 downloaded from GenBank. The blue (dark) annotations are the genes while the yellow (brighter) annotations are the ORFs with a length of at least 100 amino acids. On the positive strand around position 11,000, a gene starts before the ORF. This is due to the use of the standard genetic code rather than the bacterial code. This particular gene starts with CTG, which is a start codon in bacteria. Two short genes are entirely missing, while a handful of open reading frames do not correspond to any of the annotated genes. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. Finding open reading frames is often a good first step in annotating sequences such as cloning vectors or bacterial genomes. For eukaryotic genes, ORF determination may not always be very helpful since the intron/exon structure is not part of the algorithm.

Chapter 16

Protein analyses
Contents
16.1 Signal peptide prediction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 340 16.1.1 16.1.2 16.1.3 16.2.1 Signal peptide prediction parameter settings . . . . . . . . . . . . . . . 340 Signal peptide prediction output . . . . . . . . . . . . . . . . . . . . . . 341 Bioinformatics explained: Prediction of signal peptides . . . . . . . . . . 341 Modifying the layout . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 347

16.2 Protein charge . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 346 16.3 Transmembrane helix prediction . . . . . . . . . . . . . . . . . . . . . . . . . 347 16.4 Antigenicity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 348 16.4.1 16.4.2 16.5.1 16.5.2 16.5.3 16.6.1 16.6.2 Plot of antigenicity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 349 Antigenicity graphs along sequence . . . . . . . . . . . . . . . . . . . . 350

16.5 Hydrophobicity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 350 Hydrophobicity plot . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 351 Hydrophobicity graphs along sequence . . . . . . . . . . . . . . . . . . . 352 Bioinformatics explained: Protein hydrophobicity . . . . . . . . . . . . . . 353 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 355 Pfam search parameters . . . . . . . . . . . . . . . . . . . . . . . . . . 356 Download and installation of additional Pfam databases . . . . . . . . . 357

16.6 Pfam domain search

16.7 Secondary structure prediction . . . . . . . . . . . . . . . . . . . . . . . . . . 357 16.8 Protein report . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 359 16.8.1 16.9.1 16.9.2 Protein report output . . . . . . . . . . . . . . . . . . . . . . . . . . . . 360 . . . . . . . . . . . . . . . . . . . 361 16.9 Reverse translation from protein into DNA

Reverse translation parameters . . . . . . . . . . . . . . . . . . . . . . . 362 Bioinformatics explained: Reverse translation . . . . . . . . . . . . . . . 363

16.10 Proteolytic cleavage detection . . . . . . . . . . . . . . . . . . . . . . . . . . 365 16.10.1 Proteolytic cleavage parameters . . . . . . . . . . . . . . . . . . . . . . 365 16.10.2 Bioinformatics explained: Proteolytic cleavage . . . . . . . . . . . . . . . 368

CLC Genomics Workbench offers a number of analyses of proteins as described in this chapter.

339

CHAPTER 16. PROTEIN ANALYSES

340

16.1

Signal peptide prediction

Signal peptides target proteins to the extracellular environment either through direct plasmamembrane translocation in prokaryotes or is routed through the Endoplasmatic Reticulum in eukaryotic cells. The signal peptide is removed from the resulting mature protein during translocation across the membrane. For prediction of signal peptides, we query SignalP [Nielsen et al., 1997, Bendtsen et al., 2004b] located at http://www.cbs.dtu.dk/services/SignalP/. Thus an active internet connection is required to run the signal peptide prediction. Additional information on SignalP and Center for Biological Sequence analysis (CBS) can be found at http://www.cbs.dtu.dk and in the original research papers [Nielsen et al., 1997, Bendtsen et al., 2004b]. In order to predict potential signal peptides of proteins, the D-score from the SignalP output is used for discrimination of signal peptide versus non-signal peptide (see section 16.1.3). This score has been shown to be the most accurate [Klee and Ellis, 2005] in an evaluation study of signal peptide predictors. In order to use SignalP, you need to download the SignalP plug-in using the plug-in manager, see section 1.7.1. When the plug-in is downloaded and installed, you can use it to predict signal peptides: Select a protein sequence | Toolbox in the Menu Bar | Protein Analyses ( Signal Peptide Prediction ( ) or right-click a protein sequence | Toolbox | Protein Analyses ( Prediction ( ) ) |

) | Signal Peptide

If a sequence was selected before choosing the Toolbox action, this sequence is now listed in the Selected Elements window of the dialog. Use the arrows to add or remove sequences or sequence lists from the selected elements. Click Next to set parameters for the SignalP analysis.

16.1.1

Signal peptide prediction parameter settings

It is possible to set different options prior to running the analysis (see figure 16.1). An organism type should be selected. The default is eukaryote. Eukaryote (default) Gram-negative bacteria Gram-positive bacteria You can perform the analysis on several protein sequences at a time. This will add annotations to all the sequences and open a view for each sequence if a signal peptide is found. If no signal peptide is found in the sequence a dialog box will be shown. The predictions obtained can either be shown as annotations on the sequence, listed in a table or be shown as the detailed and full text output from the SignalP method. This can be used to interpret borderline predictions: Add annotations to sequence

CHAPTER 16. PROTEIN ANALYSES

341

Figure 16.1: Setting the parameters for signal peptide prediction. Create table Text Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish.

16.1.2

Signal peptide prediction output

After running the prediction as described above, the protein sequence will show predicted signal peptide as annotations on the original sequence (see figure 16.2).

Figure 16.2: N-terminal signal peptide shown as annotation on the sequence. Each annotation will carry a tooltip note saying that the corresponding annotation is predicted with SignalP version 3.0. Additional notes can be added through the Edit annotation ( ) right-click mouse menu. See section 10.3.2. Undesired annotations can be removed through the Delete Annotation ( menu. See section 10.3.4. ) right-click mouse

16.1.3

Bioinformatics explained: Prediction of signal peptides

Why the interest in signal peptides? The importance of signal peptides was shown in 1999 when Gnter Blobel received the Nobel Prize in physiology or medicine for his discovery that "proteins have intrinsic signals that govern

CHAPTER 16. PROTEIN ANALYSES

342

their transport and localization in the cell" [Blobel, 2000]. He pointed out the importance of defined peptide motifs for targeting proteins to their site of function. Performing a query to PubMed1 reveals that thousands of papers have been published, regarding signal peptides, secretion and subcellular localization, including knowledge of using signal peptides as vehicles for chimeric proteins for biomedical and pharmaceutical industry. Many papers describe statistical or machine learning methods for prediction of signal peptides and prediction of subcellular localization in general. After the first published method for signal peptide prediction [von Heijne, 1986], more and more methods have surfaced, although not all methods have been made available publicly. Different types of signal peptides Soon after Gnter Blobel's initial discovery of signal peptides, more targeting signals were found. Most cell types and organisms employ several ways of targeting proteins to the extracellular environment or subcellular locations. Most of the proteins targeted for the extracellular space or subcellular locations carry specific sequence motifs (signal peptides) characterizing the type of secretion/targeting it undergoes. Several new different signal peptides or targeting signals have been found during the later years, and papers often describe a small amino acid motif required for secretion of that particular protein. In most of the latter cases, the identified sequence motif is only found in this particular protein and as such cannot be described as a new group of signal peptides. Describing the various types of signal peptides is beyond the scope of this text but several review papers on this topic can be found on PubMed. Targeting motifs can either be removed from, or retained in the mature protein after the protein has reached the correct and final destination. Some of the best characterized signal peptides are depicted in figure 16.3. Numerous methods for prediction of protein targeting and signal peptides have been developed; some of them are mentioned and cited in the introduction of the SignalP research paper [Bendtsen et al., 2004b]. However, no prediction method will be able to cover all the different types of signal peptides. Most methods predicts classical signal peptides targeting to the general secretory pathway in bacteria or classical secretory pathway in eukaryotes. Furthermore, a few methods for prediction of non-classically secreted proteins have emerged [Bendtsen et al., 2004a, Bendtsen et al., 2005]. Prediction of signal peptides and subcellular localization In the search for accurate prediction of signal peptides, many approaches have been investigated. Almost 20 years ago, the first method for prediction of classical signal peptides was published [von Heijne, 1986]. Nowadays, more sophisticated machine learning methods, such as neural networks, support vector machines, and hidden Markov models have arrived along with the increasing computational power and they all perform superior to the old weight matrix based methods [Menne et al., 2000]. Also, many other "classical" statistical approaches have been carried out, often in conjunction with machine learning methods. In the following sections, a wide range of different signal peptide and subcellular prediction methods will be described. Most signal peptide prediction methods require the presence of the correct N-terminal end of
1

http://www.ncbi.nlm.nih.gov/entrez/

CHAPTER 16. PROTEIN ANALYSES

343

Figure 16.3: Schematic representation of various signal peptides. Red color indicates n-region, gray color indicates h-region, cyan indicates c-region. All white circles are part of the mature protein. +1 indicates the first position of the mature protein. The length of the signal peptides is not drawn to scale. the preprotein for correct classification. As large scale genome sequencing projects sometimes assign the 5'-end of genes incorrectly, many proteins are annotated without the correct Nterminal [Reinhardt and Hubbard, 1998] leading to incorrect prediction of subcellular localization. These erroneous predictions can be ascribed directly to poor gene finding. Other methods for prediction of subcellular localization use information within the mature protein and therefore they are more robust to N-terminal truncation and gene finding errors.

CHAPTER 16. PROTEIN ANALYSES

344

Figure 16.4: Sequence logo of eukaryotic signal peptides, showing conservation of amino acids in bits [Schneider and Stephens, 1990]. Polar and hydrophobic residues are shown in green and black, respectively, while blue indicates positively charged residues and red negatively charged residues. The logo is based on an ungapped sequence alignment fixed at the -1 position of the signal peptides. The SignalP method One of the most cited and best methods for prediction of classical signal peptides is the SignalP method [Nielsen et al., 1997, Bendtsen et al., 2004b]. In contrast to other methods, SignalP also predicts the actual cleavage site; thus the peptide which is cleaved off during translocation over the membrane. Recently, an independent research paper has rated SignalP version 3.0 to be the best standalone tool for signal peptide prediction. It was shown that the D-score which is reported by the SignalP method is the best measure for discriminating secretory from non-secretory proteins [Klee and Ellis, 2005]. SignalP is located at http://www.cbs.dtu.dk/services/SignalP/ What do the SignalP scores mean? Many bioinformatics approaches or prediction tools do not give a yes/no answer. Often the user is facing an interpretation of the output, which can be either numerical or graphical. Why is that? In clear-cut examples there are no doubt; yes: this is a signal peptide! But, in borderline cases it is often convenient to have more information than just a yes/no answer. Here a graphical output can aid to interpret the correct answer. An example is shown in figure 16.5. The graphical output from SignalP (neural network) comprises three different scores, C, S and Y. Two additional scores are reported in the SignalP3-NN output, namely the S-mean and the D-score, but these are only reported as numerical values. For each organism class in SignalP; Eukaryote, Gram-negative and Gram-positive, two different neural networks are used, one for predicting the actual signal peptide and one for predicting the position of the signal peptidase I (SPase I) cleavage site. The S-score for the signal peptide prediction is reported for every single amino acid position in the submitted sequence, with high scores indicating that the corresponding amino acid is part of a signal peptide, and low scores indicating that the amino acid is part of a mature protein.

CHAPTER 16. PROTEIN ANALYSES

345

Figure 16.5: Graphical output from the SignalP method of Swiss-Prot entry SFMA_ECOLI. Initially this seemed like a borderline prediction, but closer inspection of the sequence revealed an internal methionine at position 12, which could indicate a erroneously annotated start of the protein. Later this protein was re-annotated by Swiss-Prot to start at the M in position 12. See the text for description of the scores. The C-score is the "cleavage site" score. For each position in the submitted sequence, a C-score is reported, which should only be significantly high at the cleavage site. Confusion is often seen with the position numbering of the cleavage site. When a cleavage site position is referred to by a single number, the number indicates the first residue in the mature protein. This means that a reported cleavage site between amino acid 26-27 corresponds to the mature protein starting at (and include) position 27. Y-max is a derivative of the C-score combined with the S-score resulting in a better cleavage site prediction than the raw C-score alone. This is due to the fact that multiple high-peaking C-scores can be found in one sequence, where only one is the true cleavage site. The cleavage site is assigned from the Y-score where the slope of the S-score is steep and a significant C-score is found. The S-mean is the average of the S-score, ranging from the N-terminal amino acid to the amino acid assigned with the highest Y-max score, thus the S-mean score is calculated for the length of the predicted signal peptide. The S-mean score was in SignalP version 2.0 used as the criteria for discrimination of secretory and non-secretory proteins. The D-score is introduced in SignalP version 3.0 and is a simple average of the S-mean and Y-max score. The score shows superior discrimination performance of secretory and non-secretory proteins to that of the S-mean score which was used in SignalP version 1 and 2. For non-secretory proteins all the scores represented in the SignalP3-NN output should ideally be very low. The hidden Markov model calculates the probability of whether the submitted sequence contains a signal peptide or not. The eukaryotic HMM model also reports the probability of a signal anchor, previously named uncleaved signal peptides. Furthermore, the cleavage site is assigned by a probability score together with scores for the n-region, h-region, and c-region of the signal peptide, if it is found. Other useful resources http://www.cbs.dtu.dk/services/SignalP Pubmed entries for some of the original papers.

CHAPTER 16. PROTEIN ANALYSES

346

http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&cmd=Retrieve&dopt= AbstractPlus&list_uids=9051728&query_hl=1&itool=pubmed_docsum http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_ uids=15223320&dopt=Citation Creative Commons License All CLC bio's scientific articles are licensed under a Creative Commons Attribution-NonCommercialNoDerivs 2.5 License. You are free to copy, distribute, display, and use the work for educational purposes, under the following conditions: You must attribute the work in its original form and "CLC bio" has to be clearly labeled as author and provider of the work. You may not use this work for commercial purposes. You may not alter, transform, nor build upon this work.

See http://creativecommons.org/licenses/by-nc-nd/2.5/ for more information on how to use the contents.

16.2

Protein charge

In CLC Genomics Workbench you can create a graph in the electric charge of a protein as a function of pH. This is particularly useful for finding the net charge of the protein at a given pH. This knowledge can be used e.g. in relation to isoelectric focusing on the first dimension of 2D-gel electrophoresis. The isoelectric point (pI) is found where the net charge of the protein is zero. The calculation of the protein charge does not include knowledge about any potential post-translational modifications the protein may have. The pKa values reported in the literature may differ slightly, thus resulting in different looking graphs of the protein charge plot compared to other programs. In order to calculate the protein charge: Select a protein sequence | Toolbox in the Menu Bar | Protein Analyses ( Create Protein Charge Plot ( ) or right-click a protein sequence | Toolbox | Protein Analyses ( Charge Plot ( ) This opens the dialog displayed in figure 16.6: If a sequence was selected before choosing the Toolbox action, the sequence is now listed in the Selected Elements window of the dialog. Use the arrows to add or remove sequences or sequence lists from the selected elements. You can perform the analysis on several protein sequences at a time. This will result in one output graph showing protein charge graphs for the individual proteins. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. ) |

) | Create Protein

CHAPTER 16. PROTEIN ANALYSES

347

Figure 16.6: Choosing protein sequences to calculate protein charge.

16.2.1

Modifying the layout

Figure 16.7 shows the electrical charges for three proteins. In the Side Panel to the right, you can modify the layout of the graph.

Figure 16.7: View of the protein charge. See section B in the appendix for information about the graph view.

16.3

Transmembrane helix prediction

Many proteins are integral membrane proteins. Most membrane proteins have hydrophobic regions which span the hydrophobic core of the membrane bi-layer and hydrophilic regions located on the outside or the inside of the membrane. Many receptor proteins have several transmembrane helices spanning the cellular membrane. For prediction of transmembrane helices, CLC Genomics Workbench uses TMHMM version 2.0 [Krogh et al., 2001] located at http://www.cbs.dtu.dk/services/TMHMM/, thus an active internet connection is required to run the transmembrane helix prediction. Additional information on THMHH and Center for Biological Sequence analysis (CBS) can be found at

CHAPTER 16. PROTEIN ANALYSES http://www.cbs.dtu.dk and in the original research paper [Krogh et al., 2001].

348

In order to use the transmembrane helix prediction, you need to download the plug-in using the plug-in manager (see section 1.7.1). When the plug-in is downloaded and installed, you can use it to predict transmembrane helices: Select a protein sequence | Toolbox in the Menu Bar | Protein Analyses ( Transmembrane Helix Prediction ( ) or right-click a protein sequence | Toolbox | Protein Analyses ( Helix Prediction ( ) ) |

) | Transmembrane

If a sequence was selected before choosing the Toolbox action, this sequence is now listed in the Selected Elements window of the dialog. Use the arrows to add or remove sequences or sequence lists from the selected elements. The predictions obtained can either be shown as annotations on the sequence, in a table or as the detailed and text output from the TMHMM method. Add annotations to sequence Create table Text Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. You can perform the analysis on several protein sequences at a time. This will add annotations to all the sequences and open a view for each sequence if a transmembrane helix is found. If a transmembrane helix is not found a dialog box will be presented. After running the prediction as described above, the protein sequence will show predicted transmembrane helices as annotations on the original sequence (see figure 16.8). Moreover, annotations showing the topology will be shown. That is, which part the proteins is located on the inside or on the outside. Each annotation will carry a tooltip note saying that the corresponding annotation is predicted with TMHMM version 2.0. Additional notes can be added through the Edit annotation ( ) right-click mouse menu. See section 10.3.2. Undesired annotations can be removed through the Delete Annotation ( menu. See section 10.3.4. ) right-click mouse

16.4

Antigenicity

CLC Genomics Workbench can help to identify antigenic regions in protein sequences in different ways, using different algorithms. The algorithms provided in the Workbench, merely plot an index of antigenicity over the sequence. Two different methods are available. [Welling et al., 1985] Welling et al. used information on the relative occurrence of amino acids in antigenic regions to make a scale which is useful for prediction of antigenic regions. This method

CHAPTER 16. PROTEIN ANALYSES

349

Figure 16.8: Transmembrane segments shown as annotation on the sequence and the topology. is better than the Hopp-Woods scale of hydrophobicity which is also used to identify antigenic regions. A semi-empirical method for prediction of antigenic regions has been developed [Kolaskar and Tongaonkar, 1990]. This method also includes information of surface accessibility and flexibility and at the time of publication the method was able to predict antigenic determinants with an accuracy of 75%. Note! Similar results from the two method can not always be expected as the two methods are based on different training sets.

16.4.1

Plot of antigenicity

Displaying the antigenicity for a protein sequence in a plot is done in the following way: select a protein sequence in Navigation Area | Toolbox in the Menu Bar | Protein Analyses ( ) | Create Antigenicity Plot ( ) This opens a dialog. The first step allows you to add or remove sequences. Clicking Next takes you through to Step 2, which is displayed in figure 16.9. The Window size is the width of the window where, the antigenicity is calculated. The wider the window, the less volatile the graph. You can chose from a number of antigenicity scales. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. The result can be seen in figure 16.10. See section B in the appendix for information about the graph view. The level of antigenicity is calculated on the basis of the different scales. The different scales add different values to each type of amino acid. The antigenicity score is then calculated as the

CHAPTER 16. PROTEIN ANALYSES

350

Figure 16.9: Step two in the Antigenicity Plot allows you to choose different antigenicity scales and the window size.

Figure 16.10: The result of the antigenicity plot calculation and the associated Side Panel. sum of the values in a 'window', which is a particular range of the sequence. The window length can be set from 5 to 25 residues. The wider the window, the less fluctuations in the antigenicity scores.

16.4.2

Antigenicity graphs along sequence

Antigenicity graphs along the sequence can be displayed using the Side Panel. The functionality is similar to hydrophobicity (see section 16.5.2).

16.5

Hydrophobicity

CLC Genomics Workbench can calculate the hydrophobicity of protein sequences in different ways, using different algorithms. (See section 16.5.3). Furthermore, hydrophobicity of sequences can be displayed as hydrophobicity plots and as graphs along sequences. In addition, CLC Genomics Workbench can calculate hydrophobicity for several sequences at the same time, and

CHAPTER 16. PROTEIN ANALYSES for alignments.

351

16.5.1

Hydrophobicity plot

Displaying the hydrophobicity for a protein sequence in a plot is done in the following way: select a protein sequence in Navigation Area | Toolbox in the Menu Bar | Protein Analyses ( ) | Create Hydrophobicity Plot ( ) This opens a dialog. The first step allows you to add or remove sequences. Clicking Next takes you through to Step 2, which is displayed in figure 16.11.

Figure 16.11: Step two in the Hydrophobicity Plot allows you to choose hydrophobicity scale and the window size. The Window size is the width of the window where the hydrophobicity is calculated. The wider the window, the less volatile the graph. You can chose from a number of hydrophobicity scales which are further explained in section 16.5.3 Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. The result can be seen in figure 16.12.

Figure 16.12: The result of the hydrophobicity plot calculation and the associated Side Panel.

CHAPTER 16. PROTEIN ANALYSES See section B in the appendix for information about the graph view.

352

16.5.2

Hydrophobicity graphs along sequence

Hydrophobicity graphs along sequence can be displayed easily by activating the calculations from the Side Panel for a sequence. right-click protein sequence in Navigation Area | Show | Sequence | open Protein info in Side Panel or double-click protein sequence in Navigation Area | Show | Sequence | open Protein info in Side Panel These actions result in the view displayed in figure 16.13.

Figure 16.13: The different available scales in Protein info in CLC Genomics Workbench. The level of hydrophobicity is calculated on the basis of the different scales. The different scales add different values to each type of amino acid. The hydrophobicity score is then calculated as the sum of the values in a 'window', which is a particular range of the sequence. The window length can be set from 5 to 25 residues. The wider the window, the less fluctuations in the hydrophobicity scores. (For more about the theory behind hydrophobicity, see 16.5.3 ). In the following we will focus on the different ways that CLC Genomics Workbench offers to display the hydrophobicity scores. We use Kyte-Doolittle to explain the display of the scores, but the different options are the same for all the scales. Initially there are three options for displaying the hydrophobicity scores. You can choose one, two or all three options by selecting the boxes. (See figure 16.14).

Figure 16.14: The different ways of displaying the hydrophobicity scores, using the Kyte-Doolittle scale. Coloring the letters and their background. When choosing coloring of letters or coloring of their background, the color red is used to indicate high scores of hydrophobicity. A 'color-slider'

CHAPTER 16. PROTEIN ANALYSES

353

allows you to amplify the scores, thereby emphasizing areas with high (or low, blue) levels of hydrophobicity. The color settings mentioned are default settings. By clicking the color bar just below the color slider you get the option of changing color settings. Graphs along sequences. When selecting graphs, you choose to display the hydrophobicity scores underneath the sequence. This can be done either by a line-plot or bar-plot, or by coloring. The latter option offers you the same possibilities of amplifying the scores as applies for coloring of letters. The different ways to display the scores when choosing 'graphs' are displayed in figure 16.14. Notice that you can choose the height of the graphs underneath the sequence.

16.5.3

Bioinformatics explained: Protein hydrophobicity

Calculation of hydrophobicity is important to the identification of various protein features. This can be membrane spanning regions, antigenic sites, exposed loops or buried residues. Usually, these calculations are shown as a plot along the protein sequence, making it easy to identify the location of potential protein features.

Figure 16.15: Plot of hydrophobicity along the amino acid sequence. Hydrophobic regions on the sequence have higher numbers according to the graph below the sequence, furthermore hydrophobic regions are colored on the sequence. Red indicates regions with high hydrophobicity and blue indicates regions with low hydrophobicity. The hydrophobicity is calculated by sliding a fixed size window (of an odd number) over the protein sequence. At the central position of the window, the average hydrophobicity of the entire window is plotted (see figure 16.15). Hydrophobicity scales Several hydrophobicity scales have been published for various uses. Many of the commonly used hydrophobicity scales are described below. Kyte-Doolittle scale. The Kyte-Doolittle scale is widely used for detecting hydrophobic regions in proteins. Regions with a positive value are hydrophobic. This scale can be used for identifying both surface-exposed regions as well as transmembrane regions, depending on the window size used. Short window sizes of 5-7 generally work well for predicting putative surface-exposed regions. Large window sizes of 19-21 are well suited for finding transmembrane domains if the values calculated are above 1.6 [Kyte and Doolittle, 1982]. These values should be used as a rule of thumb and deviations from the rule may occur. Engelman scale. The Engelman hydrophobicity scale, also known as the GES-scale, is another scale which can be used for prediction of protein hydrophobicity [Engelman et al., 1986]. As the Kyte-Doolittle scale, this scale is useful for predicting transmembrane regions in proteins. Eisenberg scale. The Eisenberg scale is a normalized consensus hydrophobicity scale which

CHAPTER 16. PROTEIN ANALYSES shares many features with the other hydrophobicity scales [Eisenberg et al., 1984].

354

Hopp-Woods scale. Hopp and Woods developed their hydrophobicity scale for identification of potentially antigenic sites in proteins. This scale is basically a hydrophilic index where apolar residues have been assigned negative values. Antigenic sites are likely to be predicted when using a window size of 7 [Hopp and Woods, 1983]. Cornette scale. Cornette et al. computed an optimal hydrophobicity scale based on 28 published scales [Cornette et al., 1987]. This optimized scale is also suitable for prediction of alpha-helices in proteins. Rose scale. The hydrophobicity scale by Rose et al. is correlated to the average area of buried amino acids in globular proteins [Rose et al., 1985]. This results in a scale which is not showing the helices of a protein, but rather the surface accessibility. Janin scale. This scale also provides information about the accessible and buried amino acid residues of globular proteins [Janin, 1979]. Welling scale. Welling et al. used information on the relative occurrence of amino acids in antigenic regions to make a scale which is useful for prediction of antigenic regions. This method is better than the Hopp-Woods scale of hydrophobicity which is also used to identify antigenic regions. Kolaskar-Tongaonkar. A semi-empirical method for prediction of antigenic regions has been developed [Kolaskar and Tongaonkar, 1990]. This method also includes information of surface accessibility and flexibility and at the time of publication the method was able to predict antigenic determinants with an accuracy of 75%. Surface Probability. Display of surface probability based on the algorithm by [Emini et al., 1985]. This algorithm has been used to identify antigenic determinants on the surface of proteins. Chain Flexibility. isplay of backbone chain flexibility based on the algorithm by [Karplus and Schulz, 1985]. It is known that chain flexibility is an indication of a putative antigenic determinant. Many more scales have been published throughout the last three decades. Even though more advanced methods have been developed for prediction of membrane spanning regions, the simple and very fast calculations are still highly used. Other useful resources AAindex: Amino acid index database http://www.genome.ad.jp/dbget/aaindex.html Creative Commons License All CLC bio's scientific articles are licensed under a Creative Commons Attribution-NonCommercialNoDerivs 2.5 License. You are free to copy, distribute, display, and use the work for educational purposes, under the following conditions: You must attribute the work in its original form and "CLC bio" has to be clearly labeled as author and provider of the work. You may not use this work for commercial purposes. You may not alter, transform, nor build upon this work.

CHAPTER 16. PROTEIN ANALYSES

aa A C D E F G H I K L M N P Q R S T V W Y aa Alanine Cysteine Aspartic acid Glutamic acid Phenylalanine Glycine Histidine Isoleucine Lysine Leucine Methionine Asparagine Proline Glutamine Arginine Serine Threonine Valine Tryptophan Tyrosine KyteDoolittle 1.80 2.50 -3.50 -3.50 2.80 -0.40 -3.20 4.50 -3.90 3.80 1.90 -3.50 -1.60 -3.50 -4.50 -0.80 -0.70 4.20 -0.90 -1.30 HoppWoods -0.50 -1.00 3.00 3.00 -2.50 0.00 -0.50 -1.80 3.00 -1.80 -1.30 0.20 0.00 0.20 3.00 0.30 -0.40 -1.50 -3.40 -2.30 Cornette 0.20 4.10 -3.10 -1.80 4.40 0.00 0.50 4.80 -3.10 5.70 4.20 -0.50 -2.20 -2.80 1.40 -0.50 -1.90 4.70 1.00 3.20 Eisenberg 0.62 0.29 -0.90 -0.74 1.19 0.48 -0.40 1.38 -1.50 1.06 0.64 -0.78 0.12 -0.85 -2.53 -0.18 -0.05 1.08 0.81 0.26 Rose 0.74 0.91 0.62 0.62 0.88 0.72 0.78 0.88 0.52 0.85 0.85 0.63 0.64 0.62 0.64 0.66 0.70 0.86 0.85 0.76 Janin 0.30 0.90 -0.60 -0.70 0.50 0.30 -0.10 0.70 -1.80 0.50 0.40 -0.50 -0.30 -0.70 -1.40 -0.10 -0.20 0.60 0.30 -0.40

355
Engelman (GES) 1.60 2.00 -9.20 -8.20 3.70 1.00 -3.00 3.10 -8.80 2.80 3.40 -4.80 -0.20 -4.10 -12.3 0.60 1.20 2.60 1.90 -0.70

Table 16.1: Hydrophobicity scales. This table shows seven different hydrophobicity scales which are generally used for prediction of e.g. transmembrane regions and antigenicity.

See http://creativecommons.org/licenses/by-nc-nd/2.5/ for more information on how to use the contents.

16.6

Pfam domain search

With CLC Genomics Workbench you can perform a search for Pfam domains on protein sequences. The Pfam database at http://pfam.sanger.ac.uk/ is a large collection of multiple sequence alignments that covers approximately 9318 protein domains and protein families [Bateman et al., 2004]. Based on the individual domain alignments, profile HMMs have been developed. These profile HMMs can be used to search for domains in unknown sequences. Many proteins have a unique combination of domains which can be responsible, for instance, for the catalytic activities of enzymes. Pfam was initially developed to aid the annotation of the C. elegans genome. Annotating unknown sequences based on pairwise alignment methods by simply transferring annotation from a known protein to the unknown partner does not take domain organization into account [Galperin and Koonin, 1998]. An unknown protein may be annotated wrongly, for instance, as an enzyme if the pairwise alignment only finds a regulatory domain. Using the Pfam search option in CLC Genomics Workbench, you can search for domains in sequence data which otherwise do not carry any annotation information. The Pfam search option adds all found domains onto the protein sequence which was used for the search. If domains of no relevance are found they can easily be removed as described in section 10.3.4. Setting a lower cutoff value will result in fewer domains.

CHAPTER 16. PROTEIN ANALYSES

356

In CLC Genomics Workbench we have implemented our own HMM algorithm for prediction of the Pfam domains. Thus, we do not use the original HMM implementation, HMMER http://hmmer.wustl.edu/ for domain prediction. We find the most probable state path/alignment through each profile HMM by the Viterbi algorithm and based on that we derive a new null model by averaging over the emission distributions of all M and I states that appear in the state path (M is a match state and I is an insert state). From that model we now arrive at an additive correction to the original bit-score, like it is done in the original HMMER algorithm. In order to conduct the Pfam search: Select a protein sequence | Toolbox in the Menu Bar | Protein Analyses ( Domain Search ( ) or right-click a protein sequence | Toolbox | Protein Analyses ( Search ( ) ) | Pfam

) | Pfam Domain

Figure 16.16: Setting parameters for Pfam domain search. If a sequence was selected before choosing the Toolbox action, this sequence is now listed in the Selected Elements window of the dialog. Use the arrows to add or remove sequences or sequence lists from the selected elements. You can perform the analysis on several protein sequences at a time. This will add annotations to all the sequences and open a view for each sequence. Click Next to adjust parameters (see figure 16.16).

16.6.1

Pfam search parameters

Choose database and search type When searching for Pfam domains it is possible to choose different databases and specify the search for full domains or fragments of domains. Only the 100 most frequent domains are included as default in CLC Genomics Workbench. Additional databases can be downloaded directly from CLC bio's web-site at http://www.clcbio.com/resources. Search full domains and fragments. This option allows you to search both for full domain but also for partial domains. This could be the case if a domain extends beyond the ends of a sequence Search full domains only. Selecting this option only allows searches for full domains.

CHAPTER 16. PROTEIN ANALYSES Search fragments only. Only partial domains will be found.

357

Database. Only the 100 most frequent domains are included as default in CLC Genomics Workbench, but additional databases can be downloaded and installed as described in section 16.6.2. Set significance cutoff. The E-value (expectation value) is the number of hits that would be expected to have a score equal to or better than this value, by chance alone. This means that a good E-value which gives a confident prediction is much less than 1. E-values around 1 is what is expected by chance. Thus, the lower the E-value, the more specific the search for domains will be. Only positive numbers are allowed. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. This will open a view showing the found domains as annotations on the original sequence (see figure 16.17). If you have selected several sequences, a corresponding number of views will be opened.

Figure 16.17: Domains annotations based on Pfam. Each found domain will be represented as an annotation of the type Region. More information on each found domain is available through the tooltip, including detailed information on the identity score which is the basis for the prediction. For a more detailed description of the provided scores through the tool tip look at http: //pfam.sanger.ac.uk/help#tabview=tab5.

16.6.2

Download and installation of additional Pfam databases

) (see

Additional databases can be downloaded as a resource using the Plug-in manager ( section 1.7.4). If you are not able to download directly from the Plug-in manager,

16.7

Secondary structure prediction

An important issue when trying to understand protein function is to know the actual structure of the protein. Many questions that are raised by molecular biologists are directly targeted at protein structure. The alpha-helix forms a coiled rodlike structure whereas a beta-sheet show an extended sheet-like structure. Some proteins are almost devoid of alpha-helices such as

CHAPTER 16. PROTEIN ANALYSES

358

chymotrypsin (PDB_ID: 1AB9) whereas others like myoglobin (PDB_ID: 101M) have a very high content of alpha-helices. With CLC Genomics Workbench one can predict the secondary structure of proteins very fast. Predicted elements are alpha-helix, beta-sheet (same as beta-strand) and other regions. Based on extracted protein sequences from the protein databank (http://www.rcsb.org/ pdb/) a hidden Makov model (HMM) was trained and evaluated for performance. Machine learning methods have shown superior when it comes to prediction of secondary structure of proteins [Rost, 2001]. By far the most common structures are Alpha-helices and beta-sheets which can be predicted, and predicted structures are automatically added to the query as annotation which later can be edited. In order to predict the secondary structure of proteins: Select a protein sequence | Toolbox in the Menu Bar | Protein Analyses ( Predict secondary structure ( ) or right-click a protein sequence | Toolbox | Protein Analyses ( structure ( ) This opens the dialog displayed in figure 16.18: ) |

) | Predict secondary

Figure 16.18: Choosing one or more protein sequences for secondary structure prediction. If a sequence was selected before choosing the Toolbox action, this sequence is now listed in the Selected Elements window of the dialog. Use the arrows to add or remove sequences or sequence lists from the selected elements. You can perform the analysis on several protein sequences at a time. This will add annotations to all the sequences and open a view for each sequence. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. After running the prediction as described above, the protein sequence will show predicted alpha-helices and beta-sheets as annotations on the original sequence (see figure 16.19). Each annotation will carry a tooltip note saying that the corresponding annotation is predicted with CLC Genomics Workbench. Additional notes can be added through the Edit Annotation ( ) right-click mouse menu. See section 10.3.2.

CHAPTER 16. PROTEIN ANALYSES

359

Figure 16.19: Alpha-helices and beta-strands shown as annotations on the sequence. Undesired alpha-helices or beta-sheets can be removed through the Delete Annotation ( right-click mouse menu. See section 10.3.4. )

16.8

Protein report

CLC Genomics Workbench is able to produce protein reports, that allow you to easily generate different kinds of information regarding a protein. Actually a protein report is a collection of some of the protein analyses which are described elsewhere in this manual. To create a protein report do the following: Right-click protein in Navigation Area | Toolbox | Protein Analyses ( Protein Report ( ) ) | Create

This opens dialog Step 1, where you can choose which proteins to create a report for. When the correct one is chosen, click Next. In dialog Step 2 you can choose which analyses you want to include in the report. The following list shows which analyses are available and explains where to find more details. Sequence statistics. See section 14.4 for more about this topic. Plot of charge as function of pH. See section 16.2 for more about this topic. Plot of hydrophobicity. See section 16.5 for more about this topic. Plot of local complexity. See section 14.3 for more about this topic. Dot plot against self. See section 14.2 for more about this topic. Secondary structure prediction. See section 16.7 for more about this topic. Pfam domain search. See section 16.6 for more about this topic. Local BLAST. See section 12.1.3 for more about this topic. NCBI BLAST. See section 12.1.1 for more about this topic. When you have selected the relevant analyses, click Next. Step 3 to Step 7 (if you select all the analyses in Step 2) are adjustments of parameters for the different analyses. The parameters

CHAPTER 16. PROTEIN ANALYSES

360

are mentioned briefly in relation to the following steps, and you can turn to the relevant chapters or sections (mentioned above) to learn more about the significance of the parameters. In Step 3 you can adjust parameters for sequence statistics: Individual Statistics Layout. Comparative is disabled because reports are generated for one protein at a time. Include Background Distribution of Amino Acids. Includes distributions from different organisms. Background distributions are calculated from UniProt www.uniprot.org version 6.0, dated September 13 2005. In Step 4 you can adjust parameters for hydrophobicity plots: Window size. Width of window on sequence (odd number). Hydrophobicity scales. Lets you choose between different scales. In Step 5 you can adjust a parameter for complexity plots: Window size. Width of window on sequence (must be odd). In Step 6 you can adjust parameters for dot plots: Score model. Different scoring matrices. Window size. Width of window on sequence. In Step 7 you can adjust parameters for BLAST search: Program. Lets you choose between different BLAST programs. Database. Lets you limit your search to a particular database.

16.8.1

Protein report output

An example of Protein report can be seen in figure 16.20. By double clicking a graph in the output, this graph is shown in a different view (CLC Genomics Workbench generates another tab). The report output and the new graph views can be saved by dragging the tab into the Navigation Area. The content of the tables in the report can be copy/pasted out of the program and e.g. into Microsoft Excel. To do so: Select content of table | Right-click the selection | Copy You can also Export ( ) the report in Excel format.

CHAPTER 16. PROTEIN ANALYSES

361

Figure 16.20: A protein report. There is a Table of Contents in the Side Panel that makes it easy to browse the report.

16.9

Reverse translation from protein into DNA

A protein sequence can be back-translated into DNA using CLC Genomics Workbench. Due to degeneracy of the genetic code every amino acid could translate into several different codons (only 20 amino acids but 64 different codons). Thus, the program offers a number of choices for determining which codons should be used. These choices are explained in this section. In order to make a reverse translation: Select a protein sequence | Toolbox in the Menu Bar | Protein Analyses ( Reverse Translate ( ) or right-click a protein sequence | Toolbox | Protein Analyses ( ( ) This opens the dialog displayed in figure 16.21: ) |

) | Reverse translate

Figure 16.21: Choosing a protein sequence for reverse translation.

CHAPTER 16. PROTEIN ANALYSES

362

If a sequence was selected before choosing the Toolbox action, the sequence is now listed in the Selected Elements window of the dialog. Use the arrows to add or remove sequences or sequence lists from the selected elements. You can translate several protein sequences at a time. Click Next to adjust the parameters for the translation.

16.9.1

Reverse translation parameters

Figure 16.22 shows the choices for making the translation.

Figure 16.22: Choosing parameters for the reverse translation.

Use random codon. This will randomly back-translate an amino acid to a codon without using the translation tables. Every time you perform the analysis you will get a different result. Use only the most frequent codon. On the basis of the selected translation table, this parameter/option will assign the codon that occurs most often. When choosing this option, the results of performing several reverse translations will always be the same, contrary to the other two options. Use codon based on frequency distribution. This option is a mix of the other two options. The selected translation table is used to attach weights to each codon based on its frequency. The codons are assigned randomly with a probability given by the weights. A more frequent codon has a higher probability of being selected. Every time you perform the analysis, you will get a different result. This option yields a result that is closer to the translation behavior of the organism (assuming you choose an appropriate codon frequency table). Map annotations to reverse translated sequence. If this checkbox is checked, then all annotations on the protein sequence will be mapped to the resulting DNA sequence. In the tooltip on the transferred annotations, there is a note saying that the annotation derives from the original sequence.

CHAPTER 16. PROTEIN ANALYSES

363

The Codon Frequency Table is used to determine the frequencies of the codons. Select a frequency table from the list that fits the organism you are working with. A translation table of an organism is created on the basis of counting all the codons in the coding sequences. Every codon in a Codon Frequency Table has its own count, frequency (per thousand) and fraction which are calculated in accordance with the occurrences of the codon in the organism. You can customize the list of codon frequency tables for your installation, see section M. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. The newly created nucleotide sequence is shown, and if the analysis was performed on several protein sequences, there will be a corresponding number of views of nucleotide sequences. The new sequence is not saved automatically. To save the sequence, drag it into the Navigation Area or press Ctrl + S ( + S on Mac) to show the save dialog.

16.9.2

Bioinformatics explained: Reverse translation

In all living cells containing hereditary material such as DNA, a transcription to mRNA and subsequent a translation to proteins occur. This is of course simplified but is in general what is happening in order to have a steady production of proteins needed for the survival of the cell. In bioinformatics analysis of proteins it is sometimes useful to know the ancestral DNA sequence in order to find the genomic localization of the gene. Thus, the translation of proteins back to DNA/RNA is of particular interest, and is called reverse translation or back-translation. The Genetic Code In 1968 the Nobel Prize in Medicine was awarded to Robert W. Holley, Har Gobind Khorana and Marshall W. Nirenberg for their interpretation of the Genetic Code (http://nobelprize.org/ medicine/laureates/1968/). The Genetic Code represents translations of all 64 different codons into 20 different amino acids. Therefore it is no problem to translate a DNA/RNA sequence into a specific protein. But due to the degeneracy of the genetic code, several codons may code for only one specific amino acid. This can be seen in the table below. After the discovery of the genetic code it has been concluded that different organism (and organelles) have genetic codes which are different from the "standard genetic code". Moreover, the amino acid alphabet is no longer limited to 20 amino acids. The 21'st amino acid, selenocysteine, is encoded by an 'UGA' codon which is normally a stop codon. The discrimination of a selenocysteine over a stop codon is carried out by the translation machinery. Selenocysteines are very rare amino acids. The table below shows the Standard Genetic Code which is the default translation table.

CHAPTER 16. PROTEIN ANALYSES TTT F Phe TTC F Phe TTA L Leu TTG L Leu i CTT L Leu CTC L Leu CTA L Leu CTG L Leu i ATT I Ile ATC I Ile ATA I Ile ATG M Met i GTT V Val GTC V Val GTA V Val GTG V Val TCT S Ser TCC S Ser TCA S Ser TCG S Ser CCT P Pro CCC P Pro CCA P Pro CCG P Pro ACT T Thr ACC T Thr ACA T Thr ACG T Thr GCT A Ala GCC A Ala GCA A Ala GCG A Ala TAT Y Tyr TAC Y Tyr TAA * Ter TAG * Ter CAT H His CAC H His CAA Q Gln CAG Q Gln AAT N Asn AAC N Asn AAA K Lys AAG K Lys GAT D Asp GAC D Asp GAA E Glu GAG E Glu TGT C Cys TGC C Cys TGA * Ter TGG W Trp CGT R Arg CGC R Arg CGA R Arg CGG R Arg AGT S Ser AGC S Ser AGA R Arg AGG R Arg GGT G Gly GGC G Gly GGA G Gly GGG G Gly

364

Challenge of reverse translation A particular protein follows from the translation of a DNA sequence whereas the reverse translation need not have a specific solution according to the Genetic Code. The Genetic Code is degenerate which means that a particular amino acid can be translated into more than one codon. Hence there are ambiguities of the reverse translation. Solving the ambiguities of reverse translation In order to solve these ambiguities of reverse translation you can define how to prioritize the codon selection, e.g: Choose a codon randomly. Select the most frequent codon in a given organism. Randomize a codon, but with respect to its frequency in the organism. As an example we want to translate an alanine to the corresponding codon. Four different codons can be used for this reverse translation; GCU, GCC, GCA or GCG. By picking either one by random choice we will get an alanine. The most frequent codon, coding for an alanine in E. coli is GCG, encoding 33.7% of all alanines. Then comes GCC (25.5%), GCA (20.3%) and finally GCU (15.3%). The data are retrieved from the Codon usage database, see below. Always picking the most frequent codon does not necessarily give the best answer. By selecting codons from a distribution of calculated codon frequencies, the DNA sequence obtained after the reverse translation, holds the correct (or nearly correct) codon distribution. It

CHAPTER 16. PROTEIN ANALYSES

365

should be kept in mind that the obtained DNA sequence is not necessarily identical to the original one encoding the protein in the first place, due to the degeneracy of the genetic code. In order to obtain the best possible result of the reverse translation, one should use the codon frequency table from the correct organism or a closely related species. The codon usage of the mitochondrial chromosome are often different from the native chromosome(s), thus mitochondrial codon frequency tables should only be used when working specifically with mitochondria. Other useful resources The Genetic Code at NCBI: http://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi?mode=c Codon usage database: http://www.kazusa.or.jp/codon/ Wikipedia on the genetic code http://en.wikipedia.org/wiki/Genetic_code Creative Commons License All CLC bio's scientific articles are licensed under a Creative Commons Attribution-NonCommercialNoDerivs 2.5 License. You are free to copy, distribute, display, and use the work for educational purposes, under the following conditions: You must attribute the work in its original form and "CLC bio" has to be clearly labeled as author and provider of the work. You may not use this work for commercial purposes. You may not alter, transform, nor build upon this work.

See http://creativecommons.org/licenses/by-nc-nd/2.5/ for more information on how to use the contents.

16.10

Proteolytic cleavage detection

CLC Genomics Workbench offers to analyze protein sequences with respect to cleavage by a selection of proteolytic enzymes. This section explains how to adjust the detection parameters and offers basic information on proteolytic cleavage in general.

16.10.1

Proteolytic cleavage parameters

Given a protein sequence, CLC Genomics Workbench detects proteolytic cleavage sites in accordance with detection parameters and shows the detected sites as annotations on the sequence and in textual format in a table below the sequence view. Detection of proteolytic cleavage sites is initiated by: right-click a protein sequence in Navigation Area | Toolbox | Protein Analyses ( | Proteolytic Cleavage, ( ) This opens the dialog shown in figure 16.23: )

CHAPTER 16. PROTEIN ANALYSES

366

Figure 16.23: Choosing sequence CAA32220 for proteolytic cleavage. CLC Genomics Workbench allows you to detect proteolytic cleavages for several sequences at a time. Correct the list of sequences by selecting a sequence and clicking the arrows pointing left and right. Then click Next to go to Step 2. In Step 2 you can select proteolytic cleavage enzymes. The list of available enzymes will be expanded continuously. Presently, the list contains the enzymes shown in figure 16.24. The full list of enzymes and their cleavage patterns can be seen in Appendix, section E.

Figure 16.24: Setting parameters for proteolytic cleavage detection. Select the enzymes you want to use for detection. When the relevant enzymes are chosen, click Next. In Step 3 you can set parameters for the detection. This limits the number of detected cleavages. Figure 16.25 shows an example of how parameters can be set. Min. and max. number of cleavage sites. Certain proteolytic enzymes cleave at many positions in the amino acid sequence. For instance proteinase K cleaves at nine different amino acids, regardless of the surrounding residues. Thus, it can be very useful to limit the number of actual cleavage sites before running the analysis.

CHAPTER 16. PROTEIN ANALYSES

367

Figure 16.25: Setting parameters for proteolytic cleavage detection. Min. and max. fragment length Likewise, it is possible to limit the output to only display sequence fragments between a chosen length. Both a lower and upper limit can be chosen. Min. and max. fragment mass The molecular weight is not necessarily directly correlated to the fragment length as amino acids have different molecular masses. For that reason it is also possible to limit the search for proteolytic cleavage sites to mass-range. Example!: If you have one protein sequence but you only want to show which enzymes cut between two and four times. Then you should select "The enzymes has more cleavage sites than 2" and select "The enzyme has less cleavage sites than 4". In the next step you should simply select all enzymes. This will result in a view where only enzymes which cut 2,3 or 4 times are presented. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. The result of the detection is displayed in figure 16.26.

Figure 16.26: The result of the proteolytic cleavage detection.

CHAPTER 16. PROTEIN ANALYSES

368

Depending on the settings in the program, the output of the proteolytic cleavage site detection will display two views on the screen. The top view shows the actual protein sequence with the predicted cleavage sites indicated by small arrows. If no labels are found on the arrows they can be enabled by setting the labels in the "annotation layout" in the preference panel. The bottom view shows a text output of the detection, listing the individual fragments and information on these.

16.10.2

Bioinformatics explained: Proteolytic cleavage

Proteolytic cleavage is basically the process of breaking the peptide bonds between amino acids in proteins. This process is carried out by enzymes called peptidases, proteases or proteolytic cleavage enzymes. Proteins often undergo proteolytic processing by specific proteolytic enzymes (proteases/peptidases) before final maturation of the protein. Proteins can also be cleaved as a result of intracellular processing of, for example, misfolded proteins. Another example of proteolytic processing of proteins is secretory proteins or proteins targeted to organelles, which have their signal peptide removed by specific signal peptidases before release to the extracellular environment or specific organelle. Below a few processes are listed where proteolytic enzymes act on a protein substrate. N-terminal methionine residues are often removed after translation. Signal peptides or targeting sequences are removed during translocation through a membrane. Viral proteins that were translated from a monocistronic mRNA are cleaved. Proteins or peptides can be cleaved and used as nutrients. Precursor proteins are often processed to yield the mature protein. Proteolytic cleavage of proteins has shown its importance in laboratory experiments where it is often useful to work with specific peptide fragments instead of entire proteins. Proteases also have commercial applications. As an example proteases can be used as detergents for cleavage of proteinaceous stains in clothing. The general nomenclature of cleavage site positions of the substrate were formulated by Schechter and Berger, 1967-68 [Schechter and Berger, 1967], [Schechter and Berger, 1968]. They designate the cleavage site between P1-P1', incrementing the numbering in the N-terminal direction of the cleaved peptide bond (P2, P3, P4, etc..). On the carboxyl side of the cleavage site the numbering is incremented in the same way (P1', P2', P3' etc. ). This is visualized in figure 16.27. Proteases often have a specific recognition site where the peptide bond is cleaved. As an example trypsin only cleaves at lysine or arginine residues, but it does not matter (with a few exceptions) which amino acid is located at position P1'(carboxyterminal of the cleavage site). Another example is trombin which cleaves if an arginine is found in position P1, but not if a D or E is found in position P1' at the same time. (See figure 16.28).

CHAPTER 16. PROTEIN ANALYSES

369

Figure 16.27: Nomenclature of the peptide substrate. The substrate is cleaved between position P1-P1'.

Figure 16.28: Hydrolysis of the peptide bond between two amino acids. Trypsin cleaves unspecifically at lysine or arginine residues whereas trombin cleaves at arginines if asparate or glutamate is absent. Bioinformatics approaches are used to identify potential peptidase cleavage sites. Fragments can be found by scanning the amino acid sequence for patterns which match the corresponding cleavage site for the protease. When identifying cleaved fragments it is relatively important to know the calculated molecular weight and the isoelectric point. Other useful resources The Peptidase Database: http://merops.sanger.ac.uk/ Creative Commons License All CLC bio's scientific articles are licensed under a Creative Commons Attribution-NonCommercialNoDerivs 2.5 License. You are free to copy, distribute, display, and use the work for educational purposes, under the following conditions: You must attribute the work in its original form and "CLC bio" has to be clearly labeled as author and provider of the work. You may not use this work for commercial purposes. You may not alter, transform, nor build upon this work.

CHAPTER 16. PROTEIN ANALYSES

370

See http://creativecommons.org/licenses/by-nc-nd/2.5/ for more information on how to use the contents.

Chapter 17

Primers
Contents
17.1 Primer design - an introduction . . . . . . . . . . . . 17.1.1 General concept . . . . . . . . . . . . . . . . . 17.1.2 Scoring primers . . . . . . . . . . . . . . . . . 17.2 Setting parameters for primers and probes . . . . . 17.2.1 Primer Parameters . . . . . . . . . . . . . . . . 17.3 Graphical display of primer information . . . . . . . 17.3.1 Compact information mode . . . . . . . . . . . 17.3.2 Detailed information mode . . . . . . . . . . . 17.4 Output from primer design . . . . . . . . . . . . . . 17.4.1 Saving primers . . . . . . . . . . . . . . . . . . 17.4.2 Saving PCR fragments . . . . . . . . . . . . . . 17.4.3 Adding primer binding annotation . . . . . . . . 17.5 Standard PCR . . . . . . . . . . . . . . . . . . . . . 17.5.1 User input . . . . . . . . . . . . . . . . . . . . 17.5.2 Standard PCR output table . . . . . . . . . . . 17.6 Nested PCR . . . . . . . . . . . . . . . . . . . . . . 17.6.1 Nested PCR output table . . . . . . . . . . . . 17.7 TaqMan . . . . . . . . . . . . . . . . . . . . . . . . 17.7.1 TaqMan output table . . . . . . . . . . . . . . 17.8 Sequencing primers . . . . . . . . . . . . . . . . . . 17.8.1 Sequencing primers output table . . . . . . . . 17.9 Alignment-based primer and probe design . . . . . . 17.9.1 Specific options for alignment-based primer and 17.9.2 Alignment based design of PCR primers . . . . 17.9.3 Alignment-based TaqMan probe design . . . . . 17.10 Analyze primer properties . . . . . . . . . . . . . . . 17.11 Find binding sites and create fragments . . . . . . . 17.11.1 Binding parameters . . . . . . . . . . . . . . . 17.11.2 Results - binding sites and fragments . . . . . 17.12 Order primers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . probe design . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 372 372 374 374 375 377 377 377 378 379 379 379 379 380 382 383 385 385 387 387 388 388 389 389 391 392 394 394 395 398

371

CHAPTER 17. PRIMERS

372

CLC Genomics Workbench offers graphically and algorithmically advanced design of primers and probes for various purposes. This chapter begins with a brief introduction to the general concepts of the primer designing process. Then follows instructions on how to adjust parameters for primers, how to inspect and interpret primer properties graphically and how to interpret, save and analyze the output of the primer design analysis. After a description of the different reaction types for which primers can be designed, the chapter closes with sections on how to match primers with other sequences and how to create a primer order.

17.1

Primer design - an introduction

) | Design

Primer design can be accessed in two ways: select sequence | Toolbox in the Menu Bar | Primers and Probes ( Primers ( ) | OK or right-click sequence | Show | Primer ( )

In the primer view (see figure 17.1), the basic options for viewing the template sequence are the same as for the standard sequence view. See section 10.1 for an explanation of these options. Note! This means that annotations such as e.g. known SNP's or exons can be displayed on the template sequence to guide the choice of primer regions. Also, traces in sequencing reads can be shown along with the structure to guide e.g. the re-sequencing of poorly resolved regions.

Figure 17.1: The initial view of the sequence used for primer design.

17.1.1

General concept

The concept of the primer view is that the user first chooses the desired reaction type for the session in the Primer Parameters preference group, e.g. Standard PCR. Reflecting the choice of reaction type, it is now possibly to select one or more regions on the sequence and to use the right-click mouse menu to designate these as primer or probe regions (see figure 17.2).

CHAPTER 17. PRIMERS

373

Figure 17.2: Right-click menu allowing you to specify regions for the primer design When a region is chosen, graphical information about the properties of all possible primers in this region will appear in lines beneath it. By default, information is showed using a compact mode but the user can change to a more detailed mode in the Primer information preference group. The number of information lines reflects the chosen length interval for primers and probes. In the compact information mode one line is shown for every possible primer-length and each of these lines contain information regarding all possible primers of the given length. At each potential primer starting position, a circular information point is shown which indicates whether the primer fulfills the requirements set in the primer parameters preference group. A green circle indicates a primer which fulfils all criteria and a red circle indicates a primer which fails to meet one or more of the set criteria. For more detailed information, place the mouse cursor over the circle representing the primer of interest. A tool-tip will then appear on screen, displaying detailed information about the primer in relation to the set criteria. To locate the primer on the sequence, simply left-click the circle using the mouse. The various primer parameters can now be varied to explore their effect and the view area will dynamically update to reflect this allowing for a high degree of interactivity in the primer design process. After having explored the potential primers the user may have found a satisfactory primer and choose to export this directly from the view area using a mouse right-click on the primers information point. This does not allow for any design information to enter concerning the properties of primer/probe pairs or sets e.g. primer pair annealing and Tm difference between primers. If the latter is desired the user can use the Calculate button at the bottom of the Primer parameter preference group. This will activate a dialog, the contents of which depends on the chosen mode. Here, the user can set primer-pair specific setting such as allowed or desired Tm

CHAPTER 17. PRIMERS

374

difference and view the single-primer parameters which were chosen in the Primer parameters preference group. Upon pressing finish, an algorithm will generate all possible primer sets and rank these based on their characteristics and the chosen parameters. A list will appear displaying the 100 most high scoring sets and information pertaining to these. The search result can be saved to the navigator. From the result table, suggested primers or primer/probe sets can be explored since clicking an entry in the table will highlight the associated primers and probes on the sequence. It is also possible to save individual primers or sets from the table through the mouse right-click menu. For a given primer pair, the amplified PCR fragment can also be opened or saved using the mouse right-click menu.

17.1.2

Scoring primers

CLC Genomics Workbench employs a proprietary algorithm to rank primer and probe solutions. The algorithm considers both the parameters pertaining to single oligos, such as e.g. the secondary structure score and parameters pertaining to oligo-pairs such as e.g. the oligo pair-annealing score. The ideal score for a solution is 100 and solutions are thus ranked in descending order. Each parameter is assigned an ideal value and a tolerance. Consider for example oligo self-annealing, here the ideal value of the annealing score is 0 and the tolerance corresponds to the maximum value specified in the side panel. The contribution to the final score is determined by how much the parameter deviates from the ideal value and is scaled by the specified tolerance. Hence, a large deviation from the ideal and a small tolerance will give a large deduction in the final score and a small deviation from the ideal and a high tolerance will give a small deduction in the final score.

17.2

Setting parameters for primers and probes

The primer-specific view options and settings are found in the Primer parameters preference group in the Side Panel to the right of the view (see figure 17.3).

Figure 17.3: The two groups of primer parameters (in the program, the Primer information group is listed below the other group).

CHAPTER 17. PRIMERS

375

17.2.1

Primer Parameters

In this preference group a number of criteria can be set, which the selected primers must meet. All the criteria concern single primers, as primer pairs are not generated until the Calculate button is pressed. Parameters regarding primer and probe sets are described in detail for each reaction mode (see below). Length. Determines the length interval within which primers can be designed by setting a maximum and a minimum length. The upper and lower lengths allowed by the program are 50 and 10 nucleotides respectively. Melting temperature. Determines the temperature interval within which primers must lie. When the Nested PCR or TaqMan reaction type is chosen, the first pair of melting temperature interval settings relate to the outer primer pair i.e. not the probe. Melting temperatures are calculated by a nearest-neighbor model which considers stacking interactions between neighboring bases in the primer-template complex. The model uses state-of-the-art thermodynamic parameters [SantaLucia, 1998] and considers the important contribution from the dangling ends that are present when a short primer anneals to a template sequence [Bommarito et al., 2000]. A number of parameters can be adjusted concerning the reaction mixture and which influence melting temperatures (see below). Melting temperatures are corrected for the presence of monovalent cations using the model of [SantaLucia, 1998] and temperatures are further corrected for the presence of magnesium, deoxynucleotide triphosphates (dNTP) and dimethyl sulfoxide (DMSO) using the model of [von Ahsen et al., 2001]. Inner melting temperature. This option is only activated when the Nested PCR or TaqMan mode is selected. In Nested PCR mode, it determines the allowed melting temperature interval for the inner/nested pair of primers, and in TaqMan mode it determines the allowed temperature interval for the TaqMan probe. Advanced parameters. A number of less commonly used options Buffer properties. A number of parameters concerning the reaction mixture which influence melting temperatures. Primer concentration. Specifies the concentration of primers and probes in units of nanomoles (nM ) Salt concentration. Specifies the concentration of monovalent cations ([N A+ ], [K + ] and equivalents) in units of millimoles (mM ) Magnesium concentration. Specifies the concentration of magnesium cations ([M g ++ ]) in units of millimoles (mM ) dNTP concentration. Specifies the concentration of deoxynucleotide triphosphates in units of millimoles (mM ) DMSO concentration. Specifies the concentration of dimethyl sulfoxide in units of volume percent (vol.%) GC content. Determines the interval of CG content (% C and G nucleotides in the primer) within which primers must lie by setting a maximum and a minimum GC content. Self annealing. Determines the maximum self annealing value of all primers and probes. This determines the amount of base-pairing allowed between two copies of

CHAPTER 17. PRIMERS

376

the same molecule. The self annealing score is measured in number of hydrogen bonds between two copies of primer molecules, with A-T base pairs contributing 2 hydrogen bonds and G-C base pairs contributing 3 hydrogen bonds. Self end annealing. Determines the maximum self end annealing value of all primers and probes. This determines the number of consecutive base pairs allowed between the 3' end of one primer and another copy of that primer. This score is calculated in number of hydrogen bonds (the example below has a score of 4 - derived from 2 A-T base pairs each with 2 hydrogen bonds). AATTCCCTACAATCCCCAAA || AAACCCCTAACATCCCTTAA . Secondary structure. Determines the maximum score of the optimal secondary DNA structure found for a primer or probe. Secondary structures are scored by the number of hydrogen bonds in the structure, and 2 extra hydrogen bonds are added for each stacking base-pair in the structure. 3' end G/C restrictions. When this checkbox is selected it is possible to specify restrictions concerning the number of G and C molecules in the 3' end of primers and probes. A low G/C content of the primer/probe 3' end increases the specificity of the reaction. A high G/C content facilitates a tight binding of the oligo to the template but also increases the possibility of mispriming. Unfolding the preference groups yields the following options: End length. The number of consecutive terminal nucleotides for which to consider the C/G content Max no. of G/C. The maximum number of G and C nucleotides allowed within the specified length interval Min no. of G/C. The minimum number of G and C nucleotides required within the specified length interval 5' end G/C restrictions. When this checkbox is selected it is possible to specify restrictions concerning the number of G and C molecules in the 5' end of primers and probes. A high G/C content facilitates a tight binding of the oligo to the template but also increases the possibility of mis-priming. Unfolding the preference groups yields the same options as described above for the 3' end. Mode. Specifies the reaction type for which primers are designed: Standard PCR. Used when the objective is to design primers, or primer pairs, for PCR amplification of a single DNA fragment. Nested PCR. Used when the objective is to design two primer pairs for nested PCR amplification of a single DNA fragment. Sequencing. Used when the objective is to design primers for DNA sequencing. TaqMan. Used when the objective is to design a primer pair and a probe for TaqMan quantitative PCR. Each mode is described further below. Calculate. Pushing this button will activate the algorithm for designing primers

CHAPTER 17. PRIMERS

377

17.3

Graphical display of primer information

The primer information settings are found in the Primer information preference group in the Side Panel to the right of the view (see figure 17.3). There are two different ways to display the information relating to a single primer, the detailed and the compact view. Both are shown below the primer regions selected on the sequence.

17.3.1

Compact information mode

This mode offers a condensed overview of all the primers that are available in the selected region. When a region is chosen primer information will appear in lines beneath it (see figure 17.4).

Figure 17.4: Compact information mode The number of information lines reflects the chosen length interval for primers and probes. One line is shown for every possible primer-length, if the length interval is widened more lines will appear. At each potential primer starting position a circle is shown which indicates whether the primer fulfills the requirements set in the primer parameters preference group. A green primer indicates a primer which fulfils all criteria and a red primer indicates a primer which fails to meet one or more of the set criteria. For more detailed information, place the mouse cursor over the circle representing the primer of interest. A tool-tip will then appear on screen displaying detailed information about the primer in relation to the set criteria. To locate the primer on the sequence, simply left-click the circle using the mouse. The various primer parameters can now be varied to explore their effect and the view area will dynamically update to reflect this. If e.g. the allowed melting temperature interval is widened more green circles will appear indicating that more primers now fulfill the set requirements and if e.g. a requirement for 3' G/C content is selected, rec circles will appear at the starting points of the primers which fail to meet this requirement.

17.3.2

Detailed information mode

In this mode a very detailed account is given of the properties of all the available primers. When a region is chosen primer information will appear in groups of lines beneath it (see figure 17.5).

CHAPTER 17. PRIMERS

378

Figure 17.5: Detailed information mode The number of information-line-groups reflects the chosen length interval for primers and probes. One group is shown for every possible primer length. Within each group, a line is shown for every primer property that is selected from the checkboxes in the primer information preference group. Primer properties are shown at each potential primer starting position and are of two types: Properties with numerical values are represented by bar plots. A green bar represents the starting point of a primer that meets the set requirement and a red bar represents the starting point of a primer that fails to meet the set requirement: G/C content Melting temperature Self annealing score Self end annealing score Secondary structure score Properties with Yes - No values. If a primer meets the set requirement a green circle will be shown at its starting position and if it fails to meet the requirement a red dot is shown at its starting position: C/G at 3' end C/G at 5' end Common to both sorts of properties is that mouse clicking an information point (filled circle or bar) will cause the region covered by the associated primer to be selected on the sequence.

17.4

Output from primer design

The output generated by the primer design algorithm is a table of proposed primers or primer pairs with the accompanying information (see figure 17.6).

CHAPTER 17. PRIMERS

379

Figure 17.6: Proposed primers In the preference panel of the table, it is possible to customize which columns are shown in the table. See the sections below on the different reaction types for a description of the available information. The columns in the output table can be sorted by the present information. For example the user can choose to sort the available primers by their score (default) or by their self annealing score, simply by right-clicking the column header. The output table interacts with the accompanying primer editor such that when a proposed combination of primers and probes is selected in the table the primers and probes in this solution are highlighted on the sequence.

17.4.1

Saving primers

Primer solutions in a table row can be saved by selecting the row and using the right-click mouse menu. This opens a dialog that allows the user to save the primers to the desired location. Primers and probes are saved as DNA sequences in the program. This means that all available DNA analyzes can be performed on the saved primers, including BLAST. Furthermore, the primers can be edited using the standard sequence view to introduce e.g. mutations and restriction sites.

17.4.2

Saving PCR fragments

The PCR fragment generated from the primer pair in a given table row can also be saved by selecting the row and using the right-click mouse menu. This opens a dialog that allows the user to save the fragment to the desired location. The fragment is saved as a DNA sequence and the position of the primers is added as annotation on the sequence. The fragment can then be used for further analysis and included in e.g. an in-silico cloning experiment using the cloning editor.

17.4.3

Adding primer binding annotation

You can add an annotation to the template sequence specifying the binding site of the primer: Right-click the primer in the table and select Mark primer annotation on sequence.

17.5

Standard PCR

This mode is used to design primers for a PCR amplification of a single DNA fragment.

CHAPTER 17. PRIMERS

380

17.5.1

User input

In this mode the user must define either a Forward primer region, a Reverse primer region, or both. These are defined by making a selection on the sequence and right-clicking the selection. It is also possible to define a Region to amplify in which case a forward- and a reverse primer region are automatically placed so as to ensure that the designated region will be included in the PCR fragment. If areas are known where primers must not bind (e.g. repeat rich areas), one or more No primers here regions can be defined. If two regions are defined, it is required that at least a part of the Forward primer region is located upstream of the Reverse primer region. After exploring the available primers (see section 17.3) and setting the desired parameter values in the Primer Parameters preference group, the Calculate button will activate the primer design algorithm. When a single primer region is defined If only a single region is defined, only single primers will be suggested by the algorithm. After pressing the Calculate button a dialog will appear (see figure 17.7).

Figure 17.7: Calculation dialog for PCR primers when only a single primer region has been defined. The top part of this dialog shows the parameter settings chosen in the Primer parameters preference group which will be used by the design algorithm. The lower part contains a menu where the user can choose to include mispriming as a criteria in the design process. If this option is selected the algorithm will search for competing binding sites of the primer within the sequence. The adjustable parameters for the search are:

CHAPTER 17. PRIMERS

381

Exact match. Choose only to consider exact matches of the primer, i.e. all positions must base pair with the template for mispriming to occur. Minimum number of base pairs required for a match. How many nucleotides of the primer that must base pair to the sequence in order to cause mispriming. Number of consecutive base pairs required in 3' end. How many consecutive 3' end base pairs in the primer that MUST be present for mispriming to occur. This option is included since 3' terminal base pairs are known to be essential for priming to occur. Note! Including a search for potential mispriming sites will prolong the search time substantially if long sequences are used as template and if the minimum number of base pairs required for a match is low. If the region to be amplified is part of a very long molecule and mispriming is a concern, consider extracting part of the sequence prior to designing primers. When both forward and reverse regions are defined If both a forward and a reverse region are defined, primer pairs will be suggested by the algorithm. After pressing the Calculate button a dialog will appear (see figure 17.8).

Figure 17.8: Calculation dialog for PCR primers when two primer regions have been defined. Again, the top part of this dialog shows the parameter settings chosen in the Primer parameters preference group which will be used by the design algorithm. The lower part again contains a menu where the user can choose to include mispriming of both primers as a criteria in the design process (see above). The central part of the dialog contains parameters pertaining to primer pairs. Here three parameters can be set:

CHAPTER 17. PRIMERS

382

Maximum percentage point difference in G/C content - if this is set at e.g. 5 points a pair of primers with 45% and 49% G/C nucleotides, respectively, will be allowed, whereas a pair of primers with 45% and 51% G/C nucleotides, respectively will not be included. Maximal difference in melting temperature of primers in a pair - the number of degrees Celsius that primers in a pair are all allowed to differ. Max hydrogen bonds between pairs - the maximum number of hydrogen bonds allowed between the forward and the reverse primer in a primer pair. Max hydrogen bonds between pair ends - the maximum number of hydrogen bonds allowed in the consecutive ends of the forward and the reverse primer in a primer pair. Maximum length of amplicon - determines the maximum length of the PCR fragment.

17.5.2

Standard PCR output table

If only a single region is selected the following columns of information are available: Sequence - the primer's sequence. Score - measures how much the properties of the primer (or primer pair) deviates from the optimal solution in terms of the chosen parameters and tolerances. The higher the score, the better the solution. Region - the interval of the template sequence covered by the primer Self annealing - the maximum self annealing score of the primer in units of hydrogen bonds Self annealing alignment - a visualization of the highest maximum scoring self annealing alignment Self end annealing - the maximum score of consecutive end base-pairings allowed between the ends of two copies of the same molecule in units of hydrogen bonds GC content - the fraction of G and C nucleotides in the primer Melting temperature of the primer-template complex Secondary structure score - the score of the optimal secondary DNA structure found for the primer. Secondary structures are scored by adding the number of hydrogen bonds in the structure, and 2 extra hydrogen bonds are added for each stacking base-pair in the structure Secondary structure - a visualization of the optimal DNA structure found for the primer If both a forward and a reverse region are selected a table of primer pairs is shown, where the above columns (excluding the score) are represented twice, once for the forward primer (designated by the letter F) and once for the reverse primer (designated by the letter R). Before these, and following the score of the primer pair, are the following columns pertaining to primer pair-information available:

CHAPTER 17. PRIMERS

383

Pair annealing - the number of hydrogen bonds found in the optimal alignment of the forward and the reverse primer in a primer pair Pair annealing alignment - a visualization of the optimal alignment of the forward and the reverse primer in a primer pair. Pair end annealing - the maximum score of consecutive end base-pairings found between the ends of the two primers in the primer pair, in units of hydrogen bonds Fragment length - the length (number of nucleotides) of the PCR fragment generated by the primer pair

17.6

Nested PCR

Nested PCR is a modification of Standard PCR, aimed at reducing product contamination due to the amplification of unintended primer binding sites (mispriming). If the intended fragment can not be amplified without interference from competing binding sites, the idea is to seek out a larger outer fragment which can be unambiguously amplified and which contains the smaller intended fragment. Having amplified the outer fragment to large numbers, the PCR amplification of the inner fragment can proceed and will yield amplification of this with minimal contamination. Primer design for nested PCR thus involves designing two primer pairs, one for the outer fragment and one for the inner fragment. In Nested PCR mode the user must thus define four regions a Forward primer region (the outer forward primer), a Reverse primer region (the outer reverse primer), a Forward inner primer region, and a Reverse inner primer region. These are defined by making a selection on the sequence and right-clicking the selection. If areas are known where primers must not bind (e.g. repeat rich areas), one or more No primers here regions can be defined. It is required that the Forward primer region, is located upstream of the Forward inner primer region, that the Forward inner primer region, is located upstream of the Reverse inner primer region, and that the Reverse inner primer region, is located upstream of the Reverse primer region. In Nested PCR mode the Inner melting temperature menu in the Primer parameters panel is activated, allowing the user to set a separate melting temperature interval for the inner and outer primer pairs. After exploring the available primers (see section 17.3) and setting the desired parameter values in the Primer parameters preference group, the Calculate button will activate the primer design algorithm. After pressing the Calculate button a dialog will appear (see figure 17.9). The top and bottom parts of this dialog are identical to the Standard PCR dialog for designing primer pairs described above. The central part of the dialog contains parameters pertaining to primer pairs and the comparison between the outer and the inner pair. Here five options can be set: Maximum percentage point difference in G/C content (described above under Standard PCR) - this criteria is applied to both primer pairs independently.

CHAPTER 17. PRIMERS

384

Figure 17.9: Calculation dialog Maximal difference in melting temperature of primers in a pair - the number of degrees Celsius that primers in a pair are all allowed to differ. This criteria is applied to both primer pairs independently. Maximum pair annealing score - the maximum number of hydrogen bonds allowed between the forward and the reverse primer in a primer pair. This criteria is applied to all possible combinations of primers. Minimum difference in the melting temperature of primers in the inner and outer primer pair - all comparisons between the melting temperature of primers from the two pairs must be at least this different, otherwise the primer set is excluded. This option is applied to ensure that the inner and outer PCR reactions can be initiated at different annealing temperatures. Please note that to ensure flexibility there is no directionality indicated when setting parameters for melting temperature differences between inner and outer primer pair, i.e. it is not specified whether the inner pair should have a lower or higher Tm . Instead this is determined by the allowed temperature intervals for inner and outer primers that are set in the primer parameters preference group in the side panel. If a higher Tm of inner primers is desired, choose a Tm interval for inner primers which has higher values than the interval for outer primers. Two radio buttons allowing the user to choose between a fast and an accurate algorithm for primer prediction.

CHAPTER 17. PRIMERS

385

17.6.1

Nested PCR output table

In nested PCR there are four primers in a solution, forward outer primer (FO), forward inner primer (FI), reverse inner primer (RI) and a reverse outer primer (RO). The output table can show primer-pair combination parameters for all four combinations of primers and single primer parameters for all four primers in a solution (see section on Standard PCR for an explanation of the available primer-pair and single primer information). The fragment length in this mode refers to the length of the PCR fragment generated by the inner primer pair, and this is also the PCR fragment which can be exported.

17.7

TaqMan

CLC Genomics Workbench allows the user to design primers and probes for TaqMan PCR applications. TaqMan probes are oligonucleotides that contain a fluorescent reporter dye at the 5' end and a quenching dye at the 3' end. Fluorescent molecules become excited when they are irradiated and usually emit light. However, in a TaqMan probe the energy from the fluorescent dye is transferred to the quencher dye by fluorescence resonance energy transfer as long as the quencher and the dye are located in close proximity i.e. when the probe is intact. TaqMan probes are designed to anneal within a PCR product amplified by a standard PCR primer pair. If a TaqMan probe is bound to a product template, the replication of this will cause the Taq polymerase to encounter the probe. Upon doing so, the 5'exonuclease activity of the polymerase will cleave the probe. This cleavage separates the quencher and the dye, and as a result the reporter dye starts to emit fluorescence. The TaqMan technology is used in Real-Time quantitative PCR. Since the accumulation of fluorescence mirrors the accumulation of PCR products it can can be monitored in real-time and used to quantify the amount of template initially present in the buffer. The technology is also used to detect genetic variation such as SNP's. By designing a TaqMan probe which will specifically bind to one of two or more genetic variants it is possible to detect genetic variants by the presence or absence of fluorescence in the reaction. Note! In CLC Genomics Workbench it is possible to annotate sequences with SNP information from dbSNP and use this information to guide TaqMan allele-specific probe design. A specific requirement of TaqMan probes is that a G nucleotide can not be present at the 5' end since this will quench the fluorescence of the reporter dye. It is recommended that the melting temperature of the TaqMan probe is about 10 degrees celsius higher than that of the primer pair. Primer design for TaqMan technology involves designing a primer pair and a TaqMan probe. In TaqMan the user must thus define three regions: a Forward primer region, a Reverse primer region, and a TaqMan probe region. The easiest way to do this is to designate a TaqMan primer/probe region spanning the sequence region where TaqMan amplification is desired. This will automatically add all three regions to the sequence. If more control is desired about the placing of primers and probes the Forward primer region, Reverse primer region and TaqMan probe region can all be defined manually. If areas are known where primers or probes must not bind (e.g. repeat rich areas), one or more No primers here regions can be defined. The regions are defined by making a selection on the sequence and right-clicking the selection.

CHAPTER 17. PRIMERS

386

It is required that at least a part of the Forward primer region is located upstream of the TaqMan Probe region, and that the TaqMan Probe region, is located upstream of a part of the Reverse primer region. In TaqMan mode the Inner melting temperature menu in the primer parameters panel is activated allowing the user to set a separate melting temperature interval for the TaqMan probe. After exploring the available primers (see section 17.3) and setting the desired parameter values in the Primer Parameters preference group, the Calculate button will activate the primer design algorithm. After pressing the Calculate button a dialog will appear (see figure 17.10) which is similar to the Nested PCR dialog described above (see section 17.6).

Figure 17.10: Calculation dialog In this dialog the options to set a minimum and a desired melting temperature difference between outer and inner refers to primer pair and probe respectively. Furthermore, the central part of the dialog contains an additional parameter Maximum length of amplicon - determines the maximum length of the PCR fragment generated in the TaqMan analysis.

CHAPTER 17. PRIMERS

387

17.7.1

TaqMan output table

In TaqMan mode there are two primers and a probe in a given solution, forward primer (F), reverse primer (R) and a TaqMan probe (TP). The output table can show primer/probe-pair combination parameters for all three combinations of primers and single primer parameters for both primers and the TaqMan probe (see section on Standard PCR for an explanation of the available primer-pair and single primer information). The fragment length in this mode refers to the length of the PCR fragment generated by the primer pair, and this is also the PCR fragment which can be exported.

17.8

Sequencing primers

This mode is used to design primers for DNA sequencing. In this mode the user can define a number of Forward primer regions and Reverse primer regions where a sequencing primer can start. These are defined by making a selection on the sequence and right-clicking the selection. If areas are known where primers must not bind (e.g. repeat rich areas), one or more No primers here regions can be defined. No requirements are instated on the relative position of the regions defined. After exploring the available primers (see section 17.3) and setting the desired parameter values in the Primer Parameters preference group, the Calculate button will activate the primer design algorithm. After pressing the Calculate button a dialog will appear (see figure 17.11).

Figure 17.11: Calculation dialog for sequencing primers Since design of sequencing primers does not require the consideration of interactions between

CHAPTER 17. PRIMERS

388

primer pairs, this dialog is identical to the dialog shown in Standard PCR mode when only a single primer region is chosen. See the section 17.5 for a description.

17.8.1

Sequencing primers output table

In this mode primers are predicted independently for each region, but the optimal solutions are all presented in one table. The solutions are numbered consecutively according to their position on the sequence such that the forward primer region closest to the 5' end of the molecule is designated F1, the next one F2 etc. For each solution, the single primer information described under Standard PCR is available in the table.

17.9

Alignment-based primer and probe design

CLC Genomics Workbench allows the user to design PCR primers and TaqMan probes based on an alignment of multiple sequences. The primer designer for alignments can be accessed in two ways: select alignment | Toolbox | Primers and Probes ( ) | Design Primers ( ) | OK

or If the alignment is already open: | Click Primer Designer ( ) at the lower left part of the view In the alignment primer view (see figure 17.12), the basic options for viewing the template alignment are the same as for the standard view of alignments. See section 22 for an explanation of these options. Note! This means that annotations such as e.g. known SNP's or exons can be displayed on the template sequence to guide the choice of primer regions. Since the definition of groups of sequences is essential to the primer design the selection boxes of the standard view are shown as default in the alignment primer view.

Figure 17.12: The initial view of an alignment used for primer design.

CHAPTER 17. PRIMERS

389

17.9.1

Specific options for alignment-based primer and probe design

Compared to the primer view of a single sequence the most notable difference is that the alignment primer view has no available graphical information. Furthermore, the selection boxes found to the left of the names in the alignment play an important role in specifying the oligo design process. This is elaborated below. The Primer Parameters group in the Side Panel has the same options for specifying primer requirements, but differs by the following (see figure 17.12): In the Mode submenu which specifies the reaction types the following options are found: Standard PCR. Used when the objective is to design primers, or primer pairs, for PCR amplification of a single DNA fragment. TaqMan. Used when the objective is to design a primer pair and a probe set for TaqMan quantitative PCR. The Primer solution submenu is used to specify requirements for the match of a PCR primer against the template sequences. These options are described further below. It contains the following options: Perfect match. Allow degeneracy. Allow mismatches. The work flow when designing alignment based primers and probes is as follows: Use selection boxes to specify groups of included and excluded sequences. To select all the sequences in the alignment, right-click one of the selection boxes and choose Mark All. Mark either a single forward primer region, a single reverse primer region or both on the sequence (and perhaps also a TaqMan region). Selections must cover all sequences in the included group. You can also specify that there should be no primers in a region (No Primers Here) or that a whole region should be amplified (Region to Amplify). Adjust parameters regarding single primers in the preference panel. Click the Calculate button.

17.9.2

Alignment based design of PCR primers

In this mode, a single or a pair of PCR primers are designed. CLC Genomics Workbench allows the user to design primers which will specifically amplify a group of included sequences but not amplify the remainder of the sequences, the excluded sequences. The selection boxes are used to indicate the status of a sequence, if the box is checked the sequence belongs to the included sequences, if not, it belongs to the excluded sequences. To design primers that are general for all primers in an alignment, simply add them all to the set of included sequences by checking all selection boxes. Specificity of priming is determined by criteria set by the user in the dialog box which is shown when the Calculate button is pressed (see below). Different options can be chosen concerning the match of the primer to the template sequences in the included group:

CHAPTER 17. PRIMERS

390

Perfect match. Specifies that the designed primers must have a perfect match to all relevant sequences in the alignment. When selected, primers will thus only be located in regions that are completely conserved within the sequences belonging to the included group. Allow degeneracy. Designs primers that may include ambiguity characters where heterogeneities occur in the included template sequences. The allowed fold of degeneracy is user defined and corresponds to the number of possible primer combinations formed by a degenerate primer. Thus, if a primer covers two 4-fold degenerate site and one 2-fold degenerate site the total fold of degeneracy is 4 4 2 = 32 and the primer will, when supplied from the manufacturer, consist of a mixture of 32 different oligonucleotides. When scoring the available primers, degenerate primers are given a score which decreases with the fold of degeneracy. Allow mismatches. Designs primers which are allowed a specified number of mismatches to the included template sequences. The melting temperature algorithm employed includes the latest thermodynamic parameters for calculating Tm when single-base mismatches occur. When in Standard PCR mode, clicking the Calculate button will prompt the dialog shown in figure 17.13. The top part of this dialog shows the single-primer parameter settings chosen in the Primer parameters preference group which will be used by the design algorithm. The central part of the dialog contains parameters pertaining to primer specificity (this is omitted if all sequences belong to the included group). Here, three parameters can be set: Minimum number of mismatches - the minimum number of mismatches that a primer must have against all sequences in the excluded group to ensure that it does not prime these. Minimum number of mismatches in 3' end - the minimum number of mismatches that a primer must have in its 3' end against all sequences in the excluded group to ensure that it does not prime these. Length of 3' end - the number of consecutive nucleotides to consider for mismatches in the 3' end of the primer. The lower part of the dialog contains parameters pertaining to primer pairs (this is omitted when only designing a single primer). Here, three parameters can be set: Maximum percentage point difference in G/C content - if this is set at e.g. 5 points a pair of primers with 45% and 49% G/C nucleotides, respectively, will be allowed, whereas a pair of primers with 45% and 51% G/C nucleotides, respectively will not be included. Maximal difference in melting temperature of primers in a pair - the number of degrees Celsius that primers in a pair are all allowed to differ. Max hydrogen bonds between pairs - the maximum number of hydrogen bonds allowed between the forward and the reverse primer in a primer pair. Maximum length of amplicon - determines the maximum length of the PCR fragment.

CHAPTER 17. PRIMERS

391

The output of the design process is a table of single primers or primer pairs as described for primer design based on single sequences. These primers are specific to the included sequences in the alignment according to the criteria defined for specificity. The only novelty in the table, is that melting temperatures are displayed with both a maximum, a minimum and an average value to reflect that degenerate primers or primers with mismatches may have heterogeneous behavior on the different templates in the group of included sequences.

Figure 17.13: Calculation dialog shown when designing alignment based PCR primers.

17.9.3

Alignment-based TaqMan probe design

CLC Genomics Workbench allows the user to design solutions for TaqMan quantitative PCR which consist of four oligos: a general primer pair which will amplify all sequences in the alignment, a specific TaqMan probe which will match the group of included sequences but not match the excluded sequences and a specific TaqMan probe which will match the group of excluded sequences but not match the included sequences. As above, the selection boxes are used to indicate the status of a sequence, if the box is checked the sequence belongs to the included sequences, if not, it belongs to the excluded sequences. We use the terms included and excluded here to be consistent with the section above although a probe solution is presented for both groups. In TaqMan mode, primers are not allowed degeneracy or mismatches to any template sequence in the alignment, variation is only allowed/required in the TaqMan probes. Pushing the Calculate button will cause the dialog shown in figure 17.14 to appear. The top part of this dialog is identical to the Standard PCR dialog for designing primer pairs described above. The central part of the dialog contains parameters to define the specificity of TaqMan probes. Two parameters can be set: Minimum number of mismatches - the minimum total number of mismatches that must

CHAPTER 17. PRIMERS

392

exist between a specific TaqMan probe and all sequences which belong to the group not recognized by the probe. Minimum number of mismatches in central part - the minimum number of mismatches in the central part of the oligo that must exist between a specific TaqMan probe and all sequences which belong to the group not recognized by the probe. The lower part of the dialog contains parameters pertaining to primer pairs and the comparison between the outer oligos(primers) and the inner oligos (TaqMan probes). Here, five options can be set: Maximum percentage point difference in G/C content (described above under Standard PCR). Maximal difference in melting temperature of primers in a pair - the number of degrees Celsius that primers in the primer pair are all allowed to differ. Maximum pair annealing score - the maximum number of hydrogen bonds allowed between the forward and the reverse primer in an oligo pair. This criteria is applied to all possible combinations of primers and probes. Minimum difference in the melting temperature of primer (outer) and TaqMan probe (inner) oligos - all comparisons between the melting temperature of primers and probes must be at least this different, otherwise the solution set is excluded. Desired temperature difference in melting temperature between outer (primers) and inner (TaqMan) oligos - the scoring function discounts solution sets which deviate greatly from this value. Regarding this, and the minimum difference option mentioned above, please note that to ensure flexibility there is no directionality indicated when setting parameters for melting temperature differences between probes and primers, i.e. it is not specified whether the probes should have a lower or higher Tm . Instead this is determined by the allowed temperature intervals for inner and outer oligos that are set in the primer parameters preference group in the side panel. If a higher Tm of probes is required, choose a Tm interval for probes which has higher values than the interval for outer primers. The output of the design process is a table of solution sets. Each solution set contains the following: a set of primers which are general to all sequences in the alignment, a TaqMan probe which is specific to the set of included sequences (sequences where selection boxes are checked) and a TaqMan probe which is specific to the set of excluded sequences (marked by *). Otherwise, the table is similar to that described above for TaqMan probe prediction on single sequences.

17.10

Analyze primer properties

CLC Genomics Workbench can calculate and display the properties of predefined primers and probes: select a primer sequence (primers are represented as DNA sequences in the Navigation Area) | Toolbox in the Menu Bar | Primers and Probes ( ) | Analyze Primer Properties ( )

CHAPTER 17. PRIMERS

393

Figure 17.14: Calculation dialog shown when designing alignment based TaqMan probes. If a sequence was selected before choosing the Toolbox action, this sequence is now listed in the Selected Elements window of the dialog. Use the arrows to add or remove a sequence from the selected elements. Clicking Next generates the dialog seen in figure 17.15:

Figure 17.15: The parameters for analyzing primer properties. In the Concentrations panel a number of parameters can be specified concerning the reaction mixture and which influence melting temperatures Primer concentration. Specifies the concentration of primers and probes in units of nanomoles (nM ) Salt concentration. Specifies the concentration of monovalent cations ([N A+ ], [K + ] and equivalents) in units of millimoles (mM )

CHAPTER 17. PRIMERS

394

In the Template panel the sequences of the chosen primer and the template sequence are shown. The template sequence is as default set to the reverse complement of the primer sequence i.e. as perfectly base-pairing. However, it is possible to edit the template to introduce mismatches which may affect the melting temperature. At each side of the template sequence a text field is shown. Here, the dangling ends of the template sequence can be specified. These may have an important affect on the melting temperature [Bommarito et al., 2000] Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. The result is shown in figure 17.16:

Figure 17.16: Properties of a primer from the Example Data. In the Side Panel you can specify the information to display about the primer. The information parameters of the primer properties table are explained in section 17.5.2.

17.11

Find binding sites and create fragments

In CLC Genomics Workbench you have the possibility of matching known primers against one or more DNA sequences or a list of DNA sequences. This can be applied to test whether a primer used in a previous experiment is applicable to amplify e.g. a homologous region in another species, or to test for potential mispriming. This functionality can also be used to extract the resulting PCR product when two primers are matched. This is particularly useful if your primers have extensions in the 5' end. To search for primer binding sites: Toolbox | Primers and Probes ( ) | Find Binding Sites and Create Fragments ( )

If a sequence was already selected, this sequence is now listed in the Selected Elements window of the dialog. Use the arrows to add or remove sequences or sequence lists from the selected elements. Click Next when all the sequence have been added. Note! You should not add the primer sequences at this step.

17.11.1

Binding parameters
) button. In CLC Genomics

This opens the dialog displayed in figure 17.17: At the top, select one or more primers by clicking the browse (

CHAPTER 17. PRIMERS

395

Figure 17.17: Search parameters for finding primer binding sites. Workbench, primers are just DNA sequences like any other, but there is a filter on the length of the sequence. Only sequences up to 400 bp can be added. The Match criteria for matching a primer to a sequence are: Exact match. Choose only to consider exact matches of the primer, i.e. all positions must base pair with the template. Minimum number of base pairs required for a match. How many nucleotides of the primer that must base pair to the sequence in order to cause priming/mispriming. Number of consecutive base pairs required in 3' end. How many consecutive 3' end base pairs in the primer that MUST be present for priming/mispriming to occur. This option is included since 3' terminal base pairs are known to be essential for priming to occur. Note that the number of mismatches is reported in the output, so you will be able to filter on this afterwards (see below). Below the match settings, you can adjust Concentrations concerning the reaction mixture. This is used when reporting melting temperatures for the primers. Primer concentration. Specifies the concentration of primers and probes in units of nanomoles (nM ) Salt concentration. Specifies the concentration of monovalent cations ([N A+ ], [K + ] and equivalents) in units of millimoles (mM )

17.11.2

Results - binding sites and fragments

Click Next to specify the output options as shown in figure 17.18: The output options are: Add binding site annotations. This will add annotations to the input sequences (see details below).

CHAPTER 17. PRIMERS

396

Figure 17.18: Output options include reporting of binding sites and fragments. Create binding site table. Creates a table of all binding sites. Described in details below. Create fragment table. Showing a table of all fragments that could result from using the primers. Note that you can set the minimum and maximum sizes of the fragments to be shown. The table is described in detail below. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. An example of a binding site annotation is shown in figure 17.19.

Figure 17.19: Annotation showing a primer match. The annotation has the following information: Sequence of the primer. Positions with mismatches will be in lower-case (see the fourth position in figure 17.19 where the primer has an a and the template sequence has a T). Number of mismatches. Number of other hits on the same sequence. This number can be useful to check specificity of the primer. Binding region. This region ends with the 3' exact match and is simply the primer length upstream. This means that if you have 5' extensions to the primer, part of the binding region covers sequence that will actually not be annealed to the primer.

CHAPTER 17. PRIMERS

397

Figure 17.20: A table showing all binding sites. An example of the primer binding site table is shown in figure 17.20. The information here is the same as in the primer annotation and furthermore you can see additional information about melting temperature etc. by selecting the options in the Side Panel. See a more detailed description of this information in section 17.5.2. You can use this table to browse the binding sites. If you make a split view of the table and the sequence (see section 3.2.6), you can browse through the binding positions by clicking in the table. This will cause the sequence view to jump to the position of the binding site. An example of a fragment table is shown in figure 17.21.

Figure 17.21: A table showing all possible fragments of the specified size.

CHAPTER 17. PRIMERS

398

The table first lists the names of the forward and reverse primers, then the length of the fragment and the region. The last column tells if there are other possible fragments fulfilling the length criteria on this sequence. This information can be used to check for competing products in the PCR. In the Side Panel you can show information about melting temperature for the primers as well as the difference between melting temperatures. You can use this table to browse the fragment regions. If you make a split view of the table and the sequence (see section 3.2.6), you can browse through the fragment regions by clicking in the table. This will cause the sequence view to jump to the start position of the fragment. There are some additional options in the fragment table. First, you can annotate the fragment on the original sequence. This is done by right-clicking (Ctrl-click on Mac) the fragment and choose Annotate Fragment as shown in figure 17.22.

Figure 17.22: Right-clicking a fragment allows you to annotate the region on the input sequence or open the fragment as a new sequence. This will put a PCR fragment annotations on the input sequence covering the region specified in the table. As you can see from figure 17.22, you can also choose to Open Fragment. This will create a new sequence representing the PCR product that would be the result of using these two primers. Note that if you have extensions on the primers, they will be used to construct the new sequence. If you are doing restriction cloning using primers with restriction site extensions, you can use this functionality to retrieve the PCR fragment for us in the cloning editor (see section 21.1).

17.12

Order primers

To facilitate the ordering of primers and probes, CLC Genomics Workbench offers an easy way of displaying, and saving, a textual representation of one or more primers: select primers in Navigation Area | Toolbox in the Menu Bar | Primers and Probes ( ) | Order Primers ( ) This opens a dialog where you can choose additional primers. Clicking OK opens a textual representation of the primers (see figure 17.23). The first line states the number of primers being ordered and after this follows the names and nucleotide sequences of the primers in 5'-3' orientation. From the editor, the primer information can be copied and pasted to web forms or e-mails. The created object can also be saved and exported as a text file. See figure 17.23

CHAPTER 17. PRIMERS

399

Figure 17.23: A primer order for 4 primers.

Chapter 18

Sequencing data analyses

Contents
18.1 Importing and viewing trace data . . 18.1.1 Scaling traces . . . . . . . . . . 18.1.2 Trace settings in the Side Panel 18.2 Trim sequences . . . . . . . . . . . . 18.2.1 Manual trimming . . . . . . . . . 18.2.2 Automatic trimming . . . . . . . 18.3 Assemble sequences . . . . . . . . . 18.4 Assemble to reference sequence . . . 18.5 Add sequences to an existing contig 18.6 View and edit read mappings . . . . . 18.6.1 View settings in the Side Panel . 18.6.2 Editing the read mapping . . . . 18.6.3 Sorting reads . . . . . . . . . . 18.6.4 Read conflicts . . . . . . . . . . 18.6.5 Output from the mapping . . . . 18.6.6 Extract parts of a mapping . . . 18.6.7 Variance table . . . . . . . . . . 18.7 Reassemble contig . . . . . . . . . . 18.8 Secondary peak calling . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 400 401 401 402 402 403 405 407 409 410 411 413 414 414 414 415 416 418 419

CLC Genomics Workbench lets you import, trim and assemble DNA sequence reads from automated sequencing machines. A number of different formats are supported (see section 7.1.1). This chapter first explains how to trim sequence reads. Next follows a description of how to assemble reads into contigs both with and without a reference sequence. In the final section, the options for viewing and editing contigs are explained.

18.1

Importing and viewing trace data

A number of different binary trace data formats can be imported into the program, including Standard Chromatogram Format (.SCF), ABI sequencer data files (.ABI and .AB1), PHRED output files (.PHD) and PHRAP output files (.ACE) (see section 7.1.1). 400

CHAPTER 18. SEQUENCING DATA ANALYSES

401

After import, the sequence reads and their trace data are saved as DNA sequences. This means that all analyzes which apply to DNA sequences can be performed on the sequence reads, including e.g. BLAST and open reading frame prediction. You can see additional information about the quality of the traces by holding the mouse cursor on the imported sequence. This will display a tool tip as shown in figure 18.1.

Figure 18.1: A tooltip displaying information about the quality of the chromatogram. The qualities are based on the phred scoring system, with scores below 19 counted as low quality, scores between 20 and 39 counted as medium quality, and those 40 and above counted as high quality. If the trace file does not contain information about quality, only the sequence length will be shown. To view the trace data, open the sequence read in a standard sequence view ( ).

18.1.1

Scaling traces

The traces can be scaled by dragging the trace vertically as shown in figure figure 18.2. The Workbench automatically adjust the height of the traces to be readable, but if the trace height varies a lot, this manual scaling is very useful. The height of the area available for showing traces can be adjusted in the Side Panel as described insection 18.1.2.

Figure 18.2: Grab the traces to scale.

18.1.2

Trace settings in the Side Panel

In the Nucleotide info preference group the display of trace data can be selected and unselected. When selected, the trace data information is shown as a plot beneath the sequence. The appearance of the plot can be adjusted using the following options (see figure 18.3): Nucleotide trace. For each of the four nucleotides the trace data can be selected and unselected. Scale traces. A slider which allows the user to scale the height of the trace area. Scaling the traces individually is described in section 18.1.1.

CHAPTER 18. SEQUENCING DATA ANALYSES

402

Figure 18.3: A sequence with trace data. The preferences for viewing the trace are shown in the Side Panel.

18.2

Trim sequences

CLC Genomics Workbench offers a number of ways to trim your sequence reads prior to assembly. Trimming can be done either as a separate task before assembling, or it can be performed as an integrated part of the assembly process (see section 18.3). Trimming as a separate task can be done either manually or automatically. In both instances, trimming of a sequence does not cause data to be deleted, instead both the manual and automatic trimming will put a "Trim" annotation on the trimmed parts as an indication to the assembly algorithm that this part of the data is to be ignored (see figure 18.4). This means that the effect of different trimming schemes can easily be explored without the loss of data. To remove existing trimming from a sequence, simply remove its trim annotation (see section 10.3.2).

Figure 18.4: Trimming creates annotations on the regions that will be ignored in the assembly process.

18.2.1

Manual trimming

Sequence reads can be trimmed manually while inspecting their trace and quality data. Trimming sequences manually corresponds to adding annotation (see also section 10.3.2) but is special in the sense that trimming can only be applied to the ends of a sequence:

CHAPTER 18. SEQUENCING DATA ANALYSES double-click the sequence to trim in the Navigation Area | select the region you want to trim | right-click the selection | Trim sequence left/right to determine the direction of the trimming This will add trimming annotation to the end of the sequence in the selected direction.

403

18.2.2

Automatic trimming

Sequence reads can be trimmed automatically based on a number of different criteria. Automatic trimming is particularly useful in the following situations: If you have many sequence reads to be trimmed. If you wish to trim vector contamination from sequence reads. If you wish to ensure that the trimming is done according to the same criteria for all the sequence reads. To trim sequences automatically: select sequence(s) or sequence lists to trim | Toolbox in the Menu Bar | Sequencing Data Analyses ( ) | Trim Sequences ( ) This opens a dialog where you can alter your choice of sequences. When the sequences are selected, click Next. This opens the dialog displayed in figure 18.5.

Figure 18.5: Setting parameters for trimming. The following parameters can be adjusted in the dialog: Ignore existing trim information. If you have previously trimmed the sequences, you can check this to remove existing trimming annotation prior to analysis. Trim using quality scores. If the sequence files contain quality scores from a base-caller algorithm this information can be used for trimming sequence ends. The program uses the modified-Mott trimming algorithm for this purpose (Richard Mott, personal communication):

CHAPTER 18. SEQUENCING DATA ANALYSES

404

Quality scores in the Workbench are on a Phred scale in the Workbench (formats using other scales are converted during import). First step in the trim process is to convert the Q quality score (Q) to error probability: perror = 10 10 . (This now means that low values are high quality bases.) Next, for every base a new value is calculated: Limit perror . This value will be negative for low quality bases, where the error probability is high. For every base, the Workbench calculates the running sum of this value. If the sum drops below zero, it is set to zero. The part of the sequence to be retained after trimming is the region between the first positive value of the running sum and the highest value of the running sum. Everything before and after this region will be trimmed off. A read will be completely removed if the score never makes it above zero. At http://www.clcbio.com/files/usermanuals/trim.zip you find an example sequence and an Excel sheet showing the calculations done for this particular sequence to illustrate the procedure described above. Trim ambiguous nucleotides. This option trims the sequence ends based on the presence of ambiguous nucleotides (typically N). Note that the automated sequencer generating the data must be set to output ambiguous nucleotides in order for this option to apply. The algorithm takes as input the maximal number of ambiguous nucleotides allowed in the sequence after trimming. If this maximum is set to e.g. 3, the algorithm finds the maximum length region containing 3 or fewer ambiguities and then trims away the ends not included in this region. Trim contamination from vectors in UniVec database. If selected, the program will match the sequence reads against all vectors in the UniVec database and remove sequence ends with significant matches (the database is included when you install the CLC Genomics Workbench). A list of all the vectors in the UniVec database can be found at http: //www.ncbi.nlm.nih.gov/VecScreen/replist.html. Hit limit. Specifies how strictly vector contamination is trimmed. Since vector contamination usually occurs at the beginning or end of a sequence, different criteria are applied for terminal and internal matches. A match is considered terminal if it is located within the first 25 bases at either sequence end. Three match categories are defined according to the expected frequency of an alignment with the same score occurring between random sequences. The CLC Genomics Workbench uses the same settings as VecScreen (http://www.ncbi.nlm.nih.gov/VecScreen/ VecScreen.html): Weak. Expect 1 random match in 40 queries of length 350 kb Terminal match with Score 16 to 18. Internal match with Score 23 to 24. Moderate. Expect 1 random match in 1,000 queries of length 350 kb Terminal match with Score 19 to 23. Internal match with Score 25 to 29. Strong. Expect 1 random match in 1,000,000 queries of length 350 kb Terminal match with Score 24. Internal match with Score 30.

CHAPTER 18. SEQUENCING DATA ANALYSES

405

Note that selecting e.g. Weak will also include matches in the Moderate and Strong categories. Trim contamination from saved sequences. This option lets you select your own vector sequences that you know might be the cause of contamination. If you select this option, you will be able to select one or more sequences when you click Next. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. This will start the trimming process. Views of each trimmed sequence will be shown, and you can inspect the result by looking at the "Trim" annotations (they are colored red as default). If there are no trim annotations, the sequence has not been trimmed.

18.3

Assemble sequences

This section describes how to assemble a number of sequence reads into a contig without the use of a reference sequence (a known sequence that can be used for comparison with the other sequences, see section 18.4). To perform the assembly: select sequences to assemble | Toolbox in the Menu Bar | Sequencing Data Analyses ( ) | Assemble Sequences ( ) This opens a dialog where you can alter your choice of sequences which you want to assemble. You can also add sequence lists. Note! You can assemble a maximum of 2000 sequences at a time. To assemble more sequences, please use the De Novo Assembly ( Sequencing ( ) in the Toolbox. ) under High-throughput

When the sequences are selected, click Next. This will show the dialog in figure 18.6

Figure 18.6: Setting assembly parameters. This dialog gives you the following options for assembling: Trim sequence ends before assembly. If you have not previously trimmed the sequences, this can be done by checking this box. If selected, the next step in the dialog will allow you to specify settings for trimming (see section 19.3.1).

CHAPTER 18. SEQUENCING DATA ANALYSES

406

Minimum aligned read length. The minimum number of nucleotides in a read which must be successfully aligned to the contig. If this criteria is not met by a read, the read is excluded from the assembly. Alignment stringency. Specifies the stringency of the scoring function used by the alignment step in the contig assembly algorithm. A higher stringency level will tend to produce contigs with less ambiguities but will also tend to omit more sequencing reads and to generate more and shorter contigs. Three stringency levels can be set: Low. Medium. High. Conflicts. If there is a conflict, i.e. a position where there is disagreement about the residue (A, C, T or G), you can specify how the contig sequence should reflect the conflict: Vote (A, C, G, T). The conflict will be solved by counting instances of each nucleotide and then letting the majority decide the nucleotide in the contig. In case of equality, ACGT are given priority over one another in the stated order. Unknown nucleotide (N). The contig will be assigned an 'N' character in all positions with conflicts. Ambiguity nucleotides (R, Y, etc.). The contig will display an ambiguity nucleotide reflecting the different nucleotides found in the reads. For an overview of ambiguity codes, see Appendix I. Note, that conflicts will always be highlighted no matter which of the options you choose. Furthermore, each conflict will be marked as annotation on the contig sequence and will be present if the contig sequence is extracted for further analysis. As a result, the details of any experimental heterogeneity can be maintained and used when the result of single-sequence analyzes is interpreted. Read more about conflicts in section 18.6.4. Create full contigs, including trace data. This will create a contig where all the aligned reads are displayed below the contig sequence. (You can always extract the contig sequence without the reads later on.) For more information on how to use the contigs that are created, see section 18.6. Show tabular view of contigs. A contig can be shown both in a graphical as well as a tabular view. If you select this option, a tabular view of the contig will also be opened (Even if you do not select this option, you can show the tabular view of the contig later on by clicking Table ( ) at the bottom of the view.) For more information about the tabular view of contigs, see section 18.6.7. Create only consensus sequences. This will not display a contig but will only output the assembled contig sequences as single nucleotide sequences. If you choose this option it is not possible to validate the assembly process and edit the contig based on the traces. If you have chosen to "Trim sequences", click Next and you will be able to set trim parameters (see section 19.3.1). Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish.

CHAPTER 18. SEQUENCING DATA ANALYSES

407

When the assembly process has ended, a number of views will be shown, each containing a contig of two or more sequences that have been matched. If the number of contigs seem too high or low, try again with another Alignment stringency setting. Depending on your choices of output options above, the views will include trace files or only contig sequences. However, the calculation of the contig is carried out the same way, no matter how the contig is displayed. See section 18.6 on how to use the resulting contigs.

18.4

Assemble to reference sequence

This section describes how to assemble a number of sequence reads into a contig using a reference sequence. A reference sequence can be particularly helpful when the objective is to characterize SNP variation in the data. To start the assembly: select sequences to assemble | Toolbox in the Menu Bar | Sequencing Data Analyses ( ) | Assemble Sequences to Reference ( ) This opens a dialog where you can alter your choice of sequences which you want to assemble. You can also add sequence lists. Note! You can assemble a maximum of 2000 sequences at a time. To assemble more sequences, please use the Map Reads to Reference ( throughput Sequencing ( ) in the Toolbox. ) under High-

When the sequences are selected, click Next, and you will see the dialog shown in figure 18.7

Figure 18.7: Setting assembly parameters when assembling to a reference sequence. This dialog gives you the following options for assembling: Reference sequence. Click the Browse and select element icon ( sequence to use as reference. ) in order to select a

Include reference sequence in contig(s). This will display a contig data-object with the reference sequence at the top and the reads aligned below. This option is useful when

CHAPTER 18. SEQUENCING DATA ANALYSES

408

comparing sequence reads to a closely related reference sequence e.g. when sequencing for SNP characterization. Only include part of the reference sequence in the contig. If the aligned sequence reads only cover a small part of the reference sequence, it may not be desirable to include the whole reference sequence in the contig data-object. When selected, this option lets you specify how many residues from the reference sequence that should be kept on each side of the region spanned by sequencing reads by entering the number in the Extra residues field. Do not include reference sequence in contig(s). This will produce a contig data-object without the reference sequence. The contig is created in the same way as when you make an ordinary assembly (see section 18.3), but the reference sequence is omitted in the resulting contig. In the assembly process the reference sequence is only used as a scaffold for alignment. This option is useful when performing assembly with a reference sequence that is not closely related to the sequencing reads. Conflicts resolved with. If there is a conflict, i.e. a position where there is disagreement about the residue (A, C, T or G), you can specify how the contig sequence should reflect this conflict: Unknown nucleotide (N). The contig will be assigned an 'N' character in all positions with conflicts. Ambiguity nucleotides (R, Y, etc.). The contig will display an ambiguity nucleotide reflecting the different nucleotides found in the reads. For an overview of ambiguity codes, see Appendix I. Vote (A, C, G, T). The conflict will be solved by counting instances of each nucleotide and then letting the majority decide the nucleotide in the contig. In case of equality, ACGT are given priority over one another in the stated order. Note, that conflicts will always be highlighted no matter which of the options you choose. Furthermore, each conflict will be marked as annotation on the contig sequence and will be present if the contig sequence is extracted for further analysis. As a result, the details of any experimental heterogeneity can be maintained and used when the result of single-sequence analyzes is interpreted. When the parameters have been adjusted, click Next, to see the dialog shown in figure 18.8 In this dialog, you can specify more options: Minimum aligned read length. The minimum number of nucleotides in a read which must be successfully aligned to the contig. If this criteria is not met by a read, this is excluded from the assembly. Alignment stringency. Specifies the stringency of the scoring function used by the alignment step in the contig assembly algorithm. A higher stringency level will tend to produce contigs with less ambiguities but will also tend to omit more sequencing reads and to generate more and shorter contigs. Three stringency levels can be set: Low. Medium.

CHAPTER 18. SEQUENCING DATA ANALYSES

409

Figure 18.8: Different options for the output of the assembly. High. Use existing trim information. When using a reference sequence, trimming is generally not necessary, but if you wish to use trimming you can check this box. It requires that the sequence reads have been trimmed beforehand (see section 18.2 for more information about trimming). Show tabular view of contigs. A contig can be shown both in a graphical as well as a tabular view. If you select this option, a tabular view of the contig will also be opened (Even if you do not select this option, you can show the tabular view of the contig later on by clicking Show ( ) and selecting Table ( ).) For more information about the tabular view of contigs, see section 18.6.7. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. This will start the assembly process. See section 18.6 on how to use the resulting contigs.

18.5

Add sequences to an existing contig

This section describes how to assemble sequences to an existing contig. This feature can be used for example to provide a steady work-flow when a number of exons from the same gene are sequenced one at a time and assembled to a reference sequence. Note that the new sequences will be added to the existing contig which will not be extended. If the new sequences extend beyond the existing contig, they will be cut off. To start the assembly: select one contig and a number of sequences | Toolbox in the Menu Bar | Sequencing Data Analyses ( ) | Add Sequences to Contig ( ) or right-click in the empty white area of the contig | Add Sequences to Contig ( )

This opens a dialog where you can alter your choice of sequences which you want to assemble. You can also add sequence lists. When the elements are selected, click Next, and you will see the dialog shown in figure 18.9

CHAPTER 18. SEQUENCING DATA ANALYSES

410

Figure 18.9: Setting assembly parameters when assembling to an existing contig. The options in this dialog are similar to the options that are available when assembling to a reference sequence (see section 18.4). Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. This will start the assembly process. See section 18.6 on how to use the resulting contig. Note that the new sequences will be added to the existing contig which will not be extended. If the new sequences extend beyond the existing contig, they will be cut off.

18.6

View and edit read mappings

The result of the mapping process is one or more read mappings where the sequence reads have been aligned (see figure 18.10). If multiple reference sequences were used, this information will be in a table where the actual visual mapping can be opened by double-clicking. You can see that color of the residues and trace at the end of one of the reads has been faded. This indicates, that this region has not contributed to the mapping. This may be due to trimming before or during the assembly or due to misalignment to the other reads. You can easily adjust the trimmed area to include more of the read in the mapping: simply drag the edge of the faded area as shown in figure 18.11. Note! This is only possible when you can see the residues on the reads. This means that you need to have zoomed in to 100% or more and chosen Compactness levels "Not compact", "Low" or "Packed". Otherwise the handles for dragging are not available (this is done in order to make the visual overview more simple). If reads have been reversed, this is indicated by red. Otherwise, the residues are colored green. The colors can be changed in the Side Panel as described in section 18.6.1 If you find out that the reversed reads should have been the forward reads and vice versa, you can reverse complement the whole mapping(imagine flipping the whole mapping): right-click in the empty white area of the mapping | Reverse Complement

CHAPTER 18. SEQUENCING DATA ANALYSES

411

Figure 18.10: The view of a read mapping. Notice that you can zoom to a very detailed level in read mappings.

Figure 18.11: Dragging the edge of the faded area.

18.6.1

View settings in the Side Panel

Apart from this the view resembles that of alignments (see section 22.2) but has some extra preferences in the Side Panel: 1 Read layout. A new preference group located at the top of the Side Panel: CompactnessThe compactness is an overall setting that lets you control the level of detail to be displayed on the sequencing reads. Please note that this setting affects many of the other settings in the Side Panel and the general behavior of the view as well. For example: if the compactness is set to Compact, you will not be able to see quality scores or annotations on the reads, no matter how this is specified in the respective settings. And when the compactness is Packed, it is not possible to edit the bases of any of the reads. There is a shortcut way of changing the compactness: Press and hold the Alt key while you scroll using your mouse wheel or touchpad. Not compact. The normal setting with full detail. Low. Hides trace data, quality scores and puts the reads' annotations on the sequence. Medium. The labels of the reads and their annotations are hidden, and the residues of the reads cannot be seen.
1

Note that for interpretation of mappings with large amounts of data, have a look at section 19.9

CHAPTER 18. SEQUENCING DATA ANALYSES

412

Compact. Even less space between the reads. Packed. All the other compactness settings will stack the reads on top of each other, but the packed setting will use all space available for displaying the reads. When zoomed in to 100%, you can see the residues but when zoomed out the reads will be represented as lines just as with the Compact setting. Please note that the packed mode is special because it does not allow any editing of the read sequences and selections, and furthermore the color coding that can be specified elsewhere in the Side Panel does not take effect. Gather sequences at top. Enabling this option affects the view that is shown when scrolling horizontally. If selected, the sequence reads which did not contribute to the visible part of the mapping will be omitted whereas the contributing sequence reads will automatically be placed right below the reference. This setting is not relevant when the compactness is packed. Show sequence ends. Regions that have been trimmed are shown with faded traces and residues. This illustrates that these regions have been ignored during the assembly. Show mismatches. When the compactness is packed, you can highlight mismatches which will get a color according to the Rasmol color scheme. A mismatch is whenever the base is different from the reference sequence at this position. This setting also causes the reads that have mismatches to be floated at the top of the view. Packed read height. When the compactness is packed, you can choose the height of the visible reads. When there are more reads than the height specified, an overflow graph will be displayed below the reads. Find Conflict. Clicking this button selects the next position where there is an conflict between the sequence reads. Residues that are different from the reference are colored (as default), providing an overview of the conflicts. Since the next conflict is automatically selected it is easy to make changes. You can also use the Space key to find the next conflict. Alignment info. There is one additional parameter: Coverage: Shows how many sequence reads that are contributing information to a given position in the mapping. The level of coverage is relative to the overall number of sequence reads. Foreground color. Colors the letters using a gradient, where the left side color is used for low coverage and the right side is used for maximum coverage. Background color. Colors the background of the letters using a gradient, where the left side color is used for low coverage and the right side is used for maximum coverage Graph. The coverage is displayed as a graph (Learn how to export the data behind the graph in section 7.4). Height. Specifies the height of the graph. Type. The graph can be displayed as Line plot, Bar plot or as a Color bar. Color box. For Line and Bar plots, the color of the plot can be set by clicking the color box. If a Color bar is chosen, the color box is replaced by a gradient color box as described under Foreground color. Residue coloring. There is one additional parameter:

CHAPTER 18. SEQUENCING DATA ANALYSES

413

Sequence colors. This option lets you use different colors for the reads. Main. The color of the consensus and reference sequence. Black per default. Forward. The color of forward reads (single reads). Green per default. Reverse. The color of reverse reads (single reads). Red per default. Paired. The color of paired reads. Blue per default. Note that reads from broken pairs are colored according to their Forward/Reverse orientation or as a Non-specific match, but with a darker nuance than ordinary single reads. Non-specific matches. When a read would have matched equally well another place in the mapping, it is considered a non-specific match. This color will "overrule" the other colors. Note that if you are mapping with several reference sequences, a read is considered a double match when it matches more than once across all the contigs/references. A non-specific match is yellow per default. Beside from these preferences, all the functionalities of the alignment view are available. This means that you can e.g. add annotations (such as SNP annotations) to regions of interest. However, some of the parameters from alignment views are set at a different default value in the view of contigs. Trace data of the sequencing reads are shown if present (can be enabled and disabled under the Nucleotide info preference group), and the Color different residues option is also enabled in order to provide a better overview of conflicts (can be changed in the Alignment info preference group).

18.6.2

Editing the read mapping

When editing mappings, you are typically interested in confirming or changing single bases, and this can be done simply by: selecting the base | typing the right base Some users prefer to use lower-case letters in order to be able to see which bases were altered when they use the results later on. In CLC Genomics Workbench all changes are recorded in the history log (see section 8) allowing the user to quickly reconstruct the actions performed in the editing session. There are three shortcut keys for easily finding the positions where there are conflicts: Space bar: Finds the next conflict. "." (punctuation mark key): Finds the next conflict. "," (comma key): Finds the previous conflict. In the mapping view, you can use Zoom in ( ) to zoom to a greater level of detail than in other views (see figure 18.10). This is useful for discerning the trace curves. If you want to replace a residue with a gap, use the Delete key. If you wish to edit a selection of more than one residue: right-click the selection | Edit Selection ( )

This will show a warning dialog, but you can choose never to see this dialog again by clicking the checkbox at the bottom of the dialog.

CHAPTER 18. SEQUENCING DATA ANALYSES

414

Note that for mappings with more than 1000 reads, you can only do single-residue replacements (you can't delete or edit a selection). When the compactness is Packed, you cannot edit any of the reads.

18.6.3

Sorting reads

If you wish to change the order of the sequence reads, simply drag the label of the sequence up and down. Note that this is not possible if you have chosen Gather sequences at top or set the compactness to Packed in the Side Panel. You can also sort the reads by right-clicking a sequence label and choose from the following options: Sort Reads by Alignment Start Position. This will list the first read in the alignment at the top etc. Sort Reads by Name. Sort the reads alphabetically. Sort Reads by Length. The shortest reads will be listed at the top.

18.6.4

Read conflicts

When the mapping is created, conflicts between the reads are annotated on the consensus sequence. The definition of a conflict is a position where at least one of the reads have a different residue. A conflict can be in two states: Conflict. Both the annotation and the corresponding row in the Table ( ) are colored red. ) are colored

Resolved. Both the annotation and the corresponding row in the Table ( green.

The conflict can be resolved by correcting the deviating residues in the reads as described above. A fast way of making all the reads reflect the consensus sequence is to select the position in the consensus, right-click the selection, and choose Transfer Selection to All Reads. The opposite is also possible: make a selection on one of the reads, right click, and Transfer Selection to Contig Sequence.

18.6.5

Output from the mapping

Due to the integrated nature of CLC Genomics Workbench it is easy to use the consensus sequences as input for additional analyzes. There are two options: right-click the name of the consensus sequence (to the left) | Open Copy of Sequence | Save ( ) the new sequence right-click the name of the consensus sequence (to the left) | Open This Sequence The first option will create a copy of the sequence which can be saved and used independently. The second option will not crate a new sequence but simply let you see the sequence in a

CHAPTER 18. SEQUENCING DATA ANALYSES

415

sequence view. This means that the sequence still "belong" to the mapping and will be saved together with the mapping. It also means that if you add annotations to the sequence, they will be shown in the mapping view as well. This can be very convenient e.g. for Primer design ( ). In addition to the two options described above, you can also open the consensus sequence including gaps (Open Copy of Sequence Including Gaps). This will replace all gaps with Ns. If you wish to BLAST the consensus sequence, simply select the whole contig for your BLAST search. It will automatically extract the consensus sequence and perform the BLAST search. In order to preserve the history of the changes you have made to the contig, the contig itself should be saved from the contig view, using either the save button ( ) or by dragging it to the Navigation Area.

18.6.6

Extract parts of a mapping

Sometimes it is useful to extract part of a mapping for in-depth analysis. This could be the case if you have performed an assembly of several genes and you want to look at a particular gene or region in isolation. This is possible through the right-click menu of the reference or consensus sequence: Select on the reference or consensus sequence the part of the contig to extract | Right-click | Extract from Selection This will present the dialog shown in figure 18.12.

Figure 18.12: Selecting the reads to include. The purpose of this dialog is to let you specify what kind of reads you want to include. Per default all reads are included. The options are:

CHAPTER 18. SEQUENCING DATA ANALYSES

416

Paired status Include intact paired reads When paired reads are placed within the paired distance specified, they will fall into this category. Per default, these reads are colored in blue. Include paired reads from broken pairs When a pair is broken, either because only one read in the pair matches, or because the distance or relative orientation is wrong, the reads are placed and colored as single reads, but you can still extract them by checking this box. Include single reads This will include reads that are marked as single reads (as opposed to paired reads). Note that paired reads that have been broken during assembly are not included in this category. Single reads that come from trimming paired sequence lists are included in this category. Match specificity Include specific matches Reads that only are mapped to one position. Include non-specific matches Reads that have multiple equally good alignments to the reference. These reads are colored yellow per default. Alignment quality Include perfectly aligned reads Reads where the full read is perfectly aligned to the reference sequence (or consensus sequence for de novo assemblies). Note that at the end of the contig, reads may extend beyond the contig (this is not visible unless you make a selection on the read and observe the position numbering in the status bar). Such reads are not considered perfectly aligned reads because they don't align in their entire length. Include reads with less than perfect alignment Reads with mismatches, insertions or deletions, or with unaligned nucleotides at the ends (the faded part of a read). Note that only reads that are completely covered by the selection will be part of the new contig. One of the benefits of this is that you can actually use this tool to extract subset of reads from a contig. An example work flow could look like this: 1. Select the whole reference sequence 2. Right-click and Extract from Selection 3. Choose to include only paired matches 4. Extract the reads from the new file (see section 10.7.3) You will now have all paired reads from the original mapping in a list.

18.6.7

Variance table

In addition to the standard graphical display of a mapping as described above, you can also see a tabular overview of the conflicts between the reads by clicking the Table ( ) icon at the bottom of the view. This will display a new view of the conflicts as shown in figure 18.13. The table has the following columns:

CHAPTER 18. SEQUENCING DATA ANALYSES

417

Figure 18.13: The graphical view is displayed at the top. At the bottom the conflicts are shown in a table. At the conflict at position 637, the user has entered a comment in the table. This comment is now also reflected on the tooltip of the conflict annotation in the graphical view above. Reference position. The position of the conflict measured from the starting point of the reference sequence. Consensus position. The position of the conflict measured from the starting point of the consensus sequence. Consensus residue. The consensus's residue at this position. The residue can be edited in the graphical view, as described above. Other residues. Lists the residues of the reads. Inside the brackets, you can see the number of reads having this residue at this position. In the example in figure 18.13, you can see that at position 637 there is a 'C' in the top read in the graphical view. The other two reads have a 'T'. Therefore, the table displays the following text: 'C (1), T (2)'. IUPAC. The ambiguity code for this position. The ambiguity code reflects the residues in the reads - not in the consensus sequence. (The IUPAC codes can be found in section I.) Status. The status can either be conflict or resolved:

CHAPTER 18. SEQUENCING DATA ANALYSES

418

Conflict. Initially, all the rows in the table have this status. This means that there is one or more differences between the sequences at this position. Resolved. If you edit the sequences, e.g. if there was an error in one of the sequences, and they now all have the same residue at this position, the status is set to Resolved. Note. Can be used for your own comments on this conflict. Right-click in this cell of the table to add or edit the comments. The comments in the table are associated with the conflict annotation in the graphical view. Therefore, the comments you enter in the table will also be attached to the annotation on the consensus sequence (the comments can be displayed by placing the mouse cursor on the annotation for one second - see figure 18.13). The comments are saved when you Save ( ). By clicking a row in the table, the corresponding position is highlighted in the graphical view. Clicking the rows of the table is another way of navigating the mapping, apart from using the Find Conflict button or using the Space bar. You can use the up and down arrow keys to navigate the rows of the table.

18.7

Reassemble contig

If you have edited a contig, changed trimmed regions, or added or removed reads, you may wish to reassemble the contig. This can be done in two ways: Toolbox in the Menu Bar | Sequencing Data Analyses ( ( ) | select the contig and click Next ) | Reassemble Contig )

or right-click in the empty white area of the contig | Reassemble contig ( This opens a dialog as shown in figure 18.14

Figure 18.14: Re-assembling a contig. In this dialog, you can choose: De novo assembly. This will perform a normal assembly in the same way as if you had selected the reads as individual sequences. When you click Next, you will follow the same steps as described in section 18.3. The consensus sequence of the contig will be ignored.

CHAPTER 18. SEQUENCING DATA ANALYSES

419

Reference assembly. This will use the consensus sequence of the contig as reference. When you click Next, you will follow the same steps as described in section 18.4. When you click Finish, a new contig is created, so you do not lose the information in the old contig.

18.8

Secondary peak calling

CLC Genomics Workbench is able to detect secondary peaks - a peak within a peak - to help discover heterozygous mutations. Looking at the height of the peak below the top peak, the CLC Genomics Workbench considers all positions in a sequence, and if a peak is higher than the threshold set by the user, it will be "called". The peak is called by changing the residue to an ambiguity character and by adding an annotation at this position. To call secondary peaks: select sequence(s) | Toolbox in the Menu Bar | Sequencing Data Analyses ( Call Secondary Peaks ( ) This opens a dialog where you can alter your choice of sequences. When the sequences are selected, click Next. This opens the dialog displayed in figure 18.15. )|

Figure 18.15: Setting parameters secondary peak calling. The following parameters can be adjusted in the dialog: Percent of max peak height for calling. Adjust this value to specify how high the secondary peak must be to be called. Use IUPAC code / N for ambiguous nucleotides. When a secondary peak is called, the residue at this position can either be replaced by an N or by a ambiguity character based on the IUPAC codes (see section I).

CHAPTER 18. SEQUENCING DATA ANALYSES

420

Add annotations. In addition to changing the actual sequence, annotations can be added for each base which has been called. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. This will start the secondary peak calling. A detailed history entry will be added to the history specifying all the changes made to the sequence.

Chapter 19

High-throughput sequencing
Contents
19.1 Import high-throughput sequencing data . . . 19.1.1 454 from Roche Applied Science . . . . . 19.1.2 Illumina Genome Analyzer from Illumina . 19.1.3 SOLiD from Life Technologies . . . . . . . 19.1.4 Fasta format . . . . . . . . . . . . . . . . 19.1.5 Sanger sequencing data . . . . . . . . . . 19.1.6 Ion Torrent PGM from Life Technologies . 19.1.7 Complete Genomics . . . . . . . . . . . . 19.1.8 General notes on handling paired data . . 19.1.9 SAM and BAM mapping files . . . . . . . 19.1.10 Tabular mapping files . . . . . . . . . . . 19.2 Multiplexing . . . . . . . . . . . . . . . . . . . 19.2.1 Sort sequences by name . . . . . . . . . 19.2.2 Process tagged sequences . . . . . . . . 19.3 Trim sequences . . . . . . . . . . . . . . . . . 19.3.1 Quality trimming . . . . . . . . . . . . . . 19.3.2 Adapter trimming . . . . . . . . . . . . . 19.3.3 Length trimming . . . . . . . . . . . . . . 19.3.4 Trim output . . . . . . . . . . . . . . . . . 19.4 De novo assembly . . . . . . . . . . . . . . . . 19.4.1 How it works . . . . . . . . . . . . . . . . 19.4.2 Randomness in the results . . . . . . . . 19.4.3 SOLiD data support in de novo assembly 19.4.4 De novo assembly parameters . . . . . . 19.4.5 Word size and contig lengths . . . . . . . 19.4.6 Assembly reporting options . . . . . . . . 19.5 Map reads to reference . . . . . . . . . . . . . 19.5.1 Starting the read mapping . . . . . . . . . 19.5.2 Including or excluding regions (masking) . 19.5.3 Mapping parameters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 423 423 425 430 433 434 435 436 437 437 439 441 442 444 450 450 452 458 458 460 461 464 464 465 466 466 468 468 468 469

421

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

422

19.5.4 General mapping options . . . . . . . . . . . . . 19.5.5 Assembly reporting options . . . . . . . . . . . . 19.6 Mapping reports . . . . . . . . . . . . . . . . . . . . . 19.6.1 Detailed mapping report . . . . . . . . . . . . . . 19.6.2 Summary assembly and mapping report . . . . . 19.7 Mapping table . . . . . . . . . . . . . . . . . . . . . . 19.8 Color space . . . . . . . . . . . . . . . . . . . . . . . 19.8.1 Sequencing . . . . . . . . . . . . . . . . . . . . 19.8.2 Error modes . . . . . . . . . . . . . . . . . . . . 19.8.3 Mapping in color space . . . . . . . . . . . . . . 19.8.4 Viewing color space information . . . . . . . . . 19.9 Interpreting genome-scale mappings . . . . . . . . . 19.9.1 Getting an overview - zooming and navigating . . 19.9.2 Single reads - coverage and conflicts . . . . . . . 19.9.3 Interpreting genomic re-arrangements . . . . . . 19.9.4 Further analysis of read mappings . . . . . . . . 19.10 Merge mapping results . . . . . . . . . . . . . . . . . 19.11 SNP detection . . . . . . . . . . . . . . . . . . . . . . 19.11.1 Assessing the quality of the neighborhood bases 19.11.2 Significance of variation: is it a SNP? . . . . . . . 19.11.3 Reporting the SNPs . . . . . . . . . . . . . . . . 19.11.4 Adjacent SNPs affecting the same codon . . . . 19.12 DIP detection . . . . . . . . . . . . . . . . . . . . . . 19.12.1 Experimental support of a DIP . . . . . . . . . . 19.12.2 Reporting the DIPs . . . . . . . . . . . . . . . . . 19.13 ChIP sequencing . . . . . . . . . . . . . . . . . . . . 19.13.1 Peak finding and false discovery rates . . . . . . 19.13.2 Peak refinement . . . . . . . . . . . . . . . . . . 19.13.3 Reporting the results . . . . . . . . . . . . . . . 19.14 RNA-Seq analysis . . . . . . . . . . . . . . . . . . . . 19.14.1 Defining reference genome and mapping settings 19.14.2 Exon identification and discovery . . . . . . . . . 19.14.3 RNA-Seq output options . . . . . . . . . . . . . . 19.14.4 Interpreting the RNA-Seq analysis result . . . . . 19.15 Expression profiling by tags . . . . . . . . . . . . . . 19.15.1 Extract and count tags . . . . . . . . . . . . . . 19.15.2 Create virtual tag list . . . . . . . . . . . . . . . 19.15.3 Annotate tag experiment . . . . . . . . . . . . . 19.16 Small RNA analysis . . . . . . . . . . . . . . . . . . . 19.16.1 Extract and count . . . . . . . . . . . . . . . . . 19.16.2 Downloading miRBase . . . . . . . . . . . . . . . 19.16.3 Annotating and merging small RNA samples . . . 19.16.4 Working with the small RNA sample . . . . . . . 19.16.5 Exploring novel miRNAs . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

475 476 477 477 482 483 485 485 486 486 489 489 489 490 491 498 498 498 499 501 503 506 507 509 511 513 513 515 517 520 522 526 527 530 535 536 539 543 545 546 550 551 559 561

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

423

The so-called Next Generation Sequencing (NGS) technologies encompass a range of technologies generating huge amounts of sequencing data at a very high speed compared to traditional Sanger sequencing. The CLC Genomics Workbench lets you import, trim, map, assemble and analyze DNA sequence reads from these high-throughput sequencing machines: The 454 FLX System from Roche Illumina's Genome Analyzer SOLiD system from Applied Biosystems (read mapping is performed in color space, see section 19.8) Ion Torrent from Life Technologies The CLC Genomics Workbench supports paired data from all platforms. Knowing the approximate distance between two reads can enable better determination over repeat regions, where assembly of short reads can be difficult, and enhances the possibility of correctly assembling data. It also enables a wide array of new approaches to interpreting the sequencing data. The first section in this chapter focuses on importing NGS data. These data are different from general data formats accepted by the CLC Genomics Workbench, and require more explanation. After the import section, the trimming capability of the CLC Genomics Workbenchis described. This includes the ability to trim on quality and length, as well as trim on adapters and de-multiplex datasets. After these sections, we go on to describe the various analysis possibilities available once you have imported your data into the CLC Genomics Workbench.

19.1
Going to:

Import high-throughput sequencing data

This section describes how to import data generated by high-throughput sequencing machines.

File | Import High-Throughput Sequencing Data (

will bring up a list of the supported NGS data types, as shown in figure 19.1. Select the appropriate format and then fill in the information as explained in the following sections. Please note that alignments of Complete Genomics data can be imported using the SAM/BAM importer, see section 19.1.7 below.

19.1.1

454 from Roche Applied Science

Choosing the Roche 454 import will open the dialog shown in figure 19.2. We support import of two kinds of data from 454 GS FLX systems: Flowgram files (.sff) which contain both sequence data and quality scores amongst others. However, the flowgram information is currently not used by CLC Genomics Workbench. There

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

424

Figure 19.1: Choosing what kind of data you wish to import.

Figure 19.2: Importing data from Roche 454. is an extra option to make use of clipping information (this will remove parts of the sequence as specified in the .sff file). Fasta/qual files: 454 FASTA files (.fna) which contain the sequence data. Quality files (.qual) which contain the quality scores.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING For all formats, compressed data in gzip format is also supported (.gz). The General options to the left are:

425

Paired reads. The paired protocol for 454 entails that the forward and reverse reads are separated by a linker sequence. During import of paired data, the linker sequence is removed and the forward and reverse reads are separated and put into the same sequence list (their status as forward and reverse reads is preserved). You can change the linker sequence in the Preferences (in the Edit menu) under Data. Since the linker for the FLX and Titanium versions are different, you can choose the appropriate protocol during import, and in the preferences you can supply a linker for both platforms (see figure 19.3. Note that since the FLX linker is palindromic, it will only be searched on the plus strand, whereas the Titanium linker will be found on both strands. Some of the sequences may not have the linker in the middle of the sequence, and in that case the partial linker sequence is still removed, and the single read is put into a separate sequence list. Thus when you import 454 paired data, you may end up with two sequence lists: one for paired reads and one for single reads. Note that for de novo assembly projects, only the paired list should be used since the single reads list may contain reads where there is still a linker sequence present but only partially due to sequencing errors. Read more about handling paired data in section 19.1.8. Discard read names. For high-throughput sequencing data, the naming of the individual reads is often irrelevant given the huge amount of reads. This option allows you to discard this option to save disk space. Discard quality scores. Quality scores are visualized in the mapping view and they are used for SNP detection. If this is not relevant for your work, you can choose to Discard quality scores. One of the benefits from discarding quality scores is that you will gain a lot in terms of reduced disk space usage and memory consumption. If you have selected the fna/qual option and choose to discard quality scores, you do not need to select a .qual file. Note! During import, partial adapter sequences are removed (TCAG and ATGC), and if the full sequencing adapters GCCTTGCCAGCCCGCTCAG, GCCTCCCTCGCGCCATCAG or their reverse complements are found, they are also removed (including tailing Ns). If you do not wish to remove the adapter sequences (e.g. if they have already been removed by other software), please uncheck the Remove adapter sequence option. Click Next to adjust how to handle the results (see section 9.2). We recommend choosing Save in order to save the results directly to a folder, since you probably want to save anyway before proceeding with your analysis. There is an option to put the import data into a separate folder. This can be handy for better organizing subsequent analysis results and for batching (see section 9.1).

19.1.2

Illumina Genome Analyzer from Illumina

Choosing the Illumina import will open the dialog shown in figure 19.4. The file formats accepted are: Fastq

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

426

Figure 19.3: Specifying linkers for 454 import.

Figure 19.4: Importing data from Illumina's Genome Analyzer. Scarf Qseq Paired data in any of these formats can be imported. Note that there is information inside qseq and fastq files specifying whether a read has passed a quality filter or not. If you check Remove failed reads these reads will be ignored during import.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

427

For qseq files there is a flag at the end of each read with values 0 (failed) or 1 (passed). In this example, the read is marked as failed and if Remove failed reads is checked, the read is removed.
M10 68 1 1 28680 29475 0 1 CATGGCCGTACAGGAAACACACATCATAGCATCACACGA BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB 0

For fastq files, part of the header information for the quality score has a flag where Y means failed and N means passed. In this example, the read has not passed the quality filter: @EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG If you import paired data and one read in a pair is removed during import, the remaining mate will be saved in a separate sequence list with single reads. For all formats, compressed data in gzip format is also supported (.gz). The General options to the left are: Paired reads. For paired import, you can select whether the data is Paired-end or Mate-pair. For paired data, the Workbench expects the first reads of the pairs to be in one file and the second reads of the pairs to be in another. When importing one pair of files, the first file in a pair will is assumed to contain the first reads of the pair, and the second file is assumed to contain the second read in a pair. So, for example, if you had specified that the pairs were in forward-reverse orientation, then the first file would be assumed to contain the forward reads. The second file would be assumed to contain the reverse reads. When loading files containing paired data, the CLC Genomics Workbench sorts the files selected according to rules based on the file naming scheme: For files coming off the CASAVA1.8 pipeline, we organise pairs according to their identifier and chunk number. Files named with _R1_ are assumed to contain the first sequences of the pairs, and those with _R2_ in the name are assumed to contain the second sequence of the pairs. For other files, we sort them all alphanumerically, and then group them two by two. This means that files 1 and 2 in the list are loaded as pairs, files 3 and 4 in the list are seen as pairs, and so on. In the simplest case, the files are typically named as shown in figure 19.4. In this case, the data is paired end, and the file containing the forward reads is called s_1_1_sequence.txt and the file containing reverse reads is called s_1_2_sequence.txt. Other common filenames for paired data, like _1_sequence.txt, _1_qseq.txt, _2_sequence.txt or _2_qseq.txt will be sorted alphanumerically. In such cases, files containing the final _1 should contain the first reads of a pair, and those containing the final _2 should contain the second reads of a pair. For files from CASAVA1.8, files with basenames like these: ID_R1_001, ID_R1_002, ID_R2_001, ID_R2_002 would be sorted in this order: 1. ID_R1_001 2. ID_R2_001 3. ID_R1_002

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING 4. ID_R2_002

428

The data in files ID_R1_001 and ID_R2_001 would be loaded as a pair, and ID_R1_002, ID_R2_002 would be loaded as a pair. Within each file, the first read of a pair will have a 1 somewhere in the information line. In most cases, this will be a /1 at the end of the read name. In some cases though (e.g. CASAVA1.8), there will be a 1 elsewhere in the information line for each sequence. Similarly, the second read of a pair will have a 2 somewhere in the information line - either a /2 at the end of the read name, or a 2 elsewhere in the information line. If you do not choose to discard your read names on import (see next parameter setting), you can quickly check that your paired data has imported in the pairs you expect by looking at the first few sequence names in your imported paired data object. The first two sequences should have the same name, except for a 1 or a 2 somewhere in the read name line. Paired-end and mate-pair data are handled the same way with regards to sorting on filenames. Their data structure is the same the same once imported into the Workbench. The only difference is that the expected orientation of the reads: reverse-forward in the case of mate pairs, and forward-reverse in the case of paired end data. Read more about handling paired data in section 19.1.8. Discard read names. For high-throughput sequencing data, the naming of the individual reads is often irrelevant given the huge amount of reads. This option allows you to discard quality scores to save disk space. Discard quality scores. Quality scores are visualized in the mapping view and they are used for SNP detection. If this is not relevant for your work, you can choose to Discard quality scores. One of the benefits from discarding quality scores is that you will gain a lot in terms of reduced disk space usage and memory consumption. Read more about the quality scores of Illumina below. Click Next to adjust how to handle the results (see section 9.2). We recommend choosing Save in order to save the results directly to a folder, since you probably want to save anyway before proceeding with your analysis. There is an option to put the import data into a separate folder. This can be handy for better organizing subsequent analysis results and for batching (see section 9.1). Quality scores in the Illumina platform The quality scores in the FASTQ format come in different versions. You can read more about the FASTQ format at http://en.wikipedia.org/wiki/FASTQ_format. When you select to import Illumina data and click Next there is an option to use different quality score schemes at the bottom of the dialog (see figure 19.5). There are three options: Automatic. Choosing this option, the Workbench attempts to automatically detect the quality score format. Sometimes this is not possible, and you have to specify the format yourself. In the cases where the Workbench is unable to determine the format, it is usually one of the Illumina Pipeline format files. If there are characters ; < = > or ? in the quality score information, it is the old Illumina pipeline format (ASCII values 59 to 63).

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

429

Figure 19.5: Selecting the quality score scheme. NCBI/Sanger or Illumina 1.8 and later. Using a Phred scale encoded using ASCII 33 to 93. This is the standard for fastq formats except for the early Illumina data formats (this changed with version 1.8 of the Illumina Pipeline). Illumina Pipeline 1.2 and earlier. Using a Solexa/Illumina scale (-5 to 40) using ASCII 59 to 104. The Workbench automatically converts these quality scores to the Phred scale on import in order to ensure a common scale for analyses across data sets from different platforms (see details on the conversion next to the sample below). Illumina Pipeline 1.3 and 1.4. Using a Phred scale using ASCII 64 to 104. Illumina Pipeline 1.5 to 1.7. Using a Phred scale using ASCII 64 to 104. Values 0 (@) and 1 (A) are not used anymore. Value 2 (B) has special meaning and is used as a trim clipping. This means that when selecting Illumina Pipeline 1.5 and later, the reads are automatically trimmed when a B is encountered in the input file. Small sample of all three kinds of files are shown below. The names of the reads have no influence on the quality score format: NCBI/Sanger Phred scores: @SRR001926.1 FC00002:7:1:111:750 length=36 TTTTTGTAAGGAGGGGGGTCATCAAAATTTGCAAAA +SRR001926.1 FC00002:7:1:111:750 length=36 IIIIIIIIIIIIIIIIIIIIIIIIIFIIIIIB<IH @SRR001926.7 FC00002:7:1:110:453 length=36 TTATATGGAGGCTTTAAGAGTCATAGGTTGTTCCCC +SRR001926.7 FC00002:7:1:110:453 length=36 IIIIIIIIIII:III?=IIIIII+&III/3I8F/& Illumina Pipeline 1.2 and earlier (note the question mark at the end of line 4 - this is one of the values that are unique to the old Illumina pipeline format): @SLXA-EAS1_89:1:1:672:654/1 GCTACGGAATAAAACCAGGAACAACAGACCCAGCA

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

430

+SLXA-EAS1_89:1:1:672:654/1 cccccccccccccccccccc]ccVcZccbSYb? @SLXA-EAS1_89:1:1:657:649/1 GCAGAAAATGGGAGTGAAAATCTCCGATGAGCAGC +SLXA-EAS1_89:1:1:657:649/1 ccccccccccbccbccbcccbcccZcc^bR^ The formulas used for converting the special Solexa-scale quality scores to Phred-scale: Qphred = 10 log10 p Qsolexa = 10 log10
p 1p

A sample of the quality scores of the Illumina Pipeline 1.3 and 1.4: @HWI-E4_9_30WAF:1:1:8:178 GCCAGCGGCGCAAAATGNCGGCGGCGATGACCTTC +HWI-E4_9_30WAF:1:1:8:178 babaaaa\ababaaaaREXabaaaaaaaaaaaaaa @HWI-E4_9_30WAF:1:1:8:1689 GATGGAGATCTCGACCTNATAGGTGCCCTCATCGG +HWI-E4_9_30WAF:1:1:8:1689 aab]_aaaaaaaaaa[ERabaaa\aaaaaaaa[ Note that it is not possible to see from that data itself that it is actually not Illumina Pipeline 1.2 and earlier, since they use the same range of ASCII values. To learn more about ASCII values, please see http://en.wikipedia.org/wiki/Ascii#ASCII_ printable_characters.

19.1.3

SOLiD from Life Technologies

Choosing the SOLiD import will open the dialog shown in figure 19.6. The file format accepted is the csfasta format which is the color space version of fasta format. If you want to import quality scores, a qual files should also be provided. The reads in a csfasta file look like this: >2_14_26_F3 T011213122200221123032111221021210131332222101 >2_14_192_F3 T110021221100310030120022032222111321022112223 >2_14_233_F3 T011001332311121212312022310203312201132111223 >2_14_294_F3 T213012132300000021323212232.03300033102330332 All reads start with a T which specifies the right phasing of the color sequence. If a reads has a . as you can see in the last read in the example above, it means that the color calling was ambiguous (this would have been an N if we were in base space). In this case, the

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

431

Figure 19.6: Importing data from SOLiD from Applied Biosystems. Workbench simply cuts off the rest of the read, since there is no way to know the right phase of the rest of the colors in the read. If the read starts with a dot, it is not imported. If all reads start with a dot, a warning dialog will be displayed. When the example above is imported into the Workbench, it looks as shown in figure 19.7.

Figure 19.7: Importing data from SOLiD from Applied Biosystems. Note that the fourth read is cut off so that the color following the dot are not included For more information about color space, please see section 19.8. In addition to the native csfasta format used by SOLiD, you can also input data in fastq format. This is particularly useful for data downloaded from the Sequence Read Archive at NCBI (http://www.ncbi.nlm.nih.gov/Traces/sra/). An example of a SOLiD fastq file is shown here with both quality scores and the color space encoding:

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

432

@SRR016056.1.1 AMELIA_20071210_2_YorubanCGB_Frag_16bit_2_51_130.1 T31000313121310211022312223311212113022121201332213 +SRR016056.1.1 AMELIA_20071210_2_YorubanCGB_Frag_16bit_2_51_130.1 !*%;2%%050%03%%5*.%%%),%%%%&%%%%%%%%%%%%%3+%%% @SRR016056.2.1 AMELIA_20071210_2_YorubanCGB_Frag_16bit_2_51_223.1 T20002201120021211012010332211122133212331221302222 +SRR016056.2.1 AMELIA_20071210_2_YorubanCGB_Frag_16bit_2_51_223.1 !%%)%))&%(((&%/&)%+(%%%&%%%%%%%%%%%%%%%+%%%%%%+ For all formats, compressed data in gzip format is also supported (.gz). The General options to the left are: Paired reads. When you import paired data, two different protocols are supported:

length=50 length=50 length=50 length=50

Mate-pair. For mate-pair data, the reads should be in two files with _F3 and _R3 in front of the the file extension. The orientation of the reads is expected to be forward-forward. Paired-end. For paired-end data, the reads should be in two files with _F3 and _F5-PE or _F5-BC. The orientation is expected to be forward-reverse. Read more about handling paired data in section 19.1.8. An example of a complete list of the four files needed for a SOLiD mate-paired data set including quality scores: dataset_F3.csfasta dataset_R3.csfasta or dataset_F3.csfasta dataset_R3.csfasta dataset_F3_.QV.qual dataset_R3_.QV.qual dataset_F3.qual dataset_R3.qual

Discard read names. For high-throughput sequencing data, the naming of the individual reads is often irrelevant given the huge amount of reads. This option allows you to discard this option to save disk space. Discard quality scores. Quality scores are visualized in the mapping view and they are used for SNP detection. If this is not relevant for your work, you can choose to Discard quality scores. One of the benefits from discarding quality scores is that you will gain a lot in terms of reduced disk space usage and memory consumption. If you choose to discard quality scores, you do not need to select a .qual file. Click Next to adjust how to handle the results (see section 9.2). We recommend choosing Save in order to save the results directly to a folder, since you probably want to save anyway before proceeding with your analysis. There is an option to put the import data into a separate folder. This can be handy for better organizing subsequent analysis results and for batching (see section 9.1).

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

433

19.1.4

Fasta format

Data coming in a standard fasta format can also be imported using the standard Import ( ), see section 7.1. However, using the special high-throughput sequencing data import is recommended since the data is imported in a "leaner" format than using the standard import. This also means that all descriptions from the fasta files are ignored (usually there are none anyway for this kind of data). The dialog for importing data in fasta format is shown in figure 19.8.

Figure 19.8: Importing data in fasta format. Compressed data in gzip format is also supported (.gz). The General options to the left are: Paired reads. For paired import, the Workbench expects the forward reads to be in one file and the reverse reads in another. The Workbench will sort the files before import and then assume that the first and second file belong together, and that the third and fourth file belong together etc. At the bottom of the dialog, you can choose whether the ordering of the files is Forward-reverse or Reverse-forward. As an example, you could have a data set with two files: sample1_fwd containing all the forward reads and sample1_rev containing all the reverse reads. In each file, the reads have to match each other, so that the first read in the fwd list should be paired with the first read in the rev list. Note that you can specify the insert sizes when running mapping and assembly. If you have data sets with different insert sizes, you should import each data set individually in order to be able to specify different insert sizes. Read more about handling paired data in section 19.1.8. Discard read names. For high-throughput sequencing data, the naming of the individual reads is often irrelevant given the huge amount of reads. This option allows you to discard this option to save disk space. Discard quality scores. This option is not relevant for fasta import, since quality scores are

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING not supported.

434

Click Next to adjust how to handle the results (see section 9.2). We recommend choosing Save in order to save the results directly to a folder, since you probably want to save anyway before proceeding with your analysis. There is an option to put the import data into a separate folder. This can be handy for better organizing subsequent analysis results and for batching (see section 9.1).

19.1.5

Sanger sequencing data

Although traditional sequencing data (with chromatogram traces like abi files) is usually imported using the standard Import ( ), see section 7.1, this option has also been included in the High-Throughput Sequencing Data import. It is designed to handle import of large amounts of sequences, and there are three differences from the standard import: All the sequences will be put in one sequence list (instead of single sequences). The chromatogram traces will be removed (quality scores remain). This is done to improve performance, since the trace data takes up a lot of disk space and significantly impacts speed and memory consumption for further analysis. Paired data is supported. With the standard import, it is practically impossible to import up to thousands of trace files and use them in an assembly. With this special High-Throughput Sequencing import, there is no limit. The import formats supported are the same: ab, abi, ab1, scf and phd. For all formats, compressed data in gzip format is also supported (.gz). The dialog for importing data Sanger sequencing data is shown in figure 19.9.

Figure 19.9: Importing data from Sanger sequencing.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING The General options to the left are:

435

Paired reads. The Workbench will sort the files before import and then assume that the first and second file belong together, and that the third and fourth file belong together etc. At the bottom of the dialog, you can choose whether the ordering of the files is Forward-reverse or Reverse-forward. As an example, you could have a data set with two files: sample1_fwd for the the forward read and sample1_rev for the reverse reads. Note that you can specify the insert sizes when running the mapping and the assembly. If you have data sets with different insert sizes, you should import each data set individually in order to be able to specify different insert sizes. Read more about handling paired data in section 19.1.8. Discard read names. For high-throughput sequencing data, the naming of the individual reads is often irrelevant given the huge amount of reads. This option allows you to discard this option to save disk space. Discard quality scores. Quality scores are visualized in the mapping view and they are used for SNP detection. If this is not relevant for your work, you can choose to Discard quality scores. One of the benefits from discarding quality scores is that you will gain a lot in terms of reduced disk space usage and memory consumption. Click Next to adjust how to handle the results (see section 9.2). We recommend choosing Save in order to save the results directly to a folder, since you probably want to save anyway before proceeding with your analysis. There is an option to put the import data into a separate folder. This can be handy for better organizing subsequent analysis results and for batching (see section 9.1).

19.1.6

Ion Torrent PGM from Life Technologies

Choosing the Ion Torrent import will open the dialog shown in figure 19.10.

Figure 19.10: Importing data from Ion Torrent.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING We support import of two kinds of data from the Ion Torrent system: SFF files (.sff)

436

Fastq files (.fastq). Quality scores are expected to be in the NCBI/Sanger format (see section 19.1.2) For all formats, compressed data in gzip format is also supported (.gz). The General options to the left are: Discard read names. For high-throughput sequencing data, the naming of the individual reads is often irrelevant given the huge amount of reads. This option allows you to discard this option to save disk space. Discard quality scores. Quality scores are visualized in the mapping view and they are used for SNP detection. If this is not relevant for your work, you can choose to Discard quality scores. One of the benefits from discarding quality scores is that you will gain a lot in terms of reduced disk space usage and memory consumption. If you have selected the fna/qual option and choose to discard quality scores, you do not need to select a .qual file. For sff files, you can also decide whether to use the clipping information in the file or not.

19.1.7

Complete Genomics

With CLC Genomics Workbench 4.8 you can import evidence files from Complete Genomics. Support for other data types from Complete Genomics will be added later. The evidence files can be imported using the SAM/BAM importer, see section 19.1.9. In order to import the data it need to be converted first. This is achieved using the CGA tools that can be downloaded from http://www.completegenomics.com/sequence-data/ cgatools/. The procedure for converting the data is the following. 1. Download the human genome in fasta format and make sure the chromosomes are named chr<number>.fa, e.g. chr9.fa. 2. Run the fasta2crr tool with a command like this: cgatools fasta2crr --input chr9.fa --output chr9.crr 3. Run the evidence2sam tool with a command like this:
cgatools evidence2sam --beta -e evidenceDnbs-chr9-.tsv -o chr9.sam -s chr9.crr

where the .tsv file is the evidence file provided by Complete Genomics (you can find sample data sets on their ftp server: ftp://ftp2.completegenomics.com/. 4. Import ( ) the fasta file from 1. into the Workbench.

5. Use the SAM/BAM importer (section 19.1.9) to import the file created by the evidence2sam tool. Please refer to the CGA documentation for a description about these tools. Note that this is not software supported by CLC bio.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

437

19.1.8

General notes on handling paired data

During import, information about the orientation of paired data is stored by the CLC Genomics Workbench. This means that all subsequent analyses will automatically take differences in orientation into account. Once imported, both reads of a pair will be stored in the same sequence list. The forward and reverse reads (e.g. for paired-end data) simply alternate so that the first read is forward, the second read is the mate reverse read; the third is again forward and the fourth read is the mate reverse read. When deleting or manipulating sequence lists with paired data, be careful not break this order. You can view and edit the orientation of the reads after they have been imported by opening the read list in the Element information view ( ), see section 10.4 as shown in figure 19.11.

Figure 19.11: The paired orientation and distance. In the Paired status part, you can specify whether the CLC Genomics Workbench should treat the data as paired data, what the orientation is and what the preferred distance is. The orientation and preferred distance is specified during import and can be changed in this view. Note that the paired distance measure that is used throughout the CLC Genomics Workbench is always including the full read sequence. For paired-end libraries it means from the beginning of the forward read to the beginning of the reverse read.

19.1.9

SAM and BAM mapping files

The CLC Genomics Workbench supports import and export of files in SAM (Sequence Alignment/Map) and BAM format which are generic formats for storing large nucleotide sequence alignments. Read more and see the format specification at http://samtools.sourceforge. net/. Please note that the CLC Genomics Workbench also supports SAM and BAM files from Complete Genomics. For a detailed explanation of the SAM and BAM files exported from CLC Genomics Workbench, please see section K. The idea behind the importer is that you import the sam/bam file which includes all the reads and then you specify one or more reference sequences which have already been imported into the Workbench. The Workbench will then combine the two to create a mapping result ( ) or mapping tables ( ). To import a SAM or BAM file:

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING File | Import High-Throughput Sequencing Data ( ( ) ) | SAM/BAM Mapping Files

438

This will open a dialog where you choose the reference sequences to be used as shown in figure 19.12.

Figure 19.12: Defining reference sequences. Select one or more reference sequence. Note that the name of your reference sequence has to match the reference name specified in the SAM/BAM file. Click Next.

Figure 19.13: Selecting the SAM/BAM file containing all the read information.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING In this dialog, select ( ) one or more SAM/BAM files as shown in figure 19.13.

439

In the panel below, all the reference sequences found in the SAM/BAM file will be listed included their lengths. In addition, it is indicated in the Status column whether they match the reference sequences selected from the Workbench. This can be used to double-check that the naming of the references are the same. (Note that reference sequences in a SAM/BAM file cannot contain spaces. If a reference sequence in the Workbench contains spaces, the space will be replaced with _ when comparing with the SAM/BAM file.). Figure19.14 shows an example where a reference sequence has not been provided (input missing) and one where the lengths of the reference sequences do not match (Length differs).

Figure 19.14: When there is inconsistency in the naming and sizes of reference sequences, this is shown in the dialog prior to import. Click Next to adjust how to handle the results (see section 9.2). We recommend choosing Save in order to save the results directly to a folder, since you probably want to save anyway before proceeding with your analysis. Note that this import operation is very memory-consuming for large data sets.

19.1.10

Tabular mapping files

The CLC Genomics Workbench supports import and export of files in tabular format such as Eland files coming from the Illumina Pipeline. The importer is quite flexible which means that it can be used to import any kind of mapping file in a tab-delimited format where each line in the file represents one read. The idea behind the importer is that you import the mapping file which includes all the reads and then you specify one or more reference sequences which have already been imported into the Workbench. The Workbench will then combine the two to create mapping results ( ) or mapping tables ( ). To import a tabular mapping file:

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING File | Import High-Throughput Sequencing Data ( ) | Tabular Mapping Files ( )

440

This will open a dialog where you choose the reference sequences to be used as shown in figure 19.15.

Figure 19.15: Defining reference sequences. Select one or more reference sequence. Note that the name of your reference sequence has to match the reference name specified in the file. Click Next.

Figure 19.16: Defining reference sequences. In this dialog, select ( ) one or more tab delimited files as shown in figure 19.16.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING Once the tab delimited file has been selected, you have to specify the following information:

441

Data columns. The Workbench needs to know how the file is organized in order to create a result where the reads have been mapped correctly. Reference name. Select the column where the name reference sequence is specified. In the example above, this is in column 1. Match start position. The position on the reference sequence where the read is mapped. The numbering starts from position 1. Match strand. Whether the read is mapped the positive or negative strand. This should be specified using F / R (denoting forward and reverse reads) or + / -. Read name. Whether the read is mapped the positive or negative strand. This should be specified using F / R (denoting forward and reverse reads) or + / -. Match length. The start position of the read is set above. In this section you specify the length of the match which can be done in any of the following ways: Use fixed read length. If all reads have the same length, and if the read length or match end position is not provided in the file, you can specify a fixed length for all the reads. Use end position. If you have a match end position just as a match start position, this can be used to determine match length. Use match descriptor. This can be used to denote mismatches in the alignment. For a 35 base read, 35 denotes an exact match and 32C2 denotes substitution of a C at the 33rd position. Note that the Workbench looks in the first line of the file to provide a preview when filling in this information. Click Next to adjust how to handle the results (see section 9.2). We recommend choosing Save in order to save the results directly to a folder, since you probably want to save anyway before proceeding with your analysis. Note that this import operation is very memory-consuming for large data sets.

19.2

Multiplexing

When you do batch sequencing of different samples, you can use multiplexing techniques to run different samples in the same run. There is often a data analysis challenge to separate the sequencing reads, so that the reads from one sample are mapped together. The CLC Genomics Workbench supports automatic grouping of samples for two multiplexing techniques: By name. This supports grouping of reads based on their name. By sequence tag. This supports grouping of reads based on information within the sequence (tagged sequences). The details of these two functionalities are described below.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

442

19.2.1

Sort sequences by name

With this functionality you will be able to group sequencing reads based on their file name. A typical example would be that you have a list of files named like this: ... A02__Asp_F_016_2007-01-10 A02__Asp_R_016_2007-01-10 A02__Gln_F_016_2007-01-11 A02__Gln_R_016_2007-01-11 A03__Asp_F_031_2007-01-10 A03__Asp_R_031_2007-01-10 A03__Gln_F_031_2007-01-11 A03__Gln_R_031_2007-01-11 ... In this example, the names have five distinct parts (we take the first name as an example): A02 which is the position on the 96-well plate Asp which is the name of the gene being sequenced F which describes the orientation of the read (forward/reverse) 016 which is an ID identifying the sample 2007-01-10 which is the data of the sequencing run To start mapping these data, you probably want to have them divided into groups instead of having all reads in one folder. If, for example, you wish to map each sample separately, or if you wish to map each gene separately, you cannot simply run the mapping on all the sequences in one step. That is where Sort Sequences by Name comes into play. It will allow you to specify which part of the name should be used to divide the sequences into groups. We will use the example described above to show how it works: Toolbox | High-throughput Sequencing ( Name ( ) ) | Multiplexing ( ) | Sort Sequences by

This opens a dialog where you can add the sequences you wish to sort. You can also add sequence lists or the contents of an entire folder by right-clicking the folder and choose: Add folder contents. When you click Next, you will be able to specify the details of how the grouping should be performed. First, you have to choose how each part of the name should be identified. There are three options: Simple. This will simply use a designated character to split up the name. You can choose a character from the list: Underscore _

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING Dash Hash (number sign / pound sign) # Pipe | Tilde ~ Dot .

443

Positions. You can define a part of the name by entering the start and end positions, e.g. from character number 6 to 14. For this to work, the names have to be of equal lengths. Java regular expression. This is an option for advanced users where you can use a special syntax to have total control over the splitting. See more below. In the example above, it would be sufficient to use a simple split with the underscore _ character, since this is how the different parts of the name are divided. When you have chosen a way to divide the name, the parts of the name will be listed in the table at the bottom of the dialog. There is a checkbox next to each part of the name. This checkbox is used to specify which of the name parts should be used for grouping. In the example above, if we want to group the reads according to sample ID and gene name, these two parts should be checked as shown in figure 19.17.

Figure 19.17: Splitting up the name at every underscore (_) and using the sample ID and gene name for grouping. At the middle of the dialog there is a preview panel listing: Sequence name. This is the name of the first sequence that has been chosen. It is shown here in the dialog in order to give you a sample of what the names in the list look like. Resulting group. The name of the group that this sequence would belong to if you proceed with the current settings. Number of sequences. The number of sequences chosen in the first step.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

444

Number of groups. The number of groups that would be produced when you proceed with the current settings. This preview cannot be changed. It is shown to guide you when finding the appropriate settings. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. A new sequence list will be generated for each group. It will be named according to the group, e.g. Asp016 will be the name of one of the groups in the example shown in figure 19.17. Advanced splitting using regular expressions You can see a more detail explanation of the regular expressions syntax in section 14.7.3. In this section you will see a practical example showing how to create a regular expression. Consider a list of files as shown below: ... adk-29_adk1n-F adk-29_adk2n-R adk-3_adk1n-F adk-3_adk2n-R adk-66_adk1n-F adk-66_adk2n-R atp-29_atpA1n-F atp-29_atpA2n-R atp-3_atpA1n-F atp-3_atpA2n-R atp-66_atpA1n-F atp-66_atpA2n-R ... In this example, we wish to group the sequences into three groups based on the number after the "-" and before the "_" (i.e. 29, 3 and 66). The simple splitting as shown in figure 19.17 requires the same character before and after the text used for grouping, and since we now have both a "-" and a "_", we need to use the regular expressions instead (note that dividing by position would not work because we have both single and double digit numbers (3, 29 and 66)). The regular expression for doing this would be (.*)-(.*)_(.*) as shown in figure 19.18. The round brackets () denote the part of the name that will be listed in the groups table at the bottom of the dialog. In this example we actually did not need the first and last set of brackets, so the expression could also have been .*-(.*)_.* in which case only one group would be listed in the table at the bottom of the dialog.

19.2.2

Process tagged sequences

Multiplexing as described in section 19.2.1 is of course only possible if proper sequence names could be assigned from the sequencing process. With many of the new high-throughput technologies, this is not possible. However, there is a need for being able to input several different samples to the same sequencing run, so multiplexing is still relevant - it just has to be based on another way of identifying the

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

445

Figure 19.18: Dividing the sequence into three groups based on the number in the middle of the name. sequences. A method has been proposed to tag the sequences with a unique identifier during the preparation of the sample for sequencing [Meyer et al., 2007]. With this technique, each sequence will have a sample-specific tag - a special sequence of nucleotides before and after the sequence of interest. This principle is shown in figure 19.19 (please refer to [Meyer et al., 2007] for more detailed information).

Figure 19.19: Tagging the target sequence. Figure from [Meyer et al., 2007]. The sample-specific tag - also called the barcode - can then be used to distinguish between the different samples when analyzing the sequence data. This post-processing of the sequencing data has been made easy by the multiplexing functionality of the CLC Genomics Workbench which simply divides the data into separate groups prior to analysis. Note that there is also an example using Illumina data at the end of this section. Before processing the data, you need to import it as described in section 19.1.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

446

The first step is to separate the imported sequence list into sublists based on the barcode of the sequences: Toolbox | High-throughput Sequencing ( Sequences ( ) ) | Multiplexing ( ) | Process Tagged

This opens a dialog where you can add the sequences you wish to sort. You can also add sequence lists. When you click Next, you will be able to specify the details of how the de-multiplexing should be performed. At the bottom of the dialog, there are three buttons which are used to Add, Edit and Delete the elements that describe how the barcode is embedded in the sequences. First, click Add to define the first element. This will bring up the dialog shown in 19.20.

Figure 19.20: Defining an element of the barcode system. At the top of the dialog, you can choose which kind of element you wish to define: Linker. This is a sequence which should just be ignored - it is neither the barcode nor the sequence of interest. Following the example in figure 19.19, it would be the four nucleotides of the SrfI site. For this element, you simply define its length - nothing else. Barcode. The barcode is the stretch of nucleotides used to group the sequences. For that, you need to define what the valid bases are. This is done when you click Next. In this dialog, you simply need to specify the length of the barcode. Sequence. This element defines the sequence of interest. You can define a length interval for how long you expect this sequence to be. The sequence part is the only part of the read that is retained in the output. Both barcodes and linkers are removed. The concept when adding elements is that you add e.g. a linker, a barcode and a sequence in the desired sequential order to describe the structure of each sequencing read. You can of course edit and delete elements by selecting them and clicking the buttons below. For the example from figure 19.19, the dialog should include a linker for the SrfI site, a barcode, a sequence, a barcode (now reversed) and finally a linker again as shown in figure 19.21. If you have paired data, the dialog shown in figure 19.21 will be displayed twice - one for each part of the pair. Clicking Next will display a dialog as shown in figure 19.22.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

447

Figure 19.21: Processing the tags as shown in the example of figure 19.19.

Figure 19.22: Specifying the barcodes as shown in the example of figure 19.19. The barcodes can be entered manually by clicking the Add ( ) button. You can edit the barcodes and the names by clicking the cells in the table. The name is used for naming the results. In addition to adding barcodes manually, you can also Import ( ) barcode definitions from an Excel or CSV file. The input format consists of two columns: the first contains the barcode sequence, the second contains the name of the barcode. An acceptable csv format file would contain columns of information that looks like:

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING "AAAAAA","Sample1" "GGGGGG","Sample2" "CCCCCC","Sample3"

448

The Preview column will show a preview of the results by running through the first 10,000 reads. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. Note that there is also an option to create subfolders for each sequence list. This can be handy when the results need to be processed in batch mode (see section 9.1). A new sequence list will be generated for each barcode containing all the sequences where this barcode is identified. Both the linker and barcode sequences are removed from each of the sequences in the list, so that only the target sequence remains. This means that you can continue the analysis by doing trimming or mapping. Note that you have to perform separate mappings for each sequence list.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING An example using Illumina barcoded sequences

449

The data set in this example can be found at the Short Read Archive at NCBI: http://www. ncbi.nlm.nih.gov/sites/entrez?db=sra&term=SRX014012. It can be downloaded directly in compressed fastq format using the URL http://trace.ncbi.nlm.nih.gov/ Traces/sra/sra.cgi?cmd=dload&run_list=SRR030730&format=fastq. The file you download can be imported directly into the Workbench. The barcoding was done using the following tags at the beginning of each read: CCT, AAT, GGT, CGT (see supplementary material of [Cronn et al., 2008] at http://nar.oxfordjournals. org/cgi/data/gkn502/DC1/1). The settings in the dialog should thus be as shown in figure 19.23.

Figure 19.23: Setting the barcode length at three Click Next to specify the bar codes as shown in figure 19.24 (use the Add button).

Figure 19.24: A preview of the result

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

450

With this data set we got the four groups as expected (shown in figure 19.25). The Not grouped list contains 445,560 reads that will have to be discarded since they do not have any of the barcodes.

Figure 19.25: The result is one sequence list per barcode and a list with the remainders

19.3

Trim sequences

CLC Genomics Workbench offers a number of ways to trim your sequence reads prior to assembly and mapping, including adapter trimming, quality trimming and length trimming. Note that different types of trimming are performed sequentially in the same order as they appear in the trim dialogs: 1. Quality trimming based on quality scores 2. Ambiguity trimming to trim off e.g. stretches of Ns 3. Adapter trimming 4. Base trim to remove a specified number of bases at either 3' or 5' end of the reads 5. Length trimming to remove reads shorter or longer than a specified threshold The result of the trim is a list of sequences that have passed the trim (referred to as the trimmed list below) and optionally a list of the sequences that have been discarded and a summary report (list of discarded sequences). The original data will be not be changed. To start trimming: Toolbox | High-throughput Sequencing ( ) | Trim Sequences ( )

This opens a dialog where you can add sequences or sequence lists. If you add several sequence lists, each list will be processed separately and you will get a a list of trimmed sequences for each input sequence list. When the sequences are selected, click Next.

19.3.1

Quality trimming

This opens the dialog displayed in figure 19.26 where you can specify parameters for quality trimming. The following parameters can be adjusted in the dialog:

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

451

Figure 19.26: Specifying quality trimming. Trim using quality scores. If the sequence files contain quality scores from a base-caller algorithm this information can be used for trimming sequence ends. The program uses the modified-Mott trimming algorithm for this purpose (Richard Mott, personal communication): Quality scores in the Workbench are on a Phred scale in the Workbench (formats using other scales are converted during import). First step in the trim process is to convert the Q quality score (Q) to error probability: perror = 10 10 . (This now means that low values are high quality bases.) Next, for every base a new value is calculated: Limit perror . This value will be negative for low quality bases, where the error probability is high. For every base, the Workbench calculates the running sum of this value. If the sum drops below zero, it is set to zero. The part of the sequence to be retained after trimming is the region between the first positive value of the running sum and the highest value of the running sum. Everything before and after this region will be trimmed off. A read will be completely removed if the score never makes it above zero. At http://www.clcbio.com/files/usermanuals/trim.zip you find an example sequence and an Excel sheet showing the calculations done for this particular sequence to illustrate the procedure described above. Trim ambiguous nucleotides. This option trims the sequence ends based on the presence of ambiguous nucleotides (typically N). Note that the automated sequencer generating the data must be set to output ambiguous nucleotides in order for this option to apply. The algorithm takes as input the maximal number of ambiguous nucleotides allowed in the sequence after trimming. If this maximum is set to e.g. 3, the algorithm finds the maximum length region containing 3 or fewer ambiguities and then trims away the ends not included in this region.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

452

19.3.2

Adapter trimming

Clicking Next will allow you to specify adapter trimming. The CLC Genomics Workbench comes with a set of predefined adapter sequences from the most common kits provided by the high-throughput sequencing vendors. You can easily add or modify the adapters on this list in the preferences: Edit | Preferences ( ) | Data

This will display the adapter trim panel as shown in figure 19.27 where each row represents an adapter sequence including the settings used for trimming.

Figure 19.27: Editing the set of adapters for adapter trimming. At the bottom of the panel, you have the following options: Add Default Rows. If you have deleted or changed the pre-defined set of adapters, you can add them to the list using this button (note that they will not replace existing adapters). Delete Row. Delete the selected adapter. Add Row. Add a new empty row where you can specify your own adapter settings. All the information in the panel can be edited by clicking or double-clicking. The Strand, Alignment score and Action settings can also be modified when running the trim (see figure 19.33).

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING Action to perform when a match is found

453

For each read sequence in the input to trim, the Workbench performs a Smith-Waterman alignment [Smith and Waterman, 1981] with the adapter sequence to see if there is a match (details described below). When a match is found, the user can specify three kinds of actions: Remove adapter. This will remove the adapter and all the nucleotides 5' of the match. All the nucleotides 3' of the adapter match will be preserved in the read that will be retained in the trimmed reads list. If there are no nucleotides 3' of the adapter match, the read is added to the List of discarded sequences (see section 19.3.4). Discard when not found. If a match is found, the adapter sequence is removed (including all nucleotides 5' of the match as described above) and the rest of the sequence is retained in the list of trimmed reads. If no match is found, the whole sequence is discarded and put in the list of discarded sequences. This kind of adapter trimming is useful for small RNA sequencing where the remnants of the adapter is an indication that this is indeed a small RNA. Discard when found. If a match is found, the read is discarded. If no match is found, the read is retained in the list of trimmed reads. This can be used for quality checking the data for linker contaminations etc. When is there a match? To determine whether there is a match there is a set of scoring thresholds that can be adjusted and inspected by double-clicking the Alignment score column. This will bring up a dialog as shown in figure 19.28.

Figure 19.28: Setting the scoring thresholds for adapter trimming. At the top, you can choose the costs for mismatch and gaps. A match is rewarded one point (this cannot be changed), and per default a mismatch costs 2 and a gap (insertion or deletion) costs 3. A few examples of adapter matches and corresponding scores are shown below. In the panel below, you can set the Minimum score for a match to be accepted. Note that there is a difference between an internal match and an end match. The examples above are

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

454

a)

CGTATCAATCGATTACGCTATGAATG ||||||| |||| TTCAATCGGTTAC

11 matches - 2 mismatches = 7

b)

CGTATCAATCGATTACGCTATGAATG |||||||||| |||| ATCAATCGAT-CGCT

14 matches - 1 gap = 11

c)

CGTATCAATCGATTACGCTATGAATG ||||||| TTCAATCGGG

7 matches - 3 mismatches = 1

Figure 19.29: Three examples showing a sequencing read (top) and an adapter (bottom). The examples are artificial, using default setting with mismatch costs = 2 and gap cost = 3. all internal matches where the alignment of the adapter falls within the read. Below are a few examples showing an adapter match at the end:
CGTATCAATCGATTACGCTATGAATG ||||| GATTCGTAT

d)

5 matches = 5 (as end match)

e)

CGTATCAATCGATTACGCTATGAATG || |||| GATTCGCATCA

6 matches - 1 mismatch = 4 (as end match)

f)

CGTATCAATCGATTACGCTATGAATG |||| ||||| CGTA-CAATC

9 matches - 1 gap = 6 (as end match)

g)

CGTATCAATCGATTACGCTATGAATG |||||||||| GCTATGAATG

10 matches = 10 (as internal match)

Figure 19.30: Four examples showing a sequencing read (top) and an adapter (bottom). The examples are artificial. In the first two examples, the adapter sequence extends beyond the end of the read. This is what typically happens when sequencing e.g. small RNAs where you sequence part of the adapter. The third example shows an example which could be interpreted both as an end match and an internal match. However, the Workbench will interpret this as an end match, because it starts at beginning (5' end) of the read. Thus, the definition of an end match is that the alignment of the adapter starts at the read's 5' end. The last example could also be interpreted as an end match, but because it is a the 3' end of the read, it counts as an internal match (this is because you would not typically expect partial adapters at the 3' end of a read). Also note, that if Remove adapter is chosen for the last example, the full read will be discarded because everything 5' of the adapter is removed. Below, the same examples are re-iterated showing the results when applying different scoring schemes. In the first round, the settings are:

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING Allowing internal matches with a minimum score of 6 Not allowing end matches Action: Remove adapter The result would be the following (the retained parts are green):
CGTATCAATCGATTACGCTATGAATG ||||||| |||| TTCAATCGGTTAC

455

a)

11 matches - 2 mismatches = 7

b)

CGTATCAATCGATTACGCTATGAATG |||||||||| |||| ATCAATCGAT-CGCT

14 matches - 1 gap = 11

c)

CGTATCAATCGATTACGCTATGAATG ||||||| TTCAATCGGG

7 matches - 3 mismatches = 1

d)

CGTATCAATCGATTACGCTATGAATG ||||| GATTCGTAT

5 matches = 5 (as end match)

e)

CGTATCAATCGATTACGCTATGAATG || |||| GATTCGCATCA

6 matches - 1 mismatch = 4 (as end match)

f)

CGTATCAATCGATTACGCTATGAATG |||| ||||| CGTA-CAATC

9 matches - 1 gap = 6 (as end match)

g)

CGTATCAATCGATTACGCTATGAATG |||||||||| GCTATGAATG

10 matches = 10 (as internal match)

Figure 19.31: The results of trimming with internal matches only. Red is the part that is removed and green is the retained part. Note that the read at the bottom is completely discarded. A different set of adapter settings could be: Allowing internal matches with a minimum score of 11 Allowing end match with a minimum score of 4 Action: Remove adapter The result would be:

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

456

a)

CGTATCAATCGATTACGCTATGAATG ||||||| |||| TTCAATCGGTTAC

11 matches - 2 mismatches = 7

b)

CGTATCAATCGATTACGCTATGAATG |||||||||| |||| ATCAATCGAT-CGCT

14 matches - 1 gap = 11

c)

CGTATCAATCGATTACGCTATGAATG ||||||| TTCAATCGGG

7 matches - 3 mismatches = 1

d)

CGTATCAATCGATTACGCTATGAATG ||||| GATTCGTAT

5 matches = 5 (as end match)

e)

CGTATCAATCGATTACGCTATGAATG || |||| GATTCGCATCA

6 matches - 1 mismatch = 4 (as end match)

f)

CGTATCAATCGATTACGCTATGAATG |||| ||||| CGTA-CAATC

9 matches - 1 gap = 6 (as end match)

g)

CGTATCAATCGATTACGCTATGAATG |||||||||| GCTATGAATG

10 matches = 10 (as internal match)

Figure 19.32: The results of trimming with both internal and end matches. Red is the part that is removed and green is the retained part. Other adapter trimming options When you run the trim, you specify the adapter settings as shown in figure 19.33. You select an adapter to be used for trimming by checking the checkbox next to the adapter name. You can overwrite the settings defined in the preferences regarding Strand, Alignment score and Action by simply clicking or double-clicking in the table. At the top, you can specify if the adapter trimming should be performed in Color space. Note that this option is only available for sequencing data imported using the SOLiD import (see section 19.1.3). When doing the trimming in color space, the Smith-Waterman alignment is simply done using colors rather than bases. The adapter sequence is still input in base space, and the Workbench then infers the color codes. Note that the scoring thresholds apply to the color space alignment (this means that a perfect match of 10 bases would get a score of 9 because 10 bases are represented by 9 color residues). Learn more about color space in section 19.8. Besides defining the Action and Alignment scores, you can also define on which strand the adapter should be found. This can be done in two ways:

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

457

Figure 19.33: Trimming your sequencing data for adapter sequences. Defining either Plus or Minus for the individual adapter sequence (this can be done either in the Preferences or in the dialog shown in figure 19.33). Note that all the definitions above regarding 3' end and 5' end also apply to the minus strand (i.e. selecting the Minus strand is equivalent to reverse complementing all the reads). The adapter in this case should be defined as you would see it on the plus strand of the reverse complemented read. Figure 19.34 below shows a few examples of an adapter defined on the minus strand. Checking the Search on both strands checkbox will search both the minus and plus strand for the adapter sequence (the result would be equivalent to defining two adapters and searching one on the plus strand and one on the minus strand). Below is an example showing hits for an adapter sequence defined as CTGCTGTACGGCCAAGGCG, searching on the minus strand. You can see that if you reverse complemented the adapter you
ACCGAGAAACGCCTTGGCCGTACAGCAG ||||||||||||||||||| CTGCTGTACGGCCAAGGCG b) ACCGATAAACGCCTTGGCCGTACAGCAGATGCC ||||||||| ||||||||| 18 matches - 2 mismatches = 16 CTGCTGTACGGCCAAGGCG

a)

19 matches = 19

Figure 19.34: An adapter defined as CTGCTGTACGGCCAAGGCG searching on the minus strand. Red is the part that is removed and green is the retained part. The retained part is 3' of the match on the minus strand, just like matches on the plus strand. would find the hit on the plus strand, but then you would have trimmed the wrong end of the read. So it is important to define the adapter as it is, without reverse complementing.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

458

Below the adapter table you find a preview listing the results of trimming with the current settings on 1000 reads in the input file (reads 1001-2000 when the read file is long enough). This is useful for a quick feedback on how changes in the parameters affect the trimming (rather than having to run the full analysis several times to identify a good parameter set). The following information is shown: Name. The name of the adapter. Matches found. Number of matches found based on the strand and alignment score settings. Reads discarded. This is the number of reads that will be completely discarded. This can either be because they are completely trimmed (when the Action is set to Remove adapter and the match is found at the 3' end of the read), or when the Action is set to Discard when found or Discard when not found. Nucleotides removed. The number of nucleotides that are trimmed include both the ones coming from the reads that are discarded and the ones coming from the parts of the reads that are trimmed off. Avg. length This is the average length of the reads that are retained (excluding the ones that are discarded). Note that the preview panel is only showing how the adapter trim affects the results. If other kinds of trimming (quality or length trimming) is applied, this will not be reflected in the preview but still influence the results. Next time you run the trimming, your previous settings will automatically be remembered. Note that if you change settings in the Preferences, they may not be updated when running trim because the last settings are always used. Any conflicts are illustrated with text in italics. To make the updated preference take effect, press the Reset to CLC Standard Settings ( ) button.

19.3.3

Length trimming

Clicking Next will allow you to specify length trimming as shown in figure 19.35. At the top you can choose to Trim bases by specifying a number of bases to be removed from either the 3' or the 5' end of the reads. Below you can choose to Discard reads below length. This can be used if you wish to simply discard reads because they are too short. Similarly, you can discard reads above a certain length. This will typically be useful when investigating e.g. small RNAs (note that this is an integral part of the small RNA analysis together with adapter trimming).

19.3.4

Trim output

Clicking Next will allow you to specify the output of the trimming as shown in figure 19.36. No matter what is chosen here, the list of trimmed reads will always be produced. In addition the following can be output as well:

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

459

Figure 19.35: Trimming on length.

Figure 19.36: Specifying the trim output. No matter what is chosen here, the list of trimmed reads will always be produced. Create list of discarded sequences. This will produce a list of reads that have been discarded during trimming. When only parts of the read has been discarded, it will now show up in this list. Create report. An example of a trim report is shown in figure 19.37. The report includes the following:

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING Trim summary. Name. The name of the sequence list used as input. Number of reads. Number of reads in the input file. Avg. length. Average length of the reads in the input file. Number of reads after trim. The number of reads retained after trimming. Percentage trimmed. The percentage of the input reads that are retained. Avg. length after trim. The average length of the retained sequences.

460

Read length before / after trimming. This is a graph showing the number of reads of various lengths. The numbers before and after are overlayed so that you can easily see how the trimming has affected the read lengths (right-click the graph to open it in a new view). Trim settings A summary of the settings used for trimming. Detailed trim results. A table with one row for each type of trimming: Input reads. The number of reads used as input. Since the trimming is done sequentially, the number of retained reads from the first type of trim is also the number of input reads for the next type of trimming. No trim. The number of reads that have been retained, unaffected by the trimming. Trimmed. The number of reads that have been partly trimmed. This number plus the number from No trim is the total number of retained reads. Nothing left or discarded. The number of reads that have been discarded either because the full read was trimmed off or because they did not pass the length trim (e.g. too short) or adapter trim (e.g. if Discard when not found was chosen for the adapter trimming). Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. This will start the trimming process. If you trim paired data, the result will be a bit special. In the case where one part of a paired read has been trimmed off completely, you no longer have a valid paired read in your sequence list. In order to use paired information when doing assembly and mapping, the Workbench therefore creates two separate sequence lists: one for the pairs that are intact, and one for the single reads where one part of the pair has been deleted. When running assembly and mapping, simply select both of these sequence lists as input, and the Workbench will automatically recognize that one has paired reads and the other has single reads.

19.4 De novo assembly

The de novo assembly algorithm of CLC Genomics Workbench offers comprehensive support for a variety of data formats, including both short and long reads, and mixing of paired reads (both insert size and orientation). The de novo assembly process has two stages: 1. First, simple contig sequences are created by using all the information that are in the read sequences. This is the actual de novo part of the process. These simple contig sequences do not contain any information about which reads the contigs are built from. This part is elaborated in section 19.4.1.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

461

Figure 19.37: A report with statistics on the trim results. 2. Second, all the reads are mapped using the simple contig sequence as reference. This is done in order to show e.g. coverage levels along the contigs and enabling more downstream analysis like SNP detection and creating mapping reports. Note that although a read aligns to a certain position on the contig, it does not mean that the information from this read was used for building the contig, because the mapping of the reads is a completely separate part of the algorithm. If you wish to only have the simple contig sequences as output, this can be chosen when starting the de novo assembly (see section 19.4.6).

19.4.1

How it works

This section explains how the first stage of the de novo assembly works: CLC bio's de novo assembly algorithm works by using de Bruijn graphs. This is similar to how most new de novo assembly algorithms work. The basic idea is to make a table of all sub-sequences of a certain length (called words) found in the reads. The words are relatively short, e.g. about 20 for small data sets and 27 for a large data set (the word size is determined automatically, see explanation below). Given a word in the table, we can look up all the potential neighboring words (in all the examples here, word of length 16 are used) as shown in figure 19.38. Typically, only one of the backward neighbors and one of the forward neighbors will be present in

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

462

Figure 19.38: The word in the middle is 16 bases long, and it shares the 15 first bases with the backward neighboring word and the last 15 bases with the forward neighboring word. the table. A graph can then be made where each node is a word that is present in the table and edges connect nodes that are neighbors. This is called a de Bruijn graph. For genomic regions without repeats or sequencing errors, we get long linear stretches of connected nodes. We may choose to reduce such stretches of nodes with only one backward and one forward neighbor into nodes representing sub-sequences longer than the initial words. Figure 19.39 shows an example where one node has two forward neighbors:

Figure 19.39: Three nodes connected, each sharing 15 bases with its neighboring node and ending with two forward neighbors. After reduction, the three first nodes are merged, and the two sets of forward neighboring nodes are also merged as shown in figure 19.40.

Figure 19.40: The five nodes are compacted into three. Note that the first node is now 18 bases and the second nodes are each 17 bases. So bifurcations in the graph leads to separate nodes. In this case we get a total of three nodes after the reduction. Note that neighboring nodes still have an overlap (in this case 15 nucleotides since the word length is 16). Given this way of representing the de Bruijn graph for the reads, we can consider some different situations: When we have a SNP or a sequencing error, we get a so-called bubble as shown in figure 19.41.

Figure 19.41: A bubble caused by a SNP or a sequencing error. Here, the central position may be either a C or a G. If this was a sequencing error occurring only once, we would see that one path through the bubble will only be words seen a single time. On the other hand if this was a heterozygote SNP we would see both paths represented more or less equally. Thus, having information about how many times this particular word is seen in all the reads is very useful and this information is stored in the initial word table together with the words.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

463

If we have a repeat sequence that is present twice in the genome, we would get a graph as shown in figure 19.42.

Figure 19.42: The central node represents the repeat region that is represented twice in the genome. The neighboring nodes represent the flanking regions of this repeat in the genome. Note that this repeat is 57 nucleotides long (the length of the sub-sequence in the central node above plus regions into the neighboring nodes where the sequences are identical). If the repeat had been shorter than 15 nucleotides, it would not have shown up as a repeat at all since the word length is 16. This is an argument for using long words in the word table. On the other hand, the longer the word, the more words from a read are affected by a sequencing error. Also, for each extra nucleotide in the words, we get one less word from each read. This is in particular an issue for very short reads. For example, if the read length is 35, we get 16 words out of each read of the word length is 20. If the word length is 25, we get only 11 words from each read. To strike a balance, CLC bio's de novo assembler chooses a word length based on the amount of input data: the more data, the longer the word length. It is based on the following: word word word word word word word word word word word word word word word word word word word etc. size size size size size size size size size size size size size size size size size size size 12: 13: 14: 15: 16: 17: 18: 19: 20: 21: 22: 23: 24: 25: 26: 27: 28: 29: 30: 0 bp - 30000 bp 30001 bp - 90002 bp 90003 bp - 270008 bp 270009 bp - 810026 bp 810027 bp - 2430080 bp 2430081 bp - 7290242 bp 7290243 bp - 21870728 bp 21870729 bp - 65612186 bp 65612187 bp - 196836560 bp 196836561 bp - 590509682 bp 590509683 bp - 1771529048 bp 1771529049 bp - 5314587146 bp 5314587147 bp - 15943761440 bp 15943761441 bp - 47831284322 bp 47831284323 bp - 143493852968 bp 143493852969 bp - 430481558906 bp 430481558907 bp - 1291444676720 bp 1291444676721 bp - 3874334030162 bp 3874334030163 bp - 11623002090488 bp

This pattern (multiplying by 3) continues until word size of 64 which is the max. Please note that the range of word sizes is 12-24 on 32-bit computers and 12-64 on 64-bit computers. See how to adjust the word size in section 19.4.5 A simple de novo assembly result would be to output the sequence of each reduced node. The bubbles described above from SNPs and sequencing errors as well as the repeats will make this quite a bad result with many short contigs. Instead, we can try to resolve the repeats with reads that span from a node before the repeat to a node after the repeat. Small bubbles can be

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

464

resolved by choosing the path with the most coverage. Thus, by using the information from the full length reads, we are able to produce much longer contigs. Furthermore, when paired reads are available, we can use this information to resolve even larger repeat regions that may not be spanned by individual reads, but are spanned by read pairs. This results in even longer contigs. So in summary, the de novo assembly algorithm goes through these stages: Make a table of the words seen in the reads. Build de Bruijn graph from the word table. Use the reads to resolve the repeats. Use the information from paired reads to resolve larger repeats. Output resulting contigs based on the paths. These stages are all performed by the assembler program. Repeat regions in large genomes often get very complex: a repeat may be found thousands of times and part of one repeat may also be part of another repeat, further complicating the graph. Sometimes a repeat is longer than the read length (or the paired distance when pairs are available) and then it becomes impossible to resolve the repeat. This is simply because there is no information available about how to connect the nodes before the repeat to the nodes after the repeat. This means that no matter how much coverage we have, we will still get a number of separate contigs as a result.

19.4.2

Randomness in the results

A side-effect of the very compact data structures needed in order to keep the memory consumption low, is that the results will vary slightly from run to run, using the same data set. When counting the number of occurrences of a word, the assembler does not keep track of the exact number (which would consume a lot of memory) but uses an approximation which relies on some probability calculations. When using a multi-threaded CPU, the data structure is build in different ways for each run, and this means that the probability calculations for certain parts of the algorithm will be a bit different from run to run. This leads to differences in the results. It should be noted that the differences are minor and will not affect the overall results. Keep in mind that whether you use CLC bio's assembler or other assemblers, there will never be one correct answer to the problem of de novo assembly. In this perspective, the small differences should not be considered a problem.

19.4.3

SOLiD data support in de novo assembly

SOLiD sequencing is done in color space. When viewed in nucleotide space this means that a single sequencing error changes the remainder of the read. An example read is shown in figure 19.43. Basically, this color error means that C's become A's and A's become C's. Likewise for G's and T's. For the three different types of errors, we get three different ends of the read. Along with

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

465

Figure 19.43: How an error in color space leads to a phase shift and subsequent problems for the rest of the read sequence the correct reads, we may get four different versions of the original genome due to errors. So if SOLiD reads are just regarded in nucleotide space, we get four different contig sequences with jumps from one to another every time there is a sequencing error. Thus, to fully accommodate SOLiD sequencing data, the special nature of the technology has to be considered in every step of the assembly algorithm. Furthermore, SOLiD reads are fairly short and often quite error prone. Due to these issues, we have chosen not to include SOLiD support in the first algorithm steps, but only use the SOLiD data where they have a large positive effect on the assembly process: when applying paired information.

19.4.4

De novo assembly parameters

) | De Novo Assembly ( )

To start the assembly: Toolbox | High-throughput Sequencing (

In this dialog, you can select one or more sequence lists or single sequences. Click Next to set the parameters for the assembly. This will show a dialog similar to the one in figure 19.44.

Figure 19.44: Setting parameters for the assembly. Note that most of these parameters regard stage two of the de novo assembly where the reads are mapped back to the simple contig sequences. Please refer to section 19.5.3 for more

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING information on the parameters and how to make selections of the data sets.

466

The only exception is the paired information in the panel at the bottom (this is only shown for paired data sets) which is used both for the first and second stage of the de novo assembly (see how this information is used in section 19.4.1). There is an additional option to use the data set for Guidance only. This is recommended for SOLiD data as explained in section 19.4.3. Note that if you need to have at least one data set where the guidance only option is not checked. When you click Next, you will see the dialog shown in figure 19.45

Figure 19.45: Conflict resolution and annotation. All these parameters also part of the second read mapping stage and are explained in section 19.5.3.

19.4.5

Word size and contig lengths

As shown in figure 19.46 you can specify the word size to be used by the assembler. The basic principles are described in section 19.4.1. When using automatic calculation, you can see the word size in the History ( ) of the result files. Please note that the range of word sizes is 12-24 on 32-bit computers and 12-64 on 64-bit computers. You can also specify the minimum contig length when doing de novo assembly. Contigs below this length will not be reported. The default value is 200 bp.

19.4.6

Assembly reporting options

Click Next lets you choose how the output of the assembly should be reported (see figure 19.47).

Create simple contig sequences. This will show a sequence list containing all the consensus sequences from the assembly. This option is much faster and less demanding for your computer. This is explained in more detail in section 19.4.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

467

Figure 19.46: Word size is automatically calculated per default.

Figure 19.47: Assembly reporting options. Map reads back to contigs. This will add mapping of the reads to the de novo assembly process. There is also an option to Update contigs based on mapped reads. This means that the original contig sequences produced from the de novo assembly will be updated to reflect the mapping of the reads (in most cases it will mean no change, but in some cases, the subsequent mapping step leads to new information). In effect, this means that all contig sequences in the output will be supported by at least one read mapped back. Note that if this option is selected, the contig lengths may get below the threshold specified in figure 19.45 because this threshold is applied to the original contig sequences.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

468

If the Update contigs based on mapped reads option is not selected, the original contig sequences from the assembler will be preserved completely also in situations where the reads that are mapped back do not support the contig sequences. No matter which option you choose, the result will be a table with one row per contig showing information about the contig length, and number of reads. Double-clicking one of the rows in the table will open the corresponding mapping. Furthermore, you can select a number of mappings and click the Open Consensus/Contig at the bottom of the table. That will open a sequence list of all the consensus/contig sequences. Furthermore, it will give some extra reporting options: Create Report. This will generate a summary report as described in section 19.6.2. Create list of non-mapped reads. This will put all the reads that could not be assembled into a sequence list. Clicking Finish will start the assembly process. See section 18.6 for general information about viewing and editing the resulting mappings.

19.5

Map reads to reference

This section describes how to map a number of sequence reads to one or more reference sequences. When the reads come from a set of known sequences with relatively few variations, read mapping is often the right approach to assembling the data. The result of mapping reads to a reference is a "mapping" or a "mapping table" which is the term we use for an alignment of reads against a reference sequence.

19.5.1

Starting the read mapping

) | Map Reads to Reference ( )

To start the read mapping: Toolbox | High-throughput Sequencing (

In this dialog, select the sequences or sequence lists containing the sequencing data. Note that the reference sequences should be selected in the next step. When the sequences are selected, click Next, and you will see the dialog shown in figure 19.48. At the top you select one or more reference sequences by clicking the Browse and select element ( ) button. You can select either single sequences or a list of sequences as reference sequences. When multiple reference sequence are used, the result of the mapping will be a mapping table with one entry per reference sequence.

19.5.2

Including or excluding regions (masking)

The next part of the dialog lets you mask the reference sequences. Masking refers to a mechanism where parts of the reference sequence are not considered in the mapping. This can be extremely useful for example when mapping human data, where more than 50 % of the sequence consists of repeats. Note that you should be careful masking all the repeat regions if your sequenced data contains the repeats. If you do that, some of the reads that would have matched a masked repeat region perfectly may be placed wrongly at another position even with a less-perfect match and lead to wrong results.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

469

Figure 19.48: Specifying the reference sequences and masking. In order to mask e.g. repeat regions when doing read mapping, the repeat regions have to be annotated on the reference sequences. Because the masking is based on annotations, any kind of annotations can be selected for masking. This means that you can choose to e.g. only map against the genes in the genome, or only the exons. As long as the reference sequences contain the relevant information in the form of annotations, it can be masked. To mask a reference sequence, first click the Include / exclude regions checkbox, and second click the Select annotation type ( ) button. This will bring up a dialog with all the annotation types of the reference sequences listed to the left. Select one or more annotation types and click Add ( ) button. Then select at the bottom whether you wish to Include or Exclude these annotation types. If you include, it means that only the regions covered by the selected type of annotations will be used in the read mapping. If you exclude, it means that all of the reference sequences except the regions covered by the selected type of annotations will be used in the read mapping. You can see an example in figure 19.49.

19.5.3

Mapping parameters

Click Next to set the parameters for the mapping. This will show a dialog similar to the one in figure 19.50. In order to understand what is going on here, a little explanation is needed: The CLC Genomics Workbench supports assembly of mixed data sets. This means that you can assemble and map both short reads, long reads, single reads and paired reads in one go. This makes it easy to combine the information from different sources, but it also makes the parameters a little more complex, because each data set may need its own parameters. At the top of the dialog shown in figure 19.50 is a table of all the sequence lists that were chosen

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

470

Figure 19.49: Masking for repeats. The repeat region annotation type is selected and excluded in the mapping.

Figure 19.50: Setting parameters for mapping. in the first step. Clicking one of the lists shows the parameters that will be used this particular data set. Note that the Workbench automatically categorizes each of the lists into short/long reads and single/paired. Reads are considered short when they are less than 56 nucleotides, unless the data is in color space where the long reads algorithm is always applied regardless of the read length. In the example in figure 19.50, you first adjust the parameters for the data set called s_1_1_sequence and then click the next data set called Ecoli.FLX and adjust parameters for this data set (as shown in figure 19.51). Because these data sets are different in terms

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

471

of length and single/paired content, you have to set the parameters for each one. If you had two similar data sets, you could select both of them in the table and then change the settings for both.

Figure 19.51: Setting parameters for the mapping. Each of the parameters are described below: Common parameters for short and long reads Three parameters are identical for both short and long reads: Mismatch cost The cost of a mismatch between the read and the reference sequence. Insertion cost The cost of an insertion in the read (causing a gap in the reference sequence) Deletion cost The cost of having a gap in the read. Global alignment Per default, the reads are aligned locally, allowing a number of "unaligned" nucleotides at the ends of the read. By selecting the global alignment option, you force the whole read to be aligned to the reference. Mismatches at the ends will then count as any other mismatch. The score for a match is always 1. Short reads parameters For short reads, there is a threshold that determines whether the read should be included in the mapping: Limit The relationship between the length of the read and the score. A limit of 8 (which is default) means that the total score for the alignment has to be more than the length of the read minus 8. This is explained in detail with examples below. This means that with the default

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

472

costs, two mismatches, two deletions or two insertions will be allowed. If no mismatches or gaps are involved, it means that up to 8 unaligned nucleotides in the ends would be allowed. For very short reads, a limit of 5 could typically be used instead, allowing up to one mismatch and two unaligned nucleotides in the ends (or no mismatches and five unaligned nucleotides). Given a certain quality threshold, it is possible to guarantee that all optimal ungapped alignments are found for each read. Alignments of short reads to reference sequences usually contain no gaps, so the short read assembly operates with a strict scoring threshold to allow the user to specify the amount of errors to accept. With other short read mapping programs like Maq and Soap, the threshold is specified as the number of allowed mismatches. This works because those programs do global alignment. For local alignments it is a little more complicated. The default alignment scoring scheme for short reads is +1 for matches and -2 for mismatches. The limit for accepting an alignment is given as the alignment score relative to the read length. For example, if the score limit is 8 below the length, up to two mismatches are allowed as well as two ending nucleotides not assembled (remember that a mismatch costs 2 points, but when there is a mismatch, a potential match is also lost). Alternatively, with one mismatch, up to 5 unaligned positions are allowed. Or finally, with no mismatches, up to 8 unaligned positions are allowed. See figure 19.52 for examples. The default setting is exactly this limit of 8 below the length.
CGTATCAATCGATTACGCTATGAATG |||||||||||||||||||| ATCAATCGATTACGCTATGA CGTATCAATCGATTACGCTATGAATG |||||||| ||||||||||| ATCAATCGGTTACGCTATGA CGTATCAATCGATTACGCTATGAATG ||||||| |||||||||| CTCAATCGGTTACGCTATGA CGTATCAATCGATTACGCTATGAATG ||||||| |||| |||||| TTCAATCGGTTACCCTATGA CGTATCAATCGATTACGCTATGAATG ||||||| |||| ||||| TTCAATCGGTTACCCTATGC 20 CGTATCAATCGATTACGCTATGAATG ||||||||||||||||||| TTCAATCGATTACGCTATGA CGTATCAATCGATTACGCTATGAATG ||||||| ||||||||||| TTCAATCGGTTACGCTATGA CGTATCAATCGATTACGCTATGAATG ||||| || ||||||||||| ATCAACCGGTTACGCTATGA CGTATCAATCGATTACGCTATGAATG |||||||||| |||| ATCAATCGATTGCGCTCTTT CGTATCAATCGATTACGCTATGAATG |||||||||||| AGCTATCGATTACGCTCTTT 19

17

16

15

14

13

12

12

12

Figure 19.52: Examples of ungapped alignments allowed for a 20 bp read with a scoring limit of 8 below the length using the default scoring scheme. The scores are noted to the right of each alignment. For reads this short, a limit of 5 would typically be used instead, allowing up to one mismatch and two unaligned nucleotides in the ends (or no mismatches and five unaligned nucleotides). Note that if you choose to do global alignment, the default setting means that up to two mismatches are allowed (because "unaligned positions" at the ends are counted as mismatches as well).

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

473

The match score is always +1. If the mismatch cost is changed, the default score limit will also change to: score limit = 3 (1 + mismatch cost) 1 The default mismatch score of -2 equals a mismatch cost of 2 and a score limit of 8 below the read length, as stated above. For any mismatch cost, the default score limit allows any alignment scoring strictly better than 3 mismatches. The maximum score limit also depends on the mismatch cost: max score limit = 4 (1 + mismatch cost) 1 Gapped alignment is also allowed for short reads. Contrary to ungapped alignments, it is very difficult to guarantee that all gapped alignments of a certain quality are found. The scoring limit discussed above applies to both gapped and ungapped alignments and there is a guarantee that there are no ungapped exceeding the limit, but there is is no such guarantee for gapped alignments. This being said, the program does a good effort to find the best gapped alignments and usually succeeds. Besides the limit, there are also two options related to mapping of color space data (from SOLiD systems). If you do not have color space data, these will be disabled and are not relevant. Color space alignment This will determine if mapping is to be performed in color space. This is strongly recommended for SOLiD data. Color error cost The cost of a color error. An example of a color space data set is shown in figure 19.53.

Figure 19.53: Setting parameters for the mapping. For more details about this, please see section 19.8 which explains how color space mapping is performed in greater detail.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING Long reads parameters

474

For long reads, the read mapping as two stages: First, the optimal alignment of the read is found, based on the costs specified above (e.g. to favor mismatches over indels). Second, a filtering process determines whether this match is good enough for the read to be included in the alignment. The filtering threshold is determined by two fractions: Length fraction Set minimum length fraction of a read that must match the reference sequence. Setting a value at 0.5 means that at least half the read needs to match the reference sequence for the read to be included in the final mapping. Similarity Set minimum fraction of identity between the read and the reference sequence. If you want the reads to have e.g. at least 90% identity with the reference sequence in order to be included in the final mapping, set this value to 0.9. Note that the similarity fraction does not apply to the whole read; it relates to the Length fraction. With the default values, it means that at least 50 % of the read must have at least 90 % identity. Paired reads At the bottom you can specify how Paired reads should be handled. You can read more about how paired data is imported and handled in section 19.1.8. If the sequence list used as input contains paired reads, this option will automatically be shown - if it contains single reads, this option will not be shown. For the paired reads, you can specify a distance interval between the two sequences in a pair. This will be used to determine how far it can expect the two reads to be from each other. This value includes the length of the read sequence as well (not just the distance in between). If you set this value very precisely, you will miss some of the opportunities to detect genomic rearrangements as described in section 19.9.3. On the other hand, a precise distance interval will give a more accurate assembly in the places where there are not significant variation between the sequencing data and the reference sequence. We recommend running the detailed mapping report (see section 19.6.1) and check that the paired distances reported show a nice distribution and that not too many pairs are broken. The approach taken for determining the placement of read pairs is the following: First, all the optimal placements for the two individual reads are found. Then, the allowed placements according to the paired distance interval are found. If both reads can be placed independently but no pairs satisfies the paired criteria, the reads are treated as independent and not marked as a pair. If only one pair of placements satisfy the criteria, the reads are placed accordingly and marked as uniquely placed even if either read may have multiple optimal placements. If several placements satisfy the paired criteria, the read is treated as a "non-specific match" (see section 19.5.4 for more information.) By default, mapping is done with local alignment of reads to a set of reference sequences. The advantage of performing local alignment instead of global alignment is that the ends are

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

475

automatically removed if there are sufficiently many sequencing errors there. If the ends of the reads contain vector contamination or adapter sequences, local alignment is also desirable. Note that the aligned region has to be greater than the length threshold set.

19.5.4

General mapping options

When you click Next, you will see the dialog shown in figure 19.54

Figure 19.54: Conflict resolution and annotation. At the top, you can choose to Add conflict annotations to the consensus sequence. Note that there may be a huge number of annotations and that it may give a visually cluttered overview of the mapping of the reads. A subtle detail about the annotations - if you add annotations, you will be able to see resolved conflicts in the table view ( ) of the mapping (e.g. if you edit the bases after mapping). If there are no annotations, only the non-resolved conflicts are shown. If there is a conflict between reads, i.e. a position where there is disagreement about which base is correct, you can specify how the consensus sequence should reflect the conflict: Vote (A, C, G, T). The conflict will be solved by counting instances of each nucleotide and then letting the majority decide the nucleotide in the consensus. In case of equality, ACGT are given priority over one another in the stated order. Unknown nucleotide (N). The consensus will be assigned an 'N' character in all positions with conflicts. Ambiguity nucleotides (R, Y, etc.). The consensus will display an ambiguity nucleotide reflecting the different nucleotides found in the reads. For an overview of ambiguity codes, see Appendix I. At the bottom of the dialog, you can specify how Non-specific matches should be treated. The concept of Non-specific matches refers to a situation where a read aligns at more than one position. In this case you have two options:

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING Random. This will place the read in one of the positions randomly. Ignore. This will not include the read in the final mapping.

476

Note that a read is only considered non-specific when the read matches equally well at several alignment positions. If there are e.g. two possible alignment positions and one of them is a perfect match and the other involves a mismatch, the read is placed at the position with the perfect match and it is not marked as a non-specific match.

19.5.5

Assembly reporting options

Click Next lets you choose how the output of the assembly should be reported (see figure 19.55).

Figure 19.55: Assembly reporting options. First, you can choose to save or open the results, and if you wish to see a log of the process (see section 9.2). No matter what you choose, you will always see the visual read mapping, but in addition you have two extra output options: Create Report. This will generate a summary report as described in section 19.6.2. Create list of non-mapped sequences. This will put all the reads that could not be mapped to the reference into a sequence list. If you have used more than one reference sequence, the Workbench creates a table which makes it easier to get an overview. The table includes this information: 1. Length of reference sequence 2. Length of consensus sequence

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING 3. Number of reads 4. Average coverage 5. Total number of conflicts

477

Double-clicking one of the rows in the table will open the corresponding mapping. Furthermore, you can select a number of rows and click the Open Consensus at the bottom of the table. That will open a sequence list of all the consensus sequences of the selected rows. Clicking Finish will start the mapping. See section 18.6 for general information about viewing and editing the resulting mappings. For special information about genome-size mapping, see section 19.9.

19.6

Mapping reports

You can create two kinds of reports regarding read mappings and de novo assemblies: First, you can choose to generate a summary report about the mapping process itself (see sections 19.4.6 and 19.5.5). This report is described in section 19.6.2 below. Second, you can generate a detailed statistics report after the mapping or assembly has finished. This report is useful if you want to generate statistics across results made in different processes, and it generates more detailed statistics than the summary mapping report. This report is described below.

19.6.1

Detailed mapping report

) | Create Detailed Mapping Report ( )

To create a detailed mapping report: Toolbox | High-throughput Sequencing (

This opens a dialog where you can select mapping results ( )/ ( ) or RNA-Seq analysis results ( ) (see sections 19.4 and 19.5 for information on how to create a contig and section 19.14 for information on how to create RNA-Seq analysis results). Clicking Next will display the dialog shown in figure 19.56 The first option is to set thresholds for grouping long and short contigs. The grouping is used to show statistics like number of contigs, mean length etc for the contigs in each group. This is only relevant for de novo assemblies. Note that the de novo assembly in the CLC Genomics Workbench per default only reports contigs longer than 200 bp (this can be changed when running the assembly). Click Next to select output options as shown in figure 19.57 Per default, an overall report will be created as described below. In addition, by checking Create table with statistics for each reference you can create a table showing detailed statistics for each reference sequence (for de novo results the contigs act as reference sequences, so it will be one row per contig). The following sections describe the information produced. Reference sequence statistics For reports on results of read mapping, section two concerns the reference sequences. The reference identity part includes the following information:

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

478

Figure 19.56: Parameters for mapping reports.

Figure 19.57: Optionally create a table with detailed statistics per reference. Reference name The name of the reference sequence. Reference Latin name The reference sequence's Latin name. Reference description Description of the reference. If you want to inspect and edit this information, right-click the reference sequence in the contig and choose Open This Sequence and switch to the Element info ( ) tab (learn more in section 10.4). Note that you need to create a new report if you want the information in the report to be updated. If you update the information for the reference sequence within the contig, you should know that it doesn't affect the original reference sequence saved in the Navigation Area.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

479

The next part of the report reports coverage statistics including GC content of the reference sequence. Note that coverage is reported on two levels: including and excluding zero coverage regions. In some cases, you do not expect the whole reference to be covered, and only the coverage levels of the covered parts of the reference sequence are interesting. On the other hand, if you have sequenced the full genome that you use as reference, the overall coverage is probably the most relevant number (i.e. including zero coverage regions). A position on the reference is counted as "covered" when at least one read is aligned to it. Note that unaligned ends (faded nucleotides at the ends) that are produced when mapping using local alignment do not contribute to the coverage. In the example shown in figure 19.58, there is a region of zero coverage in the middle and one time coverage on each side. Note that the gaps to the very right are within the same read which means that these two positions on the reference sequence are still counted as "covered".

Figure 19.58: A region of zero coverage in the middle and one time coverage on each side. Note that the gaps to the very right are within the same read which means that these two positions on the reference sequence are still counted as "covered". The identity section is followed by some statistics on the zero-coverage regions; the number, minimum and maximum length, mean length, standard deviation, total length and a list of the regions. If there are too many regions, they will not all be listed in the report (if there are more than 20, only the first 10 are reported). Next follow two bar plots showing the distribution of coverage with coverage level on the x-axis and number of contig positions with that coverage on the y-axis. An example is shown in figure 19.59. The graph to the left shows all the coverage levels, whereas the graph to the right shows coverage levels within 3 standard deviations from the mean. The reason for this is that for complex genomes, you will often have a few regions with extremely high coverage which will affect the resolution of the graph, making it impossible to see the coverage distribution for the majority of the contigs. These coverage outliers are excluded when only showing coverage within 3 standard deviations from the mean. Note that zero-coverage regions are not shown in the graph but reported in text below (this information is also in the zero-coverage section). Below the second coverage graph there are some statistics on the data that is outside the 3 standard deviations. One of the biases seen in sequencing data concerns GC content. Often there is a correlation between GC content and coverage. In order to investigate this correlation, the report includes a graph plotting coverage against GC content (see figure 19.60). Note that you can see the GC content for each reference sequence in the table above.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

480

Figure 19.59: Distribution of coverage - to the left for all the coverage levels, and to the right for coverage levels within 3 standard deviations from the mean.

Figure 19.60: The plot displays, for each GC content level (0-100 %), the mean read coverage of 100bp reference segments with that GC content. The plot displays, for each GC content level (0-100 %), the mean read coverage of 100bp reference segments with that GC content. At the end follows statistics about the reads which are the same for both reference and de novo assembly (see section 19.6.1 below). Contig statistics for de novo assembly After the summary there is a section about the contig lengths. For each set of contigs, you can see the number of contigs, minimum, maximum and mean lengths, standard deviation and total contig length (sum of the lengths of all contigs in the set). The contig sets are: N25 contigs The N25 contig set is calculated by summarizing the lengths of the biggest contigs until you reach 25 % of the total contig length. The minimum contig length in this set is the

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING number that is usually used to report the N25 value of a de novo assembly.

481

N50 This measure is similar to N25 - just with 50 % instead of 25 %. This is probably the most well-known measure of de novo assembly quality - it is a more informative way of measuring the lengths of contigs. N75 Similar to the ones above, just with 75 %. All contigs All contigs that were selected. Long contigs This contig set is based on the threshold set in the dialog in figure 19.56. Short contigs This contig set is based on the threshold set in the dialog in figure 19.56. Note that the de novo assembly in the CLC Genomics Workbench per default only reports contigs longer than 200 bp. Next follow two bar plots showing the distribution of coverage with coverage level on the x-axis and number of contig positions with that coverage on the y-axis. An example is shown in figure 19.61.

Figure 19.61: Distribution of coverage - to the left for all the coverage levels, and to the right for coverage levels within 3 standard deviations from the mean. The graph to the left shows all the coverage levels, whereas the graph to the right shows coverage levels within 3 standard deviations from the mean. The reason for this is that for complex genomes, you will often have a few regions with extremely high coverage which will affect the resolution of the graph, making it impossible to see the coverage distribution for the majority of the contigs. These coverage outliers are excluded when only showing coverage within 3 standard deviations from the mean. Below the second coverage graph there are some statistics on the data that is outside the 3 standard deviations. At the end follows statistics about the reads which are the same for both reference and de novo assembly (see section 19.6.1 below).

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING Read statistics

482

This section contains simple statistics for all mapped reads, non-specific matches (reads that match more than place during the assembly), non-perfect matches and paired reads. Note! Paired reads are counted as two, even though they form one pair. The section on paired reads also includes information about paired distance and counts the number of pairs that were broken due to: Wrong distance When starting the mapping, a distance interval is specified. If the reads during the mapping are placed outside this interval, they will be counted here. Mate inverted If one of the reads has been matched as reverse complement, the pair will be broken (note that the pairwise orientation of the reads is determined during import). Mate on other contig If the reads are placed on different contigs, the pair will also be broken. Mate not matched If only one of the reads match, the pair will be broken as well. Below these tables follow two graphs showing distribution of paired distances (see figure 19.62) and distribution of read lengths. Note that the distance includes both the read sequence and the insert between them as explained in section 19.1.8.

Figure 19.62: A bar plot showing the distribution of distances between intact pairs.

19.6.2

Summary assembly and mapping report

If you choose to create a report as part of the read mapping or assembly (see sections 19.4.6 and 19.5.5), this report will summarize the results of the assembly process. An example of a report is shown in figure 19.63 The information included in the report is: Summary statistics. A summary of the mapping statistics: Reads. The number of reads and the average length. Mapped. The number of reads that are mapped and their average length. Not mapped. The number of reads that do not map and their average length.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

483

Figure 19.63: The summary mapping report. References/contigs. Number of reference sequences or contigs (for de novo assembly) Parameters. The settings used are reported for the process as a whole and for each sequence list used as input. Quality. For de novo assemblies, the N25, N50 and N75 numbers are reported (learn more about this in section 19.6.1). Distribution of read length. For each sequence length, you can see the number of reads and the distribution in percent. This is mainly useful if you don't have too much variance in the lengths as you have in e.g. Sanger sequencing data. Distribution of matched reads lengths. Equivalent to the above, except that this includes only the reads that have been matched to a contig. Distribution of non-matched reads lengths. Show the distribution of lengths of the rest of the sequences. You can copy the information from the report by selecting in the report and click Copy ( can also export the report in Excel format. ). You

19.7

Mapping table

When several reference sequence are used or you are performing de novo assembly with the reads mapped back to the contig sequences, (see sections 19.4.6 and 19.5.5), all your mapping data will be accessible from a table ( ). It means that all the individual mappings are treated as one single file to be saved in the Navigation Area as a table. An example of a mapping table for a de novo assembly is shown in figure 19.64.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

484

Figure 19.64: The mapping table. The information included in the table is: Name. When mapping reads to a reference, this will be the name of the reference sequence. Length of consensus sequence. The length of the consensus sequence. Subtracting this from the length of the reference will indicate how much of the reference that has not been covered by reads. Number of reads. The number of reads. Reads hitting multiple places on different reference sequences are placed according to your input for Non-specific matches Average coverage. This is simply summing up the bases of the aligned part of all the reads divided by the length of the reference sequence. For read mapping, there is more information taken from the reference sequence used as input. An example of a contig table produced by mapping reads to a reference is shown in figure 19.65.

Figure 19.65: The contig table. Besides the information that is also in the de novo table, there is information about name, common name and Latin name of each reference sequence.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

485

At the bottom of the table, there are two buttons which apply to the rows that you select (press Ctrl + A - +A on Mac - to select all): Open Mapping. Simply opens the read mapping for visual inspection. You can also open one mapping simply by double-clicking in the table. Open Consensus/Open Contig. Creates a sequence list of all the consensus sequences. This can be used for further analysis or exported ( ) in e.g. fasta format. For de novo assembly results, it is the contig sequences that are opened. Extract Subset. Creates a new mapping table with the mappings that you have selected. You can copy the textual information from the table by selecting in the table and click Copy ( This can then be pasted into e.g. Excel. You can also export the table in Excel format. ).

19.8
19.8.1

Color space
Sequencing

The SOLiD sequencing technology from Applied Biosystems is different from other sequencing technologies since it does not sequence one base at a time. Instead, two bases are sequenced at a time in an overlapping pattern. There are 16 different dinucleotides, but in the SOLiD technology, the dinucleotides are grouped in four carefully chosen sets, each containing four dinucleotides. The colors are as follows: Base 1 A C G T A Base 2 C G

Notice how a base and a color uniquely defines the following base. This approach can be used to deduce a whole sequence from the initial nucleotide and a series of colors. Here is a sequence and the corresponding colors. Sequence Colors T A C T C C A T G C A

The colors do not uniquely define the sequence. Here is another sequence with the same list of colors: Sequence Colors A T G A G G T A C G T

But if the first nucleotide is known, the colors do uniquely define the remaining sequence. This is exactly the strategy used in SOLiD sequencing: The first nucleotide is known from the primer used, and the remaining nucleotides are deduced from the colors.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

486

19.8.2

Error modes

As with other sequencing technologies, errors do occur with the SOLiD technology. If a single nucleotide is changed, two colors are affected since a single nucleotide is contained in two overlapping dinucleotides: Sequence Colors Sequence Colors T A C T C C A T G C A T A C T C C A A G C A

Sometimes, a wrong color is determined at a given position. Due to the dependence between dinucleotides and colors, this affects the remaining sequence from the point of the error: Sequence Colors Sequence Colors T A C T C C A T G C A T A C T C C A A C G T

Thus, when the instrument makes an error while determining a color, the error mode is very different from when a single nucleotide is changed. This ability to differentiate different types of errors and differences is a very powerful aspect of SOLiD sequencing. With other technologies sequencing errors always appear as nucleotide differences.

19.8.3

Mapping in color space

Reads from a SOLiD sequencing run may exhibit all the same differences to a reference sequence as reads from other technologies: mismatches, insertions and deletions. On top if this, SOLiD reads may exhibit color errors, where a color is read wrongly and the rest of the read is affected. If such an error is detected, it can be corrected and the rest of the read can be converted to what it would have been without the error. Consider this SOLiD read: Read Colors T A C T C C A A C G T

The first nucleotide (T) is from the primer, so is ignored in the following analysis. Now, assume that a reference sequence is this: Reference Colors G C A C T G C A T G C A C

Here, the colors are just inferred since they are not the result of a sequencing experiment. Looking at the colors, a possible alignment presents itself:

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING Reference Colors Read Colors G C A C T G C A T G C A C | | | : | |: : : : | | | : | | : : : : A C T C C A A C G T

487

In the beginning of the read, the nucleotides match (ACT), then there is a mismatch (G in reference and C in read), then two more matches (CA), and finally the rest of the read does not match. But, the colors match at the end of the read. So a possible interpretation of the alignment is that there is a nucleotide change in position four of the read and a color space error between positions six and seven in the read. Such an interpretation can be represented as: Reference Read G C A C T G C A T G C A C | | | : | | | | | | A C T C C A*T G C A

Here, the * represents a color error. The remaining part of the displayed read sequence has been adjusted according to the inferred error. So this alignment scores nine times the match score minus the mismatch cost and a color error cost. This color error cost is a new parameter that is introduced when performing read mapping in color space. Note that a color error may be inferred before the first nucleotide of a read. This is the very first color after the known primer nucleotide that is wrong, changing the whole read. Here is an example from a set of real SOLiD data that was reference assembled by taking color space into account using ungapped global alignments.
444_1840_767_F3 has 1 match with a score of 35: 1046535 GATACTCAATGCCGCCAAAGATGGAAGCCGGGCCA 1046569 ||||||||||||||||||||||||||||||||||| GATACTCAATGCCGCCAAAGATGGAAGCCGGGCCA 444_1840_803_F3 has 0 matches 444_1840_980_F3 has 1 match with a score of 29: 2620828 GCACGAAAACGCCGCGTGGCTGGATGGT*CAAC*GTC 2620862 ||||||||||||||||||||||||||||*||||*||| GCACGAAAACGCCGCGTGGCTGGATGGT*CAAC*GTC 444_1840_1046_F3 has 1 match with a score of 32: 3673206 TT*GGTCAGGGTCTGGGCTTAGGCGGTGAATGGGGC 3673240 ||*||||||||||||||||||||||||||||||||| TT*GGTCAGGGTCTGGGCTTAGGCGGTGAATGGGGC 444_1841_22_F3 has 0 matches 444_1841_213_F3 has 1 match with a score of 29: 1593797 CTTTG*AGCGCATTGGTCAGCGTGTAATCTCCTGCA 1593831 reference reference reverse read reference read reference reverse read

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

488

|||||*|||||||| ||||||||||||||||||||| CTTTG*AGCGCATTAGTCAGCGTGTAATCTCCTGCA

reverse read

The first alignment is a perfect match and scores 35 since the reads are all of length 35. The next alignment has two inferred color errors that each count is -3 (marked by * between residues), so the score is 35 - 2 x 3 = 29. Notice that the read is reported as the inferred sequence taking the color errors into account. The last alignment has one color error and one mismatch giving a score of 34 - 3 - 2 = 29, since the mismatch cost is 2. Running the same reference assembly without allowing for color errors, the result is:
444_1840_767_F3 has 1 match with a score of 35: 1046535 GATACTCAATGCCGCCAAAGATGGAAGCCGGGCCA 1046569 ||||||||||||||||||||||||||||||||||| GATACTCAATGCCGCCAAAGATGGAAGCCGGGCCA 444_1840_803_F3 has 0 matches 444_1840_980_F3 has 0 matches 444_1840_1046_F3 has 1 match with a score of 29: 3673206 TTGGTCAGGGTCTGGGCTTAGGCGGTGAATGGGGC 3673240 ||||||||||||||||||||||||||||||||| AAGGTCAGGGTCTGGGCTTAGGCGGTGAATGGGGC 444_1841_22_F3 has 0 matches 444_1841_213_F3 has 0 matches reference reverse read reference reverse read

The first alignment is still a perfect match, whereas two of the other alignment now do not match since they have more than two errors. The last alignment now only scores 29 instead of 32, because two mismatches replaced the one color error above. This shows the power of including the possibility of color errors when aligning: many more matches are found. The reference assembly program in the CLC Genomics Workbench does not directly support alignment in color space only, but if such an alignment was carried out, sequence 444_1841_213_F3 would have three errors, since a nucleotide mismatch leads to two color space differences. The alignment would look like this:
444_1841_213_F3 has 1 match with a score of 26: 1593797 CTTTG*AGCGCATT*G*GTCAGCGTGTAATCTCCTGCA 1593831 |||||*||||||||*|*||||||||||||||||||||| CTTTG*AGCGCATT*G*GTCAGCGTGTAATCTCCTGCA reference reverse read

So, the optimal solution is to both allow nucleotide mismatches and color errors in the same program when dealing with color space data. This is the approach taken by the assembly program in the CLC Genomics Workbench. Note! If you set the color error cost as low as 1 while keeping the mismatch cost at 2 or above, a mismatch will instead be represented as two adjacent color errors.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

489

19.8.4

Viewing color space information

Importing data from SOLiD systems (see section 19.1.3) will from CLC Genomics Workbench version 3.1 be imported as color space. This means that if you open the imported data, it will look like figure 19.66

Figure 19.66: Color space sequence list. In the Side Panel under Nucleotide info, you find the Color space encoding group which lets you define a few settings for how the colors should appear. These settings are also found in the side panel of mapping results and single sequences. Infer encoding This is used if you want to display the colors for non-color space sequence (e.g. a reference sequence). The colors are then simply inferred from the sequence. Show corrections This is only relevant for mapping results - it will show where the mapping process has detected color errors. An example of a color error is shown in figure 19.67. Hide unaligned ends This option determines whether color for the unaligned ends of reads should be displayed. It also controls whether colors should be shown for gaps. The idea behind this is that these color dots will interfere with the color alignment, so it is possible to turn them off.

19.9

Interpreting genome-scale mappings

A big challenge when working with high-throughput sequencing projects is interpretation of the data. Section 19.11 describes how to automatically detect SNPs, whereas this section describes the manual inspection and interpretation techniques which are guided by visual information about the mapping. (We will not cover all the functionalities of the mapping view here, instead we refer to section 18.6 for general information about viewing and editing the resulting mappings). Of particular interest for high-throughput sequencing data is probably the opportunity to extract part of mapping result, see section 18.6.6.

19.9.1

Getting an overview - zooming and navigating

Results from mapping high-throughput sequencing data may be extremely large, requiring an extra effort when you navigate and zoom the view. Besides the normal zoom tools and scrolling via the arrow keys, there are some of the settings in the Side Panel which can help you navigate a large mapping:

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

490

Figure 19.67: One of the dots have both a blue and a green color. This is because this color has been corrected during mapping. Putting the mouse on the dot displays the small explanatory message. Gather sequences at top. Under Read layout at the top of the Side Panel. you find this option. When you zoom in, only the reads aligning to the visible part of the view will be shown. This will save a lot of vertical scrolling. Compactness. Under Read layout, you can use different modes of compactness. This affects the way reads are shown. For example, you can display reads as Packed - very thin stacked lines as shown in figure 19.68. The compactness also affects what information should be displayed below the reads (i.e. quality scores or chromatogram traces). Text size. Under Text format at the bottom of the Side Panel, you decrease the size of the text. This can improve the overview of the results (at the expense of legibility of sequence names etc.).

19.9.2

Single reads - coverage and conflicts

When you only have single reads data, coverage is one of the main resources for interpretation. You can display a coverage graph by clicking the checkbox in the Side Panel as shown in figure 19.68. If you wish to see the exact coverage at a certain position, place the mouse cursor on the graph and see the exact value in the status bar at the very lower right corner of the Workbench window. Learn how to export the data behind the graph in section 7.4. When you zoom out on a large reference sequence, it may be difficult to discern smaller regions of low coverage. In this case, click the Find Low Coverage button at the top of the Side Panel. Clicking once will select the first part of the mapping with coverage at or below the number specified above the button (Low coverage threshold). Click again to find the next part with low coverage. When mapping reads to a reference, a region of no coverage indicates genome-scale mutations. If the sequencing data contains e.g. a deletion, this will appear as a region of no coverage.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

491

Figure 19.68: The coverage graph can be displayed in the Side Panel under Alignment info. Problems during the sequencing process will also result in low coverage regions. In this case, you may wish to re-sequence these parts, e.g. using traditional "Sanger"-sequencing techniques. Due to the integrated nature of the CLC Genomics Workbench you can easily go to the primer designer and design PCR and sequencing primers to cover the low-coverage region. First select the low coverage region (and some extra nucleotides in order to get a good quality of the sequencing in the area of interest), and then: right-click the selection | Open Selection in New View ( ( ) at the bottom of the view Read more about designing primers in section 17. Besides looking at coverage, you can of course also inspect the conflicts by clicking the Find Conflict button at the top of the Side Panel. However, this will be practically impossible for large mappings, and it will not provide the same kind of overview as other approaches. ) | Show Primer Design

19.9.3

Interpreting genomic re-arrangements

Most of the analyses in this section are based on paired data which allows for much more powerful approaches to detecting genome rearrangements. Figure 19.69 shows a part of a mapping with paired reads. You can see that the sequences are colored blue and this leads us to the color settings in the Side Panel: under Residue coloring you find the group Sequence colors where you can specify the following colors: Mapping. The color of the consensus and reference sequence. Black per default. Forward. The color of forward reads (single reads). Green per default. Reverse. The color of reverse reads (single reads). Red per default. Paired. The color of paired reads. Blue per default.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

492

Figure 19.69: Paired reads are shown with both sequences in the pair on the same line. The letters are probably too small to read, but it gives you the impression of how it looks. Non-specific matches. When a read would have matched another place in the mapping, it is considered a double match. This color will "overrule" the other colors. Note that if your mapping with several reference sequences, either using de novo assembly or read mapping with multiple reference sequences, a read is considered a double match when it matches more than once across all the contigs/references. A double match is yellow per default. The settings are shown in figure 19.70. In addition to these colors, there are three graphs that will prove helpful when inspecting the paired reads, both found under Alignment info in the Side Panel (see figure 19.71): Paired distance. Displays the average distance between the forward and the reverse read in a pair. Single paired reads. Displays the percentage of the reads where only one of the reads in a pair matches. Non-perfect matches. Displays the percentage of the reads covering the current position which have at least one mismatch or a gap (the mismatch or gap does not need to be on

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

493

Figure 19.70: Coloring of the reads. this position - if there is just one anywhere on the read, it will count). Non-specific matches. Displays the percentage of the reads which match more than once. Note that if you are mapping against several sequences, either using de novo assembly or read mapping with multiple reference sequences, a read is considered a non-sepcific match when it matches more than once across all the contigs/references. A non-specific match is yellow per default.

Figure 19.71: More information about paired reads can be displayed in the Side Panel. These three graphs in combination with the read colors provide a great deal of information, guiding interpretations of the mapping result. A few examples will give directions on how to take advantage of these powerful tools: Insertions Looking at the Single paired reads graph in figure 19.72, you can see a sudden rise and fall. This means that at this position, only one part of the pair matches the reference sequence.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

494

Figure 19.72: More information about paired reads can be displayed in the Side Panel. Zooming in on the reads, you see how the color of the reads changes (see figure 19.73. They go from blue (paired) to green, meaning that at this point, the reverse part of the paired reads no longer match the reference sequence.

Figure 19.73: Zooming where the single reads kick in. Since their reverse partners do not match the reference, there must be an insertion in the sequenced data. Looking further down the view, the color changes from green to a combination of red (only reverse reads match) and blue (see figure 19.74).

Figure 19.74: Zooming where the paired reads kick in again. The reverse reads colored in red have a forward counterpart which do not match the reference sequence, for the same reason as we see the lonely forward reads before the insertion. Among the reverse reads, the "ordinary" paired reads start again, marking the end of the insertion. As we now have established the presence of an insertion, it would be nice to know the exact location of insertion. You can see its exact position in figure 19.74 where the green reads stop matching the reference and the reverse reads take over (marked by the vertical red selection line).

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING Deletions

495

Deletions are much easier to detect - they are simply areas of no coverage (see figure 19.75).

Figure 19.75: A deletion in the sequenced data results in coverage of 0. Depending on the size of the deletion, you will see a rise in other graphs as well: A small deletion will result in an increase of the Paired distance, because the gap between the forward and the reverse read will just extend the deletion. This is the case in figure 19.75. A larger deletion will result in an increase of Single paired reads when the deletion is larger than the maximum distance allowed between paired reads (because the "other" part of the read has a match which is too far away). This maximum value can be changed when mapping the reads, see section 19.5. This is not illustrated. When you zoom in on the deletion, you can see how the distance between the reads increase (see figure 19.76).

Figure 19.76: Each part of the pair still match because the deletion is smaller than the maximum distance between the reads.

Duplications In figure 19.77, the Non-specific matches graph is now shown. The Non-specific matches are reads that match more than once on the reference sequence. Zooming in on the reads puts a new color into play as shown in figure 19.78. The yellow color means that the reads also match other positions on the reference, and this indicates that there is a duplication.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

496

Figure 19.77: A rise in the Non-specific matches.

Figure 19.78: Non-specific matches are shown in yellow. For a smaller duplication, you will see an increase in the Paired distance, because some of the reads are then matched to the other part of the duplication (this is shown in figure 19.79.

Figure 19.79: Paired distance increases. Inversions The interesting part in figure 19.80 is once again the Single paired reads graph which display a distinct pattern. The explanation of this is as follows. When the first peak starts, it is because the reverse part of the pairs no longer matches the reference sequence. This is shown in detail in figure 19.81. Scrolling further along the view we can see the starting point of the inverted region. This is were the forward reads ends. At the same point, you will see a new pattern: a combination of reverse and paired reads as shown in figure 19.82.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

497

Figure 19.80: Two peaks in the Single paired reads graph.

Figure 19.81: Just before the inversion, only the forward reads match.

Figure 19.82: The inversion starts where the reads shift from green (forward) to a combination of red and blue (reverse and paired) reads. The forward counterpart of the reverse reads has no match because of the inversion, whereas the paired reads have been reversed compared to the other paired reads in the mapping (this is not visible in the user interface, but a conclusion you can draw from the pattern of the other reads). Scrolling to the end of the inversion, you will see a similar pattern as in the beginning - it is just mirrored: Forward reads kick in at the end of the inversion, and reverse reads take over at when we get back to a "normal" sequence (see figure 19.83).

Figure 19.83: The inversion ends where the reads shift from green (forward) to a combination of red and blue (reverse and paired) reads.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

498

19.9.4

Further analysis of read mappings

When you have finished interpreting the results, you may wish to perform additional analyses on the sequenced data. Apart from SNP detection, described in section 19.11, you can use the consensus or reference sequence for all the other analyses of the CLC Genomics Workbench. To get started on using the consensus or reference sequences, you need to know a little trick: right-click the name of the consensus/reference sequence | Open This Sequence in New View ( ) Alternatively, if you have several mappings in a table (as described in sections 19.4.6 and 19.5.5), you can extract the consensus sequences by selecting the relevant rows by pressing Open Consensus at the bottom of the view. In any case, the sequence(s) will now have a life of their own and are no longer attached to the original mapping. If you have annotated open reading frames on the sequence and wish to analyze each of these regions separately, e.g. translating and BLASTing or using other protein analysis tools, you can extract all the ORF annotations by using our Extract Annotations plug-in, available from the Plug-in Manager ( ). This will give you a sequence list containing all the ORFs, making it easy to do batch analyses with other tools from CLC Genomics Workbench.

19.10

Merge mapping results

If you have performed two mappings with the same reference sequences, you can merge the results using the Merge Mapping Results ( ). This can be useful in situations where you have already performed a mapping with one data set, and you receive a second data set that you want to have mapped together with the first one. In this case, you can run a new mapping of the second data set and merge the results: Toolbox | High-throughput Sequencing ( ) | Merge Mapping Results ( )

This opens a dialog where you can select two or more mapping results. Note that they have to be based on the same reference sequences (it doesn't have to be the same file, but the sequence (the residues) should be identical). Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. . For all the mappings that could be merged, a new mapping will be created. If you have used a mapping table as input, the result will be a mapping table. Note that the consensus sequence is updated to reflect the merge. The consensus voting scheme for the first mapping is used to determine the consensus sequence. This also means that for large mappings, the data processing can be quite demanding for your computer.

19.11

SNP detection

Instead of manually checking all the conflicts of a mapping to discover significant single-nucleotide variations, CLC Genomics Workbench offers automated SNP detection (see our Bioinformatics explained article on SNPs at http://www.clcbio.com/BE). The SNP detection in CLC Genomics Workbench is based on the Neighborhood Quality Standard (NQS) algorithm of [Altshuler et al., 2000] (also see [Brockman et al., 2008] for more information).

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

499

Based on your specifications on what you consider a valid SNP, the SNP detection will scan through the entire data and report all the SNPs that meet the requirements: Toolbox | High-throughput Sequencing ( ) | SNP detection ( )

This opens a dialog where you can select read mappings ( )/ ( ) to scan for SNPs (see sections 19.4 and 19.5 for information on how to map reads). You can also select RNA-Seq results ( ) as input. Clicking Next will display the dialog shown in figure 19.84

Figure 19.84: SNP detection parameters.

19.11.1

Assessing the quality of the neighborhood bases

The SNP detection will look at each position in the mapping to determine if there is a SNP at this position. In order to make a qualified assessment, it also considers the general quality of the neighboring bases. The Window size is used to determine how far away from the current position this quality assessment should extend, and it can be specified in the upper part of the dialog. Note that at the ends of the read, an asymmetric window of the specified length is used. If the mapping is based on local alignment of the reads, there will be some reads with un-aligned ends (these ends are faded when you look at the mapping). These unaligned ends are not included in the scanning for SNPs but they are included in the quality filtering (elaborated below). In figure 19.85, you can see an example with a window size of 11. The current position is high-lighted, and the horizontal high-lighting marks the nucleotides considered for a read when using a window size of 11. For each read and within the given window size,1 the following two parameters are used to assess the quality: Minimum average quality of surrounding bases. The average quality score of the nuThe window size is defined as the number of positions in the local alignment between that particular read and the reference sequence (for de novo assembly it would be the consensus sequence).)
1

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

500

Figure 19.85: An example of a window size of 11 nucleotides. cleotides in a read within the specified window length has to exceed this threshold for the base to be included in the SNP calculation for this position (learn more about importing quality scores from different sequencing platforms in section 19.1). Max. number of gaps and mismatches. The number of gaps and mismatches allowed within the window length of the read. Note that this is excluding the "mismatch" that is considered a potential SNP. If there are more gaps or mismatches, this read will not be included in the SNP calculation at this position. Unaligned regions (the faded parts of a read) also count as mismatches, even if some of the bases match. Note that for sequences without quality scores, the quality score settings will have no effect. In this case only the gap/mismatch threshold will be used for filtering low quality reads. Figure 19.85 shows an example of a read with a mismatch, marked in dark blue. The mismatch is inside the window of 11 nucleotides. When looking at a position near the end of a read (like the read at the bottom in figure 19.85), the window will be asymmetric as shown in figure 19.86. The window size will thus still be 11 in this case.

Figure 19.86: A window near the end of a read. Besides looking horizontally within a window for each read, the quality of the central base is also examined: Minimum quality of central base. This is the quality score for the central base, i.e.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

501

the bases in the column high-lighted in figure 19.87. Bases with a quality score below this value are not considered in the SNP calculation at this position.

Figure 19.87: A column of central bases in the neighborhood. In addition to low-quality reads, reads that match more than once on the reference sequence(s) are also ignored. These reads are also called Non-specific matches and are colored in yellow in the view.

19.11.2

Significance of variation: is it a SNP?

At a given position, when the reads with low quality and multiple matches have been removed, the reads which pass the quality assessment will be compared to the reference sequence to see if they are different at this position (for de novo assembly the consensus sequence is used for comparison). For a variation to count as a SNP, it has to comply with the significance threshold specified in the dialog shown in figure 19.84. Minimum coverage. If SNPs were called in areas of low coverage, you would get a higher amount of false positives. Therefore you can set the minimum coverage for a SNP to be called. Note that the coverage is counted as the number of valid reads at the current position (i.e. the reads remaining when the quality assessment has filtered out the bad ones). Minimum variant frequency. This option is the threshold for the number of reads that display a variant at a given position. The threshold can be set as a frequency percentage or as a count. Setting the percentage at 35 % means that at least 35 % of the validated reads at this position should have a different base. Below, there is an Advanced option letting you specify additional requirements. These will only take effect if the Advanced checkbox is checked. Minimum paired coverage. In samples based on paired data, more confidence is often attributed to valid paired reads than to single reads. You can therefore set the minimum coverage of valid paired reads in addition to the minimum coverage of all reads. Again, the paired coverage is counted as the number of valid reads completely covering the SNP (the space between mating pairs does not cover anything.) Note that when a value is

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

502

provided for minimum paired coverage, reads from broken pairs will not be considered for SNP detection. Maximum coverage. Although it sounds counter-intuitive at first, there is also a good reason to be suspicious about high-coverage regions. Read coverage often displays peaks in repetitive regions where the alignment is not very trustworthy. Setting the maximum coverage threshold a little higher than the expected average coverage (allowing for some variation in coverage) can be helpful in ruling out false positives from such regions. You can see the distribution of coverage by creating a detailed mapping report (see section 19.6.1). The result table created by the SNP detection includes information about coverage, so you can specify a high threshold in this dialog, check the coverage in the result afterwards, and then run the SNP detection again with an adjusted threshold. Minimum variant count. This option is the threshold for the number of reads that display a variant at a given position. In addition to the percentage setting in the simple panel above, these settings are based on absolute counts. If the count required is set to 3, and the sufficient count is set to 5, it means that even though less than the required percentage of the reads have a variant base, it will still be reported as a SNP if at least 5 reads have it. However, if the count is 2, the SNP will not be called, regardless the percentage setting. This distinction is especially useful with deep sequencing data where you have very high coverage and many different alleles. In this case, the percentage threshold is not suitable for finding valid SNPs in a small subset of the data. If you are not interested in reporting SNPs based on counts but only rely on the relative frequency, you can simply set the sufficient count number very high. Positions where the reference sequences (consensus sequences for de novo assembly) have gaps and unaligned ends of the reads (faded part of the read) will not be considered in the SNP detection. The last setting in this dialog (figure 19.84) concerns ploidy: Maximum expected variations. This is not a filtering option but a reporting option that is related to the minimum variant frequency setting. If the frequency or count threshold is set low enough the algorithm can call more allelic variants than the ploidy number of the organism sequenced. Such a result may occur as a real result but is inconsistent with the common assumption of an infinite sites mutation model where mutations are assumed to be so rare that they never affect the same position twice. For this reason, you can use the maximum expected variations setting to mark reported SNPs as "complex" when they involve more allelic variations then expected from the ploidy number under an infinite sites model. Note, that with this interpretation the "complex" flag holds true regardless of whether the sequencing data are generated from a population sample or from an individual sample (however, see below for an exception). For example, using a minimum variant frequency of 30% with a diploid organism, you are allowing SNPs with up to 3 variations within the sequencing reads, and by then setting the maximum expected variations count to 2 (the default), any SNPs with 3 variations will be marked as "complex" (see below). A ploidy level of 1 with two allelic variants represents a special case. Two allelic variants can occur if all reads are found to agree on one base that differs from the reference. Here, the number of allelic variants is higher than the ploidy level. but this is not inconsistent with an infinite sites mutation model and will not be termed complex. Two allelic variants can also occur if two variants are found within the sequencing reads where one of the variants is the same as the reference. Again, the data are not inconsistent with an infinite sites model if the sequencing data are generated from a population

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

503

sample, but they are inconsistent with a clonal mutation-free origin of a sample from a single individual. For this reason we have chosen to also designate this latter case as "complex". When there are ambiguity bases in the reads, they will be treated as separate variations. This means that e.g. a Y will not be collapsed with C or T in other reads. Rather, the Ys will be counted separately.

19.11.3

Reporting the SNPs

When you click Next, you will be able to specify how the SNPs should be reported (see figure 19.88).

Figure 19.88: Reporting options for SNP detection.

Add SNP annotations to reference. This will add an annotation for each SNP to the reference sequence. Add SNP annotations to consensus. This will add an annotation for each SNP to the consensus sequence. Create table. This will create a table showing all the SNPs found in the data set. The table will provide a valuable overview, whereas the annotations are useful for detailed inspection of a SNP, and also if the consensus sequence is used in further analysis in the CLC Genomics Workbench. The table displays the same information as the annotation for each SNP. Genetic code. When reporting the effect of a SNP on the amino acid, this translation table specified here is used. Merge SNPs located within same codon. This will merge SNPs that fall within the same codon (see section 19.11.4). Figure 19.89 shows a SNP annotation.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

504

Figure 19.89: A SNP annotation within a coding region. The SNP in figure 19.89 is within a coding region and you can see that one of the variations actually changes the protein product (from Lys to Thr). Placing your mouse on the annotation will reveal additional information about the SNP as shown in figure 19.90.

Figure 19.90: A SNP annotation with associated information. The SNP annotation includes the following additional information: Reference position. The SNP's position on the reference sequence. Consensus position. The SNP's position on the consensus sequence. Variation type. The SNP is described as complex, if it has more variations than specified in the ploidy setting in figure 19.84. Length. The length of the SNP will always be one, as the name implies, unless two SNPs are found within the same codon (see section 19.11.4). Reference. The base found in the reference sequence. For results from de novo assembly, it will be the base found in the consensus sequence.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING Variants. The number of variants among the reads.

505

Allele variations. Displays which bases are found at this position. In the example shown in figure 19.89, the reference sequence has a T whereas some of the reads have a G. Frequencies. The frequency of a given variant. In the example shown in figures 19.89 and 19.90, 61 % of the reads have a G and 39 % have a T. Counts. This is similar to the frequency just reported in absolte numbers. In the example shown in figures 19.89 and 19.90, 14 reads have a G and 9 have a T. Coverage. The coverage at the SNP position. Note that only the reads that pass the quality filter will be reported here. Variant numbers and frequencies. The information from the Allele variations, frequencies and counts are also split apart and reported for each variant individually (variant #1, #2 etc., depending on the ploidy setting. Overlapping annotations. This line shows if the SNP is covered by an annotation. The annotation's type and name will displayed. For annotated reference sequences, this information can be used to tell if the SNP is found in e.g. a coding or non-coding region of the genome. Note that annotations of type Variation and Source are not reported. Amino acid change. If the reference sequence of the is annotated with ORF or CDS annotations, the SNP detection will also report whether the SNP is synonymous or nonsynonymous. If the SNP variant changes the amino acid in the protein translation, the new amino acid will be reported (see figure 19.91). Note that adjacent SNPs within the same codon are reported as one SNP in order to determine the impact on the protein level (see section 19.11.4).. The same information is also recorded in the table. An example of a table is shown in figure 19.91. In addition to the information shown as annotation, the table also includes the name of the mapping (since the table can include SNPs for many mappings, you need to know which one it belongs to). The table can be Exported ( ) as a csv file (comma-separated values) and imported into e.g. Excel. Note that the CSV export includes all the information in the table, regardless of filtering and what has been chosen in the Side Panel. If you only want to use a subset of the information, simply select and Copy ( ) the information. The columns in the SNP and DIP tables have been synchronized to enable merging in a spreadsheet. Note that if you make a split view of the table and the mapping (see section 3.2.6), you will be able to browse through the SNPs by clicking in the table. This will cause the view to jump to the position of the SNP. If you wish to investigate the SNPs further, you can use the filter option (see section C). Figure 19.92 show how to make a filter that only shows homozygote SNPs. You can also use the filter to show e.g. nonsynonymous SNPs (filter the Amino acid change column to not being empty as shown in figure 19.93).

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

506

Figure 19.91: A table of SNPs.

Figure 19.92: Filtering away the SNPs that have more than one allele variant.

19.11.4

Adjacent SNPs affecting the same codon

Figure 19.94 shows an example where two adjacent SNPs are found within the same codon. The CLC Genomics Workbench can report these SNPs as one SNP in order to evaluate the combined effect on the translation to protein. If these SNPs were considered individually, the predicted amino acid change for each individual SNP would not have been reflecting the sequencing data.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

507

Figure 19.93: Filtering the SNP table to only display nonsynonymous SNPs.

Figure 19.94: Two adjacent SNPs in the same codon. The CLC Genomics Workbench will first find the individual SNPs and in the cases where two SNPs are found within the same codon, they are considered for a merge. Note that the merged SNP needs to be supported by the same reads that gave rise to the individual SNP calls. Consider the case shown in figure 19.95, where there are still two adjacent SNPs within the same codon, but there are no reads supporting the merged SNP. In this case, no SNP will be reported since there are no reads supporting the merged SNP. Note that both the individual SNP and the merged SNP need to fulfill the quality filtering and significance criteria to be reported. When reporting merged SNPs please be aware that these will find it harder to pass through the quality filtering since there are requirements for both the individual SNPs and the merged SNP to be fulfilled.

19.12

DIP detection

CLC Genomics Workbench offers automated detection of small deletion/insertion polymorphisms (also known as DIPs) when reads are mapped to a reference. If you have high coverage in your mapping, you will often find a lot of gaps in the consensus sequence. This is because just a single insertion in one of the reads will cause a gap in all

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

508

Figure 19.95: Two adjacent SNPs in the same codon but with different reads. other sequences at this position. The majority of all these gaps should simply be ignored as they were introduced due to sequencing errors in a single read or a very few reads. Automated DIP detection can be used to find the gaps that are significant. If you want to use the consensus sequence for other purposes, you can simply ignore all the gaps (they will disappear once the consensus sequence is out of the mapping view), and the significant ones can then be annotated as DIPs (see section 19.12.2). In CLC Genomics Workbench, a DIP is a deletion or an insertion of consecutive nucleotides present in experimental sequencing data when compared to a reference sequence. Automated DIP detection is therefore possible only for results from read mapping. The terms "deletion" and "insertion" are understood as events that have happened to the sequencing sample relative to the reference sequence: when the local alignment between a read and the reference exhibits gaps in the read, nucleotides have been deleted (in the read, relative to the reference), and when the local alignment exhibits gaps in the reference sequence, nucleotides have been inserted (in the read, relative to the reference). Figure 19.96 shows an insertion (of TC, to the left) and a deletion (of CC, to the right).

Figure 19.96: Two DIPs, an insertion and a deletion. The automated DIP detection in CLC Genomics Workbench bases all reported DIPs on DIPs found in individual reads. The length of reported deletions and insertions is therefore bounded by the number of insertions and deletions allowed per read by the read mapping algorithm.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

509

In most situations, a DIP in a single read is not sufficient experimental evidence. The CLC Genomics Workbench allows you to specify how many reads must cover and agree on a DIP in order for it to be reported by the automated DIP detection. Two reads agree on a deletion if their local alignments to the reference sequence both contain the same number of consecutive gaps aligned to the same reference positions. Likewise, two reads agree on an insertion if their local alignments specify the same number of consecutive gaps at the same position in the reference sequence and the nucleotides inserted in the two reads are the same. Figure 19.97 shows some reads disagreeing on an insertion (of TC or TA?, on the left) and agreeing on a deletion (of CC, on the right).

Figure 19.97: Disagreement and agreement of DIPs. Based on your specifications on what you consider a valid DIP, the DIP detection will scan through the entire mapping and report all the DIPs that meet the requirements: Toolbox | High-throughput Sequencing ( ) | DIP detection ( ) ) to scan for DIPs (see

This opens a dialog where you can select read mapping results ( )/ ( section 19.5 for information on how to map reads to a reference).

19.12.1

Experimental support of a DIP

Clicking Next will display the dialog shown in figure 19.98.

Figure 19.98: DIP detection parameters. To avoid false positives, the automated DIP detection of CLC Genomics Workbench ignores reads

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

510

that have multiple hit positions on the reference (marked by yellow color) or reads that come from broken pairs. In addition, CLC Genomics Workbench allows you to specify thresholds for the experimental support of reported DIPs, thus filtering the DIPs found in single, valid reads, see figure 19.98. Minimum coverage. DIPs called in areas of low coverage will likely result in a higher amount of false positives. Therefore you can set the minimum coverage for a DIP to be called. Note that the coverage is counted as the number of valid reads completely covering the DIP. Minimum variant frequency. Often reads do not completely agree on a DIP, and you may want to report only the most frequent variants at each DIP site. This threshold can be specified as the percentage of the reads or the absolute number of reads. By default, the frequency in percent is set to 35%, which means that at least 35% of the valid reads covering the DIP site must agree on the DIP for it to be reported. In effect, this means that at most two different variants will be reported at each site, which is reasonable for diploid organisms. If a DIP is frequent enough to be reported, the DIP annotation or table entry will contain information about all other variants which are also frequent enough---even if they are not DIPs. Below, there is an Advanced option letting you specify additional requirements. These will only take effect if the Advanced checkbox is checked. Minimum paired coverage. In based on paired data, more confidence is often attributed to valid paired reads than to single reads. You can therefore set the minimum coverage of valid paired reads in addition to the minimum coverage of all reads. Again, the paired coverage is counted as the number of valid reads completely covering the DIP (the space between mating pairs does not cover anything.) Note that regardless of this setting, reads from broken pairs are never considered for DIP detection. Maximum coverage. Read coverage often displays peaks in repetitive regions where the alignment is not very trustworthy. Setting the maximum coverage threshold a little higher than the expected average coverage (allowing for some variation) can be helpful in ruling out false positives from such regions. Minimum variant counts. This option is the threshold for the number of reads that display a DIP at a given position. In addition to the percentage setting in the simple panel above, these settings are based on absolute counts. If the count required is set to 3, and the sufficient count is set to 5, it means that even though less than the required percentage of the reads have a DIP, it will still be reported as a DIP if at least 5 reads have it. However, if the count is 2, the DIP will not be called, regardless the percentage setting. This distinction is especially useful with deep sequencing data where you have very high coverage and many different alleles. In this case, the percentage threshold is not suitable for finding valid DIPs in a small subset of the data. If you are not interested in reporting DIPs based on counts but only rely on the relative frequency, you can simply set the sufficient count number very high. Maximum expected variations. This is not a filtering option, but is related to the minimum variant frequency setting. By setting the frequency threshold low enough to allow more variants than the ploidy of the organism sequenced, you can use the maximum expected

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

511

variations setting to mark reported DIPs as "complex", if they involve more variations then expected from the ploidy. For example, using a minimum variant frequency of 30% with a diploid organism, you are allowing DIPs with up to 3 variations, and then by setting the maximum expected variations count to 2 (the default), any DIPs with 3 variations will be marked as complex (see below).

19.12.2

Reporting the DIPs

When you click Next, you will be able to specify how the DIPs should be reported: Annotate reference sequence(s). This will add an annotation for each DIP to the reference sequences in the input. Annotate consensus sequence(s). This will add an annotation for each DIP to the consensus sequences in the input. In either way, DIP annotations contain the following information: Reference position. The first position of the DIP in the reference sequence. Consensus position. The first position of the DIP in the consensus sequence. Variation type. Will be "DIP" or "Complex DIP", depending on the value of the maximum expected variations setting and the actual number of variations found at the DIP site. Length. The length of the DIP. Note that only small deletions and insertions are found. This is because the DIP detection is based on the alignment of the reads generated by the mapping process, and the mapping only allows a few insertions/deletions (see section 19.5 for information on how to map reads to a reference). Reference. The residues found in the reference sequence (either gaps for insertions or bases for deletions). Variants. The number of variants among the reads. Allele variation. The variations found in the reads at the DIP site. Contains only those variations whose frequency is at least that specified by the minimum variant frequency setting. Frequencies. The frequencies of the variations, both absolute (counts) and relative (percentage of coverage). Coverage. The number of valid reads completely covering the DIP site. Variant numbers and frequencies. The information from the Allele variations, frequencies and counts are also split apart and reported for each variant individually (variant #1, #2 etc., depending on the ploidy setting. Overlapping annotations. Says if the DIP is covered, in part or in whole, by an annotation. The annotation's type and name will displayed. For annotated reference sequences, this information can be used to tell if the DIP is found in e.g. a coding or non-coding region of the genome. Note that annotations of type Variation and Source are not reported. Amino acid change. If the reference sequence of is annotated with ORF or CDS annotations, the DIP detection will also report whether the DIP changes the amino acid sequence resulting from translation, and, if so, whether the change involves frame-shifting.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

512

Create table. This will create a table showing all the DIPs found. The table will provide a valuable overview, whereas the annotations are useful for detailed inspection of a DIP, and also if the annotated sequences are used for further analysis in the CLC Genomics Workbench. Figure 19.99 shows the result of a DIP detection output as annotations on the reference sequence. The DIP detection found the DIPs of figure 19.97.

Figure 19.99: DIPs detected witin a coding region. The DIPs occur within a coding region (identified by the long yellow annotation) and you can see that they both shift the frame of the translation, since their sizes are not divisible by 3. Placing your mouse on the annotations will reveal detailed information about the DIPs as shown in figure 19.100.

Figure 19.100: A DIP annotation with detailed information. The same information is also recorded in the table output. An example of a table is shown in figure 19.101. In addition to the information shown as annotation, the table also includes the name of the mapping (since the table can include DIPs for many references, you need to know which one it belongs to). The table can be Exported ( ) as a csv file (comma-separated values) and imported into e.g. Excel. Note that the CSV export includes all the information in the table, regardless of filtering and what has been chosen in the Side Panel. If you only want to use a subset of the information, simply select and Copy ( ) the information. The columns in the SNP and DIP tables have been synchronized to enable merging in a spreadsheet. Note that if you make a split view of the table and the mapping (see section 3.2.6), you will be able to browse through the DIPs by clicking in the table. This will cause the view to jump to the position of the DIP.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

513

Figure 19.101: A table of DIPs.

19.13

ChIP sequencing

CLC Genomics Workbenchcan perform analysis of Chromatin immunoprecipitation sequencing (ChIP-Seq) data based on the information contained in a single sample subjected to immunoprecipitation (ChIP-sample) or by comparing a ChIP-sample to a control sample where the immunoprecipitation step is omitted. The first step in a ChIP-Seq analysis is to map the reads to a reference (see section 19.5) which maps your reads against one or more specified reference sequences. If both a ChIP- and a control sample is used, these must be mapped separately to produce separate ChIP- and control samples. These samples are then used as input to the ChIP-Seq tool which surveys the pattern in coverage to detect significant peaks: Toolbox | High-throughput Sequencing ( ) | ChIP-Seq Analysis ( ) )/ ( ) to use as

This opens a dialog where you can select one or more mapping results ( ChIP-samples. Control samples are selected in the next step.

19.13.1

Peak finding and false discovery rates

Clicking Next will display the dialog shown in figure 19.102. If the option to include control samples is included, the user must select the appropriate sample to use as control data. If the mapping is based on several reference sequences, the Workbench will automatically match the ChIP-samples and controls based on the length of the reference sequences. The peak finding algorithm includes the following steps: Calculate the null distribution of background sequencing signal Scan the mappings to identify candidate peaks with a higher read count than expected from the null distribution

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

514

Figure 19.102: Peak finding and false discovery rates. Merge overlapping candidate peaks Refine the set of candidate peaks based on the count and the spatial distribution of reads of forward and reverse orientation within the peaks The estimation of the null distribution of coverage and the calculation of the false discovery rates are based on the Window size and Maximum false discovery rate (%) parameters. The Window size specifies the width of the window that is used to count reads both when the null distribution is estimated and for the subsequent scanning for candidate peaks. The Maximum false discovery rate specifies the maximum proportion of false positive peaks that you are willing to accept among your called peaks. A value of 10 % means that you are willing to accept that 10 % of the peaks called are expected to be false discoveries. To estimate the false discovery rate (FDR) we use the method of [Ji et al., 2008] (see also Supplementary materials of the paper). In the case where only a ChIP-sample is used, a negative binomial distribution is fitted to the counts from low coverage regions. This distribution is used as a null distribution to obtain the numbers of windows with a particular count of reads that you would expect in the absence of significant binding. By comparing the number of windows with a specific count you expect to see under the null distribution and the number you actually see in your data, you can calculate a false discovery rate for a given read count for a given window size as: 'fraction of windows with read count expected under the null distribution'/'fraction of windows with read count observed'. In the case where both a ChIP- and a control sample are used, a sampling ratio between the samples is first estimated, using only windows in which the total numbers of reads (that is, the sum of those in the sample and those in the control) is small. The sampling ratio is estimated sample as the ratio of the cumulated sample read counts (csample = i ki ) to cumulated control control ) in these windows. The sampling ratio is used to estimate the read counts (ccontrol = i ki proportion of the reads that are expected to be ChIP-sample reads under the null distribution, as p0 = csample /(csample + ccontrol ). For a given total read count, n, of a window, the numbers of reads expected in the ChIP-sample under the null distribution can then be estimated from the binomial distribution with parameters n and p0 . By comparing the expected and observed

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

515

numbers, a false discovery rate can then be calculated. Note, that when a control sample is used different null-distributions are estimated for different total read counts, n. In both cases, the user can specify whether the null distribution should be estimated separately for each reference sequence by checking the option Analyze each reference separately. Because the ChIP-seq experimental protocol selects for sequencing input fragments that are centered around a DNA-protein binding site it is expected that true peaks will exhibit a signature distribution where forward reads are found upstream of the binding site and reverse reads are found downstream of the binding site leading to reduced coverage at the exact binding site. For this reason, the algorithm allows you to shift forward reads towards the 3' end and reverse reads towards the 5' end in order to generate a more marked peak prior to the peak detection step. This is done by checking the Shift reads based on fragment length box. To shift the reads you also need to input the expected length of the sequencing input fragments by setting the Fragment length parameter, this is the size of the fragment isolated from gel (L in the illustration below). The illustration below shows a peak where the forward reads are in one window and the reverse reads fall in another window (window 1 and 3).
------------------------------------------------------------------------------|---------------------> ----> <--<--|--------------------|--------------------|------------1 2 3 reference (actual sequenced fragment length = L bp) reads reads reads reads. window size W

If the reads are not shifted, the algorithm will count 2 reads in window 1 and 3. But if the forward reads are shifted 0.5XL to the right and reverse reads are shifted 0.5xL to left, the algorithm will find 4 reads in window 2 as shown below:
--------------------------------------------------------- reference ----------------------|-----------------(actual sequenced fragment length = L basepairs) ----> reads ----> reads <--reads <--reads |--------------------|--------------------|------------1 2 3 window size W

So shifting reads will increase the signal to noise ratio. The following peak refinement step, the reporting of the peak and the visualization will use the original position of the reads, so the shifting is only a virtual shift performed as part of the peak detection.

19.13.2

Peak refinement

Clicking Next will display the dialog shown in figure 19.103. This dialog presents the parameters and options that can be used to refine the set of candidate peaks discovered when scanning the read mapping. All three refinement options again utilize the fact that coverage around a true DNA-protein binding site is expected to exhibit a signature distribution where forward reads are found upstream of the binding site and reverse reads

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

516

Figure 19.103: Peak refinement settings. are found downstream of the binding site. Peak refinement can be performed both with- and without a control sample but the algorithm only uses information contained in the reads from the ChIP-samples, not the control samples. If the Boundary refinement option is checked, the algorithm will estimate the position of the DNA-protein binding interaction and place the resulting annotations on this region, rather than on the region where a peak in coverage is found. A center of sequencing intensity is defined for all forward reads as the median value of the center points of all forward reads and likewise for all reverse reads. The "refined peak" is thus defined as the region between these two points. One of the advantages of including this boundary refinement is that shorter regions can be given as input to subsequent pattern discovery analysis. By checking the Filter peaks based on difference in read orientation counts the algorithm will calculate the normalized difference in the number of forward and reverse reads within a peak as |count forward reads - count reverse reads| count forward reads + count reverse reads The desired maximum value of this parameter can be set in the Normalized difference of read counts field and any candidate peak with a value above this will then be dismissed. Setting a low value will ensure that peaks are only called if there is a well balanced number of forward and reverse reads. As an example if you have 15 forward reads and 5 reverse reads, you will end up with a value of 0.5. With the default limit set to 0.4, a peak like that would be excluded. By checking the Filter peaks based on spatial distribution of read orientation the algorithm will evaluate how clearly separated the location of forward and reverse reads are within a peak. This is done via the Wilcoxon rank-sum test (see http://en.wikipedia.org/wiki/ Mann-Whitney-Wilcoxon_test). The null hypothesis here is that the positions of forward and reverse reads within a peak are drawn from the same distribution i.e. that their locations are not significantly different and the alternative hypothesis is that the forward reads have a sum of ranked positions that is shifted to lower positions than the reverse reads. Peaks will

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

517

be dismissed if the probability of the null hypothesis exceeds the value set in the Maximum probability field. Setting a low Maximum probability will ensure that peaks are only called if there is a clear signature distribution where forward reads are found upstream of reverse reads within the peak. A general comment about peak filtering is that the relevant statistics are all reported in the peak table that the algorithm outputs. If it is desirable to explore a large set of candidate peaks it is recommended to use no or relatively loose filtering criteria and then use the advanced table filtering options to explore the effect of the different parameters (see section C). It may be desirable to omit the addition of annotations in this exploratory analysis and rely on the information in the table instead. Once a desired set of parameters is found, the algorithm can be rerun using these as filtering criteria to add annotations to the reference sequence and to produce a final list of peaks.

19.13.3

Reporting the results

When you click Next, you will be able to specify how the results should be reported (see figure 19.104).

Figure 19.104: Output options. The different output options are described in detail below. Note, that it is not possible to output a graph and table of read counts in the case where a control sample is used. These options are therefore disabled in this case. Graph and table of background distribution and false discovery statistics An example of a FDR graph based on a single ChIP-sample is shown in figure 19.105. The graph shows the estimated background distribution of read counts in discrete windows and the observed counts and can thus be used to inspect how well the estimated distribution fits the observed pattern of coverage. The FDR table displays the observed and expected fraction of windows with a given read count

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

518

Figure 19.105: FDR graph. and also shows the rate of false discovery related to a given level of coverage within a window: # reads - the number of reads within a window. # windows - the number of windows with the given read count. A window of a fixed width is slid across the sequence. For every window position the number of reads in that window is recorded and stored as the read count. After this, the windows are counted based on their recorded read counts. # windows of read count x is thus the number of windows that were found to contain x reads during this process. This is done to establish the background distribution of coverage and to evaluate the fit of the estimated distribution. Observed - the observed faction of windows with the given read count. Expected under null - the expected fraction of windows with a given read count, under the null distribution. FDR % - the false discovery rate which is the fraction of the peaks with the given read count that can be expected to be false positives. An example is shown in figure 19.106. From this table you can see that less than 5% of the called peaks with 9 reads can be expected to be false discoveries and for peaks with 11 reads the FDR is less than 1%. Peak table and annotations The main result is the table showing the peaks and the annotations added to the reference sequence. An example of a peak table is shown in figure 19.107. The table includes information about each peak that has been found:

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

519

Figure 19.106: FDR table.

Figure 19.107: ChIP sequencing peak table. Name. If the mapping was based on more than one reference sequence, the name of the reference sequence in question will be shown here. Region. The position of the peak. To find that position in the ChIP-sample mapping, you can make a split view of the table and the mapping (see section 3.2.6). You will then be able to browse through the peaks by clicking in the table. This will cause the view to jump to the position of the peak region. Length. The length of the peak. FDR (%). The false discovery rate for the peak (learn more in section 19.13.1). # Reads. The total number of reads covering the peak region. # Forward reads. The number of forward reads covering the peak region. # Reverse reads. The number of reverse reads covering the peak region. The normalized difference in the count of forward-reverse reads is calculated based on these numbers (see

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING figure 19.103). Normalized difference. See section 19.13.2.

520

P-value. The p-value is for the Wilcoxon rank sum test for the equality of location of forward and reverse reads in a peak. See section 19.13.2. Max forward coverage. The refined region described in section 19.13.2 is calculated based on the maximum coverage of forward and reverse reads. Max reverse coverage. See previous. Refined region. The refined region. Refined region length. The length of the refined region. 5' gene. The nearest gene upstream, based on the start position of the gene. The number in brackets is the distance from the peak to the gene start position. 3' gene. The nearest gene downstream, based on the start position of the gene. The number in brackets is the distance from the peak to the gene start position. Overlapping annotations. Displays any annotations present on the reference sequence that overlap the peak. Note that if you make a split view of the table and the mapping (see section 3.2.6), you will be able to browse through the peaks by clicking in the table. This will cause the view to jump to the position of the peak. An example of a peak is shown in figure 19.108. If you want to extract the sequence of all the peak regions to a list, you can use the Extract Annotations plug-in (see http://www.clcbio.com/index.php?id=938) to extract all annotations of the type "Binding site".

19.14

RNA-Seq analysis

Based on an annotated reference genome and mRNA sequencing reads, the CLC Genomics Workbench is able to calculate gene expression levels as well as discover novel exons. The key annotation types for RNA-Seq analysis of eukaryotes are of type gene and type mRNA. For prokaryotes, annotations of type gene are considered. The approach taken by the CLC Genomics Workbench is based on [Mortazavi et al., 2008]. The RNA-Seq analysis is done in several steps: First, all genes are extracted from the reference genome (using annotations of type gene). Other annotations on the gene sequences are preserved (e.g. CDS information about coding sequences etc). Next, all annotated transcripts (using annotations of type mRNA) are extracted. If there are several annotated splice variants, they are all extracted. Note that the mRNA annotation type is used for extracting the exon-exon boundaries. An example is shown in figure 19.109. This is a simple gene with three exons and two splice variants. The transcripts are extracted as shown in figure 19.110.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

521

Figure 19.108: Inspecting an annotated peak. The green lines represent forward reads and the red lines represent reverse reads.

Figure 19.109: A simple gene with three exons and two splice variants.

Figure 19.110: All the exon-exon junctions are joined in the extracted transcript. Next, the reads are mapped against all the transcripts plus the entire gene (see figure 19.111). From this mapping, the reads are categorized and assigned to the genes (elaborated later in this section), and expression values for each gene and each transcript are calculated. After that, putative exons are identified. Details on the process are elaborated below when describing the user interface. To start the RNA-Seq analysis analysis: Toolbox | High-throughput Sequencing ( ) | RNA-Seq Analysis ( )

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

522

Figure 19.111: The reference for mapping: all the exon-exon junctions and the gene. This opens a dialog where you select the sequencing reads (not the reference genome or transcriptome). The sequencing data should be imported as described in section 19.1. If you have several different samples that you wish to measure independently and compare afterwards, you should run the analysis in batch mode (see section 9.1). Click Next when the sequencing data is listed in the right-hand side of the dialog.

19.14.1

Defining reference genome and mapping settings

You are now presented with the dialog shown in figure 19.112.

Figure 19.112: Defining a reference genome for RNA-Seq. At the top, there are two options concerning how the reference sequences are annotated: Use reference with annotations. Typically, this option is chosen when you have an annotated genome sequence. Choosing this option means that gene and mRNA annotations on the sequence will be used if you choose the option Eukarotes in the next window. If you choose the option Prokaryotes in the next window, the annotations of type gene only are used. See section 19.14.1 for more information. Use reference without annotations. This option is suitable for situations like mapping back reads to un-annotated EST consensus sequences. The reference in this case is a list of sequences. A common situation is for a multi-fasta file to be imported into the Workbench to be used for this purpose. Each sequence in the list will be treated as a "gene" (or

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

523

"transcript"). Note that the Workbench uses prokaryote settings here. This means that it does not look for new exons (see section 19.14.2) and it assumes that the sequences have no introns). Just below these two options, you click to select the reference sequences. Next, you can choose to extend the region around the gene to include more of the genomic sequence by changing the value in Flanking upstream/downstream residues. This also means that you are able to look for new exons before or after the known exons (see section 19.14.2). When the reference has been defined, click Next and you are presented with the dialog shown in figure 19.113.

Figure 19.113: Defining mapping parameters for RNA-Seq. The mapping parameters are: Maximum number of mismatches. This parameter is available if you use short reads (shorter than 56 nucleotides, except for color space data which are always treated as long reads). This is the maximum number of mismatches to be allowed. Maximum value is 3, except for color space where it is 2. Minimum length fraction. For long reads, you can specify how much of the sequence should be able to map in order to include it. The default is 0.9 which means that at least 90 % of the bases need to align to the reference. Minimum similarity fraction. This also applies to long reads and it is used to specify how exact the matching part of the read should be. When using the default setting at 0.8 and the default setting for the length fraction, it means that 90 % of the read should align with 80 % similarity in order to include the read. Maximum number of hits for a read. A read that matches to more distinct places in the references than the 'Maximum number of hits for a read' specified will not be mapped (the notion of distinct places is elaborated below). If a read matches to multiple distinct places,

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

524

but below the specified maximum number, it will be randomly assigned to one of these places. The random distribution is done proportionally to the number of unique matches that the genes to which it matches have, normalized by the exon length (to ensure that genes with no unique matches have a chance of having multi-matches assigned to them, 1 will be used instead of 0, for their count of unique matches). This means that if there are 10 reads that match two different genes with equal exon length, the two reads will be distributed according to the number of unique matches for these two genes. The gene that has the highest number of unique matches will thus get a greater proportion of the 10 reads. Places are distinct in the references if they are not identical once they have been transferred back to the gene sequences. To exemplify, consider a gene with 10 transcripts and 11 exons, where all transcripts have exon 1, and each of the 10 transcripts have only one of the exons 2 to 11. Exon 1 will be represented 11 times in the references (once for the gene region and once for each of the 10 transcripts). Reads that match to exon 1 will thus match to 11 of the extracted references. However, when transferring the mappings back to the gene it becomes evident that the 11 match places are not distinct but in fact identical. In this case the read will not be discarded for exceeding the maximum number of hits limit, but will be mapped. In the RNA-seq action this is algorithmically done by allowing the assembler to return matches that hit in the 'maximum number of hits for a read' plus 'the maximum number of transcripts' that the genes have in the specified references. The algorithm post-processes the returned matches to identify the number of distinct matches and only discards a read if this number is above the specified limit. Similarly, when a multi-match read is randomly assigned to one of it's match places, each distinct place is considered only once. Strand-specific alignment. When this option is checked, the reads will only be mapped in their forward orientation (genes on the minus strand are reverse complemented before mapping). This is useful in places where genes overlap but are on different strands because it is possible to assign the reads to the right gene. Without the strand-specific protocol, this would not be possible (see [Parkhomchuk et al., 2009]). There is also a checkbox to Use color space which is enabled if you have imported a data set from a SOLiD platform containing color space information. Note that color space data is always treated as long reads, regardless of the read length. Paired data in RNA-Seq The CLC Genomics Workbench supports the use of paired data for RNA-Seq. A combination of single reads and paired reads can also be used. There are three major advantages of using paired data: Since the mapped reads span a larger portion of the reference, there will be less nonspecifically mapped reads. This means that there is in general a greater accuracy in the expression values. This in turn means that there is a greater chance of accurately measuring the expression of transcript splice variants. Since single reads (especially from the short reads platforms) will usually only span one or two exons, there are many cases where the expression splice

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

525

variants sharing the same exons cannot be determined accurately. With paired reads, more combinations of exons will be identified as unique for a particular splice variant.2 It is possible to detect Gene fusions where one read in a pair maps in one gene and the other part maps in another gene. If several reads exhibit the same pattern, there is evidence of a fusion gene. At the bottom you can specify how Paired reads should be handled. You can read more about how paired data is imported and handled in section 19.1.8. If the sequence list used as input for the mapping contains paired reads, this option will automatically be shown - if it contains single reads, this option will not be shown. Learn more about mapping paired data in section 19.5.3. When counting the mapped reads to generate expression values, the CLC Genomics Workbench needs to decide how to handle paired reads. The standard behavior is this: if two reads map as a pair, the pair is counted as one. If the pair is broken, none of the reads are counted. The reasoning is that something is not right in this case, it could be that the transcripts are not represented correctly on the reference, or there are errors in the data. In general, more confidence is placed with an intact pair. If a combination of paired and single reads are used, "true" single reads will also count as one (the single reads that come from broken pairs will not count). In some situations it may be too strict to disregard broken pairs. This could be in cases where there is a high degree of variation compared to the reference or where the reference lacks comprehensive transcript annotations. By checking the Use 'include broken pairs' counting scheme, both intact and broken pairs are now counted as two. For the broken pairs, this means that each read is counted as one. Reads that are single reads as input are still counted as one. When looking at the mappings, reads from broken pairs have a darker color than reads that are intact pairs or originally single reads. Finding the right reference sequence for RNA-Seq For prokaryotes, the reference sequence needed for RNA-Seq is quite simple. Either you input a genome annotated with gene annotations, or you input a list of genes and select the Use reference without annotations. For eukaryotes, it is more complex because the Workbench needs to know the intron-exon structure as explained in in the beginning of this section. This means that you need to have a reference genome with annotations of type mRNA and gene (you can see the annotations of a sequence by opening the annotation table, see section 10.3.1). You can obtain an annotated reference sequence in different ways: Download the sequences from NCBI from within the Workbench (see section 11.1). Figure 19.114 shows an example of a search for the human refseq chromosomes. Retrieve the annotated sequences in supported format, e.g. GenBank format, and Import ( ) them into the Workbench. Download the unannotated sequences, (e.g. in fasta format) and annotate them using a GFF/GTF file containing gene and mRNA annotations (learn more at http://www.
Note that the CLC Genomics Workbench only calculates the expression of the transcripts already annotated on the reference.
2

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

526

clcbio.com/annotate-with-gff). Please do not over-annotate a sequence that is already marked up with gene and mRNA annotations unless you are sure that the annotation sets are exclusive. Overlapping gene and mRNA annotations will lead to useless RNA-Seq results. You need to make sure the annotations are the right type. GTF files from Ensembl are fully compatible with the RNA-Seq functionality of the CLC Genomics Workbench: ftp://ftp.ensembl.org/pub/current_gtf/. Note that GTF files from UCSC cannot be used for RNA-Seq since they do not have information to relate different transcript variants of the same gene. If you annotate your own files, please ensure that you use annotation types gene and, if it is a eurkarote, mRNA. To annotate with these types, they must be spelled correctly, and the RNA part of mRNA must be in capitals. Please see see section 10.3annotation table.

Figure 19.114: Downloading the human genome from refseq.

19.14.2

Exon identification and discovery

Clicking Next will show the dialog in figure 19.115. The choice between Prokaryote and Eukaryote is basically a matter of telling the Workbench whether you have introns in your reference. In order to select Eukaryote, you need to have reference sequences with annotations of the type mRNA (this is the way the Workbench expects exons to be defined - see section 19.14). Here you can specify the settings for discovering novel exons. The mapping will be performed against the entire gene, and by analyzing the reads located between known exons, the CLC Genomics Workbench is able to report new exons. A new exon has to fulfill the parameters you set: Required relative expression level. This is the expression level relative to the rest of the gene. A value of 20% means that the expression level of the new exon has to be at least 20% of that of the known exons of this gene. Minimum number of reads. While the previous option asks for the percentage relative to the general expression level of the gene, this option requires an absolute value. Just a few

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

527

Figure 19.115: Exon identification and discovery. matching reads will already be considered to be a new exon for genes with low expression levels. This is avoided by setting a minimum number of reads here. Minimum length. This is the minimum length of an exon. There has to be overlapping reads for the whole minimum length. Figure 19.116 shows an example of a putative exon.

Figure 19.116: A putative exon has been identified.

19.14.3

RNA-Seq output options

Clicking Next will allow you to specify the output options as shown in figure 19.117. The standard output is a table showing statistics on each gene and the option to open the mapping (see more below). Furthermore, the expression of individual transcripts is reported (for eukaryotes). The expression measure used for further analysis can be specified as well. Per default it is set to Genes RPKM. This can also be changed at a later point (see below).

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

528

Figure 19.117: Selecting the output of the RNA-Seq analysis. Furthermore, you can choose to create a sequence list of the non-mapped sequences. This could be used to do de novo assembly and perform BLAST searches to see if you can identify new genes or at least further investigate the results. Gene fusion reporting When using paired data, there is also an option to create a table summarizing the evidence for gene fusions. And example is shown in figure 19.118.

Figure 19.118: An example of a gene fusion table. The table includes the following columns for each part of the pair: Gene. The name of the gene. Reference. The name of the reference sequence (typically the chromosome name). Position. The position of the gene. Strand. The strand of the gene.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

529

Most importantly, the table lists the number of read pairs that are supporting the combination of genes listed. The threshold for when a combination of genes should be reported in the table can be set in the RNA-Seq dialog in figure 19.117. The default value is 5. Note that the reporting of gene fusions is very simple and should be analyzed in much greater detail before any evidence of gene fusions can be verified. The table should be considered more of a pointer to genes to explore rather than evidence of gene fusions. RNA-Seq report In addition, there is an option to Create report. This will create a report as shown in figure 19.119.

Figure 19.119: Report of an RNA-Seq run. The report contains the following information: Sequence reads. Information about the number of reads. Reference sequences. Information about the reference sequences used and their lengths and the total number of genes found in the reference. Transcripts per gene. A graph showing the number of transcripts per gene. For eukaryotes, this will be equivalent to the number of mRNA annotations per gene annotation. Exons per gene. A graph showing the number of exons per gene. Exons per transcript. A graph showing the number of exons per transcript. Read mapping. Shows statistics on: Mapped reads. This number is divided into uniquely and non-specifically mapped reads (see the point below on match specificity for details). Unmapped reads. Total reads. This is the number of reads used as input. Paired reads. (Only included if paired reads are used). Shows the number of reads mapped in pairs, the number of reads in broken pairs and the number of unmapped reads.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

530

Match specificity. Shows a graph of the number of match positions for the reads. Most reads will be mapped 0 or 1 time, but there will also be reads matching more than once in the reference. This depends on the Maximum number of hits for a read setting in figure19.112. Note that the number of reads that are mapped 0 times includes both the number of reads that cannot be mapped at all and the number of reads that matches to more than the 'Maximum number of hits for a read' parameter that you set in the second wizard step. If paired reads are used, a separate graph is produced for that part of the data. Paired distance. (Only included if paired reads are used). Shows a graph of the distance between mapped reads in pairs. Detailed mapping statistics. This table divides the reads into the following categories. Exon-exon reads. Reads that overlap two exons as specified in figure 19.115. Exon-intron reads. Reads that span both an exon and an intron. If you have many of these reads, it could indicate a low splicing-efficiency or that a number of splice variants are not annotated on your reference. Total exon reads. Number of reads that fall entirely within an exon or in an exon-exon junction. Total intron reads. Reads that fall entirely within an intron or in the gene's flanking regions. Total gene reads. All reads that map to the gene and it's flanking regions. This is the mapped reads number used for calculating RPKM, see definition below. For each category, the number of uniquely and non-specifically mapped reads are listed as well as the relative fractions. Note that all this detailed information is also available on the individual gene level in the RNA-Seq table ( )(see below). When the input data is a combination of paired and single reads, the mapping statistics will be divided into two parts. Note that the report can be exported in pdf or Excel format.

19.14.4

Interpreting the RNA-Seq analysis result

The main result of the RNA-Seq is the reporting of expression values which is done on both the gene and the transcript level (only eukaryotes). Gene-level expression When you open the result of an RNA-Seq analysis, it starts in the gene-level view as shown in figure 19.120. The table summarizes the read mappings that were obtained for each gene (or reference). The following information is available in this table: Feature ID. This is the name of the gene. Expression values. This is based on the expression measure chosen in figure 19.117.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

531

Figure 19.120: A subset of a result of an RNA-Seq analysis on the gene level. Not all columns are shown in this figure Transcripts. The number of transcripts based on the mRNA annotations on the reference. Note that this is not based on the sequencing data - only on the annotations already on the reference sequence(s). Detected transcripts. The number of transcripts which have reads assigned (see the description of transcript-level expression below). Exon length. The total length of all exons (not all transcripts). Unique gene reads. This is the number of reads that match uniquely to the gene. Total gene reads. This is all the reads that are mapped to this gene --- both reads that map uniquely to the gene and reads that matched to more positions in the reference (but fewer than the 'Maximum number of hits for a read' parameter) which were assigned to this gene. Unique exon reads. The number of reads that match uniquely to the exons (including the exon-exon and exon-intron junctions). Total exon reads. Number of reads mapped to this gene that fall entirely within an exon or in exon-exon or exon-intron junctions. As for the 'Total gene reads' this includes both uniquely mapped reads and reads with multiple matches that were assigned to an exon of this gene. Unique exon-exon reads. Reads that uniquely match across an exon-exon junction of the gene (as specified in figure 19.115). The read is only counted once even though it covers several exons. Total exon-exon reads. Reads that match across an exon-exon junction of the gene (as specified in figure 19.115). As for the 'Total gene reads' this includes both uniquely mapped reads and reads with multiple matches that were assigned to an exon-exon junction of this gene.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

532

Unique intron-exon reads. Reads that uniquely map across an exon-intron boundary. If you have many of these reads, it could indicate that a number of splice variants are not annotated on your reference. Total intron-exon reads. Reads that map across an exon-intron boundary. As for the 'Total gene reads' this includes both uniquely mapped reads and reads with multiple matches that were assigned to an exon-intron junction of this gene. If you have many of these reads, it could indicate that a number of splice variants are not annotated on your reference. Exons. The number of exons based on the mRNA annotations on the reference. Note that this is not based on the sequencing data - only on the annotations already on the reference sequence(s). Putative exons. The number of new exons discovered during the analysis (see more in section 19.14.2). RPKM. This is the expression value measured in RPKM [Mortazavi et al., 2008]: RPKM = total exon reads mapped reads(millions)exon length (KB) . See exact definition below. Even if you have chosen the RPKM values to be used in the Expression values column, they will also be stored in a separate column. This is useful to store the RPKM if you switch the expression measure. See more in section 19.14.4. Median coverage. This is the median coverage for all exons (for all reads - not only the unique ones). Reads spanning exon-exon boundaries are not included. Chromosome region start. Start position of the annotated gene. Chromosome region end. End position of the annotated gene. Double-clicking any of the genes will open the mapping of the reads to the reference (see figure 19.121).

Figure 19.121: Opening the mapping of the reads. Zoomed out to provide a better overview. Reads spanning two exons are shown with a dashed line between each end as shown in figure 19.121.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

533

At the bottom of the table you can change the expression measure. Simply select another value in the drop-down list. The expression measure chosen here is the one used for further analysis. When setting up an experiment, you can specify an expression value to apply to all samples in the experiment. The RNA-Seq analysis result now represents the expression values for the sample, and it can be further analyzed using the various tools described in chapter 20. Transcript-level expression In order to switch to the transcript-level expression, click the Transcript-level expression ( button at the bottom of the view. You will now see a view as shown in figure 19.122. )

Figure 19.122: A subset of a result of an RNA-Seq analysis on the transcript level. Not all columns are shown in this figure The following information is available in this table: Feature ID. This is the gene name with a number appended to differentiate between transcripts. Expression values. This is based on the expression measure chosen in figure 19.117. Transcripts. The number of transcripts based on the mRNA annotations on the reference. Note that this is not based on the sequencing data - only on the annotations already on the reference sequence(s). Transcript length. The total length of all exons of that particular transcript. Transcript ID. This information is retrieved from transcript_ID key on the mRNA annotation. Unique transcript reads. This is the number of reads in the mapping for the gene that are uniquely assignable to the transcript. This number is calculated after the reads have been mapped and both single and multi-hit reads from the read mapping may be unique transcript reads.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

534

Total transcript reads. Once the 'Unique transcript read's have been identified and their counts calculated for each transcript, the remaining (non-unique) transcript reads are assigned randomly to one of the transcripts to which they match. The 'Total transcript reads' counts are the total number of reads that are assigned to the transcript once this random assignment has been done. As for the random assignment of reads among genes, the random assignment of reads within a gene but among transcripts, is done proportionally to the 'unique transcript counts' normalized by transcript length, that is, using the RPKM (see the description of the 'Maximum number of hits for a read' option', 19.14.1). Unique transcript counts of 0 are not replaced by 1 for this proportional assignment of non-unique reads among transcripts. Ratio of unique to total (exon reads. This will show the ratio of the two columns described above. This can be convenient for filtering the results to exclude the ones where you have low confidence because of a relatively high number of non-unique transcript reads. Exons. The number of exons for this transcript. Note that this is not based on the sequencing data - only on the annotations already on the reference sequence(s). RPKM. The RPKM value for the transcript, that is, the number of reads assigned to the transcript divided by the transcript length and normalized by 'Mapped reads' (see below). Relative RPKM. The RPKM value for the transcript divided by the maximum of the RPKM values for transcripts for this gene. Chromosome region start. Start position of the annotated gene. Chromosome region end. End position of the annotated gene. Definition of RPKM RPKM, Reads Per Kilobase of exon model per Million mapped reads, is defined in this way total exon reads [Mortazavi et al., 2008]: RPKM = mapped reads(millions)exon length (KB) . Total exon reads This is the number in the column with header Total exon reads in the row for the gene. This is the number of reads that have been mapped to a region in which an exon is annotated for the gene or across the boundaries of two exons or an intron and an exon for an annotated transcript of the gene. For eukaryotes, exons and their internal relationships are defined by annotations of type mRNA. Exon length This is the number in the column with the header Exon length in the row for the gene, divided by 1000. This is calculated as the sum of the lengths of all exons annotated for the gene. Each exon is included only once in this sum, even if it is present in more annotated transcripts for the gene. Partly overlapping exons will count with their full length, even though they share the same region. Mapped reads The sum of all the numbers in the column with header Total gene reads. The Total gene reads for a gene is the total number of reads that after mapping have been mapped to the region of the gene. Thus this includes all the reads uniquely mapped to the region of the gene as well as those of the reads which match in more places (below the limit set in the dialog in figure 19.112) that have been allocated to this gene's region. A gene's region is that comprised of the flanking regions (if it was specified in figure 19.112),

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

535

the exons, the introns and across exon-exon boundaries of all transcripts annotated for the gene. Thus, the sum of the total gene reads numbers is the number of mapped reads for the sample (you can find the number in the RNA-Seq report).

19.15

Expression profiling by tags

Expression profiling by tags, also known as tag profiling or tag-based transcriptomics, is an extension of Serial analysis of gene expression (SAGE) using next-generation sequencing technologies. With respect to sequencing technology it is similar to RNA-seq (see section 19.14), but with tag profiling, you do not sequence the mRNA in full length. Instead, small tags are extracted from each transcript, and these tags are then sequenced and counted as a measure of the abundance of each transcript. In order to tell which gene's expression a given tag is measuring, the tags are often compared to a virtual tag library. This consists of the 'virtual' tags that would have been extracted from an annotated genome or a set of ESTs, had the same protocol been applied to these. For a good introduction to tag profiling including comparisons with different micro array platforms, we refer to ['t Hoen et al., 2008]. For more in-depth information, we refer to [Nielsen, 2007]. Figure 19.123 shows an example of the basic principle behind tag profiling. There are variations of this concept and additional details, but this figure captures the essence of tag profiling, namely the extraction of a tag from the mRNA based on restriction cut sites.

Figure 19.123: An example of the tag extraction process. 1+2. Oligo-dT attached to a magnetic bead is used to trap mRNA. 3. The enzyme NlaIII cuts at CATG sites and the fragments not attached to the magnetic bead are removed. 4. An adapter is ligated to the GTAC overang. 5. The adapter includes a recognition site for MmeI which cuts 17 bases downstream. 6. Another adapter is added and the sequence is now ready for amplification and sequencing. 7. The final tag is 17 bp. The example is inspired by ['t Hoen et al., 2008].

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

536

The CLC Genomics Workbench supports the entire tag profiling data analysis work flow following the sequencing: Extraction of tags from the raw sequencing reads (tags from different samples are often barcoded and sequenced in one pool). Counting tags including a sequencing-error correction algorithm. Creating a virtual tag list based on an annotated reference genome or an EST-library. Annotating the tag counts with gene names from the virtual tag list. Each of the steps in the work flow are described in details below.

19.15.1

Extract and count tags

First step in the analysis is to import the data (see section 19.1). The next step is to extract the tags and count them: Toolbox | High-throughput Sequencing ( Extract and Count Tags ( ) ) | Expression Profiling by Tags ( ) |

This will open a dialog where you select the reads that you have imported. Click Next when the sequencing data is listed in the right-hand side of the dialog. This dialog is where you define the elements in your reads. An example is shown in figure 19.124.

Figure 19.124: Defining the elements that make up your reads. By defining the order and size of each element, the Workbench is now able to both separate samples based on bar codes and extract the tag sequence (i.e. removing linkers, bar codes etc). The elements available are:

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

537

Sequence This is the part of the read that you want to use as your final tag for counting and annotating. If you have tags of varying lengths, add a spacer afterwards (see below). Sample keys Here you input a comma-separated list of the sample keys used for identifying the samples (also referred to as "bar codes"). If you have not pooled and bar coded your data, simply omit this element. Linker This is a known sequence that you know should be present and do not want to be included in your final tag. Spacer This is also a sequence that you do not want to include in your final tag, but whereas the linker is defined by its sequence, the spacer is defined by its length. Note that the length defines the maximum length of the spacer. Often not all tags will be exactly the same length, and you can use this spacer as a buffer for those tags that are longer than what you have defined as your sequence. In the example in figure 19.124, the tag length is 17 bp, but a spacer is added to allow tags up to 19 bp. Note that the part of the read that is extracted and used as the final tag does not include the spacer sequence. In this way you homogenize the tag lengths which is usually desirable because you want to count short and long tags together. When you have set up the right order of your elements, click Next to set parameters for counting tags as shown in figure 19.125.

Figure 19.125: Setting parameters for counting tags. At the top, you can specify how to tabulate (i.e. count) the tags: Raw counts This will produce the count for each tag in the data. Sage Screen trimmed counts This will produce trimmed tag counts. The trimmed tag counts are obtained by applying an implementation of the SAGEscreen method ( [Akmaev and Wang, 2004]) to the raw tag counts. In this procedure, raw counts are trimmed using probabilistic reasoning. In this procedure, if a tag with low count has a neighboring tag with

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

538

high count, and it is likely, based on the estimated mutation rate, that the low count tags have arisen through sequencing errors of the tags with higher count, the count of the less abundant tag will be attributed to the higher abundant neighboring tag. The implementation of the SAGEscreen method is highly efficient and provides considerable speed and memory improvements. Next, you can specify additional parameters for the alignment that takes place when the tags are tabulated: Allowing indels Ticking this box means that, when SAGEscreen is applied, neighboring tags will, in addition to tags which differ by nucleotide substitutions, also include tags with insertion or deletion differences. Color space This option is only available if you use data generated on the SOLiD platform. Checking this option will perform the alignment in color space which is desirable because sequencing errors can be corrected. Learn more about color space in section 19.8. At the bottom you can set a minimum threshold for tags to be reported. Although the SAGEscreen trimming procedure will reduce the number of erroneous tags reported, the procedure only handles tags that are neighbors of more abundant tags. Because of sequencing errors, there will be some tags that show extensive variation. There will by chance only be a few copies of these tags, and you can use the minimum threshold option to simply discard tags. The default value is two which means that tags only occurring once are discarded. This setting is a trade-off between removing bad-quality tags and still keeping tags with very low expression (the ability to measure low levels of mRNA is one of the advantages of tag profiling over for example micro arrays ['t Hoen et al., 2008]). Note! If more samples are created, SAGEscreen and the minimum threshold cut-offs will be applied to the cumulated counts (i.e. all tags for all samples). Clicking Next allows you to specify the output of the analysis as shown in figure 19.126.

Figure 19.126: Output options.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING The options are:

539

Create expression samples with tag counts This is the primary result showing all the tags and respective counts (an example is shown in figure 19.127). For each sample defined via the bar codes, there will be an expression sample like this. Note that all samples have the same list of tags, even if the tag is not present in the given sample (i.e. there will be tags with count 0 as shown in figure 19.127). The expression samples can be used in further analysis by the expression analysis tools (see chapter 20). Create sequence lists of extracted tags This is a simple sequence list of all the tags that were extracted. The list is simple with no counts or additional information. Create list of reads which have no tags This list contains the reads from which a tag could not be extracted. This is most likely bad quality reads with sequencing errors that make them impossible to group by their bar codes. It can be useful for troubleshooting if the amount of real tags is smaller than expected.

Figure 19.127: The tags have been extracted and counted. Finally, a log can be shown of the extraction and count process. The log gives useful information such as the number of tags in each sample and the number of reads without tags.

19.15.2

Create virtual tag list

Before annotating the tag sample ( ) created above, you need to create a so-called virtual tag list. The list is created based on a DNA sequence or sequence list holding, an annotated genome or a list of ESTs. It represents the tags that you would expect to find in your experimental data (given the reference genome or EST list reflects your sample). To create the list, you specify the restriction enzyme and tag length to be used for creating the virtual list. The virtual tag list can be saved and used to annotate experiments made from tag-based expression samples as shown in section 19.15.3. To create the list: Toolbox | High-throughput Sequencing ( Create Virtual Tag List ( ) ) | Expression Profiling by Tags ( ) |

This will open a dialog where you select one or more annotated genomic sequences or a list of ESTs. Click Next when the sequences are listed in the right-hand side of the dialog.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING This dialog is where you specify the basis for extracting the virtual tags (see figure 19.128).

540

Figure 19.128: The basis for the extraction of reads. At the top you can choose to extract tags based on annotations on your sequences by checking the Extract tags in selected areas only option. This option is applicable if you are using annotated genomes (e.g. Refseq genomes). Click the small button ( ) to the right to display a dialog showing all the annotation types in your sequences. Select the annotation type representing your transcripts (usually mRNA or Gene). The sequence fragments covered by the selected annotations will then be extracted from the genomic sequence and used as basis for creating the virtual tag list. If you use a sequence list where each sequence represents your transcript (e.g. an EST library), you should not check the Extract tags in selected areas only option. Below, you can choose to include the reverse complement for creating virtual tags. This is mainly used if there is uncertainty about the orientation of sequences in an EST library. Clicking Next allows you to specify enzymes and tag length as shown in figure 19.129. At the top, find the enzyme used to define your tag and double-click to add it to the panel on the right (as it has been done with NlaIII in figure 19.129). You can use the filter text box so search for the enzyme name. Below, there are further options for the tag extraction: Extract tags When extracting the virtual tags, you have to decide how to handle the situation where one transcript has several cut sites. In that case there would be several potential tags. Most tag profiling protocols extract the 3'-most tag (as shown in the introduction in figure 19.123), so that would be one way of defining the tags in the virtual tag list. However, due to non-specific cleavage, new alternative splicing or alternative polyadenylation ['t Hoen et al., 2008], tags produced from internal cut sites of the transcript are also quite frequent. This means that it is often not enough to consider the 3'-most restriction site only. The list lets you select either All, External 3' which is the 3'-most tag or External 5' which is the 5' most tag (used by some protocols, for example CAGE - cap analysis of gene expression - see [Maeda et al., 2008]). The result of the analysis displays whether the tag is found at

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

541

Figure 19.129: Defining restriction enzyme and tag length. the 3' end or if it is an internal tag (see more below). Tag downstream/upstream When the cut site is found, you can specify whether the tag is then found downstream or upstream of the site. In figure 19.123, the tag is found downstream. Tag length The length of the tag to be extracted. This should correspond to the sequence length defined in figure 19.124. Clicking Next allows you to specify the output of the analysis as shown in figure 19.130.

Figure 19.130: Output options. The output options are: Create virtual tag table This is the primary result listing all the virtual tags. The table is explained in detail below.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

542

Create a sequence list of extracted tags All the extracted tags can be represented in a raw sequence list with no additional information except the name of the transcript. You can e.g. Export ( ) this list to a fasta file. Output list of sequences in which no tags were found The transcripts that do not have a cut site or where the cut site is so close to the end that no tag could be extracted are presented in this list. The list can be used to inspect which transcripts you could potentially fail to measure using this protocol. If there are tags for all transcripts, this list will not be produced. In figure 19.131 you see an example of a table of virtual tags that have been produced using the 3' external option described above.

Figure 19.131: A virtual tag table of 3' external tags. The first column lists the tag itself. This is the column used when you annotate your tag count samples or experiments (see section 19.15.3). Next follows the name of the tag's origin transcript. Sometimes the same tag is seen in more than one transcript. In that case, the different origins are separated by /// as it is the case for the tag of LOC100129681 /// BST2 in figure 19.131. The row just below, UBA52, has the same name listed twice. This is because the analysis was based on mRNA annotations from a Refseq genome where each splice variant has its own mRNA annotation, and in this case the UBA52 gene has two mRNA annotations including the same tag. The last column is the description of the transcript (which is either the sequence description if you use a list of un-annotated sequences or all the information in the annotation if you use annotated sequences). The example shown in figure 19.131 is the simplest case where only the 3' external tags are listed. If you choose to list All tags, the table will look like figure 19.132. In addition to the information about the 3' tags, there are additional columns for 5' and internal tags. For the internal tags there is also a numbering, see for example the top row in figure 19.132 where the TMEM16H tag is tag number 3 out of 16. This information can be used to judge how close to the 3' end of the transcript the tag is. As mentioned above, you would often expect to sequence more tags from cut sites near the 3' end of the transcript. If you have chosen to include reverse complemented sequences in the analysis, there will be an additional set of columns for the tags of the other strand, denoted with a (-). You can use the advanced table filtering (see section C) to interrogate the number of tags with

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

543

Figure 19.132: A virtual tag table where all tags have been extracted. Note that some of the columns have been ticked off in the Side Panel. specific origins (e.g. define a filter where 3' origin != and then leave the text field blank).

19.15.3

Annotate tag experiment

Combining the tag counts ( ) from the experimental data (see section 19.15.1) with the virtual tag list ( ) (see above) makes it possible to put gene or transcript names on the tag counts. The Workbench simply compares the tags in the experimental data with the virtual tags and transfers the annotations from the virtual tag list to the experimental data. This is done on an experiment level (experiments are collections of samples with defined groupings, see section 20.1): Toolbox | High-throughput Sequencing ( Annotate Tag Experiment ( ) ) | Expression Profiling by Tags ( ) |

You can also access this functionality at the bottom of the Experiment table ( figure 19.133.

) as shown in

Figure 19.133: You can annotate an experiment directly from the experiment table. This will open a dialog where you select a virtual tag list ( ) and an experiment ( ) of tag-based samples. Click Next when the elements are listed in the right-hand side of the dialog. This dialog lets you choose how you want to annotate your experiment (see figure 19.134). If a tag in the virtual tag list has more than one origin (as shown in the example in figure 19.132) you can decide how you want your experimental data to be annotated. There are basically two options:

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

544

Figure 19.134: Defining the annotation method. Annotate all This will transfer all annotations from the virtual tag. The type of origin is still preserved so that you can see if it is a 3' external, 5' external or internal tag. Only annotate highest priority This will look for the highest priority annotation and only add this to the experiment. This means that if you have a virtual tag with a 3' external and an internal tag, only the 3' external tag will be annotated (using the default prioritization). You can define the prioritization yourself in the table below: simply select a type and press the up ( ) and down ( ) arrows to move it up and down in the list. Note that the priority table is only active when you have selected Only annotate highest priority. Click Next to choose how you want to tags to be aligned (see figure 19.135). When the tags

Figure 19.135: Settings for aligning the tags.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING Tag from experiment: Tag1 from virtual tag list (internal): Tag1 from virtual tag list (3 external): CGTATCAATCGATTAC |||||||||||||||| CGTATCAATCGATTAC | |||||||||||||| CCTATCAATCGATTAC

545

from the virtual tag list are compared to your experiment, the tags are matched using one of the following options: Require perfect match The tags need to be identical to be matched. Allow single substitutions If there is up to one mismatch in the alignment, the tags will still be matched. If there is a perfect match, single substitutions will not be considered. Allow single substitutions or indels Similar to the previous option, but now single-base insertions and deletions are also allowed. Perfect matches are preferred to single-base substitutions which are preferred to insertions, which are again preferred to deletions. 3 If you select any of the two options allowing mismatches or mismatches and indels, you can also choose to Prefer high priority mutant. This option is only available if you have chosen to annotate highest priority only in the previous step (see figure 19.134). The option is best explained through an example: In this case, you have a tag that matches perfectly to an internal tag from the virtual tag list. Imagine that in this example, you have prioritized the annotation so that 3' external tags are of higher priority than internal tags. The question is now if you want to accept the perfect match (of a low priority virtual tag) or the high-priority virtual tag with one mismatch? If you check the Prefer high priority mutant, the 3' external tag in the example above will be used rather than the perfect match. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. . This will add extra annotation columns to the experiment. The extra columns corresponds to the columns found in your virtual tag list. If you have chosen to annotate highest priority-only, there will only be information from one origin-column for each tag as shown in figure 19.136.

19.16

Small RNA analysis

The small RNA analysis tools in CLC Genomics Workbench are designed to facilitate trimming of sequencing reads, counting and annotating of the resulting tags using miRBase or other annotation sources and performing expression analysis of the results. The tools are general and flexible enough to accommodate a variety of data sets and applications within small RNA profiling, including the counting and annotation of both microRNAs and other non-coding RNAs from any organism. Both Illumina, 454 and SOLiD sequencing platforms are supported. For SOLiD, adapter trimming and annotation is done in color space. The annotation part is designed to make special use of the information in miRBase but more general references can be used as well. There are generally two approaches to the analysis of microRNAs or other smallRNAs: (1) count the different types of small RNAs in the data and compare them to databases of microRNAs or
3

Note that if you use color space data, only color errors are allowed when choosing anything but perfect match.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

546

Figure 19.136: An experiment annotated with prioritized tags. other smallRNAs, or (2) map the small RNAs to an annotated reference genome and count the numbers of reads mapped to regions which have smallRNAs annotated. The approach taken by CLC Genomics Workbench is (1). This approach has the advantage that it does not require an annotated genome for mapping --- you can use the sequences in miRBase or any other sequence list of smallRNAs of interest to annotate the small RNAs. In addition, small RNAs that would not have mapped to the genome (e.g. when lacking a high-quality reference genome or if the RNAs have not been transcribed from the host genome) can still be measured and their expression be compared. The methods and tools developed for CLC Genomics Workbench are inspired by the findings and methods described in [Creighton et al., 2009], [Wyman et al., 2009], [Morin et al., 2008] and [Stark et al., 2010]. In the following, the tools for working with small RNAs are described in detail. Look at the tutorials on http://www.clcbio.com/tutorials to see examples of analyzing specific data sets.

19.16.1

Extract and count

First step in the analysis is to import the data (see section 19.1). The next step is to extract and count the small RNAs to create a small RNA sample that can be used for further analysis (either annotating or analyzing using the expression analysis tools): Toolbox | High-throughput Sequencing ( Count ( ) ) | Small RNA Analysis ( ) | Extract and

This will open a dialog where you select the sequencing reads that you have imported. Click Next when the sequencing data is listed in the right-hand side of the dialog. Note that if you have several samples, they should be processed separately. This dialog (see figure 19.137) is where you specify whether the reads should be trimmed for adapter sequences prior to counting. It is often necessary to trim off remainders of adapter sequences from the reads before counting. When you click Next, you will be able to specify how the trim should be performed as shown in figure 19.138.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

547

Figure 19.137: Specifying whether adapter trimming is needed.

Figure 19.138: Setting parameters for adapter trim. If you have chosen not to trim the reads for adapter sequence, you will see figure 19.139 instead. The trim options shown in figure 19.138 are the same as described under adapter trim in section 19.3.2. Please refer to this section for more information. It should be noted that if you expect to see part of adapters in your reads, you would typically choose Discard when not found as the action. By doing this, only reads containing the adapter sequence will be counted as small RNAs in the further analysis. If you have a data set where the adapter may be there or not you would choose Remove adapter. Note that all reads will be trimmed for ambiguity symbols such as N before the adapter trim. Clicking Next allows you to specify additional options regarding trimming and counting as shown in figure 19.139. At the top you can choose to Trim bases by specifying a number of bases to be removed from

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

548

Figure 19.139: Defining length interval and sampling threshold. either the 3' or the 5' end of the reads. Below, you can specify the minimum and maximum lengths of the small RNAs to be counted (this is the length after trimming). The minimum length that can be set is 15 and the maximum is 55. At the bottom, you can specify the Minimum sampling count. This is the number of copies of the small RNAs (tags) that are needed in order to include it in the resulting count table (the small RNA sample). The actual counting is very simple and relies on perfect match between the reads to be counted together4 . This also means that a count threshold of 1 will include a lot of unique tags as a result of sequencing errors. In order to set the threshold right, the following should be considered: If the sample is going to be annotated, annotations may be found for the tags resulting from sequencing errors. This means that there is no negative effect of including tags with a low count in the output. When using un-annotated sequences for discovery of novel small RNAs, it may be useful to apply a higher threshold to eliminate the noise from sequencing errors. However, this can be done at a later stage by filtering the sample and creating a sub-set. When multiple samples are compared, it is interesting to know if one tag which is abundant in one sample is also found in another, even at a very low number. In this case, it is useful to include the tags with very low counts, since they may become more trustworthy in combination with information from other samples. Setting the count threshold higher will reduce the size of the sample produced which will reduce the memory and disk usage when working with the results. Clicking Next allows you to specify the output of the analysis as shown in 19.140. The options are:
4

Note that you can identify variants of the same miRNA when annotating the sample (see below).

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

549

Figure 19.140: Output options. Create sample This is the primary result showing all the tags and respective counts (an example is shown in figure 19.141). Each row represents a tag with the actual sequence as the feature ID and a column with Length and Count. The actual count is based on 100 % similarity5 . The sample can be used in further analysis by the expression analysis tools (see chapter 20) in the "raw" form, or you can annotate it (see below). The tools for working with the data in the sample are described in section 19.16.4. Create report This will create a summary report as described below. Create list of reads discarded during trimming This list contains the reads where no adapter was found (when choosing Discard when not found as the action). Create list of reads excluded from sample This list contains the reads that passed the trimming but failed to meet the sampling thresholds regarding minimum/maximum length and number of copies. The summary report includes the following information (an example is shown in figure 19.142): Trim summary Shows the following information for each input file: Number of reads in the input. Average length of the reads in the input. Number of reads after trim. The difference between the number of reads in the input and this number will be the number of reads that are discarded by the trim. Percentage of the reads that pass the trim. Average length after trim. When analyzing miRNAs, you would expect this number to be around 22. If the number is significantly lower or higher, it could indicate that the trim settings are not right. In this case, check that the trim sequence is correct, that the strand is right, and adjust the alignment scores. Sometimes it is preferable to
5

Note that you can identify variants of the same miRNA when annotating the sample (see below).

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

550

Figure 19.141: The tags have been extracted and counted. increase the minimum scores to get rid of low-quality reads. The average length after trim could also be somewhat larger than 22 if your sequenced data contains a mixture of miRNA and other (longer) small RNAs. Read length before/after trimming Shows the distribution of read lengths before and after trim. The graph shown in figure 19.142 is typical for miRNA sequencing where the read lengths after trim peaks at 22 bp. Trim settings The trim settings summarized. Note that ambiguity characters will automatically be trimmed. Detailed trim results This is described under adapter trim in section 19.3.2. Tag counts The number of tags and two plots showing on the x-axis the counts of tags and on the y-axis the number of tags for which this particular count is observed. The plot is in a zoomed version where only the lower part of the y-axis is shown to make it possible to see the numbers of tags higher counts.

19.16.2

Downloading miRBase

In order to make use of the additional information about mature and mature* regions on the precursor miRNAs in miRBase, you need to use the integrated tool to download miRBase rather than downloading it from http://www.mirbase.org/: Toolbox | High-throughput Sequencing ( miRBase ( ) ) | Small RNA Analysis ( ) | Download

This will download a sequence list with all the precursor miRNAs including annotations for mature and mature* regions. The list can then be selected when annotating the samples with miRBase (see section 19.16.3).

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

551

Figure 19.142: A summary report of the counting. The downloaded version will always be the latest version (it is downloaded from ftp:// mirbase.org/pub/mirbase/CURRENT/miRNA.dat.gz). Information on the version number of miRBase is also available in the History ( ) of the downloaded sequence list, and when using this for annotation, the annotated samples will also include this information in their History ( ).

19.16.3

Annotating and merging small RNA samples

The small RNA sample produced when counting the tags (see section 19.16.1) can be enriched by CLC Genomics Workbench by comparing the tag sequences with annotation resources such as miRBase and other small RNA annotation sources. Note that the annotation can also be performed on an experiment, set up from small RNA samples (see section 20.1.2). Besides adding annotations to known small RNAs in the sample, it is also possible to merge variants of the same small RNA to get a cumulated count. When initially counting the tags, the Workbench requires that the trimmed reads are identical for them to be counted as the same tag. However, you will often see different variants of the same miRNA in a sample, and it is useful to be able to count these together. This is also possible using the tool to annotate and merge samples. Toolbox | High-throughput Sequencing ( and Merge Counts ( ) ) | Small RNA Analysis ( ) | Annotate

This will open a dialog where you select the small RNA samples ( ) to be annotated. Note that if you have included several samples, they will be processed separately but summarized in one report providing a good overview of all samples. You can also input Experiments ( )

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

552

(see section 20.1.2) created from small RNA samples. Click Next when the data is listed in the right-hand side of the dialog. This dialog (figure 19.143) is where you define the annotation resources to be used.

Figure 19.143: Defining annotation resources. There are two ways of providing annotation sources: Downloading miRBase using the integrated download tool (explained in section 19.16.2). Importing a list of sequences, e.g. from a fasta file. This could be from Ensembl, e.g. ftp://ftp.ensembl.org/pub/release-57/fasta/homo_sapiens/ncrna/ Homo_sapiens.GRCh37.57.ncrna.fa.gz or from ncRNA.org: http://www.ncrna. org/frnadb/files/ncrna.zip. The downloaded miRBase file contains all precursor sequences from the latest version of miRBase http://www.mirbase.org/ including annotations defining the mature and optionally mature* regions (see an example in figure 19.144).

Figure 19.144: Some of the precursor miRNAs from miRBase have both mature and mature* regions annotated (as the two first in this list).

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

553

This means that it is possible to have a more fine-grained classification of the tags using miRBase compared to a simple fasta file resource containing the full precursor sequence. This is the reason why the miRBase annotation source is specified separately in figure 19.143. At the bottom of the dialog, you can specify whether miRBase should be prioritized over the additional annotation resource. The prioritization is explained in detail later in this section. To prioritize one over the other can be useful when there is redundant information (e.g. if you have an additional source that also contains all the miRNAs from miRBase and you prefer the miRBase annotations when possible). When you click Next, you will be able to choose which species from miRBase should be used and in which order (see figure 19.145). Note that if you have not selected a miRBase annotation source, you will go directly to the next step shown in figure 19.146.

Figure 19.145: Defining and prioritizing species in miRBase. To the left, you see the list of species in miRBase. This list is dynamically created based on the information in the miRBase file. Using the arrow button ( ) you can add species to the right-hand panel. The order of the species is important since the tags are annotated iteratively based on the order specified here. This means that in the example in figure 19.145, a human miRNA will preferred over mouse, even if they are identical in sequence (the prioritization is elaborated below). The up and down arrows ( )/ ( ) can be used to change the order of species. When you click Next, you will be able to specify how the alignment of the tags against the annotation sources should be performed (see figure 19.146). The panel at the top is active only if you have chosen to annotate with miRBase. It is used to define the requirements to the alignment of a read for it to be counted as a mature or mature* tag: Additional upstream bases This defines how many bases the tag is allowed to extend the annotated mature region at the 5' end and still be categorized as mature. Additional downstream bases This defines how many bases the tag is allowed to extend the

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

554

Figure 19.146: Setting parameters for aligning. annotated mature region at the 3' end and still be categorized as mature. Missing upstream bases This defines how many bases the tag is allowed to miss at the 5' end compared to the annotated mature region and still be categorized as mature. Missing downstream bases This defines how many bases the tag is allowed to miss at the 3' end compared to the annotated mature region and still be categorized as mature. At the bottom of the dialog you can specify the Maximum mismatches (default value is 2). Furthermore, you can specify if the alignment and annotation should be performed in color space which is available when your small RNA sample is based on SOLiD data. 6 Finally, you can choose whether the tags should be aligned against both strands of the reference or only the positive strand. Usually it is only necessary to align against the positive strand. At this point, a more elaborate explanation of the annotation algorithm is needed. The short read mapping algorithm in the CLC Genomics Workbench is used to map all the tags to the reference sequences which comprise the full precursor sequences from miRBase and the sequence lists chosen as additional resources. The mapping is done in several rounds: the first round is done requiring a perfect match, the second allowing one mismatch, the third allowing two mismatches etc. No gaps are allowed. The number of rounds depend on the number of mismatches allowed7 (default is two which means three rounds of read mapping, see figure 19.146). After each round of mapping, the tags that are mapped will be removed from the list of tags that continue to the next round. This means that a tag mapping with perfect match in the first round will not be considered for the subsequent one-mismatch round of mapping. Following the mapping, the tags are classified into the following categories according to where they match:
Note that this option is only going to make a difference for tags with low counts. Since the actual tag counting in the first place is done based on perfect matches, the highly abundant tags are not likely to have sequencing errors, and aligning in color space does not add extra benefit for these. 7 For color space, the maximum number of mismatches is 2.
6

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING Mature exact Mature super Mature sub Mature sub/super Mature* exact Mature* super Mature* sub Mature* sub/super Precursor Other

555

All these categories except Other refer to hits in miRBase. The Other category is for hits in the other resources (the information about resource is also shown in the output). Sub means that the observed tag is shorter than the annotated mature or mature*; super means that the observed tag is longer than the annotated mature or mature*. The combination sub/super means that the observed tag extends the annotation in one end and is shorter at the other end. An example of an alignment is shown in figure 19.147 using the same alignment settings as in figure 19.146.

Figure 19.147: Alignment of length variants of mir-30a. The two tags at the top are both classified as mature super because they cover and extend beyond the annotated mature RNA. The third tag is identical to the annotated mature. The fourth

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

556

tag is classified as precursor because it does not meet the requirements on length for it to be counted as a mature hit --- it lacks 6 bp compared to the annotated mature RNA. The fifth tag is classified as mature sub because it also lacks one base but stays within the threshold defined in figure 19.146. If a tag has several hits, the list above is used for prioritization. This means that e.g. a Mature sub is preferred over a Mature* exact. Note that if miRBase was chosen as lowest priority (figure 19.143), the Other category will be at the top of the list. All tags mapping to a miRBase reference without qualifying to any of the mature and mature* types will be typed as Precursor. In case you have selected more than one species for miRBase annotation (e.g. Homo Sapiens and Mus Musculus) the following rules for adding annotations apply: 1. If a tag has hits with the same priority for both species, the annotation for the top-prioritized species will be added. 2. Read category priority is stronger than species category priority: If a read is a higher priority match for a mouse miRBase sequence than it is for a human miRBase sequence the annotation for the mouse will be used Clicking Next allows you to specify the output of the analysis as shown in 19.148.

Figure 19.148: Output options. The options are: Create unannotated sample All the tags where no hit was found in the annotation source are included in the unannotated sample. This sample can be used for investigating novel miRNAs, see section 19.16.5. No extra information is added, so this is just a subset of the input sample. Create annotated sample This will create a sample as described in section 19.16.4. In this sample, the following columns have been added to the counts.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

557

Name This is the name of the annotation sequence in the annotation source. For miRBase, it will be the names of the miRNAs (e.g. let-7g or mir-147), and for other source, it will be the name of the sequence. Resource This is the source of the annotation, either miRBase (in which case the species name will be shown) or other sources (e.g. Homo_sapiens.GRCh37.57.ncrna). Match type The match type can be exact or variant (with mismatches) of the following types: Mature Mature super Mature sub Mature sub/super Mature* Mature* super Mature* sub Mature* sub/super Precursor Other

Mismatches The number of mismatches. Note that if a tag has two equally prioritized hits, they will be shown with // between the names. This could be e.g. two precursor sequences sharing the same mature sequence (also see the sample grouped on mature below). Create grouped sample, grouping by Precursor/Reference This will create a sample as described in section 19.16.4. All variants of the same reference sequence will be merged to create one expression value for all. Expression values. The expression value can be changed at the bottom of the table. The default is to use the counts in the mature column. Name. The name of the reference. For miRBase this will then be the name of the precursor. Resource. The name of the resource that the reference comes from. Exact mature. The number of exact mature reads. Mature. The number of all mature reads including sub, super and variants. Unique exact mature. In cases where one tag has several hits (as denoted by the // in the ungrouped annotated sample as described above), the counts are distributed evenly across the references. The difference between Exact mature and Unique exact mature is that the latter only includes reads that are unique to this reference. Unique mature. Same as above but for all matures including sub, super and variants. Exact mature*. Same as above, but for mature*. Mature*. Same as above, but for mature*. Unique exact mature*. Same as above, but for mature*. Unique mature*. Same as above, but for mature*. Exact other. Exact match in the resources chosen besides miRBase. Other. All matches in the resources chosen besides miRBase including variants. The last two numbers are the only ones used when the reference is not from miRBase.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

558

Total. The total number of tags mapped and classified to the precursor/reference sequence. Create grouped sample, grouping by Mature This will create a sample as described in section 19.16.4. This is also a grouped sample, but in addition to grouping based on the same reference sequence, the tags in this sample are grouped on the same mature. This means that two precursor variants of the same mature miRNA are merged. Note that it is only possible to create this sample when using miRBase as annotation resource (because the Workbench has a special interpretation of the miRBase annotations for mature as described previously). To find identical mature miRNAs, the Workbench compares all the mature sequences and when they are identical, they are merged. The names of the precursor sequences merged are all shown in the table. Expression values. The expression value can be changed at the bottom of the table. The default is to use the counts in the mature column. Name. The name of the reference. When several precursor sequences have been merged, all the names will be shown separated by //. Resource. The species of the reference. Exact mature. The number of exact mature reads. Mature. The number of all mature reads including sub, super and variants. Unique exact mature. In cases where one tag has several hits (as denoted by the // in the ungrouped annotated sample as described above), the counts are distributed evenly across the references. The difference between Exact mature and Unique exact mature is that the latter only includes reads that are unique to one of the precursor sequences that are represented under this mature sequence. Unique mature. Same as above but for all matures including sub, super and variants. Create report. A summary report described below. The summary report includes the following information (an example is shown in figure 19.149): Summary Shows the following information for each input sample: Number of small RNAs(tags) in the input. Number of annotated tags (number and percentage). Number of reads in the sample (one tag can represent several reads) Number of annotated reads (number and percentage). Resources Shows how many matches were found in each resource: Number of sequences in the resource. Number of sequences where a match was found (i.e. this sequence has been observed at least once in the sequencing data). Reads Shows the number of reads that fall into different categories (there is one table per input sample). On the left hand side are the annotation resources. For each resource, the count and percentage of reads in that category are shown. Note that the percentage are relative to the overall categories (e.g. the miRBase reads are a percentage of all the annotated reads, not all reads). This is information is shown for each mismatch level.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

559

Small RNAs Similar numbers as for the reads but this time for each small RNA tag and without mismatch differentiation. Read count proportions A histogram showing, for each interval of read counts, the proportion of annotated (respectively, unannotated) small RNAs with a read count in that interval. Annotated small RNAs may be expected to be associated with higher counts, since the most abundant small RNAs are likely to be known already. Annotations (miRBase) Shows an overview table for classifications of the number of reads that fall in the miRBase categories for each species selected. Annotations (Other) Shows an overview table with read numbers for total, exact match and mutant variants for each of the other annotation resources.

Figure 19.149: A summary report of the annotation.

19.16.4

Working with the small RNA sample

Generally speaking, the small RNA sample comes in two variants: The un-grouped sample, either as it comes directly from the Extract and Count ( ) or when it has been annotated. In this sample, there is one row per tag, and the feature ID is the tag sequence. The grouped sample created using the Annotate and Merge Counts ( ) tool. In this sample, each row represents several tags grouped by a common Mature or Precursor miRNA or other reference. Below, these two kinds of samples are described in further detail. Note that for both samples, filtering and sorting can be applied, see section C.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING The un-grouped sample An example of an un-grouped annotated sample is shown in figure 19.150.

560

Figure 19.150: An ungrouped annotated sample. By selecting one or more rows in the table, the buttons at the bottom of the view can be used to extract sequences from the table: Extract Reads ( ) This will extract the original sequencing reads that contributed to this tag. Figure 19.151 shows an example of such a read. The reads include trim annotations (for use when inspecting and double-checking the results of trimming). Note that if these reads are used for read mapping, the trimmed part of the read will automatically be removed. If all rows in the sample are selected and extracted, the sequence list would be the same as the input except for the reads that did not meet the adapter trim settings and the sampling thresholds (tag length and number of copies). Extract Trimmed Reads ( removed. Extract Small RNAs ( ) The same as above, except that the trimmed part has been

) This will extract only one copy of each tag.

Note that for all these, you will be able to determine whether a list of DNA or RNA sequences should be produced (when working within the CLC Genomics Workbench environment, this only effects the RNA folding tools).

Figure 19.151: Extracting reads from a sample. The button Create Sample from Selection ( ) can be used to create a new sample based on the tags that are selected. This can be useful in combination with filtering and sorting. The grouped sample An example of a grouped annotated sample is shown in figure 19.152.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

561

Figure 19.152: A sample grouped on mature miRNAs. The contents of the table are explained in section 19.16.3. In this section, we focus on the tools available for working with the sample. By selecting one or more rows in the table, the buttons at the bottom of the view become active: Open Read Mapping ( ) This will open a view showing the annotation reference sequence at the top and the tags aligned to it as shown in figure 19.153. The names of the tags indicate their status compared with the reference (e.g. Mature, Mature super, Precursor). This categorization is based on the choices you make when annotating. You can also see the annotations when using miRBase as the annotation source. In this example both the mature and the mature * are annotated, and you can see that both are found in the sample. In the Side Panel to the right you can see the Match weight group under Residue coloring which is used to color the tags according to their relative abundance. The weight is also shown next to the name of the tag. The left side color is used for tags with low counts and the right side color is used for tags with high counts, relative to the total counts of this annotation reference. The sliders just above the gradient color box can be dragged to highlight relevant levels of abundance. The colors can be changed by clicking the box. This will show a list of gradients to choose from. Create Sample from Selection ( ) This is used to create a new sample based on the tags that are selected. This can be useful in combination with filtering and sorting.

19.16.5

Exploring novel miRNAs

One way of doing this would be to identify interesting tags based on their counts (typically you would be interested in pursuing tags with not too low counts in order to avoid wasting efforts on tags based on reads with sequencing errors), Extract Small RNAs ( ) and use this list of tags as input to Map Reads to Reference ( ) using the genome as reference. You could then examine where the reads match, and for reads that map in otherwise unannotated regions you could select a region around the match and create a subsequence from this. The subsequence could be folded and examined to see whether the secondary structure was in agreement with the expected hairpin-type structure for miRNAs.

CHAPTER 19. HIGH-THROUGHPUT SEQUENCING

562

Figure 19.153: Aligning all the variants of this miRNA from miRBase, providing a visual overview of the distribution of tags along the precursor sequence.

Chapter 20

Expression analysis
Contents
20.1 Experimental design . . . . . . . . . . . . . . . . . . . . . . . . . 20.1.1 Supported array platforms . . . . . . . . . . . . . . . . . . . . 20.1.2 Setting up an experiment . . . . . . . . . . . . . . . . . . . . 20.1.3 Organization of the experiment table . . . . . . . . . . . . . . 20.1.4 Adding annotations to an experiment . . . . . . . . . . . . . . 20.1.5 Scatter plot view of an experiment . . . . . . . . . . . . . . . 20.1.6 Cross-view selections . . . . . . . . . . . . . . . . . . . . . . 20.2 Transformation and normalization . . . . . . . . . . . . . . . . . . 20.2.1 Selecting transformed and normalized values for analysis . . 20.2.2 Transformation . . . . . . . . . . . . . . . . . . . . . . . . . . 20.2.3 Normalization . . . . . . . . . . . . . . . . . . . . . . . . . . 20.3 Quality control . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20.3.1 Creating box plots - analyzing distributions . . . . . . . . . . . 20.3.2 Hierarchical clustering of samples . . . . . . . . . . . . . . . 20.3.3 Principal component analysis . . . . . . . . . . . . . . . . . . 20.4 Statistical analysis - identifying differential expression . . . . . . 20.4.1 Gaussian-based tests . . . . . . . . . . . . . . . . . . . . . . 20.4.2 Tests on proportions . . . . . . . . . . . . . . . . . . . . . . 20.4.3 Corrected p-values . . . . . . . . . . . . . . . . . . . . . . . . 20.4.4 Volcano plots - inspecting the result of the statistical analysis 20.5 Feature clustering . . . . . . . . . . . . . . . . . . . . . . . . . . . 20.5.1 Hierarchical clustering of features . . . . . . . . . . . . . . . 20.5.2 K-means/medoids clustering . . . . . . . . . . . . . . . . . . 20.6 Annotation tests . . . . . . . . . . . . . . . . . . . . . . . . . . . 20.6.1 Hypergeometric tests on annotations . . . . . . . . . . . . . . 20.6.2 Gene set enrichment analysis . . . . . . . . . . . . . . . . . 20.7 General plots . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20.7.1 Histogram . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20.7.2 MA plot . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20.7.3 Scatter plot . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 564 564 565 567 572 573 576 576 577 578 578 581 581 584 589 593 594 596 597 598 601 601 605 607 607 610 614 614 616 619

563

CHAPTER 20. EXPRESSION ANALYSIS

564

The CLC Genomics Workbench is able to analyze expression data produced on microarray platforms and high-throughput sequencing platforms (also known as Next-Generation Sequencing platforms). Note that the calculation of expression levels based on the raw sequence data is described in section 19.14. The CLC Genomics Workbench provides tools for performing quality control of the data, transformation and normalization, statistical analysis to measure differential expression and annotationbased tests. A number of visualization tools such as volcano plots, MA plots, scatter plots, box plots and heat maps are used to aid the interpretation of the results. The various tools available are described in the sections listed below.

20.1

Experimental design

In order to make full use of the various tools for interpreting expression data, you need to know the central concepts behind the way the data is organized in the CLC Genomics Workbench. The first piece of data you are faced with is the sample. In the Workbench, a sample contains the expression values from either one array or from sequencing data of one sample. Note that the calculation of expression levels based on the raw sequence data is described in sections 19.14 and 19.15 . See more below on how to get your expression data into the Workbench as samples (under Supported array platforms). In a sample, there is a number of features, usually genes, and their associated expression levels. To analyze differential expression, you need to tell the workbench how the samples are related. This is done by setting up an experiment. An experiment is essentially a set of samples which are grouped. By creating an experiment defining the relationship between the samples, it becomes possible to do statistical analysis to investigate differential expression between the groups. The Experiment is also used to accumulate calculations like t-tests and clustering because this information is closely related to the grouping of the samples.

20.1.1

Supported array platforms

The workbench supports analysis of one-color expression arrays. These may be imported from GEO soft sample- or series- file formats, or for Affymetrix arrays, tab-delimited pivot or metrics files, or from Illumina expression files. Expression array data from other platforms may be imported from tab, semi-colon or comma separated files containing the expression feature IDs and levels in a tabular format (see see section L.5). The workbench assumes that expression values are given at the gene level, thus probe-level analysis of e.g. Affymetrix GeneChips and import of Affymetrix CEL and CDF files is currently not supported. However, the workbench allows import of txt files exported from R containing processed Affymetrix CEL-file data (see see section L.2). Affymetrix NetAffx annotation files for expression GeneChips in csv format and Illumina annotation

CHAPTER 20. EXPRESSION ANALYSIS

565

files can also be imported. Also, you may import your own annotation data in tabular format see see section L.5). See section L in the Appendix for detailed information about supported file formats.

20.1.2

Setting up an experiment
) | Set Up Experiment ( )

To set up an experiment: Toolbox | Expression Analysis (

Select the samples that you wish to use by double-clicking or selecting and pressing the Add ( ) button (see figure 20.1).

Figure 20.1: Select the samples to use for setting up the experiment. Note that we use "samples" as the general term for both microarray-based sets of expression values and sequencing-based sets of expression values. Clicking Next shows the dialog in figure 20.2. Here you define the number of groups in the experiment. At the top you can select a two-group experiment, and below you can select a multi-group experiment and define the number of groups. Note that you can also specify if the samples are paired. Pairing is relevant if you have samples from the same individual under different conditions, e.g. before and after treatment, or at times 0, 2 and 4 hours after treatment. In this case statistical analysis becomes more efficient if effects of the individuals are taken into account, and comparisons are carried out not simply by considering raw group means but by considering these corrected for effects of the individual. If the Paired is selected, a paired rather than a standard t-test will be carried out for two group comparisons. For multiple group comparisons a repeated measures rather than a standard ANOVA will be used. For RNA-Seq experiments, you can also choose which expression value to be used when setting

CHAPTER 20. EXPRESSION ANALYSIS

566

Figure 20.2: Defining the number of groups. up the experiment. This value will then be used for all subsequence analyses. Clicking Next shows the dialog in figure 20.3.

Figure 20.3: Naming the groups. Depending on the number of groups selected in figure 20.2, you will see a list of groups with text fields where you can enter an appropriate name for that group. For multi-group experiments, if you find out that you have too many groups, click the Delete ( button. If you need more groups, simply click Add New Group. Click Next when you have named the groups, and you will see figure 20.4. This is where you define which group the individual sample belongs to. Simply select one or )

CHAPTER 20. EXPRESSION ANALYSIS

567

Figure 20.4: Putting the samples into groups. more samples (by clicking and dragging the mouse), right-click (Ctrl-click on Mac) and select the appropriate group. Note that the samples are sorted alphabetically based on their names. If you have chosen Paired in figure 20.2, there will be an extra column where you define which samples belong together. Just as when defining the group membership, you select one or more samples, right-click in the pairing column and select a pair. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish.

20.1.3

Organization of the experiment table

The resulting experiment includes all the expression values and other information from the samples (the values are copied - the original samples are not affected and can thus be deleted with no effect on the experiment). In addition it includes a number of summaries of the values across all, or a subset of, the samples for each feature. Which values are in included is described in the sections below. When you open it, it is shown in the experiment table (see figure 20.5). For a general introduction to table features like sorting and filtering, see section C. Unlike other tables in CLC Genomics Workbench, the experiment table has a hierarchical grouping of the columns. This is done to reflect the structure of the data in the experiment. The Side Panel is divided into a number of groups corresponding to the structure of the table. These are described below. Note that you can customize and save the settings of the Side Panel (see section 5.6). Whenever you perform analyses like normalization, transformation, statistical analysis etc, new columns will be added to the experiment. You can at any time Export ( ) all the data in the experiment in csv or Excel format or Copy ( ) the full table or parts of it.

CHAPTER 20. EXPRESSION ANALYSIS

568

Figure 20.5: Opening the experiment. Column width There are two options to specify the width of the columns and also the entire table: Automatic. This will fit the entire table into the width of the view. This is useful if you only have a few columns. Manual. This will adjust the width of all columns evenly, and it will make the table as wide as it needs to be to display all the columns. This is useful if you have many columns. In this case there will be a scroll bar at the bottom, and you can manually adjust the width by dragging the column separators. Experiment level The rest of the Side Panel is devoted to different levels of information on the values in the experiment. The experiment part contains a number of columns that, for each feature ID, provide summaries of the values across all the samples in the experiment (see figure 20.6). Initially, it has one header for the whole Experiment: Range (original values). The 'Range' column contains the difference between the highest and the lowest expression value for the feature over all the samples. If a feature has the value NaN in one or more of the samples the range value is NaN.

CHAPTER 20. EXPRESSION ANALYSIS

569

Figure 20.6: The initial view of the experiment level for a two-group experiment. IQR (original values). The 'IQR' column contains the inter-quantile range of the values for a feature across the samples, that is, the difference between the 75 %-ile value and the 25 %-ile value. For the IQR values, only the numeric values are considered when percentiles are calculated (that is, NaN and +Inf or -Inf values are ignored), and if there are fewer than four samples with numeric values for a feature, the IQR is set to be the difference between the highest and lowest of these. Difference (original values). For a two-group experiment the 'Difference' column contains the difference between the mean of the expression values across the samples assigned to group 2 and the mean of the expression values across the samples assigned to group 1. Thus, if the mean expression level in group 2 is higher than that of group 1 the 'Difference' is positive, and if it is lower the 'Difference' is negative. For experiments with more than two groups the 'Difference' contains the difference between the maximum and minimum of the mean expression values of the groups, multiplied by -1 if the group with the maximum mean expression value occurs after the group with the minimum mean expression value (with the ordering: group 1, group 2, ...). Fold Change (original values). For a two-group experiment the 'Fold Change' tells you how many times bigger the mean expression value in group 2 is relative to that of group 1. If the mean expression value in group 2 is bigger than that in group 1 this value is the mean expression value in group 2 divided by that in group 1. If the mean expression value in group 2 is smaller than that in group 1 the fold change is the mean expression value in group 1 divided by that in group 2 with a negative sign. Thus, if the mean expression levels in group 1 and group 2 are 10 and 50 respectively, the fold change is 5, and if the and if the mean expression levels in group 1 and group 2 are 50 and 10 respectively, the fold change is -5. For experiments with more than two groups, the 'Fold Change' column contains the ratio of the maximum of the mean expression values of the groups to the minimum of the mean expression values of the groups, multiplied by -1 if the group with the maximum mean expression value occurs after the group with the minimum mean expression value (with the ordering: group 1, group 2, ...). Thus, the sign of the values in the 'Difference' and 'Fold change' columns give the direction of the trend across the groups, going from group 1 to group 2, etc. If the samples used are Affymetrix GeneChips samples and have 'Present calls' there will also be a 'Total present count' column containing the number of present calls for all samples. The columns under the 'Experiment' header are useful for filtering purposes, e.g. you may wish to ignore features that differ too little in expression levels to be confirmed e.g. by qPCR by

CHAPTER 20. EXPRESSION ANALYSIS

570

filtering on the values in the 'Difference', 'IQR' or 'Fold Change' columns or you may wish to ignore features that do not differ at all by filtering on the 'Range' column. If you have performed normalization or transformation (see sections 20.2.3 and 20.2.2, respectively), the IQR of the normalized and transformed values will also appear. Also, if you later choose to transform or normalize your experiment, columns will be added for the transformed or normalized values. Note! It is very common to filter features on fold change values in expression analysis and fold change values are also used in volcano plots, see section 20.4.4. There are different definitions of 'Fold Change' in the literature. The definition that is used typically depends on the original scale of the data that is analyzed. For data whose original scale is not the log scale the standard definition is the ratio of the group means [Tusher et al., 2001]. This is the value you find in the 'Fold Change' column of the experiment. However, for data whose original is the log scale, the difference of the mean expression levels is sometimes referred to as the fold change [Guo et al., 2006], and if you want to filter on fold change for these data you should filter on the values in the 'Difference' column. Your data's original scale will e.g. be the log scale if you have imported Affymetrix expression values which have been created by running the RMA algorithm on the probe-intensities. Analysis level If you perform statistical analysis (see section 20.4), there will be a heading for each statistical analysis performed. Under each of these headings you find columns holding relevant values for the analysis (P-value, corrected P-value, test-statistic etc. - see more in section 20.4). An example of a more elaborate analysis level is shown in figure 20.7.

Figure 20.7: Transformation, normalization and statistical analysis has been performed.

Annotation level If your experiment is annotated (see section 20.1.4), the annotations will be listed in the Annotation level group as shown in figure 20.8.

CHAPTER 20. EXPRESSION ANALYSIS

571

Figure 20.8: An annotated experiment. In order to avoid too much detail and cluttering the table, only a few of the columns are shown per default. Note that if you wish a different set of annotations to be displayed each time you open an experiment, you need to save the settings of the Side Panel (see section 5.6). Group level At the group level, you can show/hide entire groups (Heart and Diaphragm in figure 20.5). This will show/hide everything under the group's header. Furthermore, you can show/hide group-level information like the group means and present count within a group. If you have performed normalization or transformation (see sections 20.2.3 and 20.2.2, respectively), the means of the normalized and transformed values will also appear. Sample level In this part of the side panel, you can control which columns to be displayed for each sample. Initially this is the all the columns in the samples. If you have performed normalization or transformation (see sections 20.2.3 and 20.2.2, respectively), the normalized and transformed values will also appear. An example is shown in figure 20.9. Creating a sub-experiment from a selection If you have identified a list of genes that you believe are differentially expressed, you can create a subset of the experiment. (Note that the filtering and sorting may come in handy in this situation, see section C). To create a sub-experiment, first select the relevant features (rows). If you have applied a filter and wish to select all the visible features, press Ctrl + A ( + A on Mac). Next, press the Create Experiment from Selection ( ) button at the bottom of the table (see figure 20.10). This will create a new experiment that has the same information as the existing one but with less features.

CHAPTER 20. EXPRESSION ANALYSIS

572

Figure 20.9: Sample level when transformation and normalization has been performed.

Figure 20.10: Create a subset of the experiment by clicking the button at the bottom of the experiment table. Downloading sequences from the experiment table If your experiment is annotated, you will be able to download the GenBank sequence for features which have a GenBank accession number in the 'Public identifier tag' annotation column. To do this, select a number of features (rows) in the experiment and then click Download Sequence ( ) (see figure 20.11).

Figure 20.11: Select sequences and press the download button. This will open a dialog where you specify where the sequences should be saved. You can learn more about opening and viewing sequences in chapter 10. You can now use the downloaded sequences for further analysis in the Workbench, e.g. performing BLAST searches and designing primers for QPCR experiments.

20.1.4

Adding annotations to an experiment

Annotation files provide additional information about each feature. This information could be which GO categories the protein belongs to, which pathways, various transcript and protein identifiers etc. See section L for information about the different annotation file formats that are supported CLC Genomics Workbench. The annotation file can be imported into the Workbench and will get a special icon ( ). See an overview of annotation formats supported by CLC Genomics Workbenchin section L. In order to

CHAPTER 20. EXPRESSION ANALYSIS

573

associate an annotation file with an experiment, either select the annotation file when you set up the experiment (see section 20.1.2), or click: Toolbox | Expression Analysis ( ) | Annotation Test | Add Annotations ( )

Select the experiment ( ) and the annotation file ( ) and click Finish. You will now be able to see the annotations in the experiment as described in section 20.1.3. You can also add annotations by pressing the Add Annotations ( ) button at the bottom of the table (see figure 20.12).

Figure 20.12: Adding annotations by clicking the button at the bottom of the experiment table. This will bring up a dialog where you can select the annotation file that you have imported together with the experiment you wish to annotate. Click Next to specify settings as shown in figure 20.13).

Figure 20.13: Choosing how to match annotations with samples. In this dialog, you can specify how to match the annotations to the features in the sample. The Workbench looks at the columns in the annotation file and lets you choose which column that should be used for matching to the feature IDs in the experimental data (samples or experiment). Usually the default is right, but for some annotation files, you need to use another column. Some annotation files have leading zeros in the identifier which you can remove by checking the Remove leading zeros box. Note! Existing annotations on the experiment will be overwritten.

20.1.5

Scatter plot view of an experiment

At the bottom of the experiment table, you can switch between different views of the experiment (see figure 20.14).

CHAPTER 20. EXPRESSION ANALYSIS

574

Figure 20.14: An experiment can be viewed in several ways. One of the views is the Scatter Plot ( ). The scatter plot can be adjusted to show e.g. the group means for two groups (see more about how to adjust this below). An example of a scatter plot is shown in figure 20.15.

Figure 20.15: A scatter plot of group means for two groups (transformed expression values). In the Side Panel to the left, there are a number of options to adjust this view. Under Graph preferences, you can adjust the general properties of the scatter plot: Lock axes. This will always show the axes even though the plot is zoomed to a detailed level. Frame. Shows a frame around the graph. Show legends. Shows the data legends. Tick type. Determine whether tick lines should be shown outside or inside the frame. Outside Inside Tick lines at. Choosing Major ticks will show a grid behind the graph. None Major ticks Horizontal axis range. Sets the range of the horizontal axis (x axis). Enter a value in Min and Max, and press Enter. This will update the view. If you wait a few seconds without pressing Enter, the view will also be updated.

CHAPTER 20. EXPRESSION ANALYSIS

575

Vertical axis range. Sets the range of the vertical axis (y axis). Enter a value in Min and Max, and press Enter. This will update the view. If you wait a few seconds without pressing Enter, the view will also be updated. Draw x = y axis. This will draw a diagonal line across the plot. This line is shown per default. Line width Thin Medium Wide Line type None Line Long dash Short dash Line color. Allows you to choose between many different colors. Click the color box to select a color. Below the general preferences, you find the Dot properties preferences, where you can adjust coloring and appearance of the dots: Dot type None Cross Plus Square Diamond Circle Triangle Reverse triangle Dot Dot color. Allows you to choose between many different colors. Click the color box to select a color. Finally, the group at the bottom - Columns to compare - is where you choose the values to be plotted. Per default for a two-group experiment, the group means are used. Note that if you wish to use the same settings next time you open a scatter plot, you need to save the settings of the Side Panel (see section 5.6).

CHAPTER 20. EXPRESSION ANALYSIS

576

Figure 20.16: An experiment can be viewed in several ways.

20.1.6

Cross-view selections

There are a number of different ways of looking at an experiment as shown in figure 20.16). Beside the Experiment table ( ) which is the default view, the views are: Scatter plot ( ), Volcano plot ( ) and the Heat map ( ). By pressing and holding the Ctrl ( on Mac) button while you click one of the view buttons in figure 20.16, you can make a split view. This will make it possible to see e.g. the experiment table in one view and the volcano plot in another view. An example of such a split view is shown in figure 20.17. Selections are shared between all these different views of an experiment. This means that if you select a number of rows in the table, the corresponding dots in the scatter plot, volcano plot or heatmap will also be selected. The selection can be made in any view, also the heat map, and all other open views will reflect the selection. A common use of the split views is where you have an experiment and have performed a statistical analysis. You filter the experiment to identify all genes that have an FDR corrected p-value below 0.05 and a fold change for the test above say, 2. You can select all the rows in the experiment table satisfying these filters by holding down the Cntrl button and clicking 'a'. If you have a split view of the experiment and the volcano plot all points in the volcano plot corresponding to the selected features will be red. Note that the volcano plot allows two sets of values in the columns under the test you are considering to be displayed on the x-axis: the 'Fold change's and the 'Difference's. You control which to plot in the side panel. If you have filtered on 'Fold change' you will typically want to choose 'Fold change' in the side panel. If you have filtered on 'Difference' (e.g. because your original data is on the log scale, see the note on fold change in 20.1.3) you typically want to choose 'Difference'.

20.2

Transformation and normalization

The original expression values often need to be transformed and/or normalized in order to ensure that samples are comparable and assumptions on the data for analysis are met [Allison et al., 2006]. These are essential requirements for carrying out a meaningful analysis. The raw expression values often exhibit a strong dependency of the variance on the mean, and it may be preferable to remove this by log-transforming the data. Furthermore, the sets of expression values in the different samples in an experiment may exhibit systematic differences that are likely due to differences in sample preparation and array processing, rather being the result of the underlying biology. These noise effects should be removed before statistical analysis is carried out. When you perform transformation and normalization, the original expression values will be kept, and the new values will be added. If you select an experiment ( ), the new values will be added to the experiment (not the original samples). And likewise if you select a sample ( ( ) or ( )) in this case the new values will be added to the sample (the original values are still kept on the sample).

CHAPTER 20. EXPRESSION ANALYSIS

577

Figure 20.17: A split view showing an experiment table at the top and a volcano plot at the bottom (note that you need to perform statistical analysis to show a volcano plot, see section 20.4).

20.2.1

Selecting transformed and normalized values for analysis

A number of the tools in the Expression Analysis ( ) folder use expression levels. All of these tools let you choose between Original, Transformed and Normalized expression values as shown in figure 20.18.

Figure 20.18: Selecting which version of the expression values to analyze. In this case, the values have not been normalized, so it is not possible to select normalized values.

CHAPTER 20. EXPRESSION ANALYSIS

578

In this case, the values have not been normalized, so it is not possible to select normalized values.

20.2.2

Transformation

The CLC Genomics Workbench lets you transform expression values based on logarithm and adding a constant: Toolbox | Expression Analysis ( ( ) Select a number of samples ( ( ) or ( ) | Transformation and Normalization | Transform )) or an experiment ( ) and click Next.

This will display a dialog as shown in figure 20.19.

Figure 20.19: Transforming expression values. At the top, you can select which values to transform (see section 20.2.1). Next, you can choose three kinds of transformation: Logarithm transformation. Transformed expression values will be calculated by taking the logarithm (of the specified type) of the values you have chosen to transform. 10. 2. Natural logarithm. Adding a constant. Transformed expression values will be calculated by adding the specified constant to the values you have chosen to transform. Square root transformation. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish.

20.2.3

Normalization

The CLC Genomics Workbench lets you normalize expression values. To start the normalization:

CHAPTER 20. EXPRESSION ANALYSIS Toolbox | Expression Analysis ( ( ) Select a number of samples ( ( ) or ( ) | Transformation and Normalization | Normalize )) or an experiment ( ) and click Next.

579

This will display a dialog as shown in figure 20.20.

Figure 20.20: Choosing normalization method. At the top, you can choose three kinds of normalization (for mathematical descriptions see [Bolstad et al., 2003]): Scaling. The sets of the expression values for the samples will be multiplied by a constant so that the sets of normalized values for the samples have the same 'target' value (see description of the Normalization value below). Quantile. The empirical distributions of the sets of expression values for the samples are used to calculate a common target distribution, which is used to calculate normalized sets of expression values for the samples. By totals. This option is intended to be used with count-based data, i.e. data from RNA-seq, small RNA or expression profiling by tags. A sum is calculated for the expression values in a sample. The transformed value are generated by dividing the input values by the sample sum and multiplying by the factor (e.g. per '1,000,000'). Figures 20.21 and 20.22 show the effect on the distribution of expression values when using scaling or quantile normalization, respectively.

Figure 20.21: Box plot after scaling normalization.

CHAPTER 20. EXPRESSION ANALYSIS

580

Figure 20.22: Box plot after quantile normalization. At the bottom of the dialog in figure 20.20, you can select which values to normalize (see section 20.2.1). Clicking Next will display a dialog as shown in figure 20.23.

Figure 20.23: Normalization settings. The following parameters can be set: Normalization value. The type of value of the samples which you want to ensure are equal for the normalized expression values Mean. Median. Reference. The specific value that you want the normalized value to be after normalization. Median mean. Median median. Use another sample. Trimming percentage. Expression values that lie below the value of this percentile, or above 100 minus the value of this percentile, in the empirical distribution of the expression values in a sample will be excluded when calculating the normalization and reference values. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish.

CHAPTER 20. EXPRESSION ANALYSIS

581

20.3

Quality control

The CLC Genomics Workbench includes a number of tools for quality control. These allow visual inspection of the overall distributions, variability and similarity of the sets of expression values in samples, and may be used to spot unwanted systematic differences between samples, outlying samples and samples of poor quality, that you may want to exclude.

20.3.1

Creating box plots - analyzing distributions

In most cases you expect the majority of genes to behave similarly under the conditions considered, and only a smaller proportion to behave differently. Thus, at an overall level you would expect the distributions of the sets of expression values in samples in a study to be similar. A boxplot provides a visual presentation of the distributions of expression values in samples. For each sample the distribution of it's values is presented by a line representing a center, a box representing the middle part, and whiskers representing the tails of the distribution. Differences in the overall distributions of the samples in a study may indicate that normalization is required before the samples are comparable. An atypical distribution for a single sample (or a few samples), relative to the remaining samples in a study, could be due to imperfections in the preparation and processing of the sample, and may lead you to reconsider using the sample(s). To create a box plot: Toolbox | Expression Analysis ( Select a number of samples ( ( ) or ( ) | Quality Control | Create Box Plot ( )) or an experiment ( )

) and click Next.

This will display a dialog as shown in figure 20.24.

Figure 20.24: Choosing values to analyze for the box plot. Here you select which values to use in the box plot (see section 20.2.1). Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. Viewing box plots An example of a box plot of a two-group experiment with 12 samples is shown in figure 20.25. Note that the boxes per default are colored according to their group relationship. At the bottom you find the names of the samples, and the y-axis shows the expression values (note that sample

CHAPTER 20. EXPRESSION ANALYSIS

582

Figure 20.25: A box plot of 12 samples in a two-group experiment, colored by group. names are not shown in figure 20.25). Per default the box includes the IQR values (from the lower to the upper quartile), the median is displayed as a line in the box, and the whiskers extend 1.5 times the height of the box. In the Side Panel to the left, there is a number of options to adjust this view. Under Graph preferences, you can adjust the general properties of the box plot (see figure 20.26).

Figure 20.26: Graph preferences for a box plot. Lock axes. This will always show the axes even though the plot is zoomed to a detailed level. Frame. Shows a frame around the graph. Show legends. Shows the data legends.

CHAPTER 20. EXPRESSION ANALYSIS Tick type. Determine whether tick lines should be shown outside or inside the frame. Outside Inside Tick lines at. Choosing Major ticks will show a grid behind the graph. None Major ticks

583

Vertical axis range. Sets the range of the vertical axis (y axis). Enter a value in Min and Max, and press Enter. This will update the view. If you wait a few seconds without pressing Enter, the view will also be updated. Draw median line. This is the default - the median is drawn as a line in the box. Draw mean line. Alternatively, you can also display the mean value as a line. Show outliers. The values outside the whiskers range are called outliers. Per default they are not shown. Note that the dot type that can be set below only takes effect when outliers are shown. When you select and deselect the Show outliers, the vertical axis range is automatically re-calculated to accommodate the new values. Below the general preferences, you find the Lines and dots preferences, where you can adjust coloring and appearance (see figure 20.27).

Figure 20.27: Lines and dot preferences for a box plot.

Select sample or group. When you wish to adjust the properties below, first select an item in this drop-down menu. That will apply the changes below to this item. If your plot is based on an experiment, the drop-down menu includes both group names and sample names, as well as an entry for selecting "All". If your plot is based on single elements, only sample names will be visible. Note that there are sometimes "mixed states" when you select a group where two of the samples e.g. have different colors. Selecting a new color in this case will erase the differences. Dot type None Cross Plus Square

CHAPTER 20. EXPRESSION ANALYSIS Diamond Circle Triangle Reverse triangle Dot

584

Dot color. Allows you to choose between many different colors. Click the color box to select a color. Note that if you wish to use the same settings next time you open a box plot, you need to save the settings of the Side Panel (see section 5.6). Interpreting the box plot This section will show how to interpret a box plot through a few examples. First, if you look at figure 20.28, you can see a box plot for an experiment with 5 groups and 27 samples.

Figure 20.28: Box plot for an experiment with 5 groups and 27 samples. None of the samples stand out as having distributions that are atypical: the boxes and whiskers ranges are about equally sized. The locations of the distributions however, differ some, and indicate that normalization may be required. Figure 20.29 shows a box plot for the same experiment after quantile normalization: the distributions have been brought into par. In figure 20.30 a box plot for a two group experiment with 5 samples in each group is shown. The distribution of values in the second sample from the left is quite different from those of other samples, and could indicate that the sample should not be used.

20.3.2

Hierarchical clustering of samples

A hierarchical clustering of samples is a tree representation of their relative similarity. The tree structure is generated by 1. letting each feature be a cluster

CHAPTER 20. EXPRESSION ANALYSIS

585

Figure 20.29: Box plot after quantile normalization.

Figure 20.30: Box plot for a two-group experiment with 5 samples. 2. calculating pairwise distances between all clusters 3. joining the two closest clusters into one new cluster 4. iterating 2-3 until there is only one cluster left (which will contain all samples). The tree is drawn so that the distances between clusters are reflected by the lengths of the branches in the tree. Thus, features with expression profiles that closely resemble each other have short distances between them, those that are more different, are placed further apart. (See [Eisen et al., 1998] for a classical example of application of a hierarchical clustering algorithm in microarray analysis. The example is on features rather than samples). To start the clustering: Toolbox | Expression Analysis ( Samples ( ) Select a number of samples ( ( ) or ( ) | Quality Control | Hierarchical Clustering of )) or an experiment ( ) and click Next.

This will display a dialog as shown in figure 20.31. The hierarchical clustering algorithm requires that you specify a distance measure and a cluster linkage. The similarity measure is used to specify how distances between two samples should be calculated. The cluster distance metric specifies how you want the distance between two clusters, each consisting of a number of samples, to be calculated. At the top, you can choose three kinds of Distance measures:

CHAPTER 20. EXPRESSION ANALYSIS

586

Figure 20.31: Parameters for hierarchical clustering of samples. Euclidean distance. The ordinary distance between two points - the length of the segment connecting them. If u = (u1 , u2 , . . . , un ) and v = (v1 , v2 , . . . , vn ), then the Euclidean distance between u and v is
n

|u v| =
i=1

(ui vi )2 .

1 - Pearson correlation. The Pearson correlation coefficient between two elements x = (x1 , x2 , ..., xn ) and y = (y1 , y2 , ..., yn ) is defined as r= 1 n1
n

(
i=1

xi x yi y )( ) sx sy

where x/y is the average of values in x/y and sx /sy is the sample standard deviation of these values. It takes a value [1, 1]. Highly correlated elements have a high absolute value of the Pearson correlation, and elements whose values are un-informative about each other have Pearson correlation 0. Using 1 |P earsoncorrelation| as distance measure means that elements that are highly correlated will have a short distance between them, and elements that have low correlation will be more distant from each other. Manhattan distance. The Manhattan distance between two points is the distance measured along axes at right angles. If u = (u1 , u2 , . . . , un ) and v = (v1 , v2 , . . . , vn ), then the Manhattan distance between u and v is
n

|u v| =
i=1

|ui vi |.

Next, you can select the cluster linkage to be used: Single linkage. The distance between two clusters is computed as the distance between the two closest elements in the two clusters. Average linkage. The distance between two clusters is computed as the average distance between objects from the first cluster and objects from the second cluster. The averaging is performed over all pairs (x, y), where x is an object from the first cluster and y is an object from the second cluster.

CHAPTER 20. EXPRESSION ANALYSIS

587

Complete linkage. The distance between two clusters is computed as the maximal objectto-object distance d(xi , yj ), where xi comes from the first cluster, and yj comes from the second cluster. In other words, the distance between two clusters is computed as the distance between the two farthest objects in the two clusters. At the bottom, you can select which values to cluster (see section 20.2.1). Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. Result of hierarchical clustering of samples The result of a sample clustering is shown in figure 20.32.

Figure 20.32: Sample clustering. If you have used an experiment ( ) as input, the clustering is added to the experiment and will be saved when you save the experiment. It can be viewed by clicking the Show Heat Map ( ) button at the bottom of the view (see figure 20.33).

Figure 20.33: Showing the hierarchical clustering of an experiment. If you have selected a number of samples ( ( that has to be saved separately. ) or ( )) as input, a new element will be created

Regardless of the input, the view of the clustering is the same. As you can see in figure 20.32, there is a tree at the bottom of the view to visualize the clustering. The names of the samples are listed at the top. The features are represented as horizontal lines, colored according to the expression level. If you place the mouse on one of the lines, you will see the names of the feature to the left. The features are sorted by their expression level in the first sample (in order to cluster the features, see section 20.5.1). Researchers often have a priori knowledge of which samples in a study should be similar (e.g. samples from the same experimental condition) and which should be different (samples from biological distinct conditions). Thus, researches have expectations about how they should cluster. Samples that are placed unexpectedly in the hierarchical clustering tree may be samples that have been wrongly allocated to a group, samples of unintended or unclean tissue composition

CHAPTER 20. EXPRESSION ANALYSIS

588

or samples for which the processing has gone wrong. Unexpectedly placed samples, of course, could also be highly interesting samples. There are a number of options to change the appearance of the heat map. At the top of the Side Panel, you find the Heat map preference group (see figure 20.34).

Figure 20.34: Side Panel of heat map. At the top, there is information about the heat map currently displayed. The information regards type of clustering, expression value used together with distance and linkage information. If you have performed more than one clustering, you can choose between the resulting heat maps in a drop-down box (see figure 20.46).

Figure 20.35: When more than one clustering has been performed, there will be a list of heat maps to choose from. Note that if you perform an identical clustering, the existing heat map will simply be replaced. Below this box, there is a number of settings for displaying the heat map. Lock width to window. When you zoom in the heat map, you will per default only zoom in on the vertical level. This is because the width of the heat map is locked to the window. If you uncheck this option, you will zoom both vertically and horizontally. Since you always have more features than samples, it is useful to lock the width since you then have all the samples in view all the time.

CHAPTER 20. EXPRESSION ANALYSIS

589

Lock height to window. This is the corresponding option for the height. Note that if you check both options, you will not be able to zoom at all, since both the width and the height is fixed. Lock headers and footers. This will ensure that you are always able to see the sample and feature names and the trees when you zoom in. Colors. The expression levels are visualized using a gradient color scheme, where the right side color is used for high expression levels and the left side color is used for low expression levels. You can change the coloring by clicking the box, and you can change the relative coloring of the values by dragging the two knobs on the white slider above. Below you find the Samples and Features groups. They contain options to show names above/below and left/right, respectively. Furthermore, they contain options to show the tree above/below or left/right, respectively. Note that for clustering of samples, you find the tree options in the Samples group, and for clustering of features, you find the tree options in the Features group. With the tree options, you can also control the Tree size, from tiny to very large, and the option of showing the full tree, no matter how much space it will use. Note that if you wish to use the same settings next time you open a heat map, you need to save the settings of the Side Panel (see section 5.6).

20.3.3

Principal component analysis

A principal component analysis is a mathematical analysis that identifies and quantifies the directions of variability in the data. For a set of samples, e.g. an experiment, this can be done by finding the eigenvectors and eigenvalues of the covariance matrix of the samples. The eigenvectors are orthogonal. The first principal component is the eigenvector with the largest eigenvalue, and specifies the direction with the largest variability. The second principal component is the eigenvector with the second largest eigenvalue, and specifies the direction with the second largest variability. Similarly for the third, etc. The data can be projected onto the space spanned by the eigenvectors. A plot of the data in the space spanned by the first and second principal component will show a simplified version of the data with variability in other directions than the two major directions of variability ignored. To start the analysis: Toolbox | Expression Analysis ( ( ) Select a number of samples ( ( ) or ( ) | Quality Control | Principal Component Analysis )) or an experiment ( ) and click Next.

This will display a dialog as shown in figure 20.36. In this dialog, you select the values to be used for the principal component analysis (see section 20.2.1). Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. Principal component analysis plot This will create a principal component plot as shown in figure 20.37.

CHAPTER 20. EXPRESSION ANALYSIS

590

Figure 20.36: Selcting which values the principal component analysis should be based on.

Figure 20.37: A principal component analysis colored by group. The plot shows the projection of the samples onto the two-dimensional space spanned by the first and second principal component. (These are the orthogonal directions in which the data exhibits the largest and second-largest variability). The plot in figure 20.37 is based on a two-group experiment. The group relationships are indicated by color. We expect the samples from within a group to exhibit less variability when compared, than samples from different groups. Thus samples should cluster according to groups and this is what we see. The PCA plot is thus helpful in identifying outlying samples and samples that have been wrongly assigned to a group. In the Side Panel to the left, there is a number of options to adjust the view. Under Graph preferences, you can adjust the general properties of the plot. Lock axes. This will always show the axes even though the plot is zoomed to a detailed level. Frame. Shows a frame around the graph.

CHAPTER 20. EXPRESSION ANALYSIS Show legends. Shows the data legends. Tick type. Determine whether tick lines should be shown outside or inside the frame. Outside Inside Tick lines at. Choosing Major ticks will show a grid behind the graph. None Major ticks

591

Horizontal axis range. Sets the range of the horizontal axis (x axis). Enter a value in Min and Max, and press Enter. This will update the view. If you wait a few seconds without pressing Enter, the view will also be updated. Vertical axis range. Sets the range of the vertical axis (y axis). Enter a value in Min and Max, and press Enter. This will update the view. If you wait a few seconds without pressing Enter, the view will also be updated. y = 0 axis. Draws a line where y = 0. Below there are some options to control the appearance of the line: Line width Thin Medium Wide Line type None Line Long dash Short dash

Line color. Allows you to choose between many different colors. Click the color box to select a color. Below the general preferences, you find the Dot properties: Select sample or group. When you wish to adjust the properties below, first select an item in this drop-down menu. That will apply the changes below to this item. If your plot is based on an experiment, the drop-down menu includes both group names and sample names, as well as an entry for selecting "All". If your plot is based on single elements, only sample names will be visible. Note that there are sometimes "mixed states" when you select a group where two of the samples e.g. have different colors. Selecting a new color in this case will erase the differences. Dot type None Cross

CHAPTER 20. EXPRESSION ANALYSIS Plus Square Diamond Circle Triangle Reverse triangle Dot

592

Dot color. Allows you to choose between many different colors. Click the color box to select a color. Show name. This will show a label with the name of the sample next to the dot. Note that the labels quickly get crowded, so that is why the names are not put on per default. Note that if you wish to use the same settings next time you open a principal component plot, you need to save the settings of the Side Panel (see section 5.6). Scree plot Besides the view shown in figure 20.37, the result of the principal component can also be viewed as a scree plot by clicking the Show Scree Plot ( ) button at the bottom of the view. The scree plot shows the proportion of variation in the data explained by the each of the principal components. The first principal component explains about 99 percent of the variability. In the Side Panel to the left, there is a number of options to adjust the view. Under Graph preferences, you can adjust the general properties of the plot. Lock axes. This will always show the axes even though the plot is zoomed to a detailed level. Frame. Shows a frame around the graph. Show legends. Shows the data legends. Tick type. Determine whether tick lines should be shown outside or inside the frame. Outside Inside Tick lines at. Choosing Major ticks will show a grid behind the graph. None Major ticks Horizontal axis range. Sets the range of the horizontal axis (x axis). Enter a value in Min and Max, and press Enter. This will update the view. If you wait a few seconds without pressing Enter, the view will also be updated. Vertical axis range. Sets the range of the vertical axis (y axis). Enter a value in Min and Max, and press Enter. This will update the view. If you wait a few seconds without pressing Enter, the view will also be updated.

CHAPTER 20. EXPRESSION ANALYSIS The Lines and plots below contains the following parameters: Dot type None Cross Plus Square Diamond Circle Triangle Reverse triangle Dot

593

Dot color. Allows you to choose between many different colors. Click the color box to select a color. Line width Thin Medium Wide Line type None Line Long dash Short dash Line color. Allows you to choose between many different colors. Click the color box to select a color. Note that the graph title and the axes titles can be edited simply by clicking them with the mouse. These changes will be saved when you Save ( ) the graph - whereas the changes in the Side Panel need to be saved explicitly (see section 5.6).

20.4

Statistical analysis - identifying differential expression

The CLC Genomics Workbench is designed to help you identify differential expression. You have a choice of a number of standard statistical tests, that are suitable for different data types and different types of experimental settings. There are two main categories of tests: tests that assume that the data has Gaussian distributions and compare means (described in section 20.4.1) and tests that compare proportions and assume that data consists of counts and (described in section 20.4.2). To run the statistical analysis: Toolbox | Expression Analysis ( ) | Statistical Analysis | On Gaussian Data ( )

CHAPTER 20. EXPRESSION ANALYSIS or Toolbox | Expression Analysis ( ) | Statistical Analysis | On Proportions ( )

594

For both kinds of statistics you first select the experiment ( ) that you wish to use and click Next (learn more about setting up experiments in section 20.1.2). The first part of the explanation of how to proceed and perform the statistical analysis is divided into two, depending on whether you are doing Gaussian-based tests or tests on proportions. The last part has an explanation of the options regarding corrected p-values which applies to all tests.

20.4.1

Gaussian-based tests

The tests based on the Gaussian distribution essentially compare the mean expression level in the experimental groups in the study, and evaluates the significance of the difference relative to the variance (or 'spread') of the data within the groups. The details of the formula used for calculating the test statistics vary according to the experimental setup and the assumptions you make about the data (read more about this in the sections on t-test and ANOVA below). The explanation of how to proceed is divided into two, depending on how many groups there are in your experiment. First comes the explanation for t-tests which is the only analysis available for two-group experimental setups (t-tests can also be used for pairwise comparison of groups in multi-group experiments). Next comes an explanation of the ANOVA test which can be used for multi-group experiments. Note that the test statistics for the t-test and ANOVA analysis use the estimated group variances in their denominators. If all expression values in a group are identical the estimated variance for that group will be zero. If the estimated variances for both (or all) groups are zero the denominator of the test statistic will be zero. The numerator's value depends on the difference of the group means. If this is zero, the numerator is zero and the test statistic will be 0/0 which is NaN. If the numerator is different from zero the test statistic will be + or - infinity, depending on which group mean is bigger. If all values in all groups are identical the test statistic is set to zero. T-tests For experiments with two groups you can, among the Gaussian tests, only choose a T-test as shown in figure 20.38.

Figure 20.38: Selecting a t-test. There are different types of t-tests, depending on the assumption you make about the variances

CHAPTER 20. EXPRESSION ANALYSIS

595

in the groups. By selecting 'Homogeneous' (the default) calculations are done assuming that the groups have equal variances. When 'In-homogeneous' is selected, this assumption is not made. The t-test can also be chosen if you have a multi-group experiment. In this case you may choose either to have t-tests produced for all pairs of groups (by clicking the 'All pairs' button) or to have a t-test produced for each group compared to a specified reference group (by clicking the 'Against reference' button). In the last case you must specify which of the groups you want to use as reference (the default is to use the group you specified as Group 1 when you set up the experiment). If a experiment with pairing was set up (see section 20.1.2) the Use pairing tick box is active. If ticked, paired t-tests will be calculated, if not, the formula for the standard t-test will be used. When a t-test is run on an experiment four columns will be added to the experiment table for each pair of groups that are analyzed. The 'Difference' column contains the difference between the mean of the expression values across the samples assigned to group 2 and the mean of the expression values across the samples assigned to group 1. The 'Fold Change' column tells you how many times bigger the mean expression value in group 2 is relative to that of group 1. If the mean expression value in group 2 is bigger than that in group 1 this value is the mean expression value in group 2 divided by that in group 1. If the mean expression value in group 2 is smaller than that in group 1 the fold change is the mean expression value in group 1 divided by that in group 2 with a negative sign. The 'Test statistic' column holds that value of the test statistic, and the 'P-value' holds the two-sided p-value for the test. Up to two more columns may be added if the options to calculate Bonferroni and FDR corrected p-values were chosen (see 20.4.3). ANOVA For experiments with more than two groups you can choose T-test as described above, or ANOVA as shown in figure 20.39.

Figure 20.39: Selecting ANOVA. The ANOVA method allows analysis of an experiment with one factor and a number of groups, e.g. different types of tissues, or time points. In the analysis, the variance within groups is compared to the variance between groups. You get a significant result (that is, a small ANOVA p-value) if the difference you see between groups relative to that within groups, is larger than what you would expect, if the data were really drawn from groups with equal means. If an experiment with pairing was set up (see section 20.1.2) the Use pairing tick box is active.

CHAPTER 20. EXPRESSION ANALYSIS

596

If ticked, a repeated measures one-way ANOVA test will be calculated, if not, the formula for the standard one-way ANOVA will be used. When an ANOVA analysis is run on an experiment four columns will be added to the experiment table for each pair of groups that are analyzed. The 'Max difference' column contains the difference between the maximum and minimum of the mean expression values of the groups, multiplied by -1 if the group with the maximum mean expression value occurs after the group with the minimum mean expression value (with the ordering: group 1, group 2, ...). The 'Max fold change' column contains the ratio of the maximum of the mean expression values of the groups to the minimum of the mean expression values of the groups, multiplied by -1 if the group with the maximum mean expression value occurs after the group with the minimum mean expression value (with the ordering: group 1, group 2, ...). The 'Test statistic' column holds the value of the test statistic, and the 'P-value' holds the two-sided p-value for the test. Up to two more columns may be added if the options to calculate Bonferroni and FDR corrected p-values were chosen (see 20.4.3).

20.4.2

Tests on proportions

The proportions-based tests are applicable in situations where your data samples consists of counts of a number of 'types' of data. This could e.g. be in a study where gene expression levels are measured by RNA-Seq or tag profiling. Here the different 'types' could correspond to the different 'genes' in a reference genome, and the counts could be the numbers of reads matching each of these genes. The tests compare counts by considering the proportions that they make up the total sum of counts in each sample. By comparing the expression levels at the level of proportions rather than raw counts, the data is corrected for sample size. There are two tests available for comparing proportions: the test of [Kal et al., 1999] and the test of [Baggerly et al., 2003]. Both tests compare pairs of groups. If you have a multi-group experiment (see section 20.1.2), you may choose either to have tests produced for all pairs of groups (by clicking the 'All pairs' button) or to have a test produced for each group compared to a specified reference group (by clicking the 'Against reference' button). In the last case you must specify which of the groups you want to use as reference (the default is to use the group you specified as Group 1 when you set up the experiment). Note that the proportion-based tests use the total sample counts (that is, the sum over all expression values). If one (or more) of the counts are NaN, the sum will be NaN and all the test statistics will be NaN. As a consequence all p-values will also be NaN. You can avoid this by filtering your experiment and creating a new experiment so that no NaN values are present, before you apply the tests. Kal et al.'s test (Z-test) Kal et al.'s test [Kal et al., 1999] compares a single sample against another single sample, and thus requires that each group in you experiment has only one sample. The test relies on an approximation of the binomial distribution by the normal distribution [Kal et al., 1999]. Considering proportions rather than raw counts the test is also suitable in situations where the sum of counts is different between the samples. When Kal's test is run on an experiment four columns will be added to the experiment table for each pair of groups that are analyzed. The 'Proportions difference' column contains the difference

CHAPTER 20. EXPRESSION ANALYSIS

597

between the proportion in group 2 and the proportion in group 1. The 'Fold Change' column tells you how many times bigger the proportion in group 2 is relative to that of group 1. If the proportion in group 2 is bigger than that in group 1 this value is the proportion in group 2 divided by that in group 1. If the proportion in group 2 is smaller than that in group 1 the fold change is the proportion in group 1 divided by that in group 2 with a negative sign. The 'Test statistic' column holds that value of the test statistic, and the 'P-value' holds the two-sided p-value for the test. Up to two more columns may be added if the options to calculate Bonferroni and FDR corrected p-values were chosen (see 20.4.3). Baggerley et al.'s test (Beta-binomial) Baggerley et al.'s test [Baggerly et al., 2003] compares the proportions of counts in a group of samples against those of another group of samples, and is suited to cases where replicates are available in the groups. The samples are given different weights depending on their sizes (total counts). The weights are obtained by assuming a Beta distribution on the proportions in a group, and estimating these, along with the proportion of a binomial distribution, by the method of moments. The result is a weighted t-type test statistic. When Baggerley's test is run on an experiment four columns will be added to the experiment table for each pair of groups that are analyzed. The 'Weighted proportions difference' column contains the difference between the mean of the weighted proportions across the samples assigned to group 2 and the mean of the weighted proportions across the samples assigned to group 1. The 'Fold Change' column tells you how many times bigger the mean of the weighted proportions in group 2 is relative to that of group 1. If the mean of the weighted proportions in group 2 is bigger than that in group 1 this value is the mean of the weighted proportions in group 2 divided by that in group 1. If the mean of the weighted proportions in group 2 is smaller than that in group 1 the fold change is the mean of the weighted proportions in group 1 divided by that in group 2 with a negative sign. The 'Test statistic' column holds that value of the test statistic, and the 'P-value' holds the two-sided p-value for the test. Up to two more columns may be added if the options to calculate Bonferroni and FDR corrected p-values were chosen (see 20.4.3).

20.4.3

Corrected p-values

Clicking Next will display a dialog as shown in figure 20.40.

Figure 20.40: Additional settings for the statistical analysis.

CHAPTER 20. EXPRESSION ANALYSIS At the top, you can select which values to analyze (see section 20.2.1).

598

Below you can select to add two kinds of corrected p-values to the analysis (in addition to the standard p-value produced for the test statistic): Bonferroni corrected. FDR corrected. Both are calculated from the original p-values, and aim in different ways to take into account the issue of multiple testing [Dudoit et al., 2003]. The problem of multiple testing arises because the original p-values are related to a single test: the p-value is the probability of observing a more extreme value than that observed in the test carried out. If the p-value is 0.04, we would expect an as extreme value as that observed in 4 out of 100 tests carried out among groups with no difference in means. Popularly speaking, if we carry out 10000 tests and select the features with original p-values below 0.05, we will expect about 0.05 times 10000 = 500 to be false positives. The Bonferroni corrected p-values handle the multiple testing problem by controlling the 'familywise error rate': the probability of making at least one false positive call. They are calculated by multiplying the original p-values by the number of tests performed. The probability of having at least one false positive among the set of features with Bonferroni corrected p-values below 0.05, is less than 5%. The Bonferroni correction is conservative: there may be many genes that are differentially expressed among the genes with Bonferroni corrected p-values above 0.05, that will be missed if this correction is applied. Instead of controlling the family-wise error rate we can control the false discovery rate: FDR. The false discovery rate is the proportion of false positives among all those declared positive. We expect 5 % of the features with FDR corrected p-values below 0.05 to be false positive. There are many methods for controlling the FDR - the method used in CLC Genomics Workbench is that of [Benjamini and Hochberg, 1995]. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. Note that if you have already performed statistical analysis on the same values, the existing one will be overwritten.

20.4.4

Volcano plots - inspecting the result of the statistical analysis

The results of the statistical analysis are added to the experiment and can be shown in the experiment table (see section 20.1.3). Typically columns containing the differences (or weighted differences) of the mean group values and the fold changes (or weighted fold changes) of the mean group values will be added along with a column of p-values. Also, columns with FDR or Bonferroni corrected p-values will be added if these were calculated. This added information allows features to be sorted and filtered to exclude the ones without sufficient proof of differential expression (learn more in section C). If you want a more visual approach to the results of the statistical analysis, you can click the Show Volcano Plot ( ) button at the bottom of the experiment table view. In the same way as the scatter plot presented in section 20.1.5, the volcano plot is yet another view on the experiment. Because it uses the p-values and mean differences produced by the statistical analysis, the plot is only available once a statistical analysis has been performed on the experiment.

CHAPTER 20. EXPRESSION ANALYSIS

599

Figure 20.41: Volcano plot. An example of a volcano plot is shown in figure 20.41. The volcano plot shows the relationship between the p-values of a statistical test and the magnitude of the difference in expression values of the samples in the groups. On the y-axis the log10 p-values are plotted. For the x-axis you may choose between two sets of values by choosing either 'Fold change' or 'Difference' in the volcano plot side panel's 'Values' part. If you choose 'Fold change' the log of the values in the 'fold change' (or 'Weighted fold change') column for the test will be displayed. If you choose 'Difference' the values in the 'Difference' (or 'Weighted difference') column will be used. Which values you wish to display will depend upon the scale of you data (Read the note on fold change in section 20.1.3). The larger the difference in expression of a feature, the more extreme it's point will lie on the X-axis. The more significant the difference, the smaller the p-value and thus the higher the log10 (p) value. Thus, points for features with highly significant differences will lie high in the plot. Features of interest are typically those which change significantly and by a certain magnitude. These are the points in the upper left and upper right hand parts of the volcano plot. If you have performed different tests or you have an experiment with multiple groups you need to specify for which test and which group comparison you want the volcano plot to be shown. You do this in the 'Test' and 'Values' parts of the volcano plot side panel. Options for the volcano plot are described in further detail when describing the Side Panel below. If you place your mouse on one of the dots, a small text box will tell the name of the feature. Note that you can zoom in and out on the plot (see section 3.3). In the Side Panel to the right, there is a number of options to adjust the view of the volcano plot. Under Graph preferences, you can adjust the general properties of the volcano plot Lock axes. This will always show the axes even though the plot is zoomed to a detailed level.

CHAPTER 20. EXPRESSION ANALYSIS Frame. Shows a frame around the graph. Show legends. Shows the data legends. Tick type. Determine whether tick lines should be shown outside or inside the frame. Outside Inside Tick lines at. Choosing Major ticks will show a grid behind the graph. None Major ticks

600

Horizontal axis range. Sets the range of the horizontal axis (x axis). Enter a value in Min and Max, and press Enter. This will update the view. If you wait a few seconds without pressing Enter, the view will also be updated. Vertical axis range. Sets the range of the vertical axis (y axis). Enter a value in Min and Max, and press Enter. This will update the view. If you wait a few seconds without pressing Enter, the view will also be updated. Below the general preferences, you find the Dot properties, where you can adjust coloring and appearance of the dots. Dot type None Cross Plus Square Diamond Circle Triangle Reverse triangle Dot Dot color. Allows you to choose between many different colors. Click the color box to select a color. At the very bottom, you find two groups for choosing which values to display: Test. In this group, you can select which kind of test you want the volcano plot to be shown for. Values. Under Values, you can select which values to plot. If you have multi-group experiments, you can select which groups to compare. You can also select whether to plot Difference or Fold change on the x-axis. Read the note on fold change in section 20.1.3. Note that if you wish to use the same settings next time you open a box plot, you need to save the settings of the Side Panel (see section 5.6).

CHAPTER 20. EXPRESSION ANALYSIS

601

20.5

Feature clustering

Feature clustering is used to identify and cluster together features with similar expression patterns over samples (or experimental groups). Features that cluster together may be involved in the same biological process or be co-regulated. Also, by examining annotations of genes within a cluster, one may learn about the underlying biological processes involved in the experiment studied.

20.5.1

Hierarchical clustering of features

A hierarchical clustering of features is a tree presentation of the similarity in expression profiles of the features over a set of samples (or groups). The tree structure is generated by 1. letting each feature be a cluster 2. calculating pairwise distances between all clusters 3. joining the two closest clusters into one new cluster 4. iterating 2-3 until there is only one cluster left (which will contain all samples). The tree is drawn so that the distances between clusters are reflected by the lengths of the branches in the tree. Thus, features with expression profiles that closely resemble each other have short distances between them, those that are more different, are placed further apart. To start the clustering of features: Toolbox | Expression Analysis ( Features ( ) Select at least two samples ( ( ) or ( ) | Feature Clustering | Hierarchical Clustering of )) or an experiment ( ).

Note! If your data contains many features, the clustering will take very long time and could make your computer unresponsive. It is recommended to perform this analysis on a subset of the data (which also makes it easier to make sense of the clustering. Typically, you will want to filter away the features that are thought to represent only noise, e.g. those with mostly low values, or with little difference between the samples). See how to create a sub-experiment in section 20.1.3. Clicking Next will display a dialog as shown in figure 20.42. The hierarchical clustering algorithm requires that you specify a distance measure and a cluster linkage. The distance measure is used specify how distances between two features should be calculated. The cluster linkage specifies how you want the distance between two clusters, each consisting of a number of features, to be calculated. At the top, you can choose three kinds of Distance measures: Euclidean distance. The ordinary distance between two points - the length of the segment connecting them. If u = (u1 , u2 , . . . , un ) and v = (v1 , v2 , . . . , vn ), then the Euclidean distance between u and v is
n

|u v| =
i=1

(ui vi )2 .

CHAPTER 20. EXPRESSION ANALYSIS

602

Figure 20.42: Parameters for hierarchical clustering of features. 1 - Pearson correlation. The Pearson correlation coefficient between two elements x = (x1 , x2 , ..., xn ) and y = (y1 , y2 , ..., yn ) is defined as r= 1 n1
n

(
i=1

yi y xi x )( ) sx sy

where x/y is the average of values in x/y and sx /sy is the sample standard deviation of these values. It takes a value [1, 1]. Highly correlated elements have a high absolute value of the Pearson correlation, and elements whose values are un-informative about each other have Pearson correlation 0. Using 1 |P earsoncorrelation| as distance measure means that elements that are highly correlated will have a short distance between them, and elements that have low correlation will be more distant from each other. Manhattan distance. The Manhattan distance between two points is the distance measured along axes at right angles. If u = (u1 , u2 , . . . , un ) and v = (v1 , v2 , . . . , vn ), then the Manhattan distance between u and v is
n

|u v| =
i=1

|ui vi |.

Next, you can select different ways to calculate distances between clusters. The possible cluster linkage to use are: Single linkage. The distance between two clusters is computed as the distance between the two closest elements in the two clusters. Average linkage. The distance between two clusters is computed as the average distance between objects from the first cluster and objects from the second cluster. The averaging is performed over all pairs (x, y), where x is an object from the first cluster and y is an object from the second cluster. Complete linkage. The distance between two clusters is computed as the maximal objectto-object distance d(xi , yj ), where xi comes from the first cluster, and yj comes from the second cluster. In other words, the distance between two clusters is computed as the distance between the two farthest objects in the two clusters. At the bottom, you can select which values to cluster (see section 20.2.1). Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish.

CHAPTER 20. EXPRESSION ANALYSIS Result of hierarchical clustering of features The result of a feature clustering is shown in figure 20.43.

603

Figure 20.43: Hierarchical clustering of features. If you have used an experiment ( ) as input, the clustering is added to the experiment and will be saved when you save the experiment. It can be viewed by clicking the Show Heat Map ( ) button at the bottom of the view (see figure 20.44).

Figure 20.44: Showing the hierarchical clustering of an experiment. If you have selected a number of samples ( ( that has to be saved separately. ) or ( )) as input, a new element will be created

Regardless of the input, a hierarchical tree view with associated heatmap is produced (figure 20.43). In the heatmap each row corresponds to a feature and each column to a sample. The color in the i'th row and j'th column reflects the expression level of feature i in sample j (the color scale can be set in the side panel). The order of the rows in the heatmap are determined by the hierarchical clustering. If you place the mouse on one of the rows, you will see the name of the corresponding feature to the left. The order of the columns (that is, samples) is determined by their input order or (if defined) experimental grouping. The names of the samples are listed at the top of the heatmap and the samples are organized into groups. There are a number of options to change the appearance of the heat map. At the top of the Side Panel, you find the Heat map preference group (see figure 20.45). At the top, there is information about the heat map currently displayed. The information regards type of clustering, expression value used together with distance and linkage information. If you have performed more than one clustering, you can choose between the resulting heat maps in a drop-down box (see figure 20.46).

CHAPTER 20. EXPRESSION ANALYSIS

604

Figure 20.45: Side Panel of heat map.

Figure 20.46: When more than one clustering has been performed, there will be a list of heat maps to choose from. Note that if you perform an identical clustering, the existing heat map will simply be replaced. Below this box, there is a number of settings for displaying the heat map. Lock width to window. When you zoom in the heat map, you will per default only zoom in on the vertical level. This is because the width of the heat map is locked to the window. If you uncheck this option, you will zoom both vertically and horizontally. Since you always have more features than samples, it is useful to lock the width since you then have all the samples in view all the time. Lock height to window. This is the corresponding option for the height. Note that if you check both options, you will not be able to zoom at all, since both the width and the height is fixed. Lock headers and footers. This will ensure that you are always able to see the sample and feature names and the trees when you zoom in. Colors. The expression levels are visualized using a gradient color scheme, where the right side color is used for high expression levels and the left side color is used for low expression levels. You can change the coloring by clicking the box, and you can change the relative coloring of the values by dragging the two knobs on the white slider above.

CHAPTER 20. EXPRESSION ANALYSIS

605

Below you find the Samples and Features groups. They contain options to show names above/below and left/right, respectively. Furthermore, they contain options to show the tree above/below or left/right, respectively. Note that for clustering of samples, you find the tree options in the Samples group, and for clustering of features, you find the tree options in the Features group. With the tree options, you can also control the Tree size, from tiny to very large, and the option of showing the full tree, no matter how much space it will use. Note that if you wish to use the same settings next time you open a heat map, you need to save the settings of the Side Panel (see section 5.6).

20.5.2

K-means/medoids clustering

In a k-means or medoids clustering, features are clustered into k separate clusters. The procedures seek to find an assignment of features to clusters, for which the distances between features within the cluster is small, while distances between clusters are large. Toolbox | Expression Analysis ( tering ( ) Select at least two samples ( ( ) or ( ) | Feature Clustering | K-means/medoids Clus)) or an experiment ( ).

Note! If your data contains many features, the clustering will take very long time and could make your computer unresponsive. It is recommended to perform this analysis on a subset of the data (which also makes it easier to make sense of the clustering). See how to create a sub-experiment in section 20.1.3. Clicking Next will display a dialog as shown in figure 20.47.

Figure 20.47: Parameters for k-means/medoids clustering. The parameters are: Algorithm. You can choose between two clustering methods: K-means. K-means clustering assigns each point to the cluster whose center is nearest. The center/centroid of a cluster is defined as the average of all points in the cluster. If a data set has three dimensions and the cluster has two points X = (x1 , x2 , x3 ) and Y = (y1 , y2 , y3 ), then the centroid Z becomes Z = (z1 , z2 , z3 ), where zi = (xi + yi )/2 for i = 1, 2, 3. The algorithm attempts to minimize the

CHAPTER 20. EXPRESSION ANALYSIS intra-cluster variance defined by:

k

606

V =
i=1 xj Si

(xj i )2

where there are k clusters Si , i = 1, 2, . . . , k and i is the centroid of all points xj Si . The detailed algorithm can be found in [Lloyd, 1982]. K-medoids. K-medoids clustering is computed using the PAM-algorithm (PAM is short for Partitioning Around Medoids). It chooses datapoints as centers in contrast to the K-means algorithm. The PAM-algorithm is based on the search for k representatives (called medoids) among all elements of the dataset. When having found k representatives k clusters are now generated by assigning each element to its nearest medoid. The algorithm first looks for a good initial set of medoids (the BUILD phase). Then it finds a local minimum for the objective function:
k

V =
i=1 xj Si

(xj ci )2

where there are k clusters Si , i = 1, 2, . . . , k and ci is the medoid of Si . This solution implies that there is no single switch of an object with a medoid that will decrease the objective (this is called the SWAP phase). The PAM-agorithm is described in [Kaufman and Rousseeuw, 1990]. Number of partitions. The number of partitions to cluster features into. Distance metric. The metric to compute distance between data points. Euclidean distance. The ordinary distance between two elements - the length of the segment connecting them. If u = (u1 , u2 , . . . , un ) and v = (v1 , v2 , . . . , vn ), then the Euclidean distance between u and v is
n

|u v| =
i=1

(ui vi )2 .

Manhattan distance. The Manhattan distance between two elements is the distance measured along axes at right angles. If u = (u1 , u2 , . . . , un ) and v = (v1 , v2 , . . . , vn ), then the Manhattan distance between u and v is
n

|u v| =
i=1

|ui vi |.

Subtract mean value. For each gene, subtract the mean gene expression value over all input samples. Clicking Next will display a dialog as shown in figure 20.48. At the top, you can choose the Level to use. Choosing 'sample values' means that distances will be calculated using all the individual values of the samples. When 'group means' are chosen, distances are calculated using the group means. At the bottom, you can select which values to cluster (see section 20.2.1). Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish.

CHAPTER 20. EXPRESSION ANALYSIS

607

Figure 20.48: Parameters for k-means/medoids clustering. Viewing the result of k-means/medoids clustering The result of the clustering is a number of graphs. The number depends on the number of partitions chosen (figure 20.47) - there is one graph per cluster. Using drag and drop as explained in section 3.2.6, you can arrange the views to see more than one graph at the time. Figure 20.49 shows an example where four clusters have been arranged side-by-side. The samples used are from a time-series experiment, and you can see that the expression levels for each cluster have a distinct pattern. The two clusters at the bottom have falling and rising expression levels, respectively, and the two clusters at the top both fall at the beginning but then rise again (the one to the right starts to rise earlier that the other one). Having inspected the graphs, you may wish to take a closer look at the features represented in each cluster. In the experiment table, the clustering has added an extra column with the name of the cluster that the feature belongs to. In this way you can filter the table to see only features from a specific cluster. This also means that you can select the feature of this cluster in a volcano or scatter plot as described in section 20.1.6.

20.6

Annotation tests

The annotation tests are tools for detecting significant patterns among features (e.g. genes) of experiments, based on their annotations. This may help in interpreting the analysis of the large numbers of features in an experiment in a biological context. Which biological context, depends on which annotation you choose to examine, and could e.g. be biological process, molecular function or pathway as specified by the Gene Ontology or KEGG. The annotation testing tools of course require that the features in the experiment you want to analyze are annotated. Learn how to annotate an experiment in section 20.1.4.

20.6.1

Hypergeometric tests on annotations

The first approach to using annotations to extract biological information is the hypergeometric annotation test. This test measures the extend to which the annotation categories of features in a smaller gene list, 'A', are over or under-represented relative to those of the features in larger gene list 'B', of which 'A' is a sub-list. Gene list B is often the features of the full experiment, possibly with features which are thought to represent only noise, filtered away. Gene list A is

CHAPTER 20. EXPRESSION ANALYSIS

608

Figure 20.49: Four clusters created by k-means/medoids clustering. a sub-experiment of the full experiment where most features have been filtered away and only those that seem of interest are kept. Typically gene list A will consist of a list of candidate differentially expressed genes. This could be the gene list obtained after carrying out a statistical analysis on the experiment, and keeping only features with FDR corrected p-values <0.05 and a fold change which is larger than 2 in absolute value. The hyper geometric test procedure implemented is similar to the unconditional GOstats test of [Falcon and Gentleman, 2007]. Toolbox | Expression Analysis ( Annotations ( ) ) | Annotation Test | Hypergeometric Tests on

This will show a dialog where you can select the two experiments - the larger experiment, e.g. the original experiment including the full list of features - and a sub-experiment (see how to create a sub-experiment in section 20.1.3). Click Next. This will display the dialog shown in figure 20.50. At the top, you select which annotation to use for testing. You can select from all the annotations available on the experiment, but it is of course only a few that are biologically relevant. Once you have selected an annotation, you will see the number of features carrying this annotation below.

CHAPTER 20. EXPRESSION ANALYSIS

609

Figure 20.50: Parameters for performing a hypergeometric test on annotations Annotations are typically given at the gene level. Often a gene is represented by more than one feature in an experiment. If this is not taken into account it may lead to a biased result. The standard way to deal with this is to reduce the set of features considered, so that each gene is represented only once. In the next step, Remove duplicates, you can choose how you want this to be done: Using gene identifier. Keep feature with: Highest IQR. The feature with the highest interquartile range (IQR) is kept. Highest value. The feature with the highest expression value is kept. First you specify which annotation you want to use as gene identifier. Once you have selected this, you will see the number of features carrying this annotation below. Next you specify which feature you want to keep for each gene. This may be either the feature with the highest inter-quartile range or the highest value. At the bottom, you can select which values to analyze (see section 20.2.1). Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. Result of hypergeometric tests on annotations The result of performing hypergeometric tests on annotations using GO biological process is shown in figure 20.51. The table shows the following information: Category. This is the identifier for the category. Description. This is the description belonging to the category. Both of these are simply extracted from the annotations. Full set. The number of features in the original experiment (not the subset) with this category. (Note that this is after removal of duplicates).

CHAPTER 20. EXPRESSION ANALYSIS

610

Figure 20.51: The result of testing on GO biological process. In subset. The number of features in the the subset with this category. (Note that this is after removal of duplicates). Expected in subset. The number of features we would have expected to find with this annotation category in the subset, if the subset was a random draw from the full set. Observed - expected. 'In subset' - 'Expected in subset' p-value. The tail probability of the hyper geometric distribution This is the value used for sorting the table. Categories with small p-values are categories that are over or under-represented on the features in the subset relative to the full set.

20.6.2

Gene set enrichment analysis

When carrying out a hypergeometric test on annotations you typically compare the annotations of the genes in a subset containing 'the significantly differentially expressed genes' to those of the total set of genes in the experiment. Which, and how many, genes are included in the subset is somewhat arbitrary - using a larger or smaller p-value cut-off will result in including more or less. Also, the magnitudes of differential expression of the genes is not considered. The Gene Set Enrichment Analysis (GSEA) does NOT take a sublist of differentially expressed genes and compare it to the full list - it takes a single gene list (a single experiment). The idea behind GSEA is to consider a measure of association between the genes and phenotype of interest (e.g. test statistic for differential expression) and rank the genes according to this measure of association. A test is then carried out for each annotation category, for whether the ranks of the genes in the category are evenly spread throughout the ranked list, or tend to occur at the top or bottom of the list. The GSEA test implemented here is that of [Tian et al., 2005]. The test implicitly calculates and uses a standard t-test statistic for two-group experiments, and ANOVA statistic for multiple group experiments for each feature, as measures of association. For each category, the test statistics for the features in than category are summed and a category based test statistic is calculated

CHAPTER 20. EXPRESSION ANALYSIS

611

as this sum divided by the square root of the number of features in the category. Note that if a feature has the value NaN in one of the samples, the t-test statistic for the feature will be NaN. Consequently, the combined statistic for each of the categories in which the feature is included will be NaN. Thus, it is advisable to filter out any feature that has a NaN value before applying GSEA. The p-values for the GSEA test statistics are calculated by permutation: The original test statistics for the features are permuted and new test statistics are calculated for each category, based on the permuted feature test statistics. This is done the number of times specified by the user in the wizard. For each category, the lower and upper tail probabilities are calculated by comparing the original category test statistics to the distribution of the permutation-based test statistics for that category. The lower and higher tail probabilities are the number of these that are lower and higher, respectively, than the observed value, divided by the number of permutations. As the p-values are based on permutations you may some times see results where category x's test statistic is lower than that of category y and the categories are of equal size, but where the lower tail probability of category x is higher than that of category y. This is due to imprecision in the estimations of the tail probabilities from the permutations. The higher the number of permutations, the more stable the estimation. You may run a GSEA on a full experiment, or on a sub-experiment where you have filtered away features that you think are un-informative and represent only noise. Typically you will remove features that are constant across samples (those for which the value in the 'Range' column is zero' --- these will have a t-test statistic of zero) and/or those for which the inter-quantile range is small. As the GSEA algorithm calculates and ranks genes on p-values from a test of differential expression, it will generally not make sense to filter the experiment on p-values produced in an analysis if differential expression, prior to running GSEA on it. Toolbox | Expression Analysis ( (GSEA) ( ) Select an experiment and click Next. Click Next. This will display the dialog shown in figure 20.52. At the top, you select which annotation to use for testing. You can select from all the annotations available on the experiment, but it is of course only a few that are biologically relevant. Once you have selected an annotation, you will see the number of features carrying this annotation below. In addition, you can set a filter: Minimum size required. Only categories with more genes (i.e. features) than the specified number will be considered. Excluding categories with small numbers of genes may lead to more robust results. Annotations are typically given at the gene level. Often a gene is represented by more than one feature in an experiment. If this is not taken into account it may lead to a biased result. The standard way to deal with this is to reduce the set of features considered, so that each gene is represented only once. Check the Remove duplicates check box to reduce the feature set, and you can choose how you want this to be done: Using gene identifier. Keep feature with: Highest IQR. The feature with the highest interquartile range (IQR) is kept. ) | Annotation Test | Gene Set Enrichment Analysis

CHAPTER 20. EXPRESSION ANALYSIS

612

Figure 20.52: Gene set enrichment analysis on GO biological process Highest value. The feature with the highest expression value is kept. First you specify which annotation you want to use as gene identifier. Once you have selected this, you will see the number of features carrying this annotation below. Next you specify which feature you want to keep for each gene. This may be either the feature with the highest inter-quartile range or the highest value. Clicking Next will display the dialog shown in figure 20.53.

Figure 20.53: Gene set enrichment analsysis parameters. At the top, you can select which values to analyze (see section 20.2.1). Below, you can set the Permutations for p-value calculation. For the GSEA test a p-value is

CHAPTER 20. EXPRESSION ANALYSIS

613

calculated by permutation: p permuted data sets are generated, each consisting of the original features, but with the test statistics permuted. The GSEA test is run on each of the permuted data sets. The test statistic is calculated on the original data, and the resulting value is compared to the distribution of the values obtained for the permuted data sets. The permutation based p-value is the number of permutation based test statistics above (or below) the value of the test statistic for the original data, divided by the number of permuted data sets. For reliable permutation-based p-value calculation a large number of permutations is required (100 is the default). Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. Result of gene set enrichment analysis The result of performing gene set enrichment analysis using GO biological process is shown in figure 20.54.

Figure 20.54: The result of gene set enrichment analysis on GO biological process. The table shows the following information: Category. This is the identifier for the category. Description. This is the description belonging to the category. Both of these are simply extracted from the annotations. Size. The number of features with this category. (Note that this is after removal of duplicates). Test statistic. This is the GSEA test statistic. Lower tail. This is the mass in the permutation based p-value distribution below the value of the test statistic. Upper tail. This is the mass in the permutation based p-value distribution above the value of the test statistic. A small lower (or upper) tail p-value for an annotation category is an indication that features in this category viewed as a whole are perturbed among the groups in the experiment considered.

CHAPTER 20. EXPRESSION ANALYSIS

614

20.7

General plots

The last folder in the Expression Analysis ( ) folder in the Toolbox is General Plots. Here you find three general plots that may be useful at various point of your analysis work flow. The plots are explained in detail below.

20.7.1

Histogram

A histogram shows a distribution of a set of values. Histograms are often used for examining and comparing distributions, e.g. of expression values of different samples, in the quality control step of an analysis. You can create a histogram showing the distribution of expression value for a sample: Toolbox | Expression Analysis ( ) | General Plots | Create Histogram ( )

Select a number of samples ( ( ) or ( )). When you have selected more than one sample, a histogram will be created for each one. Clicking Next will display a dialog as shown in figure 20.55.

Figure 20.55: Selcting which values the histogram should be based on. In this dialog, you select the values to be used for creating the histogram (see section 20.2.1). Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. Viewing histograms The resulting histogram is shown in a figure 20.56 The histogram shows the expression value on the x axis (in the case of figure 20.56 the transformed expression values) and the counts of these values on the y axis. In the Side Panel to the left, there is a number of options to adjust the view. Under Graph preferences, you can adjust the general properties of the plot. Lock axes. This will always show the axes even though the plot is zoomed to a detailed level. Frame. Shows a frame around the graph. Show legends. Shows the data legends.

CHAPTER 20. EXPRESSION ANALYSIS

615

Figure 20.56: Histogram showing the distribution of transformed expression values. Tick type. Determine whether tick lines should be shown outside or inside the frame. Outside Inside Tick lines at. Choosing Major ticks will show a grid behind the graph. None Major ticks Horizontal axis range. Sets the range of the horizontal axis (x axis). Enter a value in Min and Max, and press Enter. This will update the view. If you wait a few seconds without pressing Enter, the view will also be updated. Vertical axis range. Sets the range of the vertical axis (y axis). Enter a value in Min and Max, and press Enter. This will update the view. If you wait a few seconds without pressing Enter, the view will also be updated. Break points. Determines where the bars in the histogram should be: Sturges method. This is the default. The number of bars is calculated from the range of values by Sturges formula [Sturges, 1926]. Equi-distanced bars. This will show bars from Start to End and with a width of Sep. Number of bars. This will simply create a number of bars starting at the lowest value and ending at the highest value. Below the graph preferences, you find Line color. Allows you to choose between many different colors. Click the color box to select a color. Note that if you wish to use the same settings next time you open a principal component plot, you need to save the settings of the Side Panel (see section 5.6). Besides the histogram view itself, the histogram can also be shown in a table, summarizing key properties of the expression values. An example is shown in figure 20.57.

CHAPTER 20. EXPRESSION ANALYSIS

616

Figure 20.57: Table view of a histogram. The table lists the following properties: Number +Inf values Number -Inf values Number NaN values Number values used Total number of values

20.7.2

MA plot

The MA plot is a scatter rotated by 45 . For two samples of expression values it plots for each gene the difference in expression against the mean expression level. MA plots are often used for quality control, in particular, to assess whether normalization and/or transformation is required. You can create an MA plot comparing two samples: Toolbox | Expression Analysis ( Select two samples ( ( ) or ( ) | General Plots | Create MA Plot ( )

)). Clicking Next will display a dialog as shown in figure 20.58.

Figure 20.58: Selcting which values the MA plot should be based on. In this dialog, you select the values to be used for creating the MA plot (see section 20.2.1). Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish.

CHAPTER 20. EXPRESSION ANALYSIS Viewing MA plots The resulting plot is shown in a figure 20.59.

617

Figure 20.59: MA plot based on original expression values. The X axis shows the mean expression level of a feature on the two samples and the Y axis shows the difference in expression levels for a feature on the two samples. From the plot shown in figure 20.59 it is clear that the variance increases with the mean. With an MA plot like this, you will often choose to transform the expression values (see section 20.2.2). Figure 20.60 shows the same two samples where the MA plot has been created using log2 transformed values.

Figure 20.60: MA plot based on transformed expression values. The much more symmetric and even spread indicates that the dependance of the variance on the mean is not as strong as it was before transformation. In the Side Panel to the left, there is a number of options to adjust the view. Under Graph preferences, you can adjust the general properties of the plot. Lock axes. This will always show the axes even though the plot is zoomed to a detailed level. Frame. Shows a frame around the graph.

CHAPTER 20. EXPRESSION ANALYSIS Show legends. Shows the data legends. Tick type. Determine whether tick lines should be shown outside or inside the frame. Outside Inside Tick lines at. Choosing Major ticks will show a grid behind the graph. None Major ticks

618

Horizontal axis range. Sets the range of the horizontal axis (x axis). Enter a value in Min and Max, and press Enter. This will update the view. If you wait a few seconds without pressing Enter, the view will also be updated. Vertical axis range. Sets the range of the vertical axis (y axis). Enter a value in Min and Max, and press Enter. This will update the view. If you wait a few seconds without pressing Enter, the view will also be updated. y = 0 axis. Draws a line where y = 0. Below there are some options to control the appearance of the line: Line width Thin Medium Wide Line type None Line Long dash Short dash

Line color. Allows you to choose between many different colors. Click the color box to select a color. Line width Thin Medium Wide Line type None Line Long dash Short dash Line color. Allows you to choose between many different colors. Click the color box to select a color.

CHAPTER 20. EXPRESSION ANALYSIS

619

Below the general preferences, you find the Dot properties preferences, where you can adjust coloring and appearance of the dots: Dot type None Cross Plus Square Diamond Circle Triangle Reverse triangle Dot Dot color. Allows you to choose between many different colors. Click the color box to select a color. Note that if you wish to use the same settings next time you open a scatter plot, you need to save the settings of the Side Panel (see section 5.6).

20.7.3

Scatter plot

As described in section 20.1.5, an experiment can be viewed as a scatter plot. However, you can also create a "stand-alone" scatter plot of two samples: Toolbox | Expression Analysis ( Select two samples ( ( ) or ( ) | General Plots | Create Scatter Plot ( )

)). Clicking Next will display a dialog as shown in figure 20.61.

Figure 20.61: Selcting which values the scatter plot should be based on. In this dialog, you select the values to be used for creating the scatter plot (see section 20.2.1). Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. For more information about the scatter plot view and how to interpret it, please see section 20.1.5.

Chapter 21

Cloning and cutting

Contents
21.1 Molecular cloning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 621 21.1.1 21.1.2 21.1.3 21.1.4 21.2.1 21.2.2 21.2.3 21.3.1 21.3.2 Introduction to the cloning editor . . . . . . . . . . . . . . . . . . . . . . 622 The cloning work flow . . . . . . . . . . . . . . . . . . . . . . . . . . . . 623 Manual cloning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 626 Insert restriction site . . . . . . . . . . . . . . . . . . . . . . . . . . . . 631 Add attB sites . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 632 Create entry clones (BP) . . . . . . . . . . . . . . . . . . . . . . . . . . . 637 Create expression clones (LR) . . . . . . . . . . . . . . . . . . . . . . . 638 Dynamic restriction sites . . . . . . . . . . . . . . . . . . . . . . . . . . 639 Restriction site analysis from the Toolbox . . . . . . . . . . . . . . . . . 647

21.2 Gateway cloning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 631

21.3 Restriction site analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 639

21.4 Gel electrophoresis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 652 21.4.1 Separate fragments of sequences on gel . . . . . . . . . . . . . . . . . 653 21.4.2 21.4.3 21.5.1 21.5.2 Separate sequences on gel . . . . . . . . . . . . . . . . . . . . . . . . . 653 Gel view . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 653 Create enzyme list . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 655 View and modify enzyme list . . . . . . . . . . . . . . . . . . . . . . . . 657

21.5 Restriction enzyme lists . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 655

CLC Genomics Workbench offers graphically advanced in silico cloning and design of vectors for various purposes together with restriction enzyme analysis and functionalities for managing lists of restriction enzymes. First, after a brief introduction, restriction cloning and general vector design is explained. Next, we describe how to do Gateway Cloning 1 . Finally, the general restriction site analyses are described.
1

Gateway is a registered trademark of Invitrogen Corporation

620

CHAPTER 21. CLONING AND CUTTING

621

21.1

Molecular cloning

Molecular cloning is a very important tool in the quest to understand gene function and regulation. Through molecular cloning it is possible to study individual genes in a controlled environment. Using molecular cloning it is possible to build complete libraries of fragments of DNA inserted into appropriate cloning vectors. The in silico cloning process in CLC Genomics Workbench begins with the selection of sequences to be used: Toolbox | Cloning and Restriction Sites ( ) | Cloning ( )

This will open a dialog where you can select the sequences containing the fragments you want to clone (figure 21.1).

Figure 21.1: Selecting one or more sequences containing the fragments you want to clone. Note that the vector sequence will be selected when you click Next as shown in figure figure 21.2. Select the cloning vector by clicking the browse ( ) button. Once the sequence has been selected, click Finish. The CLC Genomics Workbench will now create a sequence list of the fragments and vector sequences and open it in the cloning editor as shown in figure 21.3. When you save the cloning experiment, it is saved as a Sequence list. See section 10.7 for more information about sequence lists. If you need to open the list later for cloning work, simply switch to the Cloning ( ) editor at the bottom of the view. If you later in the process need additional sequences, you can easily add more sequences to the

CHAPTER 21. CLONING AND CUTTING

622

Figure 21.2: Selecting a cloning vector. view. Just: right-click anywhere on the empty white area | Add Sequences

21.1.1

Introduction to the cloning editor

In the cloning editor, most of the basic options for viewing, selecting and zooming the sequences are the same as for the standard sequence view. See section 10.1 for an explanation of these options. This means that e.g. known SNP's, exons and other annotations can be displayed on the sequences to guide the choice of regions to clone. However, the cloning editor has a special layout with three distinct areas (in addition to the Side Panel found in other sequence views as well): At the top, there is a panel to switch between the sequences selected as input for the cloning. You can also specify whether the sequence should be visualized as circular or as a fragment. At the right-hand side, there is a button to the status of the sequence currently shown to vector. In the middle, the selected sequence is shown. This is the central area for defining how the cloning should be performed. This is explained in details below. At the bottom, there is a panel where the selection of fragments and target vector is performed (see elaboration below).

CHAPTER 21. CLONING AND CUTTING

623

Figure 21.3: Cloning editor. There are essentially three ways of performing cloning in the CLC Genomics Workbench. The first is the most straight-forward approach which is based on a simple model of selecting restriction sites for cutting out one or more fragments and defining how to open the vector to insert the fragments. This is described as the cloning work flow below. The second approach is unguided and more flexible and allows you to manually cut, copy, insert and replace parts of the sequences. This approach is described under manual cloning below. Finally, the CLC Genomics Workbench also supports Gateway cloning (see section 21.2).

21.1.2

The cloning work flow

The cloning work flow is designed to support restriction cloning work flows through the following steps: 1. Define one or more fragments 2. Define how the vector should be opened 3. Specify orientation and order of the fragment Defining fragments First, select the sequence containing the cloning fragment in the list at the top of the view. Next, make sure the restriction enzyme you wish to use is listed in the Side Panel (see section 21.3.1). To specify which part of the sequence should be treated as the fragment, first click one of the cut sites you wish to use. Then press and hold the Ctrl key ( on Mac) while you click the second cut site. You can also right-click the cut sites and use the Select This ... Site to select a site. When this is done, the panel below will update to reflect the selections (see figure 21.4). In this example you can see that there are now three options listed in the panel below the view.

CHAPTER 21. CLONING AND CUTTING

624

Figure 21.4: HindIII and XhoI cut sites selected to cut out fragment. This is because there are now three options for selecting the fragment that should be used for cloning. The fragment selected per default is the one that is in between the cut sites selected. If the entire sequence should be selected as fragment, click the Add Current Sequence as Fragment ( ). At any time, the selection of cut sites can be cleared by clicking the Remove ( ) icon to the right of the fragment selections. If you just wish to remove the selection of one of the sites, right-click the site on the sequence and choose De-select This ... Site. Defining target vector When selecting among the sequences in the panel at the top, the vector sequence has "vector" appended to its name. If you wish to use one of the other sequences as vector, select this sequence in the list and click Change to Current. The next step is to define where the vector should be cut. If the vector sequence should just be opened, click the restriction site you want to use for opening. If you want to cut off part of the vector, click two restriction sites while pressing the Ctrl key ( on Mac). You can also right-click the cut sites and use the Select This ... Site to select a site. This will display two options for what the target vector should be (for linear vectors there would have been three option) as shown in figure 21.5) Just as when cutting out the fragment, there is a lost of choices regarding which sequence should be used as the vector. At any time, the selection of cut sites can be cleared by clicking the Remove ( ) icon to the right of the target vector selections. If you just wish to remove the selection of one of the sites, right-click the site on the sequence and choose De-select This ... Site. When the right target vector is selected, you are ready to Perform Cloning ( Perform cloning Once selections have been made for both fragments and vector, click Perform Cloning ( ). This will display a dialog to adapt overhangs and change orientation as shown in figure 21.6) ), see below.

CHAPTER 21. CLONING AND CUTTING

625

Figure 21.5: HindIII and XhoI sites used to open the vector.

Figure 21.6: Showing the insertion point of the vector. This dialog visualizes the details of the insertion. The vector sequence is on each side shown in a faded gray color. In the middle the fragment is displayed. If the overhangs of the sequence and the vector do not match, you can blunt end or fill in the overhangs using the drag handles ( ). Click and drag with the mouse to adjust the overhangs. Whenever you drag the handles, the status of the insertion point is indicated below: The overhangs match ( ).

The overhangs do not match ( ). In this case, you will not be able to click Finish. Drag the handles to make the overhangs match. The fragment can be reverse complemented by clicking the Reverse complement fragment ( ).

When several fragments are used, the order of the fragments can be changed by clicking the move buttons ( )/ ( ). There is an options for the result of the cloning: Replace input sequences with result. Per default, the construct will be opened in a new view and can be saved separately. By selecting this option, the construct will also be added to the input sequence list and the original fragment and vector sequences will be deleted. When you click Finish the final construct will be shown (see figure 21.7). You can now Save ( ) this sequence for later use. The cloning experiment used to design the construct can be saved as well. If you check the History ( ) of the construct, you can see the details about restriction sites and fragments used for the cloning.

CHAPTER 21. CLONING AND CUTTING

626

Figure 21.7: The final construct.

21.1.3

Manual cloning

If you wish to use the manual way of cloning (as opposed to using the cloning work flow explained above in section 21.1.2), you can disregard the panel at the bottom. The manual cloning approach is based on a number of ways that you can manipulate the sequences. All manipulations of sequences are done manually, giving you full control over how the final construct is made. Manipulations are performed through right-click menus which have three different appearances depending on where you click, as visualized in figure 21.8.

Figure 21.8: The red circles mark the two places you can use for manipulating the sequences. Right-click the sequence name (to the left) to manipulate the whole sequence. Right-click a selection to manipulate the selection. The two menus are described in the following: Manipulate the whole sequence Right-clicking the sequence name at the left side of the view reveals several options on sorting, opening and editing the sequences in the view (see figure 21.9).

CHAPTER 21. CLONING AND CUTTING

627

Figure 21.9: Right click on the sequence in the cloning view. Open sequence in circular view ( ) Opens the sequence in a new circular view. If the sequence is not circular, you will be asked if you wish to make it circular or not. (This will not forge ends with matching overhangs together - use "Make Sequence Circular" ( ) instead.) Duplicate sequence Adds a duplicate of the selected sequence. The new sequence will be added to the list of sequences shown on the screen. Insert sequence after this sequence ( ) Insert another sequence after this sequence. The sequence to be inserted can be selected from a list which contains the sequences present in the cloning editor. The inserted sequence remains on the list of sequences. If the two sequences do not have blunt ends, the ends' overhangs have to match each other. Otherwise a warning is displayed. Insert sequence before this sequence ( ) Insert another sequence before this sequence. The sequence to be inserted can be selected from a list which contains the sequences present in the cloning editor. The inserted sequence remains on the list of sequences. If the two sequences do not have blunt ends, the ends' overhangs have to match each other. Otherwise a warning is displayed. Reverse sequence Reverse the sequence and replaces the original sequence in the list. This is sometimes useful when working with single stranded sequences. Note that this is not the same as creating the reverse complement (see the following item in the list). Reverse complement sequence ( ) Creates the reverse complement of a sequence and replaces the original sequence in the list. This is useful if the vector and the insert sequences are not oriented the same way. Digest Sequence with Selected Enzymes and Run on Gel ( See section 21.4.1 )

CHAPTER 21. CLONING AND CUTTING Rename sequence Renames the sequence. Select sequence This will select the entire sequence. Delete sequence ( ) This deletes the given sequence from the cloning editor. Open copy of sequencew ( ) This will open a copy of the selected sequence in a normal sequence view. Open this sequence ( ) This will open the selected sequence in a normal sequence view.

628

Make sequence circular ( ) This will convert a sequence from a linear to a circular form. If the sequence have matching overhangs at the ends, they will be merged together. If the sequence have incompatible overhangs, a dialog is displayed, and the sequence cannot be made circular. The circular form is represented by >> and << at the ends of the sequence. Make sequence linear ( ) This will convert a sequence from a circular to a linear form, removing the << and >> at the ends. Manipulate parts of the sequence Right-clicking a selection reveals several options on manipulating the selection (see figure 21.10).

Figure 21.10: Right click on a sequence selection in the cloning view.

CHAPTER 21. CLONING AND CUTTING

629

Replace Selection with sequence. This will replace the selected region with a sequence. The sequence to be inserted can be selected from a list containing all sequences in the cloning editor. Insert Sequence before Selection ( ). Insert a sequence before the selected region. The sequence to be inserted can be selected from a list containing all sequences in the cloning editor. Insert Sequence after Selection ( ). Insert a sequence after the selected region. The sequence to be inserted can be selected from a list containing all sequences in the cloning editor. Cut Sequence before Selection ( ). This will cleave the sequence before the selection and will result in two smaller fragments. Cut Sequence after Selection ( ). This will cleave the sequence after the selection and will result in two smaller fragments. Make Positive Strand Single Stranded ( selected region single stranded. Make Negative Strand Single Stranded ( selected region single stranded. Make Double Stranded ( ). This will make the positive strand of the ). This will make the negative strand of the

). This will make the selected region double stranded.

Move Starting Point to Selection Start. This is only active for circular sequences. It will move the starting point of the sequence to the beginning of the selection. Copy Selection ( ). This will copy the selected region to the clipboard, which will enable it for use in other programs. Duplicate Selection. If a selection on the sequence is duplicated, the selected region will be added as a new sequence to the cloning editor with a new sequence name representing the length of the fragment. When a sequence region between two restriction sites are double-clicked the entire region will automatically be selected. This makes it very easy to make a new sequence from a fragment created by cutting with two restriction sites (right-click the selection and choose Duplicate selection). Open Selection in New View ( sequence view. Edit Selection ( residues. Delete Selection ( Add Annotation ( ). This will open the selected region in the normal

). This will open a dialog box, in which is it possible to edit the selected ). This will delete the selected region of the sequence. ). This will open the Add annotation dialog box. ). This will add enzymes cutting this selection to

Show Enzymes Only Cutting Selection ( the Side Panel.

Insert Restriction Sites before/after Selection. This will show a dialog where you can choose from a list restriction enzymes (see section 21.1.4).

CHAPTER 21. CLONING AND CUTTING Insert one sequence into another

630

Sequences can be inserted into each other in several ways as described in the lists above. When you chose to insert one sequence into another you will be presented with a dialog where all sequences in the view are present (see figure 21.11).

Figure 21.11: Select a sequence for insertion. The sequence that you have chosen to insert into will be marked with bold and the text [vector] is appended to the sequence name. Note that this is completely unrelated to the vector concept in the cloning work flow described in section 21.1.2. The list furthermore includes the length of the fragment, an indication of the overhangs, and a list of enzymes that are compatible with this overhang (for the left and right ends, respectively). If not all the enzymes can be shown, place your mouse cursor on the enzymes, and a full list will be shown in the tool tip. Select the sequence you wish to insert and click Next. This will show the dialog in figure 21.12).

Figure 21.12: Drag the handles to adjust overhangs. At the top is a button to reverse complement the inserted sequence. Below is a visualization of the insertion details. The inserted sequence is at the middle shown in red, and the vector has been split at the insertion point and the ends are shown at each side of the inserted sequence.

CHAPTER 21. CLONING AND CUTTING

631

If the overhangs of the sequence and the vector do not match, you can blunt end or fill in the overhangs using the drag handles ( ). Whenever you drag the handles, the status of the insertion point is indicated below: The overhangs match ( ).

The overhangs do not match ( ). In this case, you will not be able to click Finish. Drag the handles to make the overhangs match. At the bottom of the dialog is a summary field which records all the changes made to the overhangs. This contents of the summary will also be written in the history ( ) when you click Finish. When you click Finish and the sequence is inserted, it will be marked with a selection.

Figure 21.13: One sequence is now inserted into the cloning vector. The sequence inserted is automatically selected.

21.1.4

Insert restriction site

If you make a selection on the sequence, right-click, you find this option for inserting the recognition sequence of a restriction enzyme before or after the region you selected. This will display a dialog as shown in figure 21.14 At the top, you can select an existing enzyme list or you can use the full list of enzymes (default). Select an enzyme, and you will see its recognition sequence in the text field below the list (AAGCTT). If you wish to insert additional residues such as tags etc., this can be typed into the text fields adjacent to the recognition sequence. . Click OK will insert the sequence before or after the selection. If the enzyme selected was not already present in the list in the Side Panel, it will now be added and selected. Furthermore, an restriction site annotation is added.

21.2

Gateway cloning

CLC Genomics Workbench offers tools to perform in silico Gateway cloning2 . Multi-site Gateway cloning is not supported. The three tools for doing Gateway cloning in the CLC Genomics Workbench mimic the procedure followed in the lab:
2

Gateway is a registered trademark of Invitrogen Corporation

CHAPTER 21. CLONING AND CUTTING

632

Figure 21.14: Inserting the HindIII recognition sequence. First, attB sites are added to a sequence fragment Second, the attB-flanked fragment is recombined into a donor vector (the BP reaction) to construct an entry clone Finally, the target fragment from the entry clone is recombined into an expression vector (the LR reaction) to construct an expression clone During this process, both the attB-flanked fragment and the entry clone can be saved. For more information about the Gateway technology, please visit http://www.invitrogen.com/
site/us/en/home/Products-and-Services/Applications/Cloning/Gateway-Cloning.html

To perform these analyses in the CLC Genomics Workbench, you need to import donor and expression vectors. These can be downloaded from Invitrogen's web site and directly imported into the Workbench: http://tools.invitrogen.com/downloads/Gateway%20vectors.ma4

21.2.1

Add attB sites

The first step in the Gateway cloning process is to amplify the target sequence with primers including so-called attB sites. In the CLC Genomics Workbench, you can add attB sites to a sequence fragment in this way: Toolbox in the Menu Bar | Cloning and Restriction Sites ( ( ) | Add attB Sites ( ) ) | Gateway Cloning

This will open a dialog where you can select on ore more sequences. Note that if your fragment is part of a longer sequence, you need to extract it first. This can be done in two ways: If the fragment is covered by an annotation (if you want to use e.g. a CDS), simply right-click the annotation and Open Annotation in New View Otherwise you can simply make a selection on the sequence, right-click and Open Selection in New View

CHAPTER 21. CLONING AND CUTTING

633

In both cases, the selected part of the sequence will be copied and opened as a new sequence which can be Saved ( ). When you have selected your fragment(s), click Next. This will give you options to extend the fragment with additional sequences by extending the primers 5' of the template-specific part of the primer (i.e. between the template specific part and the attB sites). See an example of this in figure 21.20 where a Shine-Dalgarno site has been added between the attB site and the gene of interest.

Figure 21.15: Primer additions 5' of the template-specific part of the primer. At the top of the dialog (see figure 21.15), you can specify primer additions such as a ShineDalgarno site, start codon etc. Click in the text field and press Shift + F1 to show some of the most common additions (see figure 21.16). Use the up and down arrow keys to select a tag and press Enter. This will insert the selected sequence as shown in figure 21.17. At the bottom of the dialog, you can see a preview of what the final PCR product will look like. In the middle there is the sequence of interest (i.e. the sequence you selected as input). In the beginning is the attB1 site, and at the end is the attB2 site. The primer additions that you have inserted are shown in colors (like the green Shine-Dalgarno site in figure 21.17). This default list of primer additions can be modified, see section 21.2.1. You can also manually type a sequence with the keyboard or paste in a sequence from the clipboard by pressing Ctrl + v ( + v on Mac). Clicking Next allows you to specify the length of the template-specific part of the primers as shown in figure 21.18. The CLC Genomics Workbench is not doing any kind of primer design when adding the attB sites. As a user, you simply specify the length of the template-specific part of the primer, and together with the attB sites and optional primer additions, this will be the primer. The primer region will be annotated in the resulting attB-flanked sequence and you can also get a list of primers as you

CHAPTER 21. CLONING AND CUTTING

634

Figure 21.16: Pressing Shift + F1 shows some of the common additions. This default list can be modified, see section 21.2.1.

Figure 21.17: A Shine-Dalgarno sequence has been inserted. can see when clicking Next (see figure 21.19. Besides the main output which is a copy of the the input sequence(s) now including attB sites and primer additions, you can get a list of primers as output. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. The attB sites, the primer additions and the primer regions are annotated in the final result as shown in figure 21.20. There will be one output sequence for each sequence you have selected for adding attB sites. Save ( ) the resulting sequence as it will be the input to the next part of the Gateway cloning work flow (see section 21.2.2). When you open the sequence again, you may need to switch on the relevant annotation types to show the sites and primer additions as illustrated in figure

CHAPTER 21. CLONING AND CUTTING

635

Figure 21.18: Specifying the length of the template-specific part of the primers.

Figure 21.19: Besides the main output which is a copy of the the input sequence(s) now including attB sites and primer additions, you can get a list of primers as output. 21.20. Extending the pre-defined list of primer additions The list of primer additions shown when pressing Shift+F1 in the dialog shown in figure 21.15 can be configured and extended. If there is a tag that you use a lot, you can add it to the list for convenient and easy access later on. This is done in the Preferences: Edit | Preferences | Advanced In the advanced preferences dialog, scroll to the part called Gateway cloning primer additions (see figure 21.21).

CHAPTER 21. CLONING AND CUTTING

636

Figure 21.20: the attB site plus the Shine-Dalgarno primer addition is annotated.

Figure 21.21: Configuring the list of primer additions available when adding attB sites. Each element in the list has the following information: Name The name of the sequence. When the sequence fragment is extended with a primer addition, an annotation will be added displaying this name. Sequence The actual sequence to be inserted. The sequence is always defined on the sense strand (although the reverse primer would be reverse complement). Annotation type The annotation type used for the annotation that is added to the fragment. Forward primer addition Whether this addition should be visible in the list of additions for the forward primer. Reverse primer addition Whether this addition should be visible in the list of additions for the reverse primer.

CHAPTER 21. CLONING AND CUTTING

637

You can either change the existing elements in the table by double-clicking any of the cells, or you can use the buttons below to: Add Row or Delete Row. If you by accident have deleted or modified some of the default primer additions, you can press Add Default Rows. Note that this will not reset the table but only add all the default rows to the existing rows.

21.2.2

Create entry clones (BP)

The next step in the Gateway cloning work flow is to recombine the attB-flanked sequence of interest into a donor vector to create an entry clone, the so-called BP reaction: Toolbox in the Menu Bar | Cloning and Restriction Sites ( ( ) | Create Entry Clone (BP) ( ) ) | Gateway Cloning

This will open a dialog where you can select on ore more sequences that will be the sequence of interest to be recombined into your donor vector. Note that the sequences you select should be flanked with attB sites (see section 21.2.1). You can select more than one sequence as input, and the corresponding number of entry clones will be created. When you have selected your sequence(s), click Next. This will display the dialog shown in figure 21.22.

Figure 21.22: Selecting one or more donor vectors. Clicking the Browse ( ) button opens a dialog where you can select a donor vector. You can download donor vectors from Invitrogen's web site: http://tools.invitrogen.com/ downloads/Gateway%20vectors.ma4 and import into the CLC Genomics Workbench. Note that the Workbench looks for the specific sequences of the attP sites in the sequences that you select in this dialog (see how to change the definition of sites in section G). Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. The output is one entry clone per sequence selected. The attB and attP sites have been used for the recombination, and the entry clone is now equipped with attL sites as shown in figure 21.23.

CHAPTER 21. CLONING AND CUTTING

638

Figure 21.23: The resulting entry vector opened in a circular view. Note that the bi-product of the recombination is not part of the output.

21.2.3

Create expression clones (LR)

The final step in the Gateway cloning work flow is to recombine the entry clone into a donor vector to create an expression clone, the so-called LR reaction: Toolbox in the Menu Bar | Cloning and Restriction Sites ( ( ) | Create Expression Clone (LR) ( ) ) | Gateway Cloning

This will open a dialog where you can select on ore more entry clones (see how to create an entry clone in section 21.2.2). Note that the entry clone sequences you select should contain attL sites (see how to change the definition of sites in section G). You can select more than one entry clone as input, and the corresponding number of expression clones will be created. When you have selected your entry clone(s), click Next. This will display the dialog shown in figure 21.24.

Figure 21.24: Selecting one or more destination vectors.

CHAPTER 21. CLONING AND CUTTING

639

Clicking the Browse ( ) button opens a dialog where you can select a destination vector. You can download donor vectors from Invitrogen's web site: http://tools.invitrogen.com/ downloads/Gateway%20vectors.ma4 and import into the CLC Genomics Workbench. Note that the Workbench looks for the specific sequences of the attR sites in the sequences that you select in this dialog (see how to change the definition of sites in section G). Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. The output is a number of expression clones depending on how many entry clones and destination vectors that you selected. The attL and attR sites have been used for the recombination, and the expression clone is now equipped with attB sites as shown in figure 21.25.

Figure 21.25: The resulting expression clone opened in a circular view. Note that the bi-product of the recombination is not part of the output.

21.3

Restriction site analysis

There are two ways of finding and showing restriction sites: In many cases, the dynamic restriction sites found in the Side Panel of sequence views will be useful, since it is a quick and easy way of showing restriction sites. In the Toolbox you will find the other way of doing restriction site analyses. This way provides more control of the analysis and gives you more output options, e.g. a table of restriction sites and you can perform the same restriction map analysis on several sequences in one step. This chapter first describes the dynamic restriction sites, followed by "the toolbox way". This section also includes an explanation of how to simulate a gel with the selected enzymes. The final section in this chapter focuses on enzyme lists which represent an easy way of managing restriction enzymes.

21.3.1

Dynamic restriction sites

If you open a sequence, a sequence list etc, you will find the Restriction Sites group in the Side Panel.

CHAPTER 21. CLONING AND CUTTING

640

As shown in figure 21.26 you can display restriction sites as colored triangles and lines on the sequence. The Restriction sites group in the side panel shows a list of enzymes, represented by different colors corresponding to the colors of the triangles on the sequence. By selecting or deselecting the enzymes in the list, you can specify which enzymes' restriction sites should be displayed.

Figure 21.26: Showing restriction sites of ten restriction enzymes. The color of the restriction enzyme can be changed by clicking the colored box next to the enzyme's name. The name of the enzyme can also be shown next to the restriction site by selecting Show name flags above the list of restriction enzymes. There is also an option to specify how the Labels shown be shown: No labels. This will just display the cut site with no information about the name of the enzyme. Placing the mouse button on the cut site will reveal this information as a tool tip. Flag. This will place a flag just above the sequence with the enzyme name (see an example in figure 21.27). Note that this option will make it hard to see when several cut sites are located close to each other. In the circular view, this option is replaced by the Radial option: Radial. This option is only available in the circular view. It will place the restriction site labels as close to the cut site as possible (see an example in figure 21.29). Stacked. This is similar to the flag option for linear sequence views, but it will stack the labels so that all enzymes are shown. For circular views, it will align all the labels on each side of the circle. This can be useful for clearly seeing the order of the cut sites when they are located closely together (see an example in figure 21.28). Note that in a circular view, the Stacked and Radial options also affect the layout of annotations.

CHAPTER 21. CLONING AND CUTTING

641

Figure 21.27: Restriction site labels shown as flags.

Figure 21.28: Restriction site labels stacked.

Figure 21.29: Restriction site labels in radial layout. Sort enzymes Just above the list of enzymes there are three buttons to be used for sorting the list (see figure 21.30): Figure 21.30: Buttons to sort restriction enzymes. Sort enzymes alphabetically ( alphabetically. ). Clicking this button will sort the list of enzymes ). This will divide the enzymes into four

Sort enzymes by number of restriction sites ( groups: Non-cutters. Single cutters. Double cutters. Multiple cutters.

There is a checkbox for each group which can be used to hide / show all the enzymes in a group. Sort enzymes by overhang ( ). This will divide the enzymes into three groups:

Blunt. Enzymes cutting both strands at the same position. 3'. Enzymes producing an overhang at the 3' end. 5'. Enzymes producing an overhang at the 5' end. There is a checkbox for each group which can be used to hide / show all the enzymes in a group.

CHAPTER 21. CLONING AND CUTTING Manage enzymes

642

The list of restriction enzymes contains per default 20 of the most popular enzymes, but you can easily modify this list and add more enzymes by clicking the Manage enzymes button. This will display the dialog shown in figure 21.31.

Figure 21.31: Adding or removing enzymes from the Side Panel. At the top, you can choose to Use existing enzyme list. Clicking this option lets you select an enzyme list which is stored in the Navigation Area. See section 21.5 for more about creating and modifying enzyme lists. Below there are two panels: To the left, you see all the enzymes that are in the list select above. If you have not chosen to use an existing enzyme list, this panel shows all the enzymes available 3 . To the right, there is a list of the enzymes that will be used. Select enzymes in the left side panel and add them to the right panel by double-clicking or clicking the Add button ( ). If you e.g. wish to use EcoRV and BamHI, select these two enzymes and add them to the right side panel. If you wish to use all the enzymes in the list: Click in the panel to the left | press Ctrl + A ( + A on Mac) | Add ( )

The enzymes can be sorted by clicking the column headings, i.e. Name, Overhang, Methylation or Popularity. This is particularly useful if you wish to use enzymes which produce e.g. a 3' overhang. In this case, you can sort the list by clicking the Overhang column heading, and all the enzymes producing 3' overhangs will be listed together for easy selection. When looking for a specific enzyme, it is easier to use the Filter. If you wish to find e.g. HindIII sites, simply type HindIII into the filter, and the list of enzymes will shrink automatically to only include the HindIII enzyme. This can also be used to only show enzymes producing e.g. a 3' overhang as shown in figure 21.50.
3 The CLC Genomics Workbench comes with a standard set of enzymes based on http://www.rebase.neb.com. You can customize the enzyme database for your installation, see section F

CHAPTER 21. CLONING AND CUTTING

643

Figure 21.32: Selecting enzymes. If you need more detailed information and filtering of the enzymes, either place your mouse cursor on an enzyme for one second to display additional information (see figure 21.51), or use the view of enzyme lists (see 21.5).

Figure 21.33: Showing additional information about an enzyme like recognition sequence or a list of commercial vendors. At the bottom of the dialog, you can select to save this list of enzymes as a new file. In this way, you can save the selection of enzymes for later use. When you click Finish, the enzymes are added to the Side Panel and the cut sites are shown on the sequence. If you have specified a set of enzymes which you always use, it will probably be a good idea to save the settings in the Side Panel (see section 3.2.7) for future use. Show enzymes cutting inside/outside selection Section 21.3.1 describes how to add more enzymes to the list in the Side Panel based on the name of the enzyme, overhang, methylation sensitivity etc. However, you will often find yourself in a situation where you need a more sophisticated and explorative approach. An illustrative example: you have a selection on a sequence, and you wish to find enzymes cutting within the selection, but not outside. This problem often arises during design of cloning experiments. In this case, you do not know the name of the enzyme, so you want the Workbench to find the enzymes for you:

CHAPTER 21. CLONING AND CUTTING right-click the selection | Show Enzymes Cutting Inside/Outside Selection ( )

644

This will display the dialog shown in figure 21.34 where you can specify which enzymes should initially be considered.

Figure 21.34: Choosing enzymes to be considered. At the top, you can choose to Use existing enzyme list. Clicking this option lets you select an enzyme list which is stored in the Navigation Area. See section 21.5 for more about creating and modifying enzyme lists. Below there are two panels: To the left, you see all the enzymes that are in the list select above. If you have not chosen to use an existing enzyme list, this panel shows all the enzymes available 4 . To the right, there is a list of the enzymes that will be used. Select enzymes in the left side panel and add them to the right panel by double-clicking or clicking the Add button ( ). If you e.g. wish to use EcoRV and BamHI, select these two enzymes and add them to the right side panel. If you wish to use all the enzymes in the list: Click in the panel to the left | press Ctrl + A ( + A on Mac) | Add ( )

The enzymes can be sorted by clicking the column headings, i.e. Name, Overhang, Methylation or Popularity. This is particularly useful if you wish to use enzymes which produce e.g. a 3' overhang. In this case, you can sort the list by clicking the Overhang column heading, and all the enzymes producing 3' overhangs will be listed together for easy selection. When looking for a specific enzyme, it is easier to use the Filter. If you wish to find e.g. HindIII sites, simply type HindIII into the filter, and the list of enzymes will shrink automatically to only include the HindIII enzyme. This can also be used to only show enzymes producing e.g. a 3' overhang as shown in figure 21.50.
The CLC Genomics Workbench comes with a standard set of enzymes based on http://www.rebase.neb.com. You can customize the enzyme database for your installation, see section F
4

CHAPTER 21. CLONING AND CUTTING

645

Figure 21.35: Selecting enzymes. If you need more detailed information and filtering of the enzymes, either place your mouse cursor on an enzyme for one second to display additional information (see figure 21.51), or use the view of enzyme lists (see 21.5).

Figure 21.36: Showing additional information about an enzyme like recognition sequence or a list of commercial vendors. Clicking Next will show the dialog in figure 21.37.

Figure 21.37: Deciding number of cut sites inside and outside the selection. At the top of the dialog, you see the selected region, and below are two panels:

CHAPTER 21. CLONING AND CUTTING

646

Inside selection. Specify how many times you wish the enzyme to cut inside the selection. In the example described above, "One cut site (1)" should be selected to only show enzymes cutting once in the selection. Outside selection. Specify how many times you wish the enzyme to cut outside the selection (i.e. the rest of the sequence). In the example above, "No cut sites (0)" should be selected. These panels offer a lot of flexibility for combining number of cut sites inside and outside the selection, respectively. To give a hint of how many enzymes will be added based on the combination of cut sites, the preview panel at the bottom lists the enzymes which will be added when you click Finish. Note that this list is dynamically updated when you change the number of cut sites. The enzymes shown in brackets [] are enzymes which are already present in the Side Panel. If you have selected more than one region on the sequence (using Ctrl or ), they will be treated as individual regions. This means that the criteria for cut sites apply to each region. Show enzymes with compatible ends Besides what is described above, there is a third way of adding enzymes to the Side Panel and thereby displaying them on the sequence. It is based on the overhang produced by cutting with an enzyme and will find enzymes producing a compatible overhang: right-click the restriction site | Show Enzymes with Compatible Ends ( This will display the dialog shown in figure 21.38. )

Figure 21.38: Enzymes with compatible ends. At the top you can choose whether the enzymes considered should have an exact match or not. Since a number of restriction enzymes have ambiguous cut patterns, there will be variations in the resulting overhangs. Choosing All matches, you cannot be 100% sure that the overhang will match, and you will need to inspect the sequence further afterwards. We advice trying Exact match first, and use All matches as an alternative if a satisfactory result cannot be achieved.

CHAPTER 21. CLONING AND CUTTING

647

At the bottom of the dialog, the list of enzymes producing compatible overhangs is shown. Use the arrows to add enzymes which will be displayed on the sequence which you press Finish. When you have added the relevant enzymes, click Finish, and the enzymes will be added to the Side Panel and their cut sites displayed on the sequence.

21.3.2

Restriction site analysis from the Toolbox

Besides the dynamic restriction sites, you can do a more elaborate restriction map analysis with more output format using the Toolbox: Toolbox | Cloning and Restriction Sites ( This will display the dialog shown in figure 21.39. ) | Restriction Site Analysis ( )

Figure 21.39: Choosing sequence ATP8a1 mRNA for restriction map analysis. If a sequence was selected before choosing the Toolbox action, this sequence is now listed in the Selected Elements window of the dialog. Use the arrows to add or remove sequences or sequence lists from the selected elements. Selecting, sorting and filtering enzymes Clicking Next lets you define which enzymes to use as basis for finding restriction sites on the sequence. At the top, you can choose to Use existing enzyme list. Clicking this option lets you select an enzyme list which is stored in the Navigation Area. See section 21.5 for more about creating and modifying enzyme lists. Below there are two panels: To the left, you see all the enzymes that are in the list select above. If you have not chosen to use an existing enzyme list, this panel shows all the enzymes available 5 . To the right, there is a list of the enzymes that will be used.
The CLC Genomics Workbench comes with a standard set of enzymes based on http://www.rebase.neb.com. You can customize the enzyme database for your installation, see section F
5

CHAPTER 21. CLONING AND CUTTING

648

Select enzymes in the left side panel and add them to the right panel by double-clicking or clicking the Add button ( ). If you e.g. wish to use EcoRV and BamHI, select these two enzymes and add them to the right side panel. If you wish to use all the enzymes in the list: Click in the panel to the left | press Ctrl + A ( + A on Mac) | Add ( )

The enzymes can be sorted by clicking the column headings, i.e. Name, Overhang, Methylation or Popularity. This is particularly useful if you wish to use enzymes which produce e.g. a 3' overhang. In this case, you can sort the list by clicking the Overhang column heading, and all the enzymes producing 3' overhangs will be listed together for easy selection. When looking for a specific enzyme, it is easier to use the Filter. If you wish to find e.g. HindIII sites, simply type HindIII into the filter, and the list of enzymes will shrink automatically to only include the HindIII enzyme. This can also be used to only show enzymes producing e.g. a 3' overhang as shown in figure 21.50.

Figure 21.40: Selecting enzymes. If you need more detailed information and filtering of the enzymes, either place your mouse cursor on an enzyme for one second to display additional information (see figure 21.51), or use the view of enzyme lists (see 21.5).

Figure 21.41: Showing additional information about an enzyme like recognition sequence or a list of commercial vendors.

CHAPTER 21. CLONING AND CUTTING Number of cut sites

649

Clicking Next confirms the list of enzymes which will be included in the analysis, and takes you to the dialog shown in figure 21.42.

Figure 21.42: Selecting number of cut sites. If you wish the output of the restriction map analysis only to include restriction enzymes which cut the sequence a specific number of times, use the checkboxes in this dialog: No restriction site (0) One restriction site (1) Two restriction sites (2) Three restriction site (3) N restriction sites Minimum Maximum Any number of restriction sites > 0 The default setting is to include the enzymes which cut the sequence one or two times. You can use the checkboxes to perform very specific searches for restriction sites: e.g. if you wish to find enzymes which do not cut the sequence, or enzymes cutting exactly twice. Output of restriction map analysis Clicking next shows the dialog in figure 21.43. This dialog lets you specify how the result of the restriction map analysis should be presented: Add restriction sites as annotations to sequence(s). This option makes it possible to see the restriction sites on the sequence (see figure 21.44) and save the annotations for later use.

CHAPTER 21. CLONING AND CUTTING

650

Figure 21.43: Choosing to add restriction sites as annotations or creating a restriction map. Create restriction map. When a restriction map is created, it can be shown in three different ways: As a table of restriction sites as shown in figure 21.45. If more than one sequence were selected, the table will include the restriction sites of all the sequences. This makes it easy to compare the result of the restriction map analysis for two sequences. As a table of fragments which shows the sequence fragments that would be the result of cutting the sequence with the selected enzymes (see figure21.46). As a virtual gel simulation which shows the fragments as bands on a gel (see figure 21.48). For more information about gel electrophoresis, see section 21.4. The following sections will describe these output formats in more detail. In order to complete the analysis click Finish (see section 9.2 for information about the Save and Open options). Restriction sites as annotation on the sequence If you chose to add the restriction sites as annotation to the sequence, the result will be similar to the sequence shown in figure 21.44. See section 10.3 for more information about viewing

Figure 21.44: The result of the restriction analysis shown as annotations. annotations. Table of restriction sites The restriction map can be shown as a table of restriction sites (see figure 21.45). Each row in the table represents a restriction enzyme. The following information is available for each enzyme:

CHAPTER 21. CLONING AND CUTTING

651

Figure 21.45: The result of the restriction analysis shown as annotations. Sequence. The name of the sequence which is relevant if you have performed restriction map analysis on more than one sequence. Name. The name of the enzyme. Pattern. The recognition sequence of the enzyme. Overhang. The overhang produced by cutting with the enzyme (3', 5' or Blunt). Number of cut sites. Cut position(s). The position of each cut. , If the enzyme cuts more than once, the positions are separated by commas. [] If the enzyme's recognition sequence is on the negative strand, the cut position is put in brackets (as the enzyme TsoI in figure 21.45 whose cut position is [134]). () Some enzymes cut the sequence twice for each recognition site, and in this case the two cut positions are surrounded by parentheses. Table of restriction fragments The restriction map can be shown as a table of fragments produced by cutting the sequence with the enzymes: Click the Fragments button ( ) at the bottom of the view

The table is shown in see figure 21.46. Each row in the table represents a fragment. If more than one enzyme cuts in the same region, or if an enzyme's recognition site is cut by another enzyme, there will be a fragment for each of the possible cut combinations 6 . The following information is available for each fragment. Sequence. The name of the sequence which is relevant if you have performed restriction map analysis on more than one sequence. Length. The length of the fragment. If there are overhangs of the fragment, these are included in the length (both 3' and 5' overhangs). Region. The fragment's region on the original sequence.
6

Furthermore, if this is the case, you will see the names of the other enzymes in the Conflicting Enzymes column

CHAPTER 21. CLONING AND CUTTING

652

Figure 21.46: The result of the restriction analysis shown as annotations. Overhangs. If there is an overhang, this is displayed with an abbreviated version of the fragment and its overhangs. The two rows of dots (.) represent the two strands of the fragment and the overhang is visualized on each side of the dots with the residue(s) that make up the overhang. If there are only the two rows of dots, it means that there is no overhang. Left end. The enzyme that cuts the fragment to the left (5' end). Right end. The enzyme that cuts the fragment to the right (3' end). Conflicting enzymes. If more than one enzyme cuts at the same position, or if an enzyme's recognition site is cut by another enzyme, a fragment is displayed for each possible combination of cuts. At the same time, this column will display the enzymes that are in conflict. If there are conflicting enzymes, they will be colored red to alert the user. If the same experiment were performed in the lab, conflicting enzymes could lead to wrong results. For this reason, this functionality is useful to simulate digestions with complex combinations of restriction enzymes. If views of both the fragment table and the sequence are open, clicking in the fragment table will select the corresponding region on the sequence. Gel The restriction map can also be shown as a gel. This is described in section 21.4.1.

21.4

Gel electrophoresis

CLC Genomics Workbench enables the user to simulate the separation of nucleotide sequences on a gel. This feature is useful when e.g. designing an experiment which will allow the differentiation

CHAPTER 21. CLONING AND CUTTING of a successful and an unsuccessful cloning experiment on the basis of a restriction map. There are two main ways to simulate gel separation of nucleotide sequences:

653

One or more sequences can be digested with restriction enzymes and the resulting fragments can be separated on a gel. A number of existing sequences can be separated on a gel. There are several ways to apply these functionalities as described below.

21.4.1

Separate fragments of sequences on gel

This section explains how to simulate a gel electrophoresis of one or more sequences which are digested with restriction enzymes. There are two ways to do this: When performing the Restriction Site Analysis from the Toolbox, you can choose to create a restriction map which can be shown as a gel. This is explained in section 21.3.2. From all the graphical views of sequences, you can right-click the name of the sequence and choose: Digest Sequence with Selected Enzymes and Run on Gel ( ). The views where this option is available are listed below: Circular view (see section 10.2). Ordinary sequence view (see section 10.1). Graphical view of sequence lists (see section 10.7). Cloning editor (see section 21.1). Primer designer (see section 17.3). Furthermore, you can also right-click an empty part of the view of the graphical view of sequence lists and the cloning editor and choose Digest All Sequences with Selected Enzymes and Run on Gel. Note! When using the right-click options, the sequence will be digested with the enzymes that are selected in the Side Panel. This is explained in section 10.1.2. The view of the gel is explained in section 21.4.3

21.4.2

Separate sequences on gel

To separate sequences without restriction enzyme digestion, first create a sequence list of the sequences in question (see section 10.7). Then click the Gel button ( ) at the bottom of the view of the sequence list. For more information about the view of the gel, see the next section.

21.4.3

Gel view

In figure 21.48 you can see a simulation of a gel with its Side Panel to the right. This view will be explained in this section.

CHAPTER 21. CLONING AND CUTTING

654

Figure 21.47: A sequence list shown as a gel.

Figure 21.48: Five lanes showing fragments of five sequences cut with restriction enzymes. Information on bands / fragments You can get information about the individual bands by hovering the mouse cursor on the band of interest. This will display a tool tip with the following information: Fragment length Fragment region on the original sequence Enzymes cutting at the left and right ends, respectively

CHAPTER 21. CLONING AND CUTTING

655

For gels comparing whole sequences, you will see the sequence name and the length of the sequence. Note! You have to be in Selection ( ) or Pan ( ) mode in order to get this information.

It can be useful to add markers to the gel which enables you to compare the sizes of the bands. This is done by clicking Show marker ladder in the Side Panel. Markers can be entered into the text field, separated by commas. Modifying the layout The background of the lane and the colors of the bands can be changed in the Side Panel. Click the colored box to display a dialog for picking a color. The slider Scale band spread can be used to adjust the effective time of separation on the gel, i.e. how much the bands will be spread over the lane. In a real electrophoresis experiment this property will be determined by several factors including time of separation, voltage and gel density. You can also choose how many lanes should be displayed: Sequences in separate lanes. This simulates that a gel is run for each sequence. All sequences in one lane. This simulates that one gel is run for all sequences. You can also modify the layout of the view by zooming in or out. Click Zoom in ( ( ) in the Toolbar and click the view. ) or Zoom out

Finally, you can modify the format of the text heading each lane in the Text format preferences in the Side Panel.

21.5

Restriction enzyme lists

CLC Genomics Workbench includes all the restriction enzymes available in the REBASE database7 . However, when performing restriction site analyses, it is often an advantage to use a customized list of enzymes. In this case, the user can create special lists containing e.g. all enzymes available in the laboratory freezer, all enzymes used to create a given restriction map or all enzymes that are available form the preferred vendor. In the example data (see section 1.6.2) under Nucleotide->Restriction analysis, there are two enzyme lists: one with the 50 most popular enzymes, and another with all enzymes that are included in the CLC Genomics Workbench. This section describes how you can create an enzyme list, and how you can modify it.

21.5.1

Create enzyme list

CLC Genomics Workbench uses enzymes from the REBASE restriction enzyme database at http://rebase.neb.com8 . To create an enzyme list of a subset of these enzymes:
7 8

You can customize the enzyme database for your installation, see section F You can customize the enzyme database for your installation, see section F

CHAPTER 21. CLONING AND CUTTING File | New | Enzyme list ( )

656

This opens the dialog shown in figure 21.49

Figure 21.49: Choosing enzymes for the new enzyme list. At the top, you can choose to Use existing enzyme list. Clicking this option lets you select an enzyme list which is stored in the Navigation Area. See section 21.5 for more about creating and modifying enzyme lists. Below there are two panels: To the left, you see all the enzymes that are in the list select above. If you have not chosen to use an existing enzyme list, this panel shows all the enzymes available 9 . To the right, there is a list of the enzymes that will be used. Select enzymes in the left side panel and add them to the right panel by double-clicking or clicking the Add button ( ). If you e.g. wish to use EcoRV and BamHI, select these two enzymes and add them to the right side panel. If you wish to use all the enzymes in the list: Click in the panel to the left | press Ctrl + A ( + A on Mac) | Add ( )

The enzymes can be sorted by clicking the column headings, i.e. Name, Overhang, Methylation or Popularity. This is particularly useful if you wish to use enzymes which produce e.g. a 3' overhang. In this case, you can sort the list by clicking the Overhang column heading, and all the enzymes producing 3' overhangs will be listed together for easy selection. When looking for a specific enzyme, it is easier to use the Filter. If you wish to find e.g. HindIII sites, simply type HindIII into the filter, and the list of enzymes will shrink automatically to only include the HindIII enzyme. This can also be used to only show enzymes producing e.g. a 3' overhang as shown in figure 21.50. If you need more detailed information and filtering of the enzymes, either place your mouse cursor on an enzyme for one second to display additional information (see figure 21.51), or use the view of enzyme lists (see 21.5). Click Finish to open the enzyme list.
The CLC Genomics Workbench comes with a standard set of enzymes based on http://www.rebase.neb.com. You can customize the enzyme database for your installation, see section F
9

CHAPTER 21. CLONING AND CUTTING

657

Figure 21.50: Selecting enzymes.

Figure 21.51: Showing additional information about an enzyme like recognition sequence or a list of commercial vendors.

21.5.2

View and modify enzyme list

The list can be sorted by clicking the columns,

An enzyme list is shown in figure 21.52.

Figure 21.52: An enzyme list. and you can use the filter at the top right corner to search for specific enzymes, recognition sequences etc. If you wish to remove or add enzymes, click the Add/Remove Enzymes button at the bottom of the view. This will present the same dialog as shown in figure 21.49 with the enzyme list shown to the right. If you wish to extract a subset of an enzyme list:

CHAPTER 21. CLONING AND CUTTING open the list | select the relevant enzymes | right-click | Create New Enzyme List from Selection ( )

658

If you combined this method with the filter located at the top of the view, you can extract a very specific set of enzymes. E.g. if you wish to create a list of enzymes sold by a particular distributor, type the name of the distributor into the filter, and select and create a new enzyme list from the selection.

Chapter 22

Sequence alignment
Contents
22.1 Create an alignment 22.1.1 22.1.2 22.1.3 22.1.4 22.2.1 22.3.1 22.3.2 22.3.3 22.3.4 22.3.5 22.3.6 22.3.7 22.4.1 22.5.1 22.5.2 22.5.3 22.6.1 22.6.2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 660 Gap costs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 661 Fast or accurate alignment algorithm . . . . . . . . . . . . . . . . . . . . 661 Aligning alignments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 662 Fixpoints . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 663 Bioinformatics explained: Sequence logo . . . . . . . . . . . . . . . . . . 667 Move residues and gaps . . . . . . . . . . . . . . . . . . . . . . . . . . 669 Insert gaps . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 669 Delete residues and gaps . . . . . . . . . . . . . . . . . . . . . . . . . . 669 Copy annotations to other sequences . . . . . . . . . . . . . . . . . . . 670 Move sequences up and down . . . . . . . . . . . . . . . . . . . . . . . 670 Delete, rename and add sequences . . . . . . . . . . . . . . . . . . . . 670 Realign selection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 671 How alignments are joined . . . . . . . . . . . . . . . . . . . . . . . . . 673 Pairwise comparison on alignment selection . . . . . . . . . . . . . . . . 673 Pairwise comparison parameters . . . . . . . . . . . . . . . . . . . . . . 674 The pairwise comparison table . . . . . . . . . . . . . . . . . . . . . . . 675 Use of multiple alignments . . . . . . . . . . . . . . . . . . . . . . . . . 676 Constructing multiple alignments . . . . . . . . . . . . . . . . . . . . . . 676

22.2 View alignments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 665 22.3 Edit alignments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 669

22.4 Join alignments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 671 22.5 Pairwise comparison . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 673

22.6 Bioinformatics explained: Multiple alignments . . . . . . . . . . . . . . . . . 676

CLC Genomics Workbench can align nucleotides and proteins using a progressive alignment algorithm (see section 22.6 or read the White paper on alignments in the Science section of http://www.clcbio.com). This chapter describes how to use the program to align sequences. The chapter also describes alignment algorithms in more general terms. 659

CHAPTER 22. SEQUENCE ALIGNMENT

660

22.1

Create an alignment

Alignments can be created from sequences, sequence lists (see section 10.7), existing alignments and from any combination of the three. To create an alignment in CLC Genomics Workbench: select sequences to align | Toolbox in the Menu Bar | Alignments and Trees ( Create Alignment ( ) )|

or select sequences to align | right-click any selected sequence | Toolbox | Alignments and Trees ( ) | Create Alignment ( ) This opens the dialog shown in figure 22.1.

Figure 22.1: Creating an alignment. If you have selected some elements before choosing the Toolbox action, they are now listed in the Selected Elements window of the dialog. Use the arrows to add or remove sequences, sequence lists or alignments from the selected elements. Click Next to adjust alignment algorithm parameters. Clicking Next opens the dialog shown in figure 22.2.

Figure 22.2: Adjusting alignment algorithm parameters.

CHAPTER 22. SEQUENCE ALIGNMENT

661

22.1.1

Gap costs

The alignment algorithm has three parameters concerning gap costs: Gap open cost, Gap extension cost and End gap cost. The precision of these parameters is to one place of decimal. Gap open cost. The price for introducing gaps in an alignment. Gap extension cost. The price for every extension past the initial gap. If you expect a lot of small gaps in your alignment, the Gap open cost should equal the Gap extension cost. On the other hand, if you expect few but large gaps, the Gap open cost should be set significantly higher than the Gap extension cost. However, for most alignments it is a good idea to make the Gap open cost quite a bit higher than the Gap extension cost. The default values are 10.0 and 1.0 for the two parameters, respectively. End gap cost. The price of gaps at the beginning or the end of the alignment. One of the advantages of the CLC Genomics Workbench alignment method is that it provides flexibility in the treatment of gaps at the ends of the sequences. There are three possibilities: Free end gaps. Any number of gaps can be inserted in the ends of the sequences without any cost. Cheap end gaps. All end gaps are treated as gap extensions and any gaps past 10 are free. End gaps as any other. Gaps at the ends of sequences are treated like gaps in any other place in the sequences. When aligning a long sequence with a short partial sequence, it is ideal to use free end gaps, since this will be the best approximation to the situation. The many gaps inserted at the ends are not due to evolutionary events, but rather to partial data. Many homologous proteins have quite different ends, often with large insertions or deletions. This confuses alignment algorithms, but using the Cheap end gaps option, large gaps will generally be tolerated at the sequence ends, improving the overall alignment. This is the default setting of the algorithm. Finally, treating end gaps like any other gaps is the best option when you know that there are no biologically distinct effects at the ends of the sequences. Figures 22.3 and 22.4 illustrate the differences between the different gap scores at the sequence ends.

22.1.2

Fast or accurate alignment algorithm

CLC Genomics Workbench has two algorithms for calculating alignments: Fast (less accurate). This allows for use of an optimized alignment algorithm which is very fast. The fast option is particularly useful for data sets with very long sequences. Slow (very accurate). This is the recommended choice unless you find the processing time too long.

CHAPTER 22. SEQUENCE ALIGNMENT

662

Figure 22.3: The first 50 positions of two different alignments of seven calpastatin sequences. The top alignment is made with cheap end gaps, while the bottom alignment is made with end gaps having the same price as any other gaps. In this case it seems that the latter scoring scheme gives the best result.

Figure 22.4: The alignment of the coding sequence of bovine myoglobin with the full mRNA of human gamma globin. The top alignment is made with free end gaps, while the bottom alignment is made with end gaps treated as any other. The yellow annotation is the coding sequence in both sequences. It is evident that free end gaps are ideal in this situation as the start codons are aligned correctly in the top alignment. Treating end gaps as any other gaps in the case of aligning distant homologs where one sequence is partial leads to a spreading out of the short sequence as in the bottom alignment. Both algorithms use progressive alignment. The faster algorithm builds the initial tree by doing more approximate pairwise alignments than the slower option.

22.1.3

Aligning alignments

If you have selected an existing alignment in the first step (22.1), you have to decide how this alignment should be treated. Redo alignment. The original alignment will be realigned if this checkbox is checked. Otherwise, the original alignment is kept in its original form except for possible extra equally sized gaps in all sequences of the original alignment. This is visualized in figure 22.5.

CHAPTER 22. SEQUENCE ALIGNMENT

663

Figure 22.5: The top figures shows the original alignment. In the bottom panel a single sequence with four inserted X's are aligned to the original alignment. This introduces gaps in all sequences of the original alignment. All other positions in the original alignment are fixed. This feature is useful if you wish to add extra sequences to an existing alignment, in which case you just select the alignment and the extra sequences and choose not to redo the alignment. It is also useful if you have created an alignment where the gaps are not placed correctly. In this case, you can realign the alignment with different gap cost parameters.

22.1.4

Fixpoints

With fixpoints, you can get full control over the alignment algorithm. The fixpoints are points on the sequences that are forced to align to each other. Fixpoints are added to sequences or alignments before clicking "Create alignment". To add a fixpoint, open the sequence or alignment and: Select the region you want to use as a fixpoint | right-click the selection | Set alignment fixpoint here This will add an annotation labeled "Fixpoint" to the sequence (see figure 22.6). Use this procedure to add fixpoints to the other sequence(s) that should be forced to align to each other. When you click "Create alignment" and go to Step 2, check Use fixpoints in order to force the alignment algorithm to align the fixpoints in the selected sequences to each other. In figure 22.7 the result of an alignment using fixpoints is illustrated. You can add multiple fixpoints, e.g. adding two fixpoints to the sequences that are aligned will force their first fixpoints to be aligned to each other, and their second fixpoints will also be

CHAPTER 22. SEQUENCE ALIGNMENT

664

Figure 22.6: Adding a fixpoint to a sequence in an existing alignment. At the top you can see a fixpoint that has already been added.

Figure 22.7: Realigning using fixpoints. In the top view, fixpoints have been added to two of the sequences. In the view below, the alignment has been realigned using the fixpoints. The three top sequences are very similar, and therefore they follow the one sequence (number two from the top) that has a fixpoint. aligned to each other. Advanced use of fixpoints Fixpoints with the same names will be aligned to each other, which gives the opportunity for great control over the alignment process. It is only necessary to change any fixpoint names in very special cases. One example would be three sequences A, B and C where sequences A and B has one copy of a domain while sequence C has two copies of the domain. You can now force sequence A to align to the first copy and sequence B to align to the second copy of the domains in sequence C. This is done by inserting fixpoints in sequence C for each domain, and naming them 'fp1' and 'fp2'

CHAPTER 22. SEQUENCE ALIGNMENT

665

(for example). Now, you can insert a fixpoint in each of sequences A and B, naming them 'fp1' and 'fp2', respectively. Now, when aligning the three sequences using fixpoints, sequence A will align to the first copy of the domain in sequence C, while sequence B would align to the second copy of the domain in sequence C. You can name fixpoints by: right-click the Fixpoint annotation | Edit Annotation ( 'Name' field ) | type the name in the

22.2

View alignments

Since an alignment is a display of several sequences arranged in rows, the basic options for viewing alignments are the same as for viewing sequences. Therefore we refer to section 10.1 for an explanation of these basic options. However, there are a number of alignment-specific view options in the Alignment info and the Nucleotide info in the Side Panel to the right of the view. Below is more information on these view options. Under Translation in the Nucleotide info, there is an extra checkbox: Relative to top sequence. Checking this box will make the reading frames for the translation align with the top sequence so that you can compare the effect of nucleotide differences on the protein level. The options in the Alignment info relate to each column in the alignment: Consensus. Shows a consensus sequence at the bottom of the alignment. The consensus sequence is based on every single position in the alignment and reflects an artificial sequence which resembles the sequence information of the alignment, but only as one single sequence. If all sequences of the alignment is 100% identical the consensus sequence will be identical to all sequences found in the alignment. If the sequences of the alignment differ the consensus sequence will reflect the most common sequences in the alignment. Parameters for adjusting the consensus sequences are described below. Limit. This option determines how conserved the sequences must be in order to agree on a consensus. Here you can also choose IUPAC which will display the ambiguity code when there are differences between the sequences. E.g. an alignment with A and a G at the same position will display an R in the consensus line if the IUPAC option is selected. (The IUPAC codes can be found in section I and H.) No gaps. Checking this option will not show gaps in the consensus. Ambiguous symbol. Select how ambiguities should be displayed in the consensus line (as N, ?, *, . or -). This option has now effect if IUPAC is selected in the Limit list above. The Consensus Sequence can be opened in a new view, simply by right-clicking the Consensus Sequence and click Open Consensus in New View. Conservation. Displays the level of conservation at each position in the alignment. The conservation shows the conservation of all sequence positions. The height of the bar, or the gradient of the color reflect how conserved that particular position is in the alignment. If one position is 100% conserved the bar will be shown in full height, and it is colored in the color specified at the right side of the gradient slider.

CHAPTER 22. SEQUENCE ALIGNMENT

666

Foreground color. Colors the letters using a gradient, where the right side color is used for highly conserved positions and the left side color is used for positions that are less conserved. Background color. Sets a background color of the residues using a gradient in the same way as described above. Graph. Displays the conservation level as a graph at the bottom of the alignment. The bar (default view) show the conservation of all sequence positions. The height of the graph reflects how conserved that particular position is in the alignment. If one position is 100% conserved the graph will be shown in full height. Learn how to export the data behind the graph in section 7.4. Height. Specifies the height of the graph. Type. The type of the graph. Line plot. Displays the graph as a line plot. Bar plot. Displays the graph as a bar plot. Colors. Displays the graph as a color bar using a gradient like the foreground and background colors. Color box. Specifies the color of the graph for line and bar plots, and specifies a gradient for colors. Gap fraction. Which fraction of the sequences in the alignment that have gaps. The gap fraction is only relevant if there are gaps in the alignment. Foreground color. Colors the letter using a gradient, where the left side color is used if there are relatively few gaps, and the right side color is used if there are relatively many gaps. Background color. Sets a background color of the residues using a gradient in the same way as described above. Graph. Displays the gap fraction as a graph at the bottom of the alignment (Learn how to export the data behind the graph in section 7.4). Height. Specifies the height of the graph. Type. The type of the graph. Line plot. Displays the graph as a line plot. Bar plot. Displays the graph as a line plot. Colors. Displays the graph as a color bar using a gradient like the foreground and background colors. Color box. Specifies the color of the graph for line and bar plots, and specifies a gradient for colors. Color different residues. Indicates differences in aligned residues. Foreground color. Colors the letter. Background color. Sets a background color of the residues. Sequence logo. A sequence logo displays the frequencies of residues at each position in an alignment. This is presented as the relative heights of letters, along with the degree of sequence conservation as the total height of a stack of letters, measured in bits of information. The vertical scale is in bits, with a maximum of 2 bits for nucleotides and approximately 4.32 bits for amino acid residues. See section 22.2.1 for more details.

CHAPTER 22. SEQUENCE ALIGNMENT

667

Foreground color. Color the residues using a gradient according to the information content of the alignment column. Low values indicate columns with high variability whereas high values indicate columns with similar residues. Background color. Sets a background color of the residues using a gradient in the same way as described above. Logo. Displays sequence logo at the bottom of the alignment. Height. Specifies the height of the sequence logo graph. Color. The sequence logo can be displayed in black or Rasmol colors. For protein alignments, a polarity color scheme is also available, where hydrophobic residues are shown in black color, hydrophilic residues as green, acidic residues as red and basic residues as blue.

22.2.1

Bioinformatics explained: Sequence logo

In the search for homologous sequences, researchers are often interested in conserved sites/residues or positions in a sequence which tend to differ a lot. Most researches use alignments (see Bioinformatics explained: multiple alignments) for visualization of homology on a given set of either DNA or protein sequences. In proteins, active sites in a given protein family are often highly conserved. Thus, in an alignment these positions (which are not necessarily located in proximity) are fully or nearly fully conserved. On the other hand, antigen binding sites in the Fab unit of immunoglobulins tend to differ quite a lot, whereas the rest of the protein remains relatively unchanged. In DNA, promoter sites or other DNA binding sites are highly conserved (see figure 22.8). This is also the case for repressor sites as seen for the Cro repressor of bacteriophage . When aligning such sequences, regardless of whether they are highly variable or highly conserved at specific sites, it is very difficult to generate a consensus sequence which covers the actual variability of a given position. In order to better understand the information content or significance of certain positions, a sequence logo can be used. The sequence logo displays the information content of all positions in an alignment as residues or nucleotides stacked on top of each other (see figure 22.8). The sequence logo provides a far more detailed view of the entire alignment than a simple consensus sequence. Sequence logos can aid to identify protein binding sites on DNA sequences and can also aid to identify conserved residues in aligned domains of protein sequences and a wide range of other applications. Each position of the alignment and consequently the sequence logo shows the sequence information in a computed score based on Shannon entropy [Schneider and Stephens, 1990]. The height of the individual letters represent the sequence information content in that particular position of the alignment. A sequence logo is a much better visualization tool than a simple consensus sequence. An example hereof is an alignment where in one position a particular residue is found in 70% of the sequences. If a consensus sequence is used, it typically only displays the single residue with 70% coverage. In figure 22.8 an un-gapped alignment of 11 E. coli start codons including flanking regions are shown. In this example, a consensus sequence would only display ATG as the start codon in position 1, but when looking at the sequence logo it is seen that a GTG is also allowed as a start codon.

CHAPTER 22. SEQUENCE ALIGNMENT

668

Figure 22.8: Ungapped sequence alignment of eleven E. coli sequences defining a start codon. The start codons start at position 1. Below the alignment is shown the corresponding sequence logo. As seen, a GTG start codon and the usual ATG start codons are present in the alignment. This can also be visualized in the logo at position 1. Calculation of sequence logos A comprehensive walk-through of the calculation of the information content in sequence logos is beyond the scope of this document but can be found in the original paper by [Schneider and Stephens, 1990]. Nevertheless, the conservation of every position is defined as Rseq which is the difference between the maximal entropy (Smax ) and the observed entropy for the residue distribution (Sobs ),
N

Rseq = Smax Sobs = log2 N

n=1

pn log2 pn

pn is the observed frequency of a amino acid residue or nucleotide of symbol n at a particular position and N is the number of distinct symbols for the sequence alphabet, either 20 for proteins or four for DNA/RNA. This means that the maximal sequence information content per position is log2 4 = 2 bits for DNA/RNA and log2 20 4.32 bits for proteins. The original implementation by Schneider does not handle sequence gaps. We have slightly modified the algorithm so an estimated logo is presented in areas with sequence gaps. If amino acid residues or nucleotides of one sequence are found in an area containing gaps, we have chosen to show the particular residue as the fraction of the sequences. Example; if one position in the alignment contain 9 gaps and only one alanine (A) the A represented in the logo has a hight of 0.1. Other useful resources The website of Tom Schneider http://www-lmmb.ncifcrf.gov/~toms/ WebLogo

CHAPTER 22. SEQUENCE ALIGNMENT

669

http://weblogo.berkeley.edu/ [Crooks et al., 2004]

22.3
22.3.1

Edit alignments
Move residues and gaps

The placement of gaps in the alignment can be changed by modifying the parameters when creating the alignment (see section 22.1). However, gaps and residues can also be moved after the alignment is created: select one or more gaps or residues in the alignment | drag the selection to move This can be done both for single sequences, but also for multiple sequences by making a selection covering more than one sequence. When you have made the selection, the mouse pointer turns into a horizontal arrow indicating that the selection can be moved (see figure 22.9). Note! Residues can only be moved when they are next to a gap.

Figure 22.9: Moving a part of an alignment. Notice the change of mouse pointer to a horizontal arrow.

22.3.2

Insert gaps

The placement of gaps in the alignment can be changed by modifying the parameters when creating the alignment. However, gaps can also be added manually after the alignment is created. To insert extra gaps: select a part of the alignment | right-click the selection | Add gaps before/after If you have made a selection covering e.g. five residues, a gap of five will be inserted. In this way you can easily control the number of gaps to insert. Gaps will be inserted in the sequences that you selected. If you make a selection in two sequences in an alignment, gaps will be inserted into these two sequences. This means that these two sequences will be displaced compared to the other sequences in the alignment.

22.3.3

Delete residues and gaps

Residues or gaps can be deleted for individual sequences or for the whole alignment. For individual sequences:

CHAPTER 22. SEQUENCE ALIGNMENT select the part of the sequence you want to delete | right-click the selection | Edit Selection ( ) | Delete the text in the dialog | Replace

670

The selection shown in the dialog will be replaced by the text you enter. If you delete the text, the selection will be replaced by an empty text, i.e. deleted. To delete entire columns: select the part of the alignment you want to delete | right-click the selection | Delete columns The selection may cover one or more sequences, but the Delete columns function will always apply to the entire alignment.

22.3.4

Copy annotations to other sequences

Annotations on one sequence can be transferred to other sequences in the alignment: right-click the annotation | Copy Annotation to other Sequences This will display a dialog listing all the sequences in the alignment. Next to each sequence is a checkbox which is used for selecting which sequences, the annotation should be copied to. Click Copy to copy the annotation. If you wish to copy all annotations on the sequence, click the Copy All Annotations to other Sequences.

22.3.5

Move sequences up and down

Sequences can be moved up and down in the alignment: drag the name of the sequence up or down When you move the mouse pointer over the label, the pointer will turn into a vertical arrow indicating that the sequence can be moved. The sequences can also be sorted automatically to let you save time moving the sequences around. To sort the sequences alphabetically: Right-click the name of a sequence | Sort Sequences Alphabetically If you change the Sequence name (in the Sequence Layout view preferences), you will have to ask the program to sort the sequences again. The sequences can also be sorted by similarity, grouping similar sequences together: Right-click the name of a sequence | Sort Sequences by Similarity

22.3.6

Delete, rename and add sequences

Sequences can be removed from the alignment by right-clicking the label of a sequence: right-click label | Delete Sequence This can be undone by clicking Undo ( ) in the Toolbar.

If you wish to delete several sequences, you can check all the sequences, right-click and choose

CHAPTER 22. SEQUENCE ALIGNMENT

671

Delete Marked Sequences. To show the checkboxes, you first have to click the Show Selection Boxes in the Side Panel. A sequence can also be renamed: right-click label | Rename Sequence This will show a dialog, letting you rename the sequence. This will not affect the sequence that the alignment is based on. Extra sequences can be added to the alignment by creating a new alignment where you select the current alignment and the extra sequences (see section 22.1). The same procedure can be used for joining two alignments.

22.3.7

Realign selection

If you have created an alignment, it is possible to realign a part of it, leaving the rest of the alignment unchanged: select a part of the alignment to realign | right-click the selection | Realign selection This will open Step 2 in the "Create alignment" dialog, allowing you to set the parameters for the realignment (see section 22.1). It is possible for an alignment to become shorter or longer as a result of the realignment of a region. This is because gaps may have to be inserted in, or deleted from, the sequences not selected for realignment. This will only occur for entire columns of gaps in these sequences, ensuring that their relative alignment is unchanged. Realigning a selection is a very powerful tool for editing alignments in several situations: Removing changes. If you change the alignment in a specific region by hand, you may end up being unhappy with the result. In this case you may of course undo your edits, but another option is to select the region and realign it. Adjusting the number of gaps. If you have a region in an alignment which has too many gaps in your opinion, you can select the region and realign it. By choosing a relatively high gap cost you will be able to reduce the number of gaps. Combine with fixpoints. If you have an alignment where two residues are not aligned, but you know that they should have been. You can now set an alignment fixpoint on each of the two residues, select the region and realign it using the fixpoints. Now, the two residues are aligned with each other and everything in the selected region around them is adjusted to accommodate this change.

22.4

Join alignments

CLC Genomics Workbench can join several alignments into one. This feature can for example be used to construct "supergenes" for phylogenetic inference by joining alignments of several disjoint genes into one spliced alignment. Note, that when alignments are joined, all their annotations are carried over to the new spliced alignment. Alignments can be joined by:

CHAPTER 22. SEQUENCE ALIGNMENT select alignments to join | Toolbox in the Menu Bar | Alignments and Trees ( Join Alignments ( ) )|

672

or select alignments to join | right-click either selected alignment | Toolbox | Alignments and Trees ( ) | Join Alignments ( ) This opens the dialog shown in figure 22.10.

Figure 22.10: Selecting two alignments to be joined. If you have selected some alignments before choosing the Toolbox action, they are now listed in the Selected Elements window of the dialog. Use the arrows to add or remove alignments from the selected elements. Click Next opens the dialog shown in figure 22.11.

Figure 22.11: Selecting order of concatenation. To adjust the order of concatenation, click the name of one of the alignments, and move it up or down using the arrow buttons. Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish. The result is seen in figure 22.12.

CHAPTER 22. SEQUENCE ALIGNMENT

673

Figure 22.12: The joining of the alignments result in one alignment containing rows of sequences corresponding to the number of uniquely named sequences in the joined alignments.

22.4.1

How alignments are joined

Alignments are joined by considering the sequence names in the individual alignments. If two sequences from different alignments have identical names, they are considered to have the same origin and are thus joined. Consider the joining of alignments A and B. If a sequence named "in-A-and-B" is found in both A and B, the spliced alignment will contain a sequence named "in-A-and-B" which represents the characters from A and B joined in direct extension of each other. If a sequence with the name "in-A-not-B" is found in A but not in B, the spliced alignment will contain a sequence named "in-A-not-B". The first part of this sequence will contain the characters from A, but since no sequence information is available from B, a number of gap characters will be added to the end of the sequence corresponding to the number of residues in B. Note, that the function does not require that the individual alignments contain an equal number of sequences.

22.5

Pairwise comparison

For a given set of aligned sequences (see chapter 22) it is possible make a pairwise comparison in which each pair of sequences are compared to each other. This provides an overview of the diversity among the sequences in the alignment. In CLC Genomics Workbench this is done by creating a comparison table: Toolbox in the Menu Bar | Alignments and Trees ( ) | Pairwise Comparison ( ) ) |

or right-click alignment in Navigation Area | Toolbox | Alignments and Trees ( Pairwise Comparison ( ) This opens the dialog displayed in figure 22.13:

If an alignment was selected before choosing the Toolbox action, this alignment is now listed in the Selected Elements window of the dialog. Use the arrows to add or remove elements from the Navigation Area. Click Next to adjust parameters.

22.5.1

Pairwise comparison on alignment selection

)

A pairwise comparison can also be performed for a selected part of an alignment: right-click on an alignment selection | Pairwise Comparison ( This leads directly to the dialog described in the next section.

CHAPTER 22. SEQUENCE ALIGNMENT

674

Figure 22.13: Creating a pairwise comparison table.

22.5.2

Pairwise comparison parameters

There are four kinds of comparison that can be made between the sequences in the alignment, as shown in figure 22.14.

Figure 22.14: Adjusting parameters for pairwise comparison. Gaps Calculates the number of alignment positions where one sequence has a gap and the other does not. Identities Calculates the number of identical alignment positions to overlapping alignment positions between the two sequences. Differences Calculates the number of alignment positions where one sequence is different from the other. This includes gap differences as in the Gaps comparison. Distance Calculates the Jukes-Cantor distance between the two sequences. This number is given as the Jukes-Cantor correction of the proportion between identical and overlapping alignment positions between the two sequences. Percent identity Calculates the percentage of identical residues in alignment positions to overlapping alignment positions between the two sequences.

CHAPTER 22. SEQUENCE ALIGNMENT

675

Click Next if you wish to adjust how to handle the results (see section 9.2). If not, click Finish.

22.5.3

The pairwise comparison table

The table shows the results of selected comparisons (see an example in figure 22.15). Since comparisons are often symmetric, the table can show the results of two comparisons at the same time, one in the upper-right and one in the lower-left triangle.

Figure 22.15: A pairwise comparison table. The following settings are present in the side panel: Contents Upper comparison. Selects the comparison to show in the upper triangle of the table Upper comparison gradient. Selects the color gradient to use for the upper triangle. Lower comparison Selects the comparison to show in the lower triangle. Choose the same comparison as in the upper triangle to show all the results of an asymmetric comparison. Lower comparison gradient. Selects the color gradient to use for the lower triangle. Diagonal from upper. Use this setting to show the diagonal results from the upper comparison. Diagonal from lower. Use this setting to show the diagonal results from the lower comparison. No Diagonal. Leaves the diagonal table entries blank. Layout Lock headers. Locks the sequence labels and table headers when scrolling the table. Sequence label. Changes the sequence labels.

CHAPTER 22. SEQUENCE ALIGNMENT Text format Text size. Changes the size of the table and the text within it. Font. Changes the font in the table. Bold. Toggles the use of boldface in the table.

676

22.6

Bioinformatics explained: Multiple alignments

Multiple alignments are at the core of bioinformatical analysis. Often the first step in a chain of bioinformatical analyses is to construct a multiple alignment of a number of homologs DNA or protein sequences. However, despite their frequent use, the development of multiple alignment algorithms remains one of the algorithmically most challenging areas in bioinformatical research. Constructing a multiple alignment corresponds to developing a hypothesis of how a number of sequences have evolved through the processes of character substitution, insertion and deletion. The input to multiple alignment algorithms is a number of homologous sequences i.e. sequences that share a common ancestor and most often also share molecular function. The generated alignment is a table (see figure 22.16) where each row corresponds to an input sequence and each column corresponds to a position in the alignment. An individual column in this table represents residues that have all diverged from a common ancestral residue. Gaps in the table (commonly represented by a '-') represent positions where residues have been inserted or deleted and thus do not have ancestral counterparts in all sequences.

22.6.1

Use of multiple alignments

Once a multiple alignment is constructed it can form the basis for a number of analyses: The phylogenetic relationship of the sequences can be investigated by tree-building methods based on the alignment. Annotation of functional domains, which may only be known for a subset of the sequences, can be transferred to aligned positions in other un-annotated sequences. Conserved regions in the alignment can be found which are prime candidates for holding functionally important sites. Comparative bioinformatical analysis can be performed to identify functionally important regions.

22.6.2

Constructing multiple alignments

Whereas the optimal solution to the pairwise alignment problem can be found in reasonable time, the problem of constructing a multiple alignment is much harder. The first major challenge in the multiple alignment procedure is how to rank different alignments i.e. which scoring function to use. Since the sequences have a shared history they are correlated through their phylogeny and the scoring function should ideally take this into account. Doing so is, however, not straightforward as it increases the number of model parameters considerably.

CHAPTER 22. SEQUENCE ALIGNMENT

677

Figure 22.16: The tabular format of a multiple alignment of 24 Hemoglobin protein sequences. Sequence names appear at the beginning of each row and the residue position is indicated by the numbers at the top of the alignment columns. The level of sequence conservation is shown on a color scale with blue residues being the least conserved and red residues being the most conserved. It is therefore commonplace to either ignore this complication and assume sequences to be unrelated, or to use heuristic corrections for shared ancestry. The second challenge is to find the optimal alignment given a scoring function. For pairs of sequences this can be done by dynamic programming algorithms, but for more than three sequences this approach demands too much computer time and memory to be feasible. A commonly used approach is therefore to do progressive alignment [Feng and Doolittle, 1987] where multiple alignments are built through the successive construction of pairwise alignments. These algorithms provide a good compromise between time spent and the quality of the resulting alignment Presently, the most exciting development in multiple alignment methodology is the construction of statistical alignment algorithms [Hein, 2001], [Hein et al., 2000]. These algorithms employ a scoring function which incorporates the underlying phylogeny and use an explicit stochastic model of molecular evolution which makes it possible to compare different solutions in a statistically rigorous way. The optimization step, however, still relies on dynamic programming and practical use of these algorithms thus awaits further developments.

Creative Commons License

All CLC bio's scientific articles are licensed under a Creative Commons Attribution-NonCommercialNoDerivs 2.5 License. You are free to copy, distribute, display, and use the work for educational purposes, under the following conditions: You must attribute the work in its original form and "CLC bio" has to be clearly labeled as author and provider of the work. You may not use this work for commercial purposes. You may not alter, transform, nor build upon this work.

See http://creativecommons.org/licenses/by-nc-nd/2.5/ for more information on how to use the contents.

Chapter 23

Phylogenetic trees
Contents
23.1 Inferring phylogenetic trees 23.1.1 23.1.2 23.2.1 23.2.2 23.2.3 23.2.4 . . . . . . . . . . . . . . . . . . . . . . . . . . . 678 Phylogenetic tree parameters . . . . . . . . . . . . . . . . . . . . . . . . 679 Tree View Preferences . . . . . . . . . . . . . . . . . . . . . . . . . . . . 681 . . . . . . . . . . . . . . . . . . . . 683 The phylogenetic tree . . . . . . . . . . . . . . . . . . . . . . . . . . . . 683 Modern usage of phylogenies . . . . . . . . . . . . . . . . . . . . . . . . 684 Reconstructing phylogenies from molecular data . . . . . . . . . . . . . 684 Interpreting phylogenies . . . . . . . . . . . . . . . . . . . . . . . . . . . 686

23.2 Bioinformatics explained: phylogenetics

CLC Genomics Workbench offers different ways of inferring phylogenetic trees. The first part of this chapter will briefly explain the different ways of inferring trees in CLC Genomics Workbench. The second part, "Bioinformatics explained", will give a more general introduction to the concept of phylogeny and the associated bioinformatics methods.

23.1

Inferring phylogenetic trees

For a given set of aligned sequences (see chapter 22) it is possible to infer their evolutionary relationships. In CLC Genomics Workbench this may be done either by using a distance based method (see "Bioinformatics explained" in section 23.2.) or by using the statistically founded maximum likelihood (ML) approach [Felsenstein, 1981]. Both approaches generate a phylogenetic tree. The tools are found in: Toolbox | Alignments and trees ( )

To generate a distance-based phylogenetic tree choose: Create Tree ( )

and to generate a maximum likelihood based phylogenetic tree choose: Maximum Likelihood Phylogeny ( )

In both cases the dialog displayed in figure 23.1 will be opened:

678

CHAPTER 23. PHYLOGENETIC TREES

679

Figure 23.1: Creating a Tree. If an alignment was selected before choosing the Toolbox action, this alignment is now listed in the Selected Elements window of the dialog. Use the arrows to add or remove elements from the Navigation Area. Click Next to adjust parameters.

23.1.1

Phylogenetic tree parameters

Distance-based methods

Figure 23.2: Adjusting parameters for distance-based methods. Figure 23.2 shows the parameters that can be set for the distance-based methods: Algorithms The UPGMA method assumes that evolution has occurred at a constant rate in the different lineages. This means that a root of the tree is also estimated. The neighbor joining method builds a tree where the evolutionary rates are free to differ in different lineages. CLC Genomics Workbench always draws trees with roots for practical reasons, but with the neighbor joining method, no particular biological hypothesis is postulated by the placement of the root. Figure 23.3 shows the difference between the two methods.

CHAPTER 23. PHYLOGENETIC TREES

680

To evaluate the reliability of the inferred trees, CLC Genomics Workbench allows the option of doing a bootstrap analysis. A bootstrap value will be attached to each branch, and this value is a measure of the confidence in this branch. The number of replicates in the bootstrap analysis can be adjusted in the wizard. The default value is 100. For a more detailed explanation, see "Bioinformatics explained" in section 23.2.

Figure 23.3: Method choices for phylogenetic inference. The bottom shows a tree found by neighbor joining, while the top shows a tree found by UPGMA. The latter method assumes that the evolution occurs at a constant rate in different lineages.

Maximum likelihood phylogeny

Figure 23.4: Adjusting parameters for ML phylogeny Figure 23.4 shows the parameters that can be set for the ML phylogenetic tree reconstruction: Starting tree: the user is asked to specify a starting tree for the tree reconstruction. There are three possibilities Neighbor joining UPGMA

CHAPTER 23. PHYLOGENETIC TREES Use tree from file.

681

Select substitution model: CLC Genomics Workbench allows maximum likelihood tree estimation to be performed under the assumption of one of four substitution models: the Jukes Cantor [Jukes and Cantor, 1969], the Kimura 80 [Kimura, 1980], the HKY [Hasegawa et al., 1985] and the GTR (also known as the REV model) [Yang, 1994a] models. All models are time-reversible. The JC and K80 models assume equal base frequencies and the HKY and GTR models allow the frequencies of the four bases to differ (they will be estimated by the observed frequencies of the bases in the alignment). In the JC model all substitutions are assumed to occur at equal rates, in the K80 and HKY models transition and transversion rates are allowed to differ. The GTR model is the general time reversible model and allows all substitutions to occur at different rates. In case of the K80 and HKY models the user may set a transtion/transversion ratio value which will be used as starting value or fixed, depending on the level of estimation chosen by the user (see below). For the substitution rate matrices describing the substitution models we use the parametrization of Yang [Yang, 1994a]. Rate variation: in CLC Genomics Workbench substitution rates may be allowed to differ among the individual nucleotide sites in the alignment by selecting the include rate variation box. When selected, the discrete gamma model of Yang [Yang, 1994b] is used to model rate variation among sites. The number of categories used in the dicretization of the gamma distribution as well as the gamma distribution parameter may be adjusted by the user (as the gamma distribution is restricted to have mean 1, there is only one parameter in the distribution) Estimation estimation is done according to the maximum likelihood principle, that is, a search is performed for the values of the free parameters in the model assumed that results in the highest likelihood of the observed alignment [Felsenstein, 1981]. By ticking the estimate substitution rate parameters box, maximum likelihood values of the free parameters in the rate matrix describing the assumed substitution model are found. If the Estimate topology box is selected, a search in the space of tree topologies for that which best explains the alignment is performed. If left un-ticked, the starting topology is kept fixed at that of the starting tree. The Estimate Gamma distribution parameter is active if rate variation has been included in the model and in this case allows estimation of the Gamma distribution parameter to be switched on or off. If the box is left un-ticked, the value is fixed at that given in the Rate variation part. In the absence of rate variation estimation of substitution parameters and branch lengths are carried out according to the expectation maximization algorithm [Dempster et al., 1977]. With rate variation the maximization algorithm is performed. The topology space is searched according to the PHYML method [Guindon and Gascuel, 2003], allowing efficient search and estimation of large phylogenies. Branch lengths are given in terms of expected numbers of substitutions per nucleotide site.

23.1.2

Tree View Preferences

The Tree View preferences are these: Text format. Changes the text format for all of the nodes the tree contains.

CHAPTER 23. PHYLOGENETIC TREES

682

Text size. The size of the text representing the nodes can be modified in tiny, small, medium, large or huge. Font. Sets the font of the text of all nodes Bold. Sets the text bold if enabled. Tree Layout. Different layouts for the tree. Node symbol. Changes the symbol of nodes into box, dot, circle or none if you don`t want a node symbol. Layout. Displays the tree layout as standard or topology. Show internal node labels. This allows you to see labels for the internal nodes. Initially, there are no labels, but right-clicking a node allows you to type a label. Label color. Changes the color of the labels on the tree nodes. Branch label color. Modifies the color of the labels on the branches. Node color. Sets the color of all nodes. Line color. Alters the color of all lines in the tree. Labels. Specifies the text to be displayed in the tree. Nodes. Sets the annotation of all nodes either to name or to species. Branches. Changes the annotation of the branches to bootstrap, length or none if you don`t want annotation on branches. Note! Dragging in a tree will change it. You are therefore asked if you want to save this tree when the Tree View is closed. You may select part of a Tree by clicking on the nodes that you want to select. Right-click a selected node opens a menu with the following options: Set root above node (defines the root of the tree to be just above the selected node). Set root at this node (defines the root of the tree to be at the selected node). Toggle collapse (collapses or expands the branches below the node). Change label (allows you to label or to change the existing label of a node). Change branch label (allows you to change the existing label of a branch). You can also relocate leaves and branches in a tree or change the length. It is possible to modify the text on the unit measurement at the bottom of the tree view by right-clicking the text. In this way you can specify a unit, e.g. "years". Branch lengths are given in terms of expected numbers of substitutions per site. Note! To drag branches of a tree, you must first click the node one time, and then click the node again, and this time hold the mouse button. In order to change the representation:

CHAPTER 23. PHYLOGENETIC TREES

683

Rearrange leaves and branches by Select a leaf or branch | Move it up and down (Hint: The mouse turns into an arrow pointing up and down) Change the length of a branch by Select a leaf or branch | Press Ctrl | Move left and right (Hint: The mouse turns into an arrow pointing left and right) Alter the preferences in the Side Panel for changing the presentation of the tree.

23.2

Bioinformatics explained: phylogenetics

Phylogenetics describes the taxonomical classification of organisms based on their evolutionary history i.e. their phylogeny. Phylogenetics is therefore an integral part of the science of systematics that aims to establish the phylogeny of organisms based on their characteristics. Furthermore, phylogenetics is central to evolutionary biology as a whole as it is the condensation of the overall paradigm of how life arose and developed on earth.

23.2.1

The phylogenetic tree

The evolutionary hypothesis of a phylogeny can be graphically represented by a phylogenetic tree. Figure 23.5 shows a proposed phylogeny for the great apes, Hominidae, taken in part from Purvis [Purvis, 1995]. The tree consists of a number of nodes (also termed vertices) and branches (also termed edges). These nodes can represent either an individual, a species, or a higher grouping and are thus broadly termed taxonomical units. In this case, the terminal nodes (also called leaves or tips of the tree) represent extant species of Hominidae and are the operational taxonomical units (OTUs). The internal nodes, which here represent extinct common ancestors of the great apes, are termed hypothetical taxonomical units since they are not directly observable.

Figure 23.5: A proposed phylogeny of the great apes (Hominidae). Different components of the tree are marked, see text for description. The ordering of the nodes determine the tree topology and describes how lineages have diverged over the course of evolution. The branches of the tree represent the amount of evolutionary divergence between two nodes in the tree and can be based on different measurements. A tree is completely specified by its topology and the set of all edge lengths. The phylogenetic tree in figure 23.5 is rooted at the most recent common ancestor of all Hominidae species, and therefore represents a hypothesis of the direction of evolution e.g. that

CHAPTER 23. PHYLOGENETIC TREES

684

the common ancestor of gorilla, chimpanzee and man existed before the common ancestor of chimpanzee and man. In contrast, an unrooted tree would represent relationships without assumptions about ancestry.

23.2.2

Modern usage of phylogenies

Besides evolutionary biology and systematics the inference of phylogenies is central to other areas of research. As more and more genetic diversity is being revealed through the completion of multiple genomes, an active area of research within bioinformatics is the development of comparative machine learning algorithms that can simultaneously process data from multiple species [Siepel and Haussler, 2004]. Through the comparative approach, valuable evolutionary information can be obtained about which amino acid substitutions are functionally tolerant to the organism and which are not. This information can be used to identify substitutions that affect protein function and stability, and is of major importance to the study of proteins [Knudsen and Miyamoto, 2001]. Knowledge of the underlying phylogeny is, however, paramount to comparative methods of inference as the phylogeny describes the underlying correlation from shared history that exists between data from different species. In molecular epidemiology of infectious diseases, phylogenetic inference is also an important tool. The very fast substitution rate of microorganisms, especially the RNA viruses, means that these show substantial genetic divergence over the time-scale of months and years. Therefore, the phylogenetic relationship between the pathogens from individuals in an epidemic can be resolved and contribute valuable epidemiological information about transmission chains and epidemiologically significant events [Leitner and Albert, 1999], [Forsberg et al., 2001].

23.2.3

Reconstructing phylogenies from molecular data

Traditionally, phylogenies have been constructed from morphological data, but following the growth of genetic information it has become common practice to construct phylogenies based on molecular data, known as molecular phylogeny. The data is most commonly represented in the form of DNA or protein sequences, but can also be in the form of e.g. restriction fragment length polymorphism (RFLP). Methods for constructing molecular phylogenies can be distance based or character based. Distance based methods Two common algorithms, both based on pairwise distances, are the UPGMA and the Neighbor Joining algorithms. Thus, the first step in these analyses is to compute a matrix of pairwise distances between OTUs from their sequence differences. To correct for multiple substitutions it is common to use distances corrected by a model of molecular evolution such as the Jukes-Cantor model [Jukes and Cantor, 1969]. UPGMA. A simple but popular clustering algorithm for distance data is Unweighted Pair Group Method using Arithmetic averages (UPGMA) ( [Michener and Sokal, 1957], [Sneath and Sokal, 1973]). This method works by initially having all sequences in separate clusters and continuously joining these. The tree is constructed by considering all initial clusters as leaf nodes in the tree, and each time two clusters are joined, a node is added to the tree as the parent of the two chosen nodes. The clusters to be joined are chosen as those with minimal pairwise distance. The branch lengths are set corresponding to the distance between clusters, which is calculated

CHAPTER 23. PHYLOGENETIC TREES as the average distance between pairs of sequences in each cluster.

685

The algorithm assumes that the distance data has the so-called molecular clock property i.e. the divergence of sequences occur at the same constant rate at all parts of the tree. This means that the leaves of UPGMA trees all line up at the extant sequences and that a root is estimated as part of the procedure.

Figure 23.6: Algorithm choices for phylogenetic inference. The bottom shows a tree found by the neighbor joining algorithm, while the top shows a tree found by the UPGMA algorithm. The latter algorithm assumes that the evolution occurs at a constant rate in different lineages. Neighbor Joining. The neighbor joining algorithm, [Saitou and Nei, 1987], on the other hand, builds a tree where the evolutionary rates are free to differ in different lineages, i.e., the tree does not have a particular root. Some programs always draw trees with roots for practical reasons, but for neighbor joining trees, no particular biological hypothesis is postulated by the placement of the root. The method works very much like UPGMA. The main difference is that instead of using pairwise distance, this method subtracts the distance to all other nodes from the pairwise distance. This is done to take care of situations where the two closest nodes are not neighbors in the "real" tree. The neighbor join algorithm is generally considered to be fairly good and is widely used. Algorithms that improves its cubic time performance exist. The improvement is only significant for quite large datasets. Character based methods. Whereas the distance based methods compress all sequence information into a single number, the character based methods attempt to infer the phylogeny based on all the individual characters (nucleotides or amino acids). Parsimony. In parsimony based methods a number of sites are defined which are informative about the topology of the tree. Based on these, the best topology is found by minimizing the number of substitutions needed to explain the informative sites. Parsimony methods are not based on explicit evolutionary models. Maximum Likelihood. Maximum likelihood and Bayesian methods (see below) are probabilistic methods of inference. Both have the pleasing properties of using explicit models of molecular evolution and allowing for rigorous statistical inference. However, both approaches are very computer intensive. A stochastic model of molecular evolution is used to assign a probability (likelihood) to each phylogeny, given the sequence data of the OTUs. Maximum likelihood inference [Felsenstein,

CHAPTER 23. PHYLOGENETIC TREES 1981] then consists of finding the tree which assign the highest probability to the data.

686

Bayesian inference. The objective of Bayesian phylogenetic inference is not to infer a single "correct" phylogeny, but rather to obtain the full posterior probability distribution of all possible phylogenies. This is obtained by combining the likelihood and the prior probability distribution of evolutionary parameters. The vast number of possible trees means that bayesian phylogenetics must be performed by approximative Monte Carlo based methods. [Larget and Simon, 1999], [Yang and Rannala, 1997].

23.2.4

Interpreting phylogenies

Bootstrap values A popular way of evaluating the reliability of an inferred phylogenetic tree is bootstrap analysis. The first step in a bootstrap analysis is to re-sample the alignment columns with replacement. I.e., in the re-sampled alignment, a given column in the original alignment may occur two or more times, while some columns may not be represented in the new alignment at all. The re-sampled alignment represents an estimate of how a different set of sequences from the same genes and the same species may have evolved on the same tree. If a new tree reconstruction on the re-sampled alignment results in a tree similar to the original one, this increases the confidence in the original tree. If, on the other hand, the new tree looks very different, it means that the inferred tree is unreliable. By re-sampling a number of times it is possibly to put reliability weights on each internal branch of the inferred tree. If the data was bootstrapped a 100 times, a bootstrap score of 100 means that the corresponding branch occurs in all 100 trees made from re-sampled alignments. Thus, a high bootstrap score is a sign of greater reliability. Other useful resources The Tree of Life web-project http://tolweb.org Joseph Felsensteins list of phylogeny software http://evolution.genetics.washington.edu/phylip/software.html

Creative Commons License

All CLC bio's scientific articles are licensed under a Creative Commons Attribution-NonCommercialNoDerivs 2.5 License. You are free to copy, distribute, display, and use the work for educational purposes, under the following conditions: You must attribute the work in its original form and "CLC bio" has to be clearly labeled as author and provider of the work. You may not use this work for commercial purposes. You may not alter, transform, nor build upon this work.

See http://creativecommons.org/licenses/by-nc-nd/2.5/ for more information on how to use the contents.

Chapter 24

RNA structure
Contents
24.1 RNA secondary structure prediction . . . . . . . . . . . . . . . . . . . . . . . 688 24.1.1 24.1.2 24.1.3 24.1.4 24.1.5 24.2.1 24.2.2 24.2.3 24.2.4 24.3.1 24.3.2 24.4.1 24.4.2 Selecting sequences for prediction . . . . . . . . . . . . . . . . . . . . . 688 Structure output . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 689 Partition function . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 690 Advanced options . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 690 Structure as annotation . . . . . . . . . . . . . . . . . . . . . . . . . . . 693 Graphical view and editing of secondary structure . . . . . . . . . . . . . 694 Tabular view of structures and energy contributions . . . . . . . . . . . . 697 Symbolic representation in sequence view . . . . . . . . . . . . . . . . . 700 Probability-based coloring . . . . . . . . . . . . . . . . . . . . . . . . . . 701 Selecting sequences for evaluation . . . . . . . . . . . . . . . . . . . . . 702 Probabilities . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 703 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 704 Selecting sequences for scanning . . . . . . . . . . . . . . . . . . . . . 704 The structure scanning result . . . . . . . . . . . . . . . . . . . . . . . . 705

24.2 View and edit secondary structures . . . . . . . . . . . . . . . . . . . . . . . 694

24.3 Evaluate structure hypothesis . . . . . . . . . . . . . . . . . . . . . . . . . . 701

24.4 Structure Scanning Plot

24.5 Bioinformatics explained: RNA structure prediction by minimum free energy minimization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 706 24.5.1 24.5.2 The algorithm . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 707 Structure elements and their energy contribution . . . . . . . . . . . . . 709

Ribonucleic acid (RNA) is a nucleic acid polymer that plays several important roles in the cell. As for proteins, the three dimensional shape of an RNA molecule is important for its molecular function. A number of tertiary RNA structures are know from crystallography but de novo prediction of tertiary structures is not possible with current methods. However, as for proteins RNA tertiary structures can be characterized by secondary structural elements which are hydrogen bonds within the molecule that form several recognizable "domains" of secondary structure like stems, hairpin loops, bulges and internal loops. A large part of the functional information is thus

687

CHAPTER 24. RNA STRUCTURE

688

contained in the secondary structure of the RNA molecule, as shown by the high degree of base-pair conservation observed in the evolution of RNA molecules. Computational prediction of RNA secondary structure is a well defined problem and a large body of work has been done to refine prediction algorithms and to experimentally estimate the relevant biological parameters. In CLC Genomics Workbench we offer the user a number of tools for analyzing and displaying RNA structures. These include: Secondary structure prediction using state-of-the-art algorithms and parameters Calculation of full partition function to assign probabilities to structural elements and hypotheses Scanning of large sequences to find local structure signal Inclusion of experimental constraints to the folding process Advanced viewing and editing of secondary structures and structure information

24.1

RNA secondary structure prediction

CLC Genomics Workbench uses a minimum free energy (MFE) approach to predict RNA secondary structure. Here, the stability of a given secondary structure is defined by the amount of free energy used (or released) by its formation. The more negative free energy a structure has, the more likely is its formation since more stored energy is released by the event. Free energy contributions are considered additive, so the total free energy of a secondary structure can be calculated by adding the free energies of the individual structural elements. Hence, the task of the prediction algorithm is to find the secondary structure with the minimum free energy. As input to the algorithm empirical energy parameters are used. These parameters summarize the free energy contribution associated with a large number of structural elements. A detailed structure overview can be found in 24.5. In CLC Genomics Workbench, structures are predicted by a modified version of Professor Michael Zukers well known algorithm [Zuker, 1989b] which is the algorithm behind a number of RNA-folding packages including MFOLD. Our algorithm is a dynamic programming algorithm for free energy minimization which includes free energy increments for coaxial stacking of stems when they are either adjacent or separated by a single mismatch. The thermodynamic energy parameters used are from the latest Mfold version 3, see http://www.bioinfo.rpi.edu/~zukerm/rna/ energy/.

24.1.1

Selecting sequences for prediction

) | Predict Secondary Structure ( )

Secondary structure prediction can be accessed in the Toolbox: Toolbox | RNA Structure (

This opens the dialog shown in figure 24.1. If you have selected sequences before choosing the Toolbox action, they are now listed in the Selected Elements window of the dialog. Use the arrows to add or remove sequences or

CHAPTER 24. RNA STRUCTURE

689

Figure 24.1: Selecting RNA or DNA sequences for structure prediction (DNA is folded as if it were RNA). sequence lists from the selected elements. You can use both DNA and RNA sequences - DNA will be folded as if it were RNA. Click Next to adjust secondary structure prediction parameters. Clicking Next opens the dialog shown in figure 24.2.

Figure 24.2: Adjusting parameters for secondary structure prediction.

24.1.2

Structure output

The predict secondary structure algorithm always calculates the minimum free energy structure of the input sequence. In addition to this, it is also possible to compute a sample of suboptimal structures by ticking the checkbox labeled Compute sample of suboptimal structures. Subsequently, you can specify how many structures to include in the output. The algorithm then

CHAPTER 24. RNA STRUCTURE

690

iterates over all permissible canonical base pairs and computes the minimum free energy and associated secondary structure constrained to contain a specified base pair. These structures are then sorted by their minimum free energy and the most optimal are reported given the specified number of structures. Note, that two different sub-optimal structures can have the same minimum free energy. Further information about suboptimal folding can be found in [Zuker, 1989a].

24.1.3

Partition function

The predicted minimum free energy structure gives a point-estimate of the structural conformation of an RNA molecule. However, this procedure implicitly assumes that the secondary structure is at equilibrium, that there is only a single accessible structure conformation, and that the parameters and model of the energy calculation are free of errors. Obvious deviations from these assumptions make it clear that the predicted MFE structure may deviate somewhat from the actual structure assumed by the molecule. This means that rather than looking at the MFE structure it may be informative to inspect statistical properties of the structural landscape to look for general structural properties which seem to be robust to minor variations in the total free energy of the structure (see [Mathews et al., 2004]). To this end CLC Genomics Workbench allows the user to calculate the complete secondary structure partition function using the algorithm described in [Mathews et al., 2004] which is an extension of the seminal work by [McCaskill, 1990]. There are two options regarding the partition function calculation: Calculate base pair probabilities. This option invokes the partition function calculation and calculates the marginal probabilities of all possible base pairs and the the marginal probability that any single base is unpaired. Create plot of marginal base pairing probabilities. This creates a plot of the marginal base pair probability of all possible base pairs as shown in figure 24.3. The marginal probabilities of base pairs and of bases being unpaired are distinguished by colors which can be displayed in the normal sequence view using the Side Panel - see section 24.2.3 and also in the secondary structure view. An example is shown in figure 24.4. Furthermore, the marginal probabilities are accessible from tooltips when hovering over the relevant parts of the structure.

24.1.4

Advanced options

The free energy minimization algorithm includes a number of advanced options: Avoid isolated base pairs. The algorithm filters out isolated base pairs (i.e. stems of length 1). Apply different energy rules for Grossly Asymmetric Interior Loops (GAIL). Compute the minimum free energy applying different rules for Grossly Asymmetry Interior Loops (GAIL). A Grossly Asymmetry Interior Loop (GAIL) is an interior loop that is 1 n or n 1 where n > 2 (see http://www.bioinfo.rpi.edu/~zukerm/lectures/RNAfold-html/ rnafold-print.pdf).

CHAPTER 24. RNA STRUCTURE

691

Figure 24.3: The marginal base pair probability of all possible base pairs. Include coaxial stacking energy rules. Include free energy increments of coaxial stacking for adjacent helices [Mathews et al., 2004]. Apply base pairing constraints. With base pairing constraints, you can easily add experimental constraints to your folding algorithm. When you are computing suboptimal structures, it is not possible to apply base pair constraints. The possible base pairing constraints are: Force two equal length intervals to form a stem. Prohibit two equal length intervals to form a stem. Prohibit all nucleotides in a selected region to be a part of a base pair. Base pairing constraints have to be added to the sequence before you can use this option - see below. Maximum distance between paired bases. Forces the algorithms to only consider RNA structures of a given upper length by setting a maximum distance between the base pair that opens a structure. Specifying structure constraints Structure constraints can serve two purposes in CLC Genomics Workbench: they can act as experimental constraints imposed on the MFE structure prediction algorithm or they can form a structure hypothesis to be evaluated using the partition function (see section 24.1.3). To force two regions to form a stem, open a normal sequence view and: Select the two regions you want to force by pressing Ctrl while selecting - (use on Mac) | right-click the selection | Add Structure Prediction Constraints| Force Stem Here This will add an annotation labeled "Forced Stem" to the sequence (see figure 24.5).

CHAPTER 24. RNA STRUCTURE

692

Figure 24.4: Marginal probability of base pairs shown in linear view (top) and marginal probability of being unpaired shown in the secondary structure 2D view (bottom).

Figure 24.5: Force a stem of the selected bases. Using this procedure to add base pairing constraints will force the algorithm to compute minimum free energy and structure with a stem in the selected region. The two regions must be of equal length. To prohibit two regions to form a stem, open the sequence and: Select the two regions you want to prohibit by pressing Ctrl while selecting - (use on Mac) | right-click the selection | Add Structure Prediction Constraints | Prohibit Stem Here This will add an annotation labeled "Prohibited Stem" to the sequence (see figure 24.6).

Figure 24.6: Prohibit the selected bases from forming a stem.

CHAPTER 24. RNA STRUCTURE

693

Using this procedure to add base pairing constraints will force the algorithm to compute minimum free energy and structure without a stem in the selected region. Again, the two selected regions must be of equal length. To prohibit a region to be part of any base pair, open the sequence and: Select the bases you don't want to base pair | right-click the selection | Add Structure Prediction Constraints | Prohibit From Forming Base Pairs This will add an annotation labeled "No base pairs" to the sequence, see 24.7.

Figure 24.7: Prohibiting any of the selected base from pairing with other bases. Using this procedure to add base pairing constraints will force the algorithm to compute minimum free energy and structure without a base pair containing any residues in the selected region. When you click Predict secondary structure ( ) and click Next, check Apply base pairing constraints in order to force or prohibit stem regions or prohibit regions from forming base pairs. You can add multiple base pairing constraints, e.g. simultaneously adding forced stem regions and prohibited stem regions and prohibit regions from forming base pairs.

24.1.5

Structure as annotation

You can choose to add the elements of the best structure as annotations (see figure 24.8).

Figure 24.8: Annotations added for each structure element. This makes it possible to use the structure information in other analysis in the CLC Genomics Workbench. You can e.g. align different sequences and compare their structure predictions. Note that possibly existing structure annotation will be removed when a new structure is calculated and added as annotations. If you generate multiple structures, only the best structure will be added as annotations. If you wish to add one of the sub-optimal structures as annotations, this can be done from the Show Secondary Structure Table ( ) described in section 24.2.2.

CHAPTER 24. RNA STRUCTURE

694

24.2

View and edit secondary structures

When you predict RNA secondary structure (see section 24.1), the resulting predictions are attached to the sequence and can be shown as: Annotations in the ordinary sequence views (Linear sequence view ( ), Annotation table ( ) etc. This is only possible if this has been chosen in the dialog in figure 24.2. See an example in figure 24.8. Symbolic representation below the sequence (see section 24.2.3). A graphical view of the secondary structure (see section 24.2.1). A tabular view of the energy contributions of the elements in the structure. If more than one structure have been predicted, the table is also used to switch between the structures shown in the graphical view. The table is described in section 24.2.2.

24.2.1

Graphical view and editing of secondary structure

To show the secondary view of an already open sequence, click the Show Secondary Structure 2D View ( ) button at the bottom of the sequence view. If the sequence is not open, click Show ( ) and select Secondary Structure 2D View ( ).

This will open a view similar to the one shown in figure 24.9.

Figure 24.9: The secondary structure view of an RNA sequence zoomed in. Like the normal sequence view, you can use Zoom in ( ) and Zoom out ( ). Zooming in will reveal the residues of the structure as shown in figure 24.9. For large structures, zooming out will give you an overview of the whole structure. Side Panel settings The settings in the Side Panel are a subset of the settings in the normal sequence view described in section 10.1.1. However, there are two additional groups of settings unique to the secondary structure 2D view: Secondary structure.

CHAPTER 24. RNA STRUCTURE

695

Follow structure selection. This setting pertains to the connection between the structures in the secondary structure table ( ) . If this option is checked, the structure displayed in the secondary structure 2D view will follow the structure selections made in this table. See section 24.2.2 for more information. Layout strategy. Specify the strategy used for the layout of the structure. In addition to these strategies, you can also modify the layout manually as explained in the next section. Auto. The layout is adjusted to minimize overlapping structure elements [Han et al., 1999]. This is the default setting (see figure 24.10). Proportional. Arc lengths are proportional to the number of residues (see figure 24.11). Nothing is done to prevent overlap. Even spread. Stems are spread evenly around loops as shown in figure 24.12. Reset layout. If you have manually modified the layout of the structure, clicking this button will reset the structure to the way it was laid out when it was created.

Figure 24.10: Auto layout. Overlaps are minimized.

Figure 24.11: Proportional layout. Length of the arc is proportional to the number of residues in the arc.

Figure 24.12: Even spread. Stems are spread evenly around loops. Selecting and editing When you are in Selection mode ( sequence view: ), you can select parts of the structure like in a normal

CHAPTER 24. RNA STRUCTURE Press down the mouse button where the selection should start | move the mouse cursor to where the selection should end | release the mouse button

696

One of the advantages of the secondary structure 2D view is that it is integrated with other views of the same sequence. This means that any selection made in this view will be reflected in other views (see figure 24.13).

Figure 24.13: A split view of the secondary structure view and a linear sequence view. If you make a selection in another sequence view, this will will also be reflected in the secondary structure view. The CLC Genomics Workbench seeks to produce a layout of the structure where none of the elements overlap. However, it may be desirable to manually edit the layout of a structure for ease of understanding or for the purpose of publication. To edit a structure, first select the Pan ( ) mode in the Tool bar. Now place the mouse cursor on the opening of a stem, and a visual indication of the anchor point for turning the substructure will be shown (see figure 24.14).

Figure 24.14: The blue circle represents the anchor point for rotating the substructure. Click and drag to rotate the part of the structure represented by the line going from the anchor point. In order to keep the bases in a relatively sequential arrangement, there is a restriction

CHAPTER 24. RNA STRUCTURE

697

on how much the substructure can be rotated. The highlighted part of the circle represents the angle where rotating is allowed. In figure 24.15, the structure shown in figure 24.14 has been modified by dragging with the mouse.

Figure 24.15: The structure has now been rotated. Press Reset layout in the Side Panel to reset the layout to the way it looked when the structure was predicted.

24.2.2

Tabular view of structures and energy contributions

There are three main reasons to use the Secondary structure table: If more than one structure is predicted (see section 24.1), the table provides an overview of all the structures which have been predicted. With multiple structures you can use the table to determine which structure should be displayed in the Secondary structure 2D view (see section 24.2.1). The table contains a hierarchical display of the elements in the structure with detailed information about each element's energy contribution. To show the secondary structure table of an already open sequence, click the Show Secondary Structure Table ( ) button at the bottom of the sequence view. If the sequence is not open, click Show ( ) and select Secondary Structure Table ( ).

This will open a view similar to the one shown in figure 24.16. On the left side, all computed structures are listed with the information about structure name, when the structure was created, the free energy of the structure and the probability of the structure if the partition function was calculated. Selecting a row (equivalent: a structure) will display a tree of the contained substructures with their contributions to the total structure free energy. Each substructure contains a union of nested structure elements and other substructures (see a detailed description of the different structure elements in section 24.5.2). Each substructure

CHAPTER 24. RNA STRUCTURE

698

Figure 24.16: The secondary structure table with the list of structures to the left, and to the right the substructures of the selected structure. contributes a free energy given by the sum of its nested substructure energies and energies of its nested structure elements. The substructure elements to the right are ordered after their occurrence in the sequence; they are described by a region (the sequence positions covered by this substructure) and an energy contribution. Three examples of mixed substructure elements are "Stem base pairs", "Stem with bifurcation" and "Stem with hairpin". The "Stem base pairs"-substructure is simply a union of stacking elements. It is given by a joined set of base pair positions and an energy contribution displaying the sum of all stacking element-energies. The "Stem with bifurcation"-substructure defines a substructure enclosed by a specified base pair with and with energy contribution G. The substructure contains a "Stem base pairs"substructure and a nested bifurcated substructure (multi loop). Also bulge and interior loops can occur separating stem regions. The "Stem with hairpin"-substructure defines a substructure starting at a specified base pair with an enclosed substructure-energy given by G. The substructure contains a "Stem base pairs"-substructure and a hairpin loop. Also bulge and interior loops can occur, separating stem regions. In order to describe the tree ordering of different substructures, we use an example as a starting point (see figure 24.17). The structure is a (disjoint) nested union of a "Stem with bifurcation"-substructure and a dangling nucleotide. The nested substructure energies add up to the total energy. The "Stem with bifurcation"-substructure is again a (disjoint) union of a "Stem base pairs"-substructure joining position 1-7 with 64-70 and a multi loop structure element opened at base pair(7,64). To see these structure elements, simply expand the "Stem with bifurcation" node (see figure 24.18). The multi loop structure element is a union of three "Stem with hairpin"-substructures and contributions to the multi loop opening considering multi loop base pairs and multi loop arcs. Selecting an element in the table to the right will make a corresponding selection in the Show Secondary Structure 2D View ( ) if this is also open and if the "Follow structure selection" has been set in the editors side panel. In figure 24.18 the "Stem with bifurcation" is selected in the

CHAPTER 24. RNA STRUCTURE

699

Figure 24.17: A split view showing a structure table to the right and the secondary structure 2D view to the left.

Figure 24.18: Now the "Stem with bifurcation" node has been selected in the table and a corresponding selection has been made in the view of the secondary structure to the left. table, and this part of the structure is high-lighted in the Secondary Structure 2D view. The correspondence between the table and the structure editor makes it easy to inspect the thermodynamic details of the structure while keeping a visual overview as shown in the above figures. Handling multiple structures The table to the left offers a number of tools for working with structures. Select a structure, right-click, and the following menu items will be available: Open Secondary Structure in 2D View ( Secondary structure 2D view. ). This will open the selected structure in the

Annotate Sequence with Secondary Structure. This will add the structure elements as annotations to the sequence. Note that existing structure annotations will be removed. Rename Secondary Structure. This will allow you to specify a name for the structure to be

CHAPTER 24. RNA STRUCTURE displayed in the table. Delete Secondary Structure. This will delete the selected structure.

700

Delete All Secondary Structures. This will delete all the selected structures. Note that once you save and close the view, this operation is irreversible. As long as the view is open, you can Undo ( ) the operation.

24.2.3

Symbolic representation in sequence view

In the Side Panel of normal sequence views ( ), you will find an extra group under Nucleotide info called Secondary Structure. This is used to display a symbolic representation of the secondary structure along the sequence (see figure 24.19).

Figure 24.19: The secondary structure visualized below the sequence and with annotations shown above. The following options can be set: Show all structures. If more than one structure is predicted, this option can be used if all the structures should be displayed. Show first. If not all structures are shown, this can be used to determine the number of structures to be shown. Sort by. When you select to display e.g. four out of eight structures, this option determines which the "first four" should be. Sort by G. Sort by name. Sort by time of creation. If these three options do not provide enough control, you can rename the structures in a meaningful alphabetical way so that you can use the "name" to display the desired ones. Match symbols. How a base pair should be represented. No match symbol. How bases which are not part of a base pair should be represented.

CHAPTER 24. RNA STRUCTURE

701

Height. When you zoom out, this option determines the height of the symbols as shown in figure 24.20 (when zoomed in, there is no need for specifying the height). Base pair probability. See section 24.2.4 below). When you zoom in and out, the appearance of the symbols change. In figure 24.19, the view is zoomed in. In figure 24.20 you see the same sequence zoomed out to fit the width of the sequence.

Figure 24.20: The secondary structure visualized below the sequence and with annotations shown above. The view is zoomed out to fit the width of the sequence.

24.2.4

Probability-based coloring

In the Side Panel of both linear and secondary structure 2D views, you can choose to color structure symbols and sequence residues according to the probability of base pairing / not base pairing, as shown in figure 24.4. In the linear sequence view ( ), this is found in Nucleotide info under Secondary structure, and in the secondary structure 2D view ( ), it is found under Residue coloring. For both paired and unpaired bases, you can set the foreground color and the background color to a gradient with the color at the left side indicating a probability of 0, and the color at the right side indicating a probability of 1. Note that you have to Zoom to 100% ( ) in order to see the coloring.

24.3

Evaluate structure hypothesis

Hypotheses about an RNA structure can be tested using CLC Genomics Workbench. A structure hypothesis H is formulated using the structural constraint annotations described in section 24.1.4. By adding several annotations complex structural hypotheses can be formulated (see 24.21). Given the set S of all possible structures, only a subset of these SH will comply with the formulated hypotheses. We can now find the probability of H as:

CHAPTER 24. RNA STRUCTURE

702

P (sH ) P (H) =
sH SH

= P (s)

P FH , P Ffull

sS

where P FH is the partition function calculated for all structures permissible by H (SH ) and P Ffull is the full partition function. Calculating the probability can thus be done with two passes of the partition function calculation, one with structural constraints, and one without. 24.21.

Figure 24.21: Two constraints defining a structural hypothesis.

24.3.1

Selecting sequences for evaluation

) | Evaluate Structure Hypothesis ( )

The evaluation is started from the Toolbox: Toolbox | RNA Structure (

This opens the dialog shown in figure 24.22.

Figure 24.22: Selecting RNA or DNA sequences for evaluating structure hypothesis. If you have selected sequences before choosing the Toolbox action, they are now listed in the Selected Elements window of the dialog. Use the arrows to add or remove sequences or sequence lists from the selected elements. Note, that the selected sequences must contain a structure hypothesis in the form of manually added constraint annotations. Click Next to adjust evaluation parameters (see figure 24.23).

CHAPTER 24. RNA STRUCTURE The partition function algorithm includes a number of advanced options:

703

Avoid isolated base pairs. The algorithm filters out isolated base pairs (i.e. stems of length 1). Apply different energy rules for Grossly Asymmetric Interior Loops (GAIL). Compute the minimum free energy applying different rules for Grossly Asymmetry Interior Loops (GAIL). A Grossly Asymmetry Interior Loop (GAIL) is an interior loop that is 1 n or n 1 where n > 2 (see http://www.bioinfo.rpi.edu/~zukerm/lectures/RNAfold-html/ rnafold-print.pdf). Include coaxial stacking energy rules. Include free energy increments of coaxial stacking for adjacent helices [Mathews et al., 2004].

Figure 24.23: Adjusting parameters for hypothesis evaluation.

24.3.2

Probabilities

After evaluation of the structure hypothesis an annotation is added to the input sequence. This annotation covers the same region as the annotations that constituted the hypothesis and contains information about the probability of the evaluated hypothesis (see figure 24.24).

Figure 24.24: This hypothesis has a probability of 0.338 as shown in the annotation.

CHAPTER 24. RNA STRUCTURE

704

24.4

Structure Scanning Plot

In CLC Genomics Workbench it is possible to scan larger sequences for the existence of local conserved RNA structures. The structure scanning approach is similar in spirit to the works of [Workman and Krogh, 1999] and [Clote et al., 2005]. The idea is that if natural selection is operating to maintain a stable local structure in a given region, then the minimum free energy of the region will be markedly lower than the minimum free energy found when the nucleotides of the subsequence are distributed in random order. The algorithm works by sliding a window along the sequence. Within the window, the minimum free energy of the subsequence is calculated. To evaluate the significance of the local structure signal its minimum free energy is compared to a background distribution of minimum free energies obtained from shuffled sequences, using Z-scores [Rivas and Eddy, 2000]. The Z-score statistics corresponds to the number of standard deviations by which the minimum free energy of the original sequence deviates from the average energy of the shuffled sequences. For a given Z-score, the statistical significance is evaluated as the probability of observing a more extreme Z-score under the assumption that Z-scores are normally distributed [Rivas and Eddy, 2000].

24.4.1

Selecting sequences for scanning

) | Evaluate Structure Hypothesis ( )

The scanning is started from the Toolbox: Toolbox | RNA Structure (

This opens the dialog shown in figure 24.25.

Figure 24.25: Selecting RNA or DNA sequences for structure scanning. If you have selected sequences before choosing the Toolbox action, they are now listed in the Selected Elements window of the dialog. Use the arrows to add or remove sequences or sequence lists from the selected elements. Click Next to adjust scanning parameters (see figure 24.26). The first group of parameters pertain to the methods of sequence resampling. There are four ways of resampling, all described in detail in [Clote et al., 2005]: Mononucleotide shuffling. Shuffle method generating a sequence of the exact same mononucleotide frequency

CHAPTER 24. RNA STRUCTURE

705

Dinucleotide shuffling. Shuffle method generating a sequence of the exact same dinucleotide frequency Mononucleotide sampling from zero order Markov chain. Resampling method generating a sequence of the same expected mononucleotide frequency. Dinucleotide sampling from first order Markov chain. Resampling method generating a sequence of the same expected dinucleotide frequency. The second group of parameters pertain to the scanning settings and include: Window size. The width of the sliding window. Number of samples. The number of times the sequence is resampled to produce the background distribution. Step increment. Step increment when plotting sequence positions against scoring values. The third parameter group contains the output options: Z-scores. Create a plot of Z-scores as a function of sequence position. P-values. Create a plot of the statistical significance of the structure signal as a function of sequence position.

Figure 24.26: Adjusting parameters for structure scanning.

24.4.2

The structure scanning result

The output of the analysis are plots of Z-scores and probabilities as a function of sequence position. A strong propensity for local structure can be seen as spikes in the graphs (see figure 24.27).

CHAPTER 24. RNA STRUCTURE

706

Figure 24.27: A plot of the Z-scores produced by sliding a window along a sequence.

24.5

Bioinformatics explained: RNA structure prediction by minimum free energy minimization

RNA molecules are hugely important in the biology of the cell. Besides their rather simple role as an intermediate messenger between DNA and protein, RNA molecules can have a plethora of biologic functions. Well known examples of this are the infrastructural RNAs such as tRNAs,rRNAs and snRNAs, but the existence and functionality of several other groups of non-coding RNAs are currently being discovered. These include micro- (miRNA), small interfering- (siRNA), Piwi interacting- (piRNA) and small modulatory RNAs (smRNA) [Costa, 2007]. A common feature of many of these non-coding RNAs is that the molecular structure is important for the biological function of the molecule. Ideally, biological function is best interpreted against a 3D structure of an RNA molecule. However, 3D structure determination of RNA molecules is time-consuming, expensive, and difficult [Shapiro et al., 2007] and there is therefore a great disparity between the number of known RNA sequences and the number of known RNA 3D structures. However, as it is the case for proteins, RNA tertiary structures can be characterized by secondary structural elements. These are defined by hydrogen bonds within the molecule that form several recognizable "domains" of secondary structure like stems, hairpin loops, bulges and internal loops (see below). Furthermore, the high degree of base-pair conservation observed in the evolution of RNA molecules shows that a large part of the functional information is actually contained in the secondary structure of the RNA molecule. Fortunately, RNA secondary structure can be computationally predicted from sequence data allowing researchers to map sequence information to functional information. The subject of this

CHAPTER 24. RNA STRUCTURE

707

paper is to describe a very popular way of doing this, namely free energy minimization. For an in-depth review of algorithmic details, we refer the reader to [Mathews and Turner, 2006].

24.5.1

The algorithm

Consider an RNA molecule and one of its possible structures S1 . In a stable solution there will be an equilibrium between unstructured RNA strands and RNA strands folded into S1 . The propensity of a strand to leave a structure such as S1 (the stability of S1 ), is determined by the free energy change involved in its formation. The structure with the lowest free energy (Smin ) is the most stable and will also be the most represented structure at equilibrium. The objective of minimum free energy (MFE) folding is therefore to identify Smin amongst all possible structures. In the following, we only consider structures without pseudoknots, i.e. structures that do not contain any non-nested base pairs. Under this assumption, a sequence can be folded into a single coherent structure or several sequential structures that are joined by unstructured regions. Each of these structures is a union of well described structure elements (see below for a description of these). The free energy for a given structure is calculated by an additive nearest neighbor model. Additive, means that the total free energy of a secondary structure is the sum of the free energies of its individual structural elements. Nearest neighbor, means that the free energy of each structure element depends only on the residues it contains and on the most adjacent Watson-Crick base pairs. The simplest method to identify Smin would be to explicitly generate all possible structures, but it can be shown that the number of possible structures for a sequence grows exponentially with the sequence length [Zuker and Sankoff, 1984] leaving this approach unfeasible. Fortunately, a two step algorithm can be constructed which implicitly surveys all possible structures without explicitly generating the structures [Zuker and Stiegler, 1981]: The first step determines the free energy for each possible sequence fragment starting with the shortest fragments. Here, the lowest free energy for longer fragments can be expediently calculated from the free energies of the smaller sub-sequences they contain. When this process reaches the longest fragment, i.e., the complete sequence, the MFE of the entire molecule is known. The second step is called traceback, and uses all the free energies computed in the first step to determine Smin - the exact structure associated with the MFE. Acceptable calculation speed is achieved by using dynamic programming where sub-sequence results are saved to avoid recalculation. However, this comes at the price of a higher requirement for computer memory. The structure element energies that are used in the recursions of these two steps, are derived from empirical calorimetric experiments performed on small molecules see e.g. [Mathews et al., 1999]. Suboptimal structures determination A number of known factors violate the assumptions that are implicit in MFE structure prediction. [Schroeder et al., 1999] and [Chen et al., 2004] have shown experimental indications that the thermodynamic parameters are sequence dependent. Moreover, [Longfellow et al., 1990] and [Kierzek et al., 1999], have demonstrated that some structural elements show non-nearest neighbor effects. Finally, single stranded nucleotides in multi loops are known to influence stability [Mathews and Turner, 2002]. These phenomena can be expected to limit the accuracy of RNA secondary structure prediction

CHAPTER 24. RNA STRUCTURE

708

by free energy minimization and it should be clear that the predicted MFE structure may deviate somewhat from the actual preferred structure of the molecule. This means that it may be informative to inspect the landscape of suboptimal structures which surround the MFE structure to look for general structural properties which seem to be robust to minor variations in the total free energy of the structure. An effective procedure for generating a sample of suboptimal structures is given in [Zuker, 1989a]. This algorithm works by going through all possible Watson-Crick base pair in the molecule. For each of these base pairs, the algorithm computes the most optimal structure among all the structures that contain this pair, see figure 24.28.

Figure 24.28: A number of suboptimal structures have been predicted using CLC Genomics Workbench and are listed at the top left. At the right hand side, the structural components of the selected structure are listed in a hierarchical structure and on the left hand side the structure is displayed.

CHAPTER 24. RNA STRUCTURE

709

24.5.2

Structure elements and their energy contribution

In this section, we classify the structure elements defining a secondary structure and describe their energy contribution.

Figure 24.29: The different structure elements of RNA secondary structures predicted with the free energy minimization algorithm in CLC Genomics Workbench. See text for a detailed description. Nested structure elements The structure elements involving nested base pairs can be classified by a given base pair and the other base pairs that are nested and accessible from this pair. For a more elaborate description we refer the reader to [Sankoff et al., 1983] and [Zuker and Sankoff, 1984]. If the nucleotides with position number (i, j) form a base pair and i < k, l < j, then we say that the base pair (k, l) is accessible from (i, j) if there is no intermediate base pair (i , j ) such that i < i < k, l < j < j. This means that (k, l) is nested within the pair i, j and there is no other base pair in between.

CHAPTER 24. RNA STRUCTURE

710

Using the number of accessible pase pairs, we can define the following distinct structure elements: 1. Hairpin loop ( ). A base pair with 0 other accessible base pairs forms a hairpin loop. The energy contribution of a hairpin is determined by the length of the unpaired (loop) region and the two bases adjacent to the closing base pair which is termed a terminal mismatch (see figure 24.29A). 2. A base pair with 1 accessible base pair can give rise to three distinct structure elements: Stacking of base pairs ( ). A stacking of two consecutive pairs occur if i i = 1 = j j . Only canonical base pairs (A U or G C or G U ) are allowed (see figure 24.29B). The energy contribution is determined by the type and order of the two base pairs. Bulge ( ). A bulge loop occurs if i i > 1 or j j > 1, but not both. This means that the two base pairs enclose an unpaired region of length 0 on one side and an unpaired region of length 1 on the other side (see figure 24.29C). The energy contribution of a bulge is determined by the length of the unpaired (loop) region and the two closing base pairs. Interior loop ( ).An interior loop occurs if both i i > 1 and i j > 1 This means that the two base pairs enclose an unpaired region of length 1 on both sides (see figure 24.29D). The energy contribution of an interior loop is determined by the length of the unpaired (loop) region and the four unpaired bases adjacent to the opening- and the closing base pair. 3. Multi loop opened ( ). A base pair with more than two accessible base pairs gives rise to a multi loop, a loop from which three or more stems are opened (see figure 24.29E). The energy contribution of a multi loop depends on the number of Stems opened in multi-loop ( ) that protrude from the loop. Other structure elements A collection of single stranded bases not accessible from any base pair is called an exterior (or external) loop (see figure 24.29F). These regions do not contribute to the total free energy. Dangling nucleotide ( ). A dangling nucleotide is a single stranded nucleotide that forms a stacking interaction with an adjacent base pair. A dangling nucleotide can be a 3 or 5 -dangling nucleotide depending on the orientation (see figure 24.29G). The energy contribution is determined by the single stranded nucleotide, its orientation and on the adjacent base pair. Non-GC terminating stem ( ). If a base pair other than a G-C pair is found at the end of a stem, an energy penalty is assigned (see figure 24.29H). Coaxial interaction ( ). Coaxial stacking is a favorable interaction of two stems where the base pairs at the ends can form a stacking interaction. This can occur between stems in a multi loop and between the stems of two different sequential structures. Coaxial stacking can occur between stems with no intervening nucleotides (adjacent stems) and between stems with one intervening nucleotide from each strand (see figure 24.29I). The energy contribution is determined by the adjacent base pairs and the intervening nucleotides.

CHAPTER 24. RNA STRUCTURE Experimental constraints

711

A number of techniques are available for probing RNA structures. These techniques can determine individual components of an existing structure such as the existence of a given base pair. It is possible to add such experimental constraints to the secondary structure prediction based on free energy minimization (see figure 24.30) and it has been shown that this can dramatically increase the fidelity of the secondary structure prediction [Mathews and Turner, 2006].

Figure 24.30: Known structural features can be added as constraints to the secondary structure prediction algorithm in CLC Genomics Workbench.

Creative Commons License

All CLC bio's scientific articles are licensed under a Creative Commons Attribution-NonCommercialNoDerivs 2.5 License. You are free to copy, distribute, display, and use the work for educational purposes, under the following conditions: You must attribute the work in its original form and "CLC bio" has to be clearly labeled as author and provider of the work. You may not use this work for commercial purposes. You may not alter, transform, nor build upon this work.

See http://creativecommons.org/licenses/by-nc-nd/2.5/ for more information on how to use the contents.

Part IV

Appendix

712

Appendix A

Comparison of workbenches
Below we list a number of functionalities that differ between CLC Workbenches and the CLC Sequence Viewer: CLC Sequence Viewer ( ) CLC Protein Workbench ( ) CLC DNA Workbench ( ) CLC RNA Workbench ( ) CLC Main Workbench ( ) CLC Genomics Workbench ( ) Data handling Add multiple locations to Navigation Area Share data on network drive Search all your data Assembly of sequencing data Advanced contig assembly Importing and viewing trace data Trim sequences Assemble without use of reference sequence Map to reference sequence Assemble to existing contig Viewing and edit contigs Tabular view of an assembled contig (easy data overview) Secondary peak calling Multiplexing based on barcode or name Viewer Protein DNA RNA Main Genomics

Viewer

Protein

DNA

RNA

Main

Genomics

713

APPENDIX A. COMPARISON OF WORKBENCHES Next-generation Sequencing Data Analysis Import of 454, Illumina Genome Analyzer, SOLiD and Helicos data Reference assembly of human-size genomes De novo assembly SNP/DIP detection Graphical display of large contigs Support for mixed-data assembly Paired data support RNA-Seq analysis Expression profiling by tags ChIP-Seq analysis Expression Analysis Import of Illumina BeadChip, Affymetrix, GEO data Import of Gene Ontology annotation files Import of Custom expression data table and Custom annotation files Multigroup comparisons Advanced plots: scatter plot, volcano plot, box plot and MA plot Hierarchical clustering Statistical analysis on count-based and gaussian data Annotation tests Principal component analysis (PCA) Hierarchical clustering and heat maps Analysis of RNA-Seq/Tag profiling samples Molecular cloning Advanced molecular cloning Graphical display of in silico cloning Advanced sequence manipulation Database searches GenBank Entrez searches UniProt searches (Swiss-Prot/TrEMBL) Web-based sequence search using BLAST BLAST on local database Creation of local BLAST database PubMed lookup Web-based lookup of sequence data Search for structures (at NCBI) Viewer Protein DNA RNA Main

714 Genomics

Viewer

Protein

DNA

RNA

Main

Genomics

Viewer

Protein

DNA

RNA

Main

Genomics

Viewer

Protein

DNA

RNA

Main

Genomics

APPENDIX A. COMPARISON OF WORKBENCHES General sequence analyses Linear sequence view Circular sequence view Text based sequence view Editing sequences Adding and editing sequence annotations Advanced annotation table Join multiple sequences into one Sequence statistics Shuffle sequence Local complexity region analyses Advanced protein statistics Comprehensive protein characteristics report Nucleotide analyses Basic gene finding Reverse complement without loss of annotation Restriction site analysis Advanced interactive restriction site analysis Translation of sequences from DNA to proteins Interactive translations of sequences and alignments G/C content analyses and graphs Protein analyses 3D molecule view Hydrophobicity analyses Antigenicity analysis Protein charge analysis Reverse translation from protein to DNA Proteolytic cleavage detection Prediction of signal peptides (SignalP) Transmembrane helix prediction (TMHMM) Secondary protein structure prediction PFAM domain search Viewer Protein DNA RNA Main

715 Genomics

Viewer

Protein

DNA

RNA

Main

Genomics

Viewer

Protein

DNA

RNA

Main

Genomics

APPENDIX A. COMPARISON OF WORKBENCHES Sequence alignment Multiple sequence alignments (Two algorithms) Advanced re-alignment and fix-point alignment options Advanced alignment editing options Join multiple alignments into one Consensus sequence determination and management Conservation score along sequences Sequence logo graphs along alignments Gap fraction graphs Copy annotations between sequences in alignments Pairwise comparison RNA secondary structure Advanced prediction of RNA secondary structure Integrated use of base pairing constraints Graphical view and editing of secondary structure Info about energy contributions of structure elements Prediction of multiple sub-optimal structures Evaluate structure hypothesis Structure scanning Partition function Dot plots Dot plot based analyses Phylogenetic trees Neighbor-joining and UPGMA phylogenies Maximum likelihood phylogeny of nucleotides Pattern discovery Search for sequence match Motif search for basic patterns Motif search with regular expressions Motif search with ProSite patterns Pattern discovery Viewer Protein DNA RNA Main

716 Genomics

Viewer

Protein

DNA

RNA

Main

Genomics

Viewer Viewer

Protein Protein

DNA DNA

RNA RNA

Main Main

Genomics Genomics

Viewer

Protein

DNA

RNA

Main

Genomics

APPENDIX A. COMPARISON OF WORKBENCHES Primer design Advanced primer design tools Detailed primer and probe parameters Graphical display of primers Generation of primer design output Support for Standard PCR Support for Nested PCR Support for TaqMan PCR Support for Sequencing primers Alignment based primer design Alignment based TaqMan probedesign Match primer with sequence Ordering of primers Advanced analysis of primer properties Molecular cloning Advanced molecular cloning Graphical display of in silico cloning Advanced sequence manipulation Virtual gel view Fully integrated virtual 1D DNA gel simulator Viewer Protein DNA RNA Main

717 Genomics

Viewer

Protein

DNA

RNA

Main

Genomics

Viewer

Protein

DNA

RNA

Main

Genomics

For a more detailed comparison, we refer to http://www.clcbio.com/compare.

Appendix B

Graph preferences
This section explains the view settings of graphs. The Graph preferences at the top of the Side Panel includes the following settings: Lock axes. This will always show the axes even though the plot is zoomed to a detailed level. Frame. Shows a frame around the graph. Show legends. Shows the data legends. Tick type. Determine whether tick lines should be shown outside or inside the frame. Outside Inside Tick lines at. Choosing Major ticks will show a grid behind the graph. None Major ticks Horizontal axis range. Sets the range of the horizontal axis (x axis). Enter a value in Min and Max, and press Enter. This will update the view. If you wait a few seconds without pressing Enter, the view will also be updated. Vertical axis range. Sets the range of the vertical axis (y axis). Enter a value in Min and Max, and press Enter. This will update the view. If you wait a few seconds without pressing Enter, the view will also be updated. X-axis at zero. This will draw the x axis at y = 0. Note that the axis range will not be changed. Y-axis at zero. This will draw the y axis at x = 0. Note that the axis range will not be changed. Show as histogram. For some data-series it is possible to see the graph as a histogram rather than a line plot.

718

APPENDIX B. GRAPH PREFERENCES The Lines and plots below contains the following settings: Dot type None Cross Plus Square Diamond Circle Triangle Reverse triangle Dot

719

Dot color. Allows you to choose between many different colors. Click the color box to select a color. Line width Thin Medium Wide Line type None Line Long dash Short dash Line color. Allows you to choose between many different colors. Click the color box to select a color. For graphs with multiple data series, you can select which curve the dot and line preferences should apply to. This setting is at the top of the Side Panel group. Note that the graph title and the axes titles can be edited simply by clicking with the mouse. These changes will be saved when you Save ( ) the graph - whereas the changes in the Side Panel need to be saved explicitly (see section 5.6). For more information about the graph view, please see section B.

Appendix C

Working with tables

Tables are used in a lot of places in the CLC Genomics Workbench. The contents of the tables are of course different depending on the context, but there are some general features for all tables that will be explained in the following. Figure C.1 shows an example of a typical table. This is the table result of Find Open Reading Frames ( ). We will use this table as an example in the following to illustrate the concepts that are relevant for all kinds of tables.

Figure C.1: A table showing open reading frames. First of all, the columns of the table are listed in the Side Panel to the right of the table. By clicking the checkboxes you can hide/show the columns in the table. Furthermore, you can sort the table by clicking on the column headers. (Pressing Ctrl - while you click will refine the existing sorting). on Mac

720

APPENDIX C. WORKING WITH TABLES

721

C.1

Filtering tables

The final concept to introduce is Filtering. The table filter as an advanced and a simple mode. The simple mode is the default and is applied simply by typing text or numbers (see an example in figure C.2).

Figure C.2: Typing "neg" in the filter in simple mode. Typing "neg" in the filter will only show the rows where "neg" is part of the text in any of the columns (also the ones that are not shown). The text does not have to be in the beginning, thus "ega" would give the same result. This simple filter works fine for fast, textual and non-complicated filtering and searching. However, if you wish to make use of numerical information or make more complex filters, you can switch to the advanced mode by clicking the Advanced filter ( ) button. The advanced filter is structure in a different way: First of all, you can have more than one criterion in the filter. Criteria can be added or removed by clicking the Add ( ) or Remove ( ) buttons. At the top, you can choose whether all the criteria should be fulfilled (Match all), or if just one of the needs to be fulfilled (Match any). For each filter criterion, you first have to select which column it should apply to. Next, you choose an operator. For numbers, you can choose between: = (equal to) < (smaller than) > (greater than) <> (not equal to) abs. value < (absolute value smaller than. This is useful if it doesn't matter whether the number is negative or positive) abs. value > (absolute value greater than. This is useful if it doesn't matter whether the number is negative or positive) For text-based columns, you can choose between: contains (the text does not have to be in the beginning) doesn't contain

APPENDIX C. WORKING WITH TABLES = (the whole text in the table cell has to match, also lower/upper case) Once you have chosen an operator, you can enter the text or numerical value to use.

722

If you wish to reset the filter, simply remove ( ) all the search criteria. Note that the last one will not disappear - it will be reset and allow you to start over. Figure C.3 shows an example of an advanced filter which displays the open reading frames larger than 400 that are placed on the negative strand.

Figure C.3: The advanced filter showing open reading frames larger than 400 that are placed on the negative strand. Both for the simple and the advanced filter, there is a counter at the upper left corner which tells you the number of rows that pass the filter (91 in figure C.2 and 15 in figure C.3).

Appendix D

BLAST databases
Several databases are available at NCBI, which can be selected to narrow down the possible BLAST hits.

D.1

Peptide sequence databases

nr. Non-redundant GenBank CDS translations + PDB + SwissProt + PIR + PRF, excluding those in env_nr. refseq. Protein sequences from NCBI Reference Sequence project http://www.ncbi. nlm.nih.gov/RefSeq/. swissprot. Last major release of the SWISS-PROT protein sequence database (no incremental updates). pat. Proteins from the Patent division of GenBank. pdb. Sequences derived from the 3-dimensional structure records from the Protein Data Bank http://www.rcsb.org/pdb/. env_nr. Non-redundant CDS translations from env_nt entries. month. All new or revised GenBank CDS translations + PDB + SwissProt + PIR + PRF released in the last 30 days..

D.2

Nucleotide sequence databases

nr. All GenBank + EMBL + DDBJ + PDB sequences (but no EST, STS, GSS, or phase 0, 1 or 2 HTGS sequences). No longer "non-redundant" due to computational cost. refseq_rna. mRNA sequences from NCBI Reference Sequence Project. refseq_genomic. Genomic sequences from NCBI Reference Sequence Project. est. Database of GenBank + EMBL + DDBJ sequences from EST division. est_human. Human subset of est. 723

APPENDIX D. BLAST DATABASES est_mouse. Mouse subset of est. est_others. Subset of est other than human or mouse.

724

gss. Genome Survey Sequence, includes single-pass genomic data, exon-trapped sequences, and Alu PCR sequences. htgs. Unfinished High Throughput Genomic Sequences: phases 0, 1 and 2. Finished, phase 3 HTG sequences are in nr. pat. Nucleotides from the Patent division of GenBank. pdb. Sequences derived from the 3-dimensional structure records from Protein Data Bank. They are NOT the coding sequences for the corresponding proteins found in the same PDB record. month. All new or revised GenBank+EMBL+DDBJ+PDB sequences released in the last 30 days. alu. Select Alu repeats from REPBASE, suitable for masking Alu repeats from query sequences. See "Alu alert" by Claverie and Makalowski, Nature 371: 752 (1994). dbsts. Database of Sequence Tag Site entries from the STS division of GenBank + EMBL + DDBJ. chromosome. Complete genomes and complete chromosomes from the NCBI Reference Sequence project. It overlaps with refseq_genomic. wgs. Assemblies of Whole Genome Shotgun sequences. env_nt. Sequences from environmental samples, such as uncultured bacterial samples isolated from soil or marine samples. The largest single source is Sagarsso Sea project. This does overlap with nucleotide nr.

D.3

Adding more databases

Besides the databases that are part of the default configuration, you can add more databases located at NCBI by configuring files in the Workbench installation directory. The list of databases that can be added is here: http://www.ncbi.nlm.nih.gov/staff/ tao/URLAPI/remote_blastdblist.html. In order to add a new database, find the settings folder in the Workbench installation directory (e.g. C:\Program files\CLC Genomics Workbench 4). Download unzip and place the following files in this directory to replace the built-in list of databases:

Nucleotide databases: http://www.clcbio.com/wbsettings/NCBI_BlastNucleotideDatabas properties.zip Protein databases: http://www.clcbio.com/wbsettings/NCBI_BlastProteinDatabases. properties.zip

Open the file you have downloaded into thesettings folder, e.g. NCBI_BlastProteinDatabases.propert in a text editor and you will see the contents look like this:

APPENDIX D. BLAST DATABASES

725

nr[clcdefault] = Non-redundant protein sequences refseq_protein = Reference proteins swissprot = Swiss-Prot protein sequences pat = Patented protein sequences pdb = Protein Data Bank proteins env_nr = Environmental samples month = New or revised GenBank sequences Simply add another database as a new line with the first item being the database name taken from http://www.ncbi.nlm.nih.gov/staff/tao/URLAPI/remote_blastdblist.html and the second part is the name to display in the Workbench. Restart the Workbench, and the new database will be visible in the BLAST dialog.

Appendix E

Proteolytic cleavage enzymes

Most proteolytic enzymes cleave at distinct patterns. Below is a compiled list of proteolytic enzymes used in CLC Genomics Workbench.

726

APPENDIX E. PROTEOLYTIC CLEAVAGE ENZYMES Name Cyanogen bromide (CNBr) Asp-N endopeptidase Arg-C Lys-C Trypsin Trypsin Trypsin Trypsin* Trypsin* Trypsin* Trypsin* Chymotrypsin-high spec. Chymotrypsin-high spec. Chymotrypsin-low spec. Chymotrypsin-low spec. Chymotrypsin-low spec. Chymotrypsin-low spec. o-Iodosobenzoate Thermolysin Post-Pro Glu-C Asp-N Proteinase K P4 P3 P2 W M C, D C C R H, K, R P1 M R K K, R K R K K R R F, Y W F, L, Y W M H W not D, E P E A, E, F, I, L, T, V, W, Y R D R R P1' D not P P P D H, Y K H,R not P not M, P not P not M, P not P, Y not D, M, P, W A, F, I, L, M or V not P D P2' -

727

Factor Xa Granzyme B Thrombin Thrombin

A, F, G, I, L, T, V, M I A, F, G, I, L, T, V, M -

D,E E A, F, G, I, L, T, V, W, A Y

G P G P

G not D, E

not D, E

TEV (Tobacco Etch Virus)

G, S

Appendix F

Restriction enzymes database configuration

CLC Genomics Workbench uses enzymes from the REBASE restriction enzyme database at http://rebase.neb.com. If you wish to add enzymes to this list, you can do this by manually using the procedure described here. Note! Please be aware that this process needs to be handled carefully, otherwise you may have to re-install the Workbench to get it to work. First, download the following file: http://www.clcbio.com/wbsettings/link_emboss_ e_custom. In the Workbench installation folder under settings, create a folder named rebase and place the extracted link_emboss_e_custom file here. Open the file in a text editor. The top of the file contains information about the format, and at the bottom there are two example enzymes that you should replace with your own. Restart the Workbench to have the changes take effect.

728

Appendix G

Technical information about modifying Gateway cloning sites

The CLC Genomics Workbench comes with a pre-defined list of Gateway recombination sites. These sites and the recombination logics can be modified by downloading and editing a properties file. Note that this is a technical procedure only needed if the built-in functionality is not sufficient for your needs. The properties file can be downloaded from http://www.clcbio.com/wbsettings/gatewaycloning. zip. Extract the file included in the zip archive and save it in the settings folder of the Workbench installation folder. The file you download contains the standard configuration. You should thus update the file to match your specific needs. See the comments in the file for more information. The name of the properties file you download is gatewaycloning.1.properties. You can add several files with different configurations by giving them a different number, e.g. gatewaycloning.2.properties and so forth. When using the Gateway tools in the Workbench, you will be asked which configuration you want to use (see figure G.1). Note that you need to restart the Workbench after editing or adding the files for the changes to take effect.

729

APPENDIX G. TECHNICAL INFORMATION ABOUT MODIFYING GATEWAY CLONING SITES

730

Figure G.1: Selecting between different gateway cloning configurations.

Appendix H

IUPAC codes for amino acids

(Single-letter codes based on International Union of Pure and Applied Chemistry) The information is gathered from: http://www.ebi.ac.uk/2can/tutorials/aa.html One-letter abbreviation A R N D C Q E G H J L I K M F P O U S T W Y V B Z X Three-letter abbreviation Ala Arg Asn Asp Cys Gln Glu Gly His Xle Leu ILe Lys Met Phe Pro Pyl Sec Ser Thr Trp Tyr Val Asx Glx Xaa Description Alanine Arginine Asparagine Aspartic acid Cysteine Glutamine Glutamic acid Glycine Histidine Leucine or Isoleucineucine Leucine Isoleucine Lysine Methionine Phenylalanine Proline Pyrrolysine Selenocysteine Serine Threonine Tryptophan Tyrosine Valine Aspartic acid or Asparagine Asparagine Glutamic acid or Glutamine Glutamine Any amino acid

731

Appendix I

IUPAC codes for nucleotides

(Single-letter codes based on International Union of Pure and Applied Chemistry) The information is gathered from: http://www.iupac.org and http://www.ebi.ac.uk/ 2can/tutorials/aa.html. Code A C G T U R Y M K W S B D H V N Description Adenine Cytosine Guanine Thymine Uracil Purine (A or G) Pyrimidine (C, T, or U) C or A T, U, or G T, U, or A C or G C, T, U, or G (not A) A, T, U, or G (not C) A, T, U, or C (not G) A, C, or G (not T, not U) Any base (A, C, G, T, or U)

732

Appendix J

Formats for import and export

J.1 List of bioinformatic data formats

Below is a list of bioinformatic data formats, i.e. formats for importing and exporting sequences, alignments and trees.

J.1.1

Sequence data formats

Note that high-throughput sequencing data formats from Illumina Genome Analyzer, SOLiD, 454 and also high-throughput fasta and trace files are imported using a special import as described in section 19.1. These data can also be exported in fastq format (using NCBI/Sanger Phred quality scores).

733

APPENDIX J. FORMATS FOR IMPORT AND EXPORT

734

File type FASTA AB1 ABI CLC Clone Manager CSV export CSV import DNAstrider DS Gene Embl GCG sequence GenBank Gene Construction Kit Lasergene Nexus Phred PIR (NBRF) Raw sequence SCF2 SCF3 Staden Swiss-Prot Tab delimited text Vector NTI archives Vector NTI Database Zip export Zip import

Suffix .fsa/.fasta .ab1 .abi .clc .cm5 .csv .csv .str/.strider .bsml .embl .gcg .gbk/.gb/.gp .gck .pro/.seq .nxs/.nexus .phd .pir any .scf .scf .sdn .swp .txt

Import X X X X X

Export X

Description Simple format, name & description Including chromatograms Including chromatograms

Rich format including all information

X X X X X X X X X X X X X X X X X X X X X X X X

Annotations in csv format One sequence per line: name; description(optional); sequence

Only nucleotide sequence Rich information incl. annotations Rich information incl. annotations

Including chromatograms Simple format, name & description Only sequence (no name) Including chromatograms Including chromatograms

Rich information (only proteins) Annotations in tab delimited text format Archives in rich format Special import full database

.ma4/.pa4/.oa4 X X .zip .zip/.gzip./.tar X X

Selected files in CLC format Contained files/folder structure

APPENDIX J. FORMATS FOR IMPORT AND EXPORT

735

J.1.2

Read mapping formats

Suffix .ace .bam .clc .cas .sam .txt .zip X Import X X X X X X X X Export X X X Description No chromatogram or quality score See details in section 19.1.9 Rich format including all information Output from the CLC Assembly Cell See details in section 19.1.9 See details in section 19.1.10 Selected files in CLC format Contained files/folder structure

File type ACE BAM (Compressed version of SAM) CLC CLC Assembly File SAM (Sequence Alignment/Map) Tabular assembly (e.g. ELAND) Zip export

Zip import .zip Special notes for SAM/BAM export:

Broken pairs on RNA-seq samples are always exported as single reads. Broken pairs are only exported as paired if both reads map on the same gene.

J.1.3

Alignment formats
Suffix .clc .aln .msf .nxs/.nexus .phy .zip .zip/.gzip./.tar X Import X X X X X Export X X X X X X Selected files in CLC format Contained files/folder structure Description Rich format including all information

File type CLC Clustal Alignment GCG Alignment Nexus Phylip Alignment Zip export Zip import

J.1.4

Tree formats
Suffix .clc .nwk .nxs/.nexus .zip .zip/.gzip./.tar X Import X X X Export X X X X Selected files in CLC format Contained files/folder structure Description Rich format including all information

File type CLC Newick Nexus Zip export Zip import

APPENDIX J. FORMATS FOR IMPORT AND EXPORT

736

J.1.5

Expression data formats

Import X X X X X X X X X X X X X X Export

Read about technical details of these data formats in section L. File type Affymetrix CHP Affymetrix pivot/metric Affymetrix NetAffx CLC CSV Excel Generic Generic GEO soft sample/series Illumina Tab delimited Zip export Zip import Suffix .chp/.psi .txt/.csv .csv .clc .csv .xls/.xlsx .txt/.csv .txt/.csv .txt/.csv .txt .txt .zip .zip/.gzip./.tar Description Expression values and annotations Gene-level expression values Annotations Rich format including all information Samples and experiments, All tables and reports expression values annotations Expression values Expression values and annotations Samples and experiments, Selected files in CLC format Contained files/folder structure

J.1.6

Miscellaneous formats
Suffix .phr/.nhr .clc .csv .xls/.xlsx .gff .cif .pdb .ct, .col, .rnaml/.xml .txt .txt .zip .zip/.gzip./.tar X X X X X x X X X Import X X X X X X Export Description Link to database imported Rich format including all information All tables All tables and reports See http://www.clcbio.com/ annotate-with-gff 3D structure 3D structure Secondary structure for RNA All tables All data in a textual format Selected files in CLC format Contained files/folder structure

File type BLAST Database CLC CSV Excel GFF mmCIF PDB RNA structures Tab delimited Text Zip export Zip import

APPENDIX J. FORMATS FOR IMPORT AND EXPORT

737

Note! The Workbench can import 'external' files, too. This means that all kinds of files can be imported and displayed in the Navigation Area, but the above mentioned formats are the only ones whose contents can be shown in the Workbench.

J.2

List of graphics data formats

Below is a list of formats for exporting graphics. All data displayed in a graphical format can be exported using these formats. Data represented in lists and tables can only be exported in .pdf format (see section 7.3 for further details). Format Portable Network Graphics JPEG Tagged Image File PostScript Encapsulated PostScript Portable Document Format Scalable Vector Graphics Suffix .png .jpg .tif .ps .eps .pdf .svg Type bitmap bitmap bitmap vector graphics vector graphics vector graphics vector graphics

Appendix K

SAM/BAM export format specification

K.1 SAM Specification

The workbench aims to import and export SAM and BAM files in accordance to the v1.4-r962 version of the SAM specification. This appendix describes how the workbench exports SAM and BAM files along with known limitations.

K.2

SAM Header Section

The SAM importer and exporter does not support read groups. These will be ignored on import and not exported. The SAM exporter writes unsorted SAM and BAM files.

K.3

SAM Alignment Section

A few remarks on the exported alignment section: If pairs are not on the same contig, the mates will be exported as single reads. Non-broken pairs are always exported so the leftmost mate is forward and the rightmost mate is reversed. Multi fragment mappings will be imported as a paired data set. If the reference name contains either ' ' (space), '=' (equals sign) or '@' (at sign), each occurrence of these characters is replaced by a '_' (underscore). The exported CIGAR string uses 'M' to indicate match or mismatch and does not use '=' (equals sign) or 'X'.

K.4

Flags

The workbench's use of the alignment flags is shown in the following table and subsequent examples.

738

APPENDIX K. SAM/BAM EXPORT FORMAT SPECIFICATION

739

Bit 0x1 0x2 0x4 0x8

SAM description template having multiple fragments in sequencing each fragment properly aligned according to the aligner fragment unmapped next fragment in the template unmapped SEQ being mented reverse comple-

Usage in Workbench set if the fragment is part of a pair set if the pair is not broken never set since the exporter does not export unmapped reads never set by the exporter. If a fragment has an unmapped mate, the flag 0x1 is not set for the fragment, i.e. it is not output as part of a pair. for a broken pair or single read, this bit depends on the read's orientation. For a non-broken pair, this bit is unset for the leftmost fragment and set for the rightmost fragment for a broken pair, this bit depends on the read's orientation. For a non-broken pair, this bit is set for the leftmost fragment and unset for the rightmost fragment never set by the exporter, i.e. the exporter does not output the order of the fragments idem never set by the exporter never set by the exporter never set by the exporter

0x10

0x20

SEQ of the next fragment in the template being reversed

0x40 0x80 0x100 0x200 0x400

the first fragment in the template the last fragment in the template secondary alignment not passing quality controls PCR or optical duplicate

K.4.1

Flag Examples

The current set of possible flags in the workbench is described by the following table. The examples were generated by doing a default read mapping on the Illumina/Solexa paired end data from http://www.clcbio.com/index.php?id=1290.

APPENDIX K. SAM/BAM EXPORT FORMAT SPECIFICATION

740

Description of the example The left mate of a non-broken paired read The right mate of a non-broken paired read A single, forward read (or paired read, where only one mate of the pair is mapped) A single, reversed read (or paired read, where only one mate of the pair is mapped) A forward read from a broken pair with forward mate A forward read from broken pair with reversed mate A reversed read from broken pair with forward mate A reversed read from broken pair with reversed mate

Bits 0x1, 0x2, 0x20 0x1, 0x2, 0x10 No set bits

Flag 35 19 0

Illustration See Figure K.1 See Figure K.2 see Figure K.3

0x10

16

See Figure K.4

0x1 0x1, 0x20 0x1, 0x10 0x1, 0x10, 0x20

1 33 17 49

See Figure K.5 See Figure K.6 See Figure K.7 See Figure K.8

Figure K.1: The read is paired, both reads are mapped and the mate of this read is reversed

Figure K.2: The read is paired, both mates are mapped, and this fragment is reversed

Figure K.3: A single, forward read, or a paired read where the mate is not mapped

K.5

Optional fields in the alignment section

The following is true for the export of optional fields: The NH tag is exported.

APPENDIX K. SAM/BAM EXPORT FORMAT SPECIFICATION

741

Figure K.4: The read is a single, reversed read, or a paired read where the mate is not mapped

Figure K.5: These forward reads are paired. They map to the same place, so the pair is broken

Figure K.6: Forward read that is part of a broken read where the mate is reversed

Figure K.7: Reversed read that is part of a broken pair, where the mate is forward

Figure K.8: Reversed read that is part of a broken pair, where the mate is also reversed. The NM tag is not exported. The workbench exports color space information in the CS tag. The colors of a right mate are incorrect since the colors of a paired read are stored as a single color string. For hard clipped sequence reads, the color space is incorrect, since the color space string is not hard clipped. SAM files contain sequence quality score and color quality scores. The workbench only have color quality scores and these are stored and exported as sequence quality scores.

Appendix L

Expression data formats

Below you find descriptions of the microarray data formats that are supported by CLC Genomics Workbench. Note that we for some platforms support both expression data and annotation data.

L.1

GEO (Gene Expression Omnibus)

The GEO (Gene Expression Omnibus) sample and series formats are supported. Figure L.1 shows how to download the data from GEO in the right format. GEO is located at http: //www.ncbi.nlm.nih.gov/geo/.

Figure L.1: Selecting Samples, SOFT and Data before clicking go will give you the format supported by the CLC Genomics Workbench. The GEO sample files are tab-delimited .txt files. They have three required lines: ^SAMPLE = GSM21610 !sample_table_begin ... !sample_table_end The first line should start with ^SAMPLE = followed by the sample name, the line !sample_table_begin and the line !sample_table_end. Between the !sample_table_begin and !sample_table_end, lines are the column contents of the sample. 742

APPENDIX L. EXPRESSION DATA FORMATS

743

Note that GEO sample importer will also work for concatenated GEO sample files --- allowing multiple samples to be imported in one go. Download a sample file containing concatenated sample files here: http://www.clcbio.com/madata/GEOSampleFilesConcatenated.txt Below you can find examples of the formatting of the GEO formats.

L.1.1

GEO sample file, simple

This format is very simple and includes two columns: one for feature id (e.g. gene name) and one for the expression value. ^SAMPLE = GSM21610 !sample_table_begin ID_REF VALUE id1 105.8 id2 32 id3 50.4 id4 57.8 id5 2914.1 !sample_table_end Download the sample file here: http://www.clcbio.com/madata/GEOSampleFileSimple.txt

L.1.2

GEO sample file, including present/absent calls

This format includes an extra column for absent/present calls that can also be imported. ^SAMPLE = GSM21610 !sample_table_begin ID_REF VALUE ABS_CALL id1 105.8 M id2 32 A id3 50.4 A id4 57.8 A id5 2914.1 P !sample_table_end Download the sample file here: http://www.clcbio.com/madata/GEOSampleFileAbsentPresent.txt

L.1.3

GEO sample file, including present/absent calls and p-values

This format includes two extra columns: one for absent/present calls and one for absent/present call p-values, that can also be imported. ^SAMPLE = GSM21610

APPENDIX L. EXPRESSION DATA FORMATS

744

!sample_table_begin ID_REF VALUE id1 105.8 id2 32 id3 50.4 id4 57.8 id5 2914.1 !sample_table_end

ABS_CALL M A A A P

DETECTION P-VALUE 0.00227496 0.354441 0.904352 0.937071 6.02111e-05

Download the sample file here: http://www.clcbio.com/madata/GEOSampleFileAbsentPresentCallAndPValue.txt

L.1.4

GEO sample file: using absent/present call and p-value columns for sequence information

The workbench assumes that if there is a third column in the GEO sample file then it contains present/absent calls and that if there is a fourth column then it contains p-values for these calls. This means that the contents of the third column is assumed to be text and that of the fourth column a number. As long as these two basic requirements are met, the sample should be recognized and interpreted correctly. You can thus use these two columns to carry additional information on your probes. The absent/present column can be used to carry additional information like e.g. sequence tags as shown below: ^SAMPLE = GSM21610 !sample_table_begin ID_REF VALUE id1 105.8 id2 32 id3 50.4 id4 57.8 id5 2914.1 !sample_table_end

ABS_CALL AAA AAC ATA ATT TTA

Download the sample file here: http://www.clcbio.com/madata/GEOSampleFileSimpleSequenceTag.txt Or, if you have multiple probes per sequence you could use the present/absent column to hold the sequence name and the p-value column to hold the interrogation position of your probes: ^SAMPLE = GSM21610 !sample_table_begin ID_REF VALUE ABS_CALL probe1 755.07 seq1 probe2 587.88 seq1 probe3 716.29 seq1 probe4 1287.18 seq2 !sample_table_end

DETECTION P-VALUE 1452 497 1447 1899

APPENDIX L. EXPRESSION DATA FORMATS

745

Download the sample file here: http://www.clcbio.com/madata/GEOSampleFileSimpleSequenceTagAndProbe.txt

L.1.5

GEO series file, simple

The series file includes expression values for multiple samples. Each of the samples in the file will be represented by its own element with the sample name. The first row lists the sample names. !Series_title "Myb specificity !series_matrix_table_begin "ID_REF" "GSM21610" "GSM21611" "id1" 2541 1781.8 "id2" 11.3 621.5 "id3" 61.2 149.1 "id4" 55.3 328.8 "id5" 183.8 378.3 !series_matrix_table_end determinants" "GSM21612" 1804.8 50.2 22 97.2 423.2

Download the sample file here: http://www.clcbio.com/madata/GEOSeriesFile.txt

L.2

Affymetrix GeneChip

For Affymetrix, three types of files are currently supported: Affymetrix .CHP files, Affymetrix NetAffx annotation files and tab-delimited pivot or metrics files. Affymetrix .CEL files are currently not supported. However, the Bioconductor R package 'affy' allows you to preprocess the .CEL files and export a txt file containing a table of estimated gene-level expression values in three lines of code:
library(affy) # loading Bioconductor library affy data=ReadAffy() # probe-level data import eset=rma(data) # probe-level data pre-processing using rma write.exprs(eset,file="evals.txt") # writing gene expression levels to evals-txt

The exported txt file (evals.txt) can be imported into the workbench using the Generic expression data table format importer (see section L.5; you can just 'drag-and-drop' it in). In R, you should have all the CEL files you wish to process in your working directory and the file 'evals.txt' will be written to that directory.

L.2.1

Affymetrix CHP expression files

The Affymetrix scanner software produces a number of files when a GeneChip is scanned. Two of these are the .CHP and the .CEL files. These are binary files with native Affymetrix formats. The Affymetrix GeneChips contain a number of probes for each gene (typically between 22 and 40). The .CEL file contains the probe-level intensities, and the .CHP file contains the gene-level information. The gene-level information has been obtained by the scanner software through postprocessing and summarization of the probe-level intensities.

APPENDIX L. EXPRESSION DATA FORMATS

746

In order to interpret the probe-level information in the .CEL file, the .CDF file for the type of GeneChip that was used is required. Similarly for the .CHP file: in order to interpret the gene-level information in the .CHP file, the .PSI file for the type of GeneChip that was used is required. In order to import a .CHP file it is required that the corresponding .PSI file is present in the same folder as the .CHP file you want to import, and furthermore, this must be the only .PSI file that is present there. There are no requirements for the name of the .PSI file. Note that the .PSI file itself will not be imported - it is only used to guide the import of the .CHP file which contains the expression values. Download example .CHP and .PSI files here (note that these are binary files): http://www.clcbio.com/madata/AffymetrixCHPandPSI.zip

L.2.2

Affymetrix metrix files

The Affymetrix metrics or pivot files are tab-delimited files that may be exported from the Affymetrix scanner software. The metrics files have a lot of technical information that is only partly used in the Workbench. The feature ids (Probe Set Name), expression values (Used Signal), absent/present call (Detection) and absent/present p-value (Detection p-value) are imported into the Workbench. Download a small example sample file here: http://www.clcbio.com/madata/AffymetrixMetrics.txt

L.2.3

Affymetrix NetAffx annotation files

The NetAffx annotation files for Whole-Transcript Expression Gene arrays and 3' IVT Expression Analysis Arrays can be imported and used to annotate experiments as shown in section 20.1.4. Download a small example annotation file here which includes header information: http://www.clcbio.com/madata/AffymetrixNetAffxAnnotationFile.csv

L.3

Illumina BeadChip

Both BeadChip expression data files from Illumina's BeadStudio software and the corresponding BeadChip annotation files are supported by CLC Genomics Workbench. The formats of the BeadStudio and annotation files have changed somewhat over time and various formats are supported.

L.3.1

Illumina expression data, compact format

An example of this format is shown below: TargetID GI_10047089-S GI_10047091-S AVG_Signal 112.5 127.6 BEAD_STDEV 4.2 4.8 Detection 0.16903226 0.76774194

All this information is imported into the Workbench. The AVG_Signal is used as the expression measure.

APPENDIX L. EXPRESSION DATA FORMATS Download a small sample file here: http://www.clcbio.com/madata/IlluminaBeadChipCompact.txt

747

L.3.2

Illumina expression data, extended format

An example of this format is shown below:

TargetID GI_10047089-S GI_10047091-S MIN_Signal 73.7 312.7 AVG_Signal 73.7 312.7 MAX_Signal 73.7 312.7 NARRAYS 1 1 ARRAY_STDEV NaN NaN BEAD_STDEV 3.4 11.1 Avg_NBEADS 53 50 Detection 0.05669084 0.99604483

All this information is imported into the Workbench. The AVG_Signal is used as the expression measure. Download a small sample file here: http://www.clcbio.com/madata/IlluminaBeadChipExtended.txt

L.3.3

Illumina expression data, with annotations

An example of this format is shown below:

TargetID Accession Symbol GI_10047089-S NM_014332.1 GI_10047091-S NM_013259.1 GI_10047093-S NM_016299.1 Definition Synonym Signal-BG02 DCp32 Detection-BG02 DCp32 SMPX "Homo sapiens small muscle protein, X-linked (SMPX), mRNA." -17.6 0.03559657 NP25 "Homo sapiens neuronal protein (NP25), mRNA." NP22 32.6 0.99604483 HSP70-4 "Homo sapiens likely ortholog of mouse heat shock protein, 70 kDa 4 (HSP70-4), mRNA."

228.1 1

Only the TargetID, Signal and Detection columns will be imported, the remaining columns will be ignored. This means that the annotations are not imported. The Signal is used as the expression measure. Download a small example sample file here: http://www.clcbio.com/madata/IlluminaBeadStudioWithAnnotations.txt

L.3.4

Illumina expression data, multiple samples in one file

This file format has too much information to show it inline in the text. You can download a small example sample file here: http://www.clcbio.com/madata/IlluminaBeadStudioMultipleSamples.txt This file contains data for 18 samples. Each sample has an expression value (the value in the AVG_Signal column), a detection p-value, a bead standard deviation and an average bead number column. The workbench recognizes the 18 samples and their columns.

L.3.5

Illumina annotation files

The Workbench supports import of two types of Illumina BeadChip annotation files. These are either comma-separated or tab-delimited .txt files. They can be used to annotate experiments as shown in section 20.1.4. This file format has too much information to show it inline in the text. Download a small example annotation file of the first type here: http://www.clcbio.com/madata/IlluminaBeadChipAnnotation.txt and the second type here: http://www.clcbio.com/madata/IlluminaBeadChipAnnotationV2.txt

APPENDIX L. EXPRESSION DATA FORMATS

748

L.4

Gene ontology annotation files

The Gene ontology web site provides annotation files for a variety of species which can all be downloaded and imported into the CLC Genomics Workbench. This can be used to annotate experiments as shown in section 20.1.4. See the complete list including download links at http://www.geneontology.org/GO.current.annotations.shtml. This is an easy way to annotate your experiment with GO categories.

L.5

Generic expression and annotation data file formats

If you have your expression or annotation data in e.g. Excel and can export the data as a txt file, or if you are able to do some scripting or other manipulations to format your data files, you will be able to import them into the CLC Genomics Workbench as a 'generic' expression or annotation data file. There are a few simple requirements that need to be fulfilled to do this as described below.

L.5.1

Generic expression data table format

The CLC Genomics Workbench will import a tab, semicolon or comma-separated .txt or .csv file as expression array samples if the following requirements are met: 1. the first non-empty line of the file contains text. All entries, except the first, will be used as sample names 2. the following (non-empty) lines contain the same number of entries as the first non-empty line. The requirements to these are that the first entry should be a string (this will be used as the feature ID) and the remaining entries should contain numbers (which will be used as expression values --- one per sample). Empty entries are not allowed, but NaN values are allowed. 3. the file contains at least two samples. An example of this format is shown below: FeatureID; sample1; sample2; sample3 gene1; 200;300;23 gene2; 210;30;238 gene3; 230;50;23 gene4; 50;100;235 gene5; 200;300;23 gene6; 210;30;238 gene7; 230;50;23 gene8; 50;100;235 This will be imported as three samples with eight genes in each sample. Download a this example as a file here: http://www.clcbio.com/madata/CustomExpressionData.txt

APPENDIX L. EXPRESSION DATA FORMATS

749

L.5.2

Generic annotation file for expression data format

The CLC Genomics Workbench will import a tab, semicolon or comma-separated .txt or .csv file as an annotation file if the following is met: 1. It has a line which can serve as a valid header line. In order to do this, the line should have a number of headers where at least two are among the valid column headers in the Column header column below. 2. It contains one of the PROBE_ID headers (that is: 'Probe Set ID', 'Feature ID', 'ProbeID' or 'Probe_Id'). The importer will import an annotation table with a column for each of the valid column headers (those in the Column header column below). Columns with invalid headers will be ignored. Note that some column headers are alternatives so that only one of the alternative columns headers should be used. Also note that when adding annotations from an annotation file onto an experiment the file contents are merged onto the experiment by matching the entries in a user specified annotation column in the annotation file to the entries in the feature id column of the experiment. It will thus typically be useful to include a column in your annotation file in which the entries are a subset of, or identical to, the entries in the Feature Id column of the experiment you want to annotate. A simple example of an annotation file is shown here:
"Probe Set ID","Gene Symbol","Gene Ontology Biological Process" "1367452_at","Sumo2","0006464 // protein modification process // not recorded" "1367453_at","Cdc37","0051726 // regulation of cell cycle // not recorded" "1367454_at","Copb2","0006810 // transport // /// 0016044 // membrane organization // "

Download this example plus a more elaborate one here: http://www.clcbio.com/madata/SimpleCustomAnnotation.csv http://www.clcbio.com/madata/FullCustomAnnotation.csv To meet requirements imposed by special functionalities in the workbench, there are a number of further restrictions on the contents in the entries of the columns: Download sequence functionality In the experiment table, you can click a button to download sequence. This uses the contents of the PUBLIC_ID column, so this column must be present for the action to work and should contain the NCBI accession number. Annotation tests The annotation tests can make use of several entries in a column as long as a certain format is used. The tests assume that entries are separated by /// and it interprets all that appears before // as the actual entry and all that appears after // within an entry as comments. Example:
/// 0000001 // comment1 /// 0000008 // comment2 /// 0003746 // comment3

The annotation tests will interpret this as three entries (0000001, 0000008, and 0003746) with the according comments.

APPENDIX L. EXPRESSION DATA FORMATS The most common column headers are summarized below:
Column header in imported file (alternatives separated by commas) Probe Set ID, Feature ID, ProbeID, Probe_Id, transcript_cluster_id Representative Public ID, Public identifier tag, GenbankAccession Gene Symbol, GeneSymbol Gene Ontology Biological Process, Ontology_Process, GO_biological_process Gene Ontology Cellular Component, Ontology_Component, GO_cellular_component Gene Ontology Molecular Function, Ontology_Function, GO_molecular_function Pathway Label in experiment table Feature ID Public identifier tag Gene symbol GO biological process GO cellular component GO molecular function Pathway

750

Description (tool tip) Probe identifier tag Representative public ID Gene symbol Gene Ontology biological process

Gene Ontology cellular componen Pathway

Gene Ontology molecular function

The full list of possible column headers:

APPENDIX L. EXPRESSION DATA FORMATS

751

Column header in imported file (alternatives separated by commas) Species Scientific Name, Species Name, Species GeneChip Array Annotation Date Sequence Type Sequence Source Transcript ID(Array Design), Transcript Target Description Archival UniGene Cluster UniGene ID, UniGeneID, Unigene_ID, unigene Genome Version Alignments Gene Title geng_assignments Chromosomal Location Unigene Cluster Type Ensemble Ensembl Entrez Gene, EntrezGeneID, Entrez_Gene_ID SwissProt EC OMIM RefSeq Protein ID RefSeq Transcript ID FlyBase AGI WormBase MGI Name RGD Name SGD accession number InterPro Trans Membrane QTL Annotation Description Annotation Transcript Cluster Transcript Assignments mrna_assignments Annotation Notes GO, Ontology Cytoband PrimaryAccession RefSeqAccession GeneName TIGRID Description GenomicCoordinates Search_key Target Gid, GI Accession Symbol Probe_Type crosshyb_type category Start, Probe_Start Stop Definition Synonym, Synonyms Source Source_Reference_ID RefSeq_ID ILMN_Gene Protein_Product protein_domains Array_Address_Id Probe_Sequence seqname Chromosome strand Probe_Chr_Orientation Probe_Coordinates Obsolete_Probe_Id

Label in experiment table Species name Gene chip array Annotation date Sequence type Sequence source Transcript ID Target description Archival UniGene cluster UniGene ID Genome version Alignments Gene title Gene assignments Chromosomal location UniGene cluster type Ensembl Entrez gene SwissProt EC OMIM RefSeq protein ID RefSeq transcript ID FlyBase AGI WormBase MGI name RGD name SGD accession number InterPro Trans membrane QTL Annotation description Annotation transcript cluster Transcript assignments mRNA assignments Annotation notes Go annotations Cytoband Primary accession RefSeq accession Gene name TIGR Id Description Genomic coordinates Search key Target Genbank identifier GenBank accession Gene symbol Probe type Crosshyb type category Start Stop Definition Synonym Source Source reference id Reference sequence id Illumina Gene Protein product Protein domains Array adress id Sequence Seqname Chromosome Strand Probe chr orientation Probe coordinates Obsolete probe id

Description (tool tip) Scientific species name Gene Chip Array name Date of annotation Type of sequence Source from which sequence was obtained Transcript identifier tag Target description Archival UniGene cluster UniGene identifier tag Version of genome on which annotation is based Alignments Gene title Gene assignments Chromosomal location UniGene cluster type Entrez gene SwissProt EC Online Mendelian Inheritance in Man RefSeq protein identifier tag RefSeq transcript identifier tag FlyBase AGI WormBase MGI name RGD name SGD accession number InterPro Trans membrane QTL Annotation description Annotation transcript cluster Trancript assignments mRNA assignments Annotation notes Go annotations Cytoband Primary accession RefSeq accession Gene name TIGR Id Description Genomic coordinates Search key Target Genbank identifier GenBank accession Gene symbol Probe type Crosshyb type category Start Stop Definition Synonym Source Source reference id Reference sequence id Illumina Gene Protein product Protein domains Array adress id Sequence Seqname Chromosome Strand Probe chr orientation Probe coordinates Obsolete probe id

Appendix M

Custom codon frequency tables

You can edit the list of codon frequency tables used by CLC Genomics Workbench. Note! Please be aware that this process needs to be handled carefully, otherwise you may have to re-install the Workbench to get it to work. In the Workbench installation folder under res, there is a folder named codonfreq. This folder contains all the codon frequency tables organized into subfolders in a hierarchy. In order to change the tables, you simply add, delete or rename folders and the files in the folders. If you wish to add new tables, please use the existing ones as template. Restart the Workbench to have the changes take effect. Please note that when updating the Workbench to a new version, this information is not preserved. This means that you should keep this information in a separate place as back-up. (The ability to change the tables is mainly aimed at centrally deployed installations of the Workbench).

752

Bibliography
[Akmaev and Wang, 2004] Akmaev, V. R. and Wang, C. J. (2004). Correction of sequence-based artifacts in serial analysis of gene expression. Bioinformatics, 20(8):1254--1263. [Allison et al., 2006] Allison, D., Cui, X., Page, G., and Sabripour, M. (2006). Microarray data analysis: from disarray to consolidation and consensus. NATURE REVIEWS GENETICS, 7(1):55. [Altschul and Gish, 1996] Altschul, S. F. and Gish, W. (1996). Local alignment statistics. Methods Enzymol, 266:460--480. [Altschul et al., 1990] Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990). Basic local alignment search tool. J Mol Biol, 215(3):403--410. [Altshuler et al., 2000] Altshuler, D., Pollara, V. J., Cowles, C. R., Etten, W. J. V., Baldwin, J., Linton, L., and Lander, E. S. (2000). An snp map of the human genome generated by reduced representation shotgun sequencing. Nature, 407(6803):513--516. [Andrade et al., 1998] Andrade, M. A., O'Donoghue, S. I., and Rost, B. (1998). Adaptation of protein surfaces to subcellular location. J Mol Biol, 276(2):517--525. [Bachmair et al., 1986] Bachmair, A., Finley, D., and Varshavsky, A. (1986). In vivo half-life of a protein is a function of its amino-terminal residue. Science, 234(4773):179--186. [Baggerly et al., 2003] Baggerly, K., Deng, L., Morris, J., and Aldaz, C. (2003). Differential expression in SAGE: accounting for normal between-library variation. Bioinformatics, 19(12):1477--1483. [Bateman et al., 2004] Bateman, A., Coin, L., Durbin, R., Finn, R. D., Hollich, V., Griffiths-Jones, S., Khanna, A., Marshall, M., Moxon, S., Sonnhammer, E. L. L., Studholme, D. J., Yeats, C., and Eddy, S. R. (2004). The Pfam protein families database. Nucleic Acids Res, 32(Database issue):D138--D141. [Bendtsen et al., 2004a] Bendtsen, J. D., Jensen, L. J., Blom, N., Heijne, G. V., and Brunak, S. (2004a). Feature-based prediction of non-classical and leaderless protein secretion. Protein Eng Des Sel, 17(4):349--356. [Bendtsen et al., 2005] Bendtsen, J. D., Kiemer, L., Fausbll, A., and Brunak, S. (2005). Non-classical protein secretion in bacteria. BMC Microbiol, 5:58. [Bendtsen et al., 2004b] Bendtsen, J. D., Nielsen, H., von Heijne, G., and Brunak, S. (2004b). Improved prediction of signal peptides: SignalP 3.0. J Mol Biol, 340(4):783--795.

753

BIBLIOGRAPHY

754

[Benjamini and Hochberg, 1995] Benjamini, Y. and Hochberg, Y. (1995). Controlling the false discovery rate: a practical and powerful approach to multiple testing. JOURNAL-ROYAL STATISTICAL SOCIETY SERIES B, 57:289--289. [Blobel, 2000] Blobel, G. (2000). Protein targeting (Nobel lecture). Chembiochem., 1:86--102. [Bolstad et al., 2003] Bolstad, B., Irizarry, R., Astrand, M., and Speed, T. (2003). A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics, 19(2):185--193. [Bommarito et al., 2000] Bommarito, S., Peyret, N., and SantaLucia, J. (2000). Thermodynamic parameters for DNA sequences with dangling ends. Nucleic Acids Res, 28(9):1929--1934. [Brockman et al., 2008] Brockman, W., Alvarez, P., Young, S., Garber, M., Giannoukos, G., Lee, W. L., Russ, C., Lander, E. S., Nusbaum, C., and Jaffe, D. B. (2008). Quality scores and snp detection in sequencing-by-synthesis systems. Genome Res, 18(5):763--770. [Chen et al., 2004] Chen, G., Znosko, B. M., Jiao, X., and Turner, D. H. (2004). Factors affecting thermodynamic stabilities of RNA 3 x 3 internal loops. Biochemistry, 43(40):12865--12876. [Clote et al., 2005] Clote, P., Ferr, F., Kranakis, E., and Krizanc, D. (2005). Structural RNA has lower folding energy than random RNA of the same dinucleotide frequency. RNA, 11(5):578-591. [Cornette et al., 1987] Cornette, J. L., Cease, K. B., Margalit, H., Spouge, J. L., Berzofsky, J. A., and DeLisi, C. (1987). Hydrophobicity scales and computational techniques for detecting amphipathic structures in proteins. J Mol Biol, 195(3):659--685. [Costa, 2007] Costa, F. F. (2007). Non-coding RNAs: lost in translation? Gene, 386(1-2):1--10. [Creighton et al., 2009] Creighton, C. J., Reid, J. G., and Gunaratne, P. H. (2009). Expression profiling of micrornas by deep sequencing. Brief Bioinform, 10(5):490--497. [Cronn et al., 2008] Cronn, R., Liston, A., Parks, M., Gernandt, D. S., Shen, R., and Mockler, T. (2008). Multiplex sequencing of plant chloroplast genomes using solexa sequencing-bysynthesis technology. Nucleic Acids Res, 36(19):e122. [Crooks et al., 2004] Crooks, G. E., Hon, G., Chandonia, J.-M., and Brenner, S. E. (2004). WebLogo: a sequence logo generator. Genome Res, 14(6):1188--1190. [Dayhoff and Schwartz, 1978] Dayhoff, M. O. and Schwartz, R. M. (1978). Atlas of Protein Sequence and Structure, volume 3 of 5 suppl., pages 353--358. Nat. Biomed. Res. Found., Washington D.C. [Dempster et al., 1977] Dempster, A., Laird, N., Rubin, D., et al. (1977). Maximum likelihood from incomplete data via the EM algorithm. Journal of the Royal Statistical Society, 39(1):1--38. [Dudoit et al., 2003] Dudoit, S., Shaffer, J., and Boldrick, J. (2003). Multiple Hypothesis Testing in Microarray Experiments. STATISTICAL SCIENCE, 18(1):71--103. [Eddy, 2004] Eddy, S. R. (2004). Where did the BLOSUM62 alignment score matrix come from? Nat Biotechnol, 22(8):1035--1036.

BIBLIOGRAPHY

755

[Eisen et al., 1998] Eisen, M., Spellman, P., Brown, P., and Botstein, D. (1998). Cluster analysis and display of genome-wide expression patterns. Proceedings of the National Academy of Sciences, 95(25):14863--14868. [Eisenberg et al., 1984] Eisenberg, D., Schwarz, E., Komaromy, M., and Wall, R. (1984). Analysis of membrane and surface protein sequences with the hydrophobic moment plot. J Mol Biol, 179(1):125--142. [Emini et al., 1985] Emini, E. A., Hughes, J. V., Perlow, D. S., and Boger, J. (1985). Induction of hepatitis a virus-neutralizing antibody by a virus-specific synthetic peptide. J Virol, 55(3):836-839. [Engelman et al., 1986] Engelman, D. M., Steitz, T. A., and Goldman, A. (1986). Identifying nonpolar transbilayer helices in amino acid sequences of membrane proteins. Annu Rev Biophys Biophys Chem, 15:321--353. [Falcon and Gentleman, 2007] Falcon, S. and Gentleman, R. (2007). Using GOstats to test gene lists for GO term association. Bioinformatics, 23(2):257. [Felsenstein, 1981] Felsenstein, J. (1981). Evolutionary trees from DNA sequences: a maximum likelihood approach. J Mol Evol, 17(6):368--376. [Feng and Doolittle, 1987] Feng, D. F. and Doolittle, R. F. (1987). Progressive sequence alignment as a prerequisite to correct phylogenetic trees. J Mol Evol, 25(4):351--360. [Forsberg et al., 2001] Forsberg, R., Oleksiewicz, M. B., Petersen, A. M., Hein, J., Btner, A., and Storgaard, T. (2001). A molecular clock dates the common ancestor of European-type porcine reproductive and respiratory syndrome virus at more than 10 years before the emergence of disease. Virology, 289(2):174--179. [Galperin and Koonin, 1998] Galperin, M. Y. and Koonin, E. V. (1998). Sources of systematic error in functional annotation of genomes: domain rearrangement, non-orthologous gene displacement and operon disruption. In Silico Biol, 1(1):55--67. [Gill and von Hippel, 1989] Gill, S. C. and von Hippel, P. H. (1989). Calculation of protein extinction coefficients from amino acid sequence data. Anal Biochem, 182(2):319--326. [Gonda et al., 1989] Gonda, D. K., Bachmair, A., Wnning, I., Tobias, J. W., Lane, W. S., and Varshavsky, A. (1989). Universality and structure of the N-end rule. J Biol Chem, 264(28):16700--16712. [Guindon and Gascuel, 2003] Guindon, S. and Gascuel, O. (2003). A Simple, Fast, and Accurate Algorithm to Estimate Large Phylogenies by Maximum Likelihood. Systematic Biology, 52(5):696--704. [Guo et al., 2006] Guo, L., Lobenhofer, E. K., Wang, C., Shippy, R., Harris, S. C., Zhang, L., Mei, N., Chen, T., Herman, D., Goodsaid, F. M., Hurban, P., Phillips, K. L., Xu, J., Deng, X., Sun, Y. A., Tong, W., Dragan, Y. P., and Shi, L. (2006). Rat toxicogenomic study reveals analytical consistency across microarray platforms. Nat Biotechnol, 24(9):1162--1169. [Han et al., 1999] Han, K., Kim, D., and Kim, H. (1999). A vector-based method for drawing RNA secondary structure. Bioinformatics, 15(4):286--297.

BIBLIOGRAPHY

756

[Hasegawa et al., 1985] Hasegawa, M., Kishino, H., and Yano, T. (1985). Dating of the humanape splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution, 22(2):160--174. [Hein, 2001] Hein, J. (2001). An algorithm for statistical alignment of sequences related by a binary tree. In Pacific Symposium on Biocomputing, page 179. [Hein et al., 2000] Hein, J., Wiuf, C., Knudsen, B., Mller, M. B., and Wibling, G. (2000). Statistical alignment: computational properties, homology testing and goodness-of-fit. J Mol Biol, 302(1):265--279. [Henikoff and Henikoff, 1992] Henikoff, S. and Henikoff, J. G. (1992). Amino acid substitution matrices from protein blocks. Proc Natl Acad Sci U S A, 89(22):10915--10919. [Hopp and Woods, 1983] Hopp, T. P. and Woods, K. R. (1983). A computer program for predicting protein antigenic determinants. Mol Immunol, 20(4):483--489. [Ikai, 1980] Ikai, A. (1980). Thermostability and aliphatic index of globular proteins. J Biochem (Tokyo), 88(6):1895--1898. [Janin, 1979] Janin, J. (1979). Surface and inside volumes in globular proteins. Nature, 277(5696):491--492. [Ji et al., 2008] Ji, H., Jiang, H., Ma, W., Johnson, D., Myers, R., and Wong, W. (2008). An integrated software system for analyzing ChIP-chip and ChIP-seq data. Nature Biotechnology, 26(11):1293--1300. [Jukes and Cantor, 1969] Jukes, T. and Cantor, C. (1969). Mammalian Protein Metabolism, chapter Evolution of protein molecules, pages 21--32. New York: Academic Press. [Kal et al., 1999] Kal, A. J., van Zonneveld, A. J., Benes, V., van den Berg, M., Koerkamp, M. G., Albermann, K., Strack, N., Ruijter, J. M., Richter, A., Dujon, B., Ansorge, W., and Tabak, H. F. (1999). Dynamics of gene expression revealed by comparison of serial analysis of gene expression transcript profiles from yeast grown on two different carbon sources. Mol Biol Cell, 10(6):1859--1872. [Karplus and Schulz, 1985] Karplus, P. A. and Schulz, G. E. (1985). Prediction of chain flexibility in proteins. Naturwissenschaften, 72:212--213. [Kaufman and Rousseeuw, 1990] Kaufman, L. and Rousseeuw, P. (1990). Finding groups in data. an introduction to cluster analysis. Wiley Series in Probability and Mathematical Statistics. Applied Probability and Statistics, New York: Wiley, 1990. [Kierzek et al., 1999] Kierzek, R., Burkard, M. E., and Turner, D. H. (1999). Thermodynamics of single mismatches in RNA duplexes. Biochemistry, 38(43):14214--14223. [Kimura, 1980] Kimura, M. (1980). A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol, 16(2):111-120. [Klee and Ellis, 2005] Klee, E. W. and Ellis, L. B. M. (2005). Evaluating eukaryotic secreted protein prediction. BMC Bioinformatics, 6:256.

BIBLIOGRAPHY

757

[Knudsen and Miyamoto, 2001] Knudsen, B. and Miyamoto, M. M. (2001). A likelihood ratio test for evolutionary rate shifts and functional divergence among proteins. Proc Natl Acad Sci U S A, 98(25):14512--14517. [Kolaskar and Tongaonkar, 1990] Kolaskar, A. S. and Tongaonkar, P. C. (1990). A semi-empirical method for prediction of antigenic determinants on protein antigens. FEBS Lett, 276(1-2):172-174. [Krogh et al., 2001] Krogh, A., Larsson, B., von Heijne, G., and Sonnhammer, E. L. (2001). Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J Mol Biol, 305(3):567--580. [Kyte and Doolittle, 1982] Kyte, J. and Doolittle, R. F. (1982). A simple method for displaying the hydropathic character of a protein. J Mol Biol, 157(1):105--132. [Larget and Simon, 1999] Larget, B. and Simon, D. (1999). Markov chain monte carlo algorithms for the bayesian analysis of phylogenetic trees. Mol Biol Evol, 16:750--759. [Leitner and Albert, 1999] Leitner, T. and Albert, J. (1999). The molecular clock of HIV-1 unveiled through analysis of a known transmission history. Proc Natl Acad Sci U S A, 96(19):10752-10757. [Lloyd, 1982] Lloyd, S. (1982). Least squares quantization in PCM. Information Theory, IEEE Transactions on, 28(2):129--137. [Longfellow et al., 1990] Longfellow, C. E., Kierzek, R., and Turner, D. H. (1990). Thermodynamic and spectroscopic study of bulge loops in oligoribonucleotides. Biochemistry, 29(1):278--285. [Maeda et al., 2008] Maeda, N., Nishiyori, H., Nakamura, M., Kawazu, C., Murata, M., Sano, H., Hayashida, K., Fukuda, S., Tagami, M., Hasegawa, A., Murakami, K., Schroder, K., Irvine, K., Hume, D., Hayashizaki, Y., Carninci, P., and Suzuki, H. (2008). Development of a dna barcode tagging method for monitoring dynamic changes in gene expression by using an ultra high-throughput sequencer. Biotechniques, 45(1):95--97. [Maizel and Lenk, 1981] Maizel, J. V. and Lenk, R. P. (1981). Enhanced graphic matrix analysis of nucleic acid and protein sequences. Proc Natl Acad Sci U S A, 78(12):7665--7669. [Mathews et al., 2004] Mathews, D. H., Disney, M. D., Childs, J. L., Schroeder, S. J., Zuker, M., and Turner, D. H. (2004). Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of rna secondary structure. Proc Natl Acad Sci U S A, 101(19):7287--7292. [Mathews et al., 1999] Mathews, D. H., Sabina, J., Zuker, M., and Turner, D. H. (1999). Expanded sequence dependence of thermodynamic parameters improves prediction of rna secondary structure. J Mol Biol, 288(5):911--940. [Mathews and Turner, 2002] Mathews, D. H. and Turner, D. H. (2002). Experimentally derived nearest-neighbor parameters for the stability of RNA three- and four-way multibranch loops. Biochemistry, 41(3):869--880. [Mathews and Turner, 2006] Mathews, D. H. and Turner, D. H. (2006). Prediction of RNA secondary structure by free energy minimization. Curr Opin Struct Biol, 16(3):270--278.

BIBLIOGRAPHY

758

[McCaskill, 1990] McCaskill, J. S. (1990). The equilibrium partition function and base pair binding probabilities for RNA secondary structure. Biopolymers, 29(6-7):1105--1119. [McGinnis and Madden, 2004] McGinnis, S. and Madden, T. L. (2004). BLAST: at the core of a powerful and diverse set of sequence analysis tools. Nucleic Acids Res, 32(Web Server issue):W20--W25. [Menne et al., 2000] Menne, K. M., Hermjakob, H., and Apweiler, R. (2000). A comparison of signal sequence prediction methods using a test set of signal peptides. Bioinformatics, 16(8):741--742. [Meyer et al., 2007] Meyer, M., Stenzel, U., Myles, S., Prfer, K., and Hofreiter, M. (2007). Targeted high-throughput sequencing of tagged nucleic acid samples. Nucleic Acids Res, 35(15):e97. [Michener and Sokal, 1957] Michener, C. and Sokal, R. (1957). A quantitative approach to a problem in classification. Evolution, 11:130--162. [Morin et al., 2008] Morin, R. D., O'Connor, M. D., Griffith, M., Kuchenbauer, F., Delaney, A., Prabhu, A.-L., Zhao, Y., McDonald, H., Zeng, T., Hirst, M., Eaves, C. J., and Marra, M. A. (2008). Application of massively parallel sequencing to microrna profiling and discovery in human embryonic stem cells. Genome Res, 18(4):610--621. [Mortazavi et al., 2008] Mortazavi, A., Williams, B. A., McCue, K., Schaeffer, L., and Wold, B. (2008). Mapping and quantifying mammalian transcriptomes by rna-seq. Nat Methods, 5(7):621--628. [Nielsen et al., 1997] Nielsen, H., Engelbrecht, J., Brunak, S., and von Heijne, G. (1997). Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng, 10(1):1--6. [Nielsen, 2007] Nielsen, K. L., editor (2007). Serial Analysis of Gene Expression (SAGE): Methods and Protocols, volume 387 of Methods in Molecular Biology. Humana Press. [Nielsen et al., 2008] Nielsen, R., Pedersen, T., Hagenbeek, D., Moulos, P., Siersbk, R., Megens, E., Denissov, S., Brgesen, M., Francoijs, K., Mandrup, S., et al. (2008). Genomewide profiling of PPAR: RXR and RNA polymerase II occupancy reveals temporal activation of distinct metabolic pathways and changes in RXR dimer composition during adipogenesis. Genes & Development, 22(21):2953. [Parkhomchuk et al., 2009] Parkhomchuk, D., Borodina, T., Amstislavskiy, V., Banaru, M., Hallen, L., Krobitsch, S., Lehrach, H., and Soldatov, A. (2009). Transcriptome analysis by strand-specific sequencing of complementary dna. Nucleic Acids Res, 37(18):e123. [Purvis, 1995] Purvis, A. (1995). A composite estimate of primate phylogeny. Philos Trans R Soc Lond B Biol Sci, 348(1326):405--421. [Reinhardt and Hubbard, 1998] Reinhardt, A. and Hubbard, T. (1998). Using neural networks for prediction of the subcellular location of proteins. Nucleic Acids Res, 26(9):2230--2236. [Rivas and Eddy, 2000] Rivas, E. and Eddy, S. R. (2000). Secondary structure alone is generally not statistically significant for the detection of noncoding RNAs. Bioinformatics, 16(7):583--605.

BIBLIOGRAPHY

759

[Rose et al., 1985] Rose, G. D., Geselowitz, A. R., Lesser, G. J., Lee, R. H., and Zehfus, M. H. (1985). Hydrophobicity of amino acid residues in globular proteins. Science, 229(4716):834-838. [Rost, 2001] Rost, B. (2001). Review: protein secondary structure prediction continues to rise. J Struct Biol, 134(2-3):204--218. [Saitou and Nei, 1987] Saitou, N. and Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol, 4(4):406--425. [Sankoff et al., 1983] Sankoff, D., Kruskal, J., Mainville, S., and Cedergren, R. (1983). Time Warps, String Edits, and Macromolecules: the Theory and Practice of Sequence Comparison, chapter Fast algorithms to determine RNA secondary structures containing multiple loops, pages 93--120. Addison-Wesley, Reading, Ma. [SantaLucia, 1998] SantaLucia, J. (1998). A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. Proc Natl Acad Sci U S A, 95(4):1460--1465. [Schechter and Berger, 1967] Schechter, I. and Berger, A. (1967). On the size of the active site in proteases. I. Papain. Biochem Biophys Res Commun, 27(2):157--162. [Schechter and Berger, 1968] Schechter, I. and Berger, A. (1968). On the active site of proteases. 3. Mapping the active site of papain; specific peptide inhibitors of papain. Biochem Biophys Res Commun, 32(5):898--902. [Schneider and Stephens, 1990] Schneider, T. D. and Stephens, R. M. (1990). Sequence logos: a new way to display consensus sequences. Nucleic Acids Res, 18(20):6097--6100. [Schroeder et al., 1999] Schroeder, S. J., Burkard, M. E., and Turner, D. H. (1999). The energetics of small internal loops in RNA. Biopolymers, 52(4):157--167. [Shapiro et al., 2007] Shapiro, B. A., Yingling, Y. G., Kasprzak, W., and Bindewald, E. (2007). Bridging the gap in RNA structure prediction. Curr Opin Struct Biol, 17(2):157--165. [Siepel and Haussler, 2004] Siepel, A. and Haussler, D. (2004). Combining phylogenetic and hidden Markov models in biosequence analysis. J Comput Biol, 11(2-3):413--428. [Smith and Waterman, 1981] Smith, T. F. and Waterman, M. S. (1981). Identification of common molecular subsequences. J Mol Biol, 147(1):195--197. [Sneath and Sokal, 1973] Sneath, P. and Sokal, R. (1973). Numerical Taxonomy. Freeman, San Francisco. [Stark et al., 2010] Stark, M. S., Tyagi, S., Nancarrow, D. J., Boyle, G. M., Cook, A. L., Whiteman, D. C., Parsons, P. G., Schmidt, C., Sturm, R. A., and Hayward, N. K. (2010). Characterization of the melanoma mirnaome by deep sequencing. PLoS One, 5(3):e9685. [Sturges, 1926] Sturges, H. A. (1926). The choice of a class interval. Journal of the American Statistical Association, 21:65--66. ['t Hoen et al., 2008] 't Hoen, P. A. C., Ariyurek, Y., Thygesen, H. H., Vreugdenhil, E., Vossen, R. H. A. M., de Menezes, R. X., Boer, J. M., van Ommen, G.-J. B., and den Dunnen, J. T. (2008). Deep sequencing-based expression analysis shows major advances in robustness, resolution and inter-lab portability over five microarray platforms. Nucleic Acids Res, 36(21):e141.

BIBLIOGRAPHY

760

[Tian et al., 2005] Tian, L., Greenberg, S., Kong, S., Altschuler, J., Kohane, I., and Park, P. (2005). Discovering statistically significant pathways in expression profiling studies. Proceedings of the National Academy of Sciences, 102(38):13544--13549. [Tobias et al., 1991] Tobias, J. W., Shrader, T. E., Rocap, G., and Varshavsky, A. (1991). The N-end rule in bacteria. Science, 254(5036):1374--1377. [Tusher et al., 2001] Tusher, V. G., Tibshirani, R., and Chu, G. (2001). Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci U S A, 98(9):5116-5121. [van Lunteren et al., 2008] van Lunteren, E., Spiegler, S., and Moyer, M. (2008). Contrast between cardiac left ventricle and diaphragm muscle in expression of genes involved in carbohydrate and lipid metabolism. Respir Physiol Neurobiol, 161(1):41--53. [von Ahsen et al., 2001] von Ahsen, N., Wittwer, C. T., and Schtz, E. (2001). Oligonucleotide melting temperatures under PCR conditions: nearest-neighbor corrections for Mg(2+), deoxynucleotide triphosphate, and dimethyl sulfoxide concentrations with comparison to alternative empirical formulas. Clin Chem, 47(11):1956--1961. [von Heijne, 1986] von Heijne, G. (1986). A new method for predicting signal sequence cleavage sites. Nucl. Acids Res., 14:4683--4690. [Welling et al., 1985] Welling, G. W., Weijer, W. J., van der Zee, R., and Welling-Wester, S. (1985). Prediction of sequential antigenic regions in proteins. FEBS Lett, 188(2):215--218. [Wootton and Federhen, 1993] Wootton, J. C. and Federhen, S. (1993). Statistics of local complexity in amino acid sequences and sequence databases. Computers in Chemistry, 17:149--163. [Workman and Krogh, 1999] Workman, C. and Krogh, A. (1999). No evidence that mRNAs have lower folding free energies than random sequences with the same dinucleotide distribution. Nucleic Acids Res, 27(24):4816--4822. [Wyman et al., 2009] Wyman, S. K., Parkin, R. K., Mitchell, P. S., Fritz, B. R., O'Briant, K., Godwin, A. K., Urban, N., Drescher, C. W., Knudsen, B. S., and Tewari, M. (2009). Repertoire of micrornas in epithelial ovarian cancer as determined by next generation sequencing of small rna cdna libraries. PLoS One, 4(4):e5311. [Yang, 1994a] Yang, Z. (1994a). Estimating the pattern of nucleotide substitution. Journal of Molecular Evolution, 39(1):105--111. [Yang, 1994b] Yang, Z. (1994b). Maximum likelihood phylogenetic estimation from DNA sequences with variable rates over sites: Approximate methods. Journal of Molecular Evolution, 39(3):306--314. [Yang and Rannala, 1997] Yang, Z. and Rannala, B. (1997). Bayesian phylogenetic inference using DNA sequences: a Markov Chain Monte Carlo Method. Mol Biol Evol, 14(7):717--724. [Zuker, 1989a] Zuker, M. (1989a). On finding all suboptimal foldings of an rna molecule. Science, 244(4900):48--52. [Zuker, 1989b] Zuker, M. (1989b). The use of dynamic programming algorithms in rna secondary structure prediction. Mathematical Methods for DNA Sequences, pages 159--184.

BIBLIOGRAPHY

761

[Zuker and Sankoff, 1984] Zuker, M. and Sankoff, D. (1984). Rna secondary structures and their prediction. Bulletin of Mathemetical Biology, 46:591--621. [Zuker and Stiegler, 1981] Zuker, M. and Stiegler, P. (1981). Optimal computer folding of large RNA sequences using thermodynamics and auxiliary information. Nucleic Acids Res, 9(1):133--148.

Part V

Index

762

Index
mapping extract from selection, 415 De novo assembly tutorial, 49 3D molecule view, 292 export graphics, 299 navigate, 293 output, 299 rotate, 293 zoom, 293 454 sequencing data, 713 AB1, file format, 734 Abbreviations amino acids, 731 ABI, file format, 734 About CLC Workbenches, 31 Accession number, display, 169 .ace, file format, 736 ACE, file format, 735 Adapter trimmming, 452 Add annotations, 243, 714 sequences to alignment, 671 sequences to contig, 409 Structure Prediction Constraints, 690 Adjust selection, 235 Adjust trim, 410 Advanced preferences, 195 Advanced RNA options Apply base pairing constraints, 690 Avoid isolated base pairs, 690, 703 Coaxial stacking, 690, 703 GAIL rule, 690, 703 Advanced search, 188 Affymetrix arrays, 564 Affymetrix NetAffx, file format, 736 Affymetrix, file format, 736 Affymetrix, supported file formats, 745 Algorithm alignment, 659 neighbor joining, 685 UPGMA, 684 Align alignments, 662 protein sequences, tutorial, 156 sequences, 715 Alignment, see Alignments Alignment Primers Degenerate primers, 389, 390 PCR primers, 389 Primers with mismatches, 389, 390 Primers with perfect match, 389, 390 TaqMan Probes, 389 Alignment-based primer design, 388 Alignments, 659, 715 add sequences to, 671 compare, 673 create, 660 design primers for, 388 edit, 669 fast algorithm, 661 join, 671 multiple, Bioinformatics explained, 676 remove sequences from, 670 view, 665 view annotations on, 240 Aliphatic index, 317 .aln, file format, 736 Alphabetical sorting of folders, 167 Ambiguities, reverse translation, 364 Amino acid composition, 320 Amino acids abbreviations, 731 UIPAC codes, 731 Analyze primer properties, 392 Annotate tag experiment, 543 Annotation select, 235 Annotation Layout, in Side Panel, 240 Annotation level, 570 Annotation tests, 607 763

INDEX

764

Gene set enrichment analysis (GSEA), 610 Batch edit element properties, 171 Batch processing, 220 GSEA, 610 log of, 225 Hypergeometric test, 607 BED, import of, 439 Annotation types Bibliography, 761 define your own, 244 Binding site for primer, 394 Annotation Types, in Side Panel, 240 Bioinformatic data Annotations export, 209 add, 243 formats, 204, 733 add to experiment, 572 bl2seq, see Local BLAST copy to other sequences, 670 BLAST, 714 edit, 243, 245 against a local Database, 271 expression analysis, 572 against NCBI, 268 in alignments, 670 contig, 415 introduction to, 239 create database from file system, 280 links, 265 create database from Navigation Area, 280 overview of, 242 create local database, 280 show/hide, 240 database file format, 736 table of, 242 database management, 281 trim, 402 graphics output, 275 types of, 240 list of databases, 723 view on sequence, 240 parameters, 269 viewing, 239 search, 267, 268 Annotations, add links to, 245 sequencing data, assembled, 415 Antigenicity, 348, 715 specify server URL, 196 Append wildcard, search, 255, 258, 261 table output, 276 Arrange tips for specialized searches, 146 layout of sequence, 43 tutorial, 144, 146 views in View Area, 175 URL, 196 Array data formats, 742 BLAST database index, 280 Array platforms, 564 BLAST DNA sequence Assemble BLASTn, 268 de novo, 460 BLASTx, 268 report, 482 tBLASTx, 268 sequences, 405 BLAST Protein sequence to existing contig, 409 BLASTp, 269 to reference sequence, 407, 468 tBLASTn, 269 Assembly, 713 BLAST result tutorial, 127 search in, 278 variance table, 416 BLAST search Atomic composition, 319 Bioinformatics explained, 282 attB sites, add, 632 BLOSUM, scoring matrices, 310 Audit, 192 Bootstrap values, 686 Backup, 211 Borrow floating license, 29 BAM format, 437 Box plot, 581 BAM, export format specification, 738 BP reaction, Gateway cloning, 637 BAM, file format, 735 Broken pair coloring, 413 Base pairs Browser,import sequence from, 206 required for mispriming, 380

INDEX Complete Genomics data, 436 Complexity plot, 313 C/G content, 232 Configure network, 37 CAS, file format, 735 Conflicting enzymes, 651 CASAVA1.8, paired data, 427 Conflicts, overview in assembly, 416 CDS, translate to protein, 236 Consensus sequence, 665, 715 Chain flexibility, 233 extract, 483 Cheap end gaps, 661 open, 483, 665 ChIP sequencing, 513 Consensus sequence, extract, 414 ChIP sequencing, tutorial, 68 Consensus sequence, open, 468, 477 ChIP-Seq analysis, 713 Conservation, 665 Chromatin immunoprecipitation, see ChIP segraphs, 715 quencing Contact information, 15 Chromatogram traces Contig, 713 scale, 401 ambiguities, 416 .cif, file format, 292, 736 BLAST, 415 Circular view of sequence, 237, 714 create, 405 .clc, file format, 210, 736 reverse complement, 410 CLC Standard Settings, 198 view and edit, 410 CLC Workbenches, 31 Copy, 217 CLC, file format, 734--736 annotations in alignments, 670 associating with CLC Genomics Workbench, elements in Navigation Area, 167 16 into sequence, 236 Cleavage, 365 search results, GenBank, 257 the Peptidase Database, 369 search results, structure search, 263 Clone Manager, file format, 734 search results, UniProt, 260 Cloning, 620, 714, 717 sequence, 249, 250 insert fragment, 630 sequence selection, 333 Close view, 173 text selection, 249 Clustal, file format, 735 Count Cluster linkage small RNAs, 546 Average linkage, 586 tag profiling, 536 Complete linkage, 586 Coverage, definition of, 479 Single linkage, 586 .cpf, file format, 196 Coding sequence, translate to protein, 236 .chp, file format, 736 Codon Create frequency tables, reverse translation, 363 alignment, 660 usage, 364 dot plots, 303 .col, file format, 736 enzyme list, 655 Color residues, 666 local BLAST database, 280 Color space new folder, 167 Digital gene expression, 524 workspace, 181 RNA sequencing, 524 Create index file, BLAST database, 280 tag profiling, 536 Create virtual tag list, 539 Comments, 247 csfasta, file format, 430 Common name CSV batch edit, 171 export graph data points, 216 Compare workbenches, 713 formatting of decimal numbers, 209 Compatible ends, 646 Bug reporting, 32

765

INDEX .csv, file format, 736 CSV, file format, 734, 736 .ct, file format, 736 Custom annotation types, 244 Dark, color of broken pairs, 413 Data storage location, 165 Data formats bioinformatic, 733 graphics, 737 Data preferences, 195 Data sharing, 165 Data structure, 165 Database GenBank, 254 local, 165 NCBI, 279 nucleotide, 723 peptide, 723 shared BLAST database, 279 structure, 260 UniProt, 258 Db source, 247 db_xref references, 265 De novo, assembly, 460 de-multiplexing, 441 Delete element, 170 residues and gaps in alignment, 669 workspace, 182 Description, 247 batch edit, 171 DGE, 714 Digital gene expression, 714 Digital gene expression(DGE), 520 tag-based, 535 DIP detect, 507 DIP detection, 507, 713 Dipeptide distribution, 320 Directional RNA-Seq, 524 Discovery studio file format, 734 Distance measure, 585 Distance, pairwise comparison of sequences in alignments, 675 DNA translation, 334 DNAstrider, file format, 734 Dot plots, 716 Bioinformatics explained, 306 create, 303 print, 305 Double cutters, 641 Double stranded DNA, 229 Download and open search results, GenBank, 257, 263 search results, UniProt, 260 Download and save search results, GenBank, 257, 263 search results, UniProt, 260 Download of CLC Genomics Workbench, 15 Drag and drop Navigation Area, 167 search results, GenBank, 257, 263 search results, UniProt, 260 DS Gene file format, 734 E-PCR, 394 Edit alignments, 669, 715 annotations, 243, 245, 714 enzymes, 642 sequence, 236 sequences, 714 single bases, 236 ELAND, import of, 439 Element delete, 170 rename, 170 .embl, file format, 736 Embl, file format, 734 Encapsulated PostScript, export, 213 End gap cost, 661 End gap costs cheap end caps, 661 free end gaps, 661 Entry clone, creating, 637 Enzyme list, 655 create, 655 edit, 657 view, 657 Epigenomics, ChIP sequencing, 513 .eps-format, export, 213 Error reports, 32 Example data, import, 33 Excel, export file format, 736

766

INDEX Expand selection, 235 Expect, BLAST search, 276 Experiment set up, 565 Experiment, 564 Export bioinformatic data, 209 dependent objects, 210 folder, 210 graph in csv format, 216 graphics, 211 history, 210 list of formats, 733 multiple files, 210 preferences, 196 Side Panel Settings, 193 tables, 736 Export visible area, 211 Export whole view, 211 Expression analysis, 564, 714 tutorial, part I, 111 tutorial, part II, 114 tutorial, part III, 120 tutorial, part IV, 124 Expression clone, creating, 638 Extensions, 34 External files, import and export, 211 Extinction coefficient, 318 Extract part of a mapping, 415 Extract and count small RNAs, 546 Extract and count tags, 536 Extract consensus sequences, from mapping table, 483 Extract sequences, 252 Find in GenBank file, 249 in sequence, 234 results from a finished process, 180 Find open reading frames, 336 Fit to pages, print, 202 Fit Width, 179 Fixpoints, for alignments, 663 Floating license, 27 Floating license: use offline, 29 Floating Side Panel, 199 Folder, create new, tutorial, 42 Follow selection, 229 Footer, 203 Format, of the manual, 38 FormatDB, 280 Fragment table, 651 Fragment, select, 236 Fragments, separate on gel, 653 Free end gaps, 661 .fsa, file format, 736

767

G/C content, 232, 715 G/C restrictions 3' end of primer, 376 5' end of primer, 376 End length, 376 Max G/C, 376 Gap compare number of, 675 delete, 669 extension cost, 661 fraction, 666, 715 insert, 669 open cost, 661 Gapped/ungapped alignment, 472 Gateway cloning FASTA, file format, 734 add attB sites, 632 FASTQ, file format, 426 create entry clones, 637 Feature clustering, 601 create expression clones, 638 K-means clustering, 605 Gb Division, 247 K-medoids clustering, 605 .gbk, file format, 736 Feature request, 32 GC content, 375 Feature table, 320 GCG Alignment, file format, 735 Feature, for expression analysis, 564 GCG Sequence, file format, 734 Features, see Annotations .gck, file format, 736 File name, sort sequences based on, 442 GCK, Gene Construction Kit file format, 734 File system, local BLAST database, 280 Filtering restriction enzymes, 642, 644, 648, Gel 656

INDEX separate sequences without restriction enzyme digestion, 653 tabular view of fragments, 651 Gel electrophoresis, 652, 717 marker, 655 view, 653 view preferences, 653 when finding restriction sites, 650 GenBank view sequence in, 248 file format, 734 search, 254, 714 search sequence in, 264 tutorial, 48 Gene Construction Kit, file format, 734 Gene expression, 564 Gene expression analysis, 714 Gene expression, sequencing-based, 520 Gene expression, sequencing-by tag, 535 Gene finding, 336 General preferences, 191 General Sequence Analyses, 301 Genetic code, reverse translation, 363 GEO, file format, 736 Getting started tutorial, 42 .gff, file format, 736 GO, import annotation file, 748 Google sequence, 264 GOstats, see Hypergeometric tests on annotations Graph export data points in csv format, 216 Graph Side Panel, 718 Graphics data formats, 737 export, 211 Groups, define, 565 .gzip, file format, 736 Gzip, file format, 736

768 Hide/show Toolbox, 181 Hierarchical clustering of features, 601 of samples, 584 High-throughput sequencing, 713 Histogram, 614 Distributions, 614 History, 218 export, 210 preserve when exporting, 219 source elements, 219 Homology, pairwise comparison of sequences in alignments, 675 Hydrophobicity, 350, 715 Bioinformatics explained, 353 Chain Flexibility, 354 Cornette, 233, 354 Eisenberg, 233, 353 Emini, 233 Engelman (GES), 233, 353 Hopp-Woods, 233, 354 Janin, 233, 354 Karplus and Schulz, 233 Kolaskar-Tongaonkar, 233, 354 Kyte-Doolittle, 233, 353 Rose, 354 Surface Probability, 354 Welling, 233, 354 Hypergeometric tests on annotations, 607

ID, license, 22 Illumina Genome Analyzer, 713 Import bioinformatic data, 205, 206 existing data, 43 FASTA-data, 43 from a web page, 206 High-throughput sequencing data, 423 list of formats, 733 Next-Generation Sequencing data, 423 NGS data, 423 Half-life, 318 preferences, 196 Handling of results, 223 raw sequence, 206 Header, 203 Side Panel Settings, 193 Heat map, 714 using copy paste, 206 clustering of features, 603 In silico PCR, 394 clustering of samples, 587 Index for searching, 190 Help, 33 Heterozygotes, discover via secondary peaks, Infer Phylogenetic Tree, 678 Information point, primer design, 373 419

INDEX Insert gaps, 669 Insert restriction site, 631 Installation, 15 Invert sequence, 334 Isoelectric point, 317 Isoschizomers, 646 IUPAC codes nucleotides, 732 Join alignments, 671 sequences, 320 .jpg-format, export, 213 K-means clustering, 605 K-medoids clsutering, 605 Keywords, 247 Label of sequence, 229 Landscape, Print orientation, 202 Lasergene sequence file format, 734 Latin name batch edit, 171 Length, 247 License, 19 ID, 22 starting without a license, 31 License server, 27 License server: access offline, 29 Limited mode, 31 Linker trimming, 452 Links, from annotations, 245 Linux installation, 17 installation with RPM-package, 18 List of restriction enzymes, 655 List of sequences, 250 Load enzyme list, 642 Local BLAST, 271 Local BLAST Database, 280 Local BLAST database management, 281 Local BLAST Databases, 278 Local complexity plot, 313, 714 Local Database, BLAST, 271 Locale setting, 192 Location search in, 188 of selection on sequence, 179 path to, 165 Side Panel, 193 Locations multiple, 713 Log of batch processing, 225 Logo, sequence, 666, 715 LR reaction, Gateway cloning, 638

769

MA plot, 616 .ma4, file format, 736 Mac OS X installation, 16 Manage BLAST databases, 281 Manipulate sequences, 714, 717 Manual editing, auditing, 192 Manual format, 38 Map to coding regions, 468 Map reads to reference masking, 468 select reference sequences, 468 Map reads to reference, tutorial, 60 Mapping report, 477 short reads, 472 Mapping reads to a reference sequence, 468 Mapping table, 483 Mappings merge, 498 Marker, in gel view, 655 Mask, reference sequence, 468 Match weight, 561 Maximize size of view, 177 Maximum likelihood, 716 Melting temperature DMSO concentration, 375 dNTP concentration, 375 Magnesium concentration, 375 Melting temperature, 375 Cation concentration, 375, 393 Cation concentration, 395 Inner, 375 Primer concentration, 375, 393 Primer concentration, 395 Menu Bar, illustration, 164 Merge mapping results, 498 MFold, 716 Microarray analysis, 564

INDEX Microarray data formats, 742 Microarray platforms, 564 microRNA analysis, 545 Mixed data, 498 mmCIF, file format, 736 Mode toolbar, 178 Modification date, 247 Modify enzyme list, 657 Modules, 34 Molecular weight, 317 Motif list, 329 Motif search, 324, 329, 716 Mouse modes, 178 Move content of a view, 179 elements in Navigation Area, 167 sequences in alignment, 670 mRNA sequencing by tag, 535 .msf, file format, 736 Multi-group experiment, 565 Multiple alignments, 676, 715 Multiple testing Benjamini-Hochberg corrected p-values, 597 Benjamini-Hochberg FDR, 597 Bonferroni, 597 Correction of p-values, 597 FDR, 597 Multiplexing, 441 by name, 442 Multiselecting, 167 N50, 477 Name, 247 Navigate, 3D structure, 293 Navigation Area, 164 create local BLAST database, 280 illustration, 164 NCBI, 254 search for structures, 260 search sequence in, 264 search, tutorial, 48 NCBI BLAST add more databases, 724 Negatively charged residues, 319 Neighbor Joining algorithm, 685 Neighbor-joining, 716 Nested PCR primers, 716 NetAffx annotation files, 746

770 Network configuration, 37 Network drive, shared BLAST database, 279 Never show this dialog again, 192 New feature request, 32 folder, 167 folder, tutorial, 42 sequence, 249 New sequence create from a selection, 236 Newick, file format, 735 Next-Generation Sequencing, 713 .nexus, file format, 736 Nexus, file format, 734, 735 NGS, 713 .nhr, file format, 736 NHR, file format, 736 Non-coding RNA analysis, 545 Non-perfect matches, 492 Non-specific matches, 475, 492 Non-standard residues, 231 Normalization, 578 Quantile normlization, 578 Scaling, 578 Nucleotide info, 231 sequence databases, 723 Nucleotides UIPAC codes, 732 Numbers on sequence, 229 .nwk, file format, 736 .nxs, file format, 736 .oa4, file format, 736 Open consensus sequence, 468, 477, 665 from clipboard, 206 Open reading frame determination, 336 Open-ended sequence, 336 Order primers, 398, 716 ORF, 336 Organism, 247 Origins from, 219 Overhang of fragments from restriction digest, 651 Overhang, find restriction enzymes based on, 642, 644, 648, 656 .pa4, file format, 736

INDEX dot plot, 303 Page heading, 203 local complexity, 313 Page number, 203 Plug-ins, 34 Page setup, 202 .png-format, export, 213 Paired data, 423, 432, 435, 437 Polarity colors, 231 Paired distance graph, 492 Portrait, Print orientation, 202 Paired reads Positively charged residues, 319 combined with single reads, 498 PostScript, export, 213 Paired samples, expression analysis, 565 Preference group, 196 Paired status, 437 Preferences, 191 Pairwise comparison, 673 advanced, 195 PAM, scoring matrices, 310 Data, 195 Parameters export, 196 search, 255, 258, 261 General, 191 Partition function, 690, 716 import, 196 Partitioning around medoids (PAM), see K-medoids style sheet, 196 clustering toolbar, 193 Paste View, 192 text to create a new sequence, 206 view, 177 Paste/copy, 217 Primer, 394 Pattern Discovery, 322 analyze, 392 Pattern discovery, 716 based on alignments, 388 Pattern Search, 324 Buffer properties, 375 PCA, 589 design, 716 PCR primers, 716 design from alignments, 716 PCR, perform virtually, 394 display graphically, 377 .pdb, file format, 292, 736 length, 375 .seq, file format, 736 mode, 376 PDB, file format, 736 nested PCR, 376 .pdf-format, export, 213 order, 398 Peak finding, ChIP sequencing, 513 sequencing, 376 Peak, call secondary, 419 standard, 376 Peptidase, 365 TaqMan, 376 Peptide sequence databases, 723 tutorial, 139 Percent identity, pairwise comparison of sePrimers quences in alignments, 675 find binding sites, 394 Personal information, 32 Principal component analysis, 589 Pfam domain search, 355, 715 Scree plot, 592 .phr, file format, 736 Print, 200 PHR, file format, 736 3D molecule view, 299 Phred, file format, 734 dot plots, 305 .phy, file format, 736 preview, 203 Phylip, file format, 735 visible area, 201 Phylogenetic tree, 678, 716 whole view, 201 tutorial, 158 .pro, file format, 736 Phylogenetics, Bioinformatics explained, 683 Problems when starting up, 32 .pir, file format, 736 Processes, 180 PIR (NBRF), file format, 734 Properties, batch edit, 171 Plot

771

INDEX Protease, cleavage, 365 Protein charge, 346, 715 cleavage, 365 hydrophobicity, 353 Isoelectric point, 317 report, 359, 714 report, output, 360 signal peptide, 340 statistics, 317 structure prediction, 357 translation, 361 Proteolytic cleavage, 365, 715 Bioinformatics explained, 368 tutorial, 151 Proteolytic enzymes cleavage patterns, 726 Proxy server, 37 .ps-format, export, 213 .psi, file format, 736 PubMed references, search, 265 PubMed references,search, 714 QC, 581 QSEQ,file format, 426 Quality control MA plot, 616 Quality of chromatogram trace, 401 Quality of trace, 403, 450 Quality score of trace, 403, 450 Quality scores, 232 Quick start, 33 Rasmol colors, 231 Read mapping, 468 Reading frame, 336 Realign alignment, 715 Reassemble contig, 418 Rebase, restriction enzyme database, 655 Rebuild index, 190 Recognition sequence insert, 631 Recycle Bin, 170 Redo alignment, 662 Redo/Undo, 175 Reference assembly, 468 Reference sequence, 713 References, 761 Region types, 236

772 Remove annotations, 247 sequences from alignment, 670 terminated processes, 180 Rename element, 170 Repeat masking, 468 Report of assembly, 482 Report program errors, 32 Report, protein, 714 Request new feature, 32 Resequencing, tutorial, 52 Residue coloring, 231 Restore deleted elements, 170 size of view, 177 Restriction enzmyes filter, 642, 644, 648, 656 from certain suppliers, 642, 644, 648, 656 Restriction enzyme list, 655 Restriction enzyme, star activity, 655 Restriction enzymes, 639 compatible ends, 646 cutting selection, 643 isoschizomers, 646 methylation, 642, 644, 648, 656 number of cut sites, 641 overhang, 642, 644, 648, 656 separate on gel, 653 sorting, 641 Restriction sites, 639, 715 enzyme database Rebase, 655 select fragment, 236 number of, 649 on sequence, 230, 639 parameters, 647 tutorial, 159 Results handling, 223 Reverse complement, 333, 715 Reverse complement mapping, 410 Reverse sequence, 334 Reverse translation, 361, 715 Bioinformatics explained, 363 Right-click on Mac, 38 RNA secondary structure, 716 RNA structure partition function, 690

INDEX RNA structure prediction by minimum free energy minimization Bioinformatics explained, 706 RNA translation, 334 RNA-Seq analysis, 520, 713 tutorial, part I, 77, 92 tutorial, part II, 82 tutorial, part III, 90 .rnaml, file format, 736 Rotate, 3D structure, 293 RPKM,definition, 534 Safe mode, 32 SAGE tag-based mRNA sequencing, 535 SageScreen, tag profiling by, 536 SAM format, 437 SAM, export format specification, 738 SAM, file format, 735 Sample, for expression analysis, 564 Save changes in a view, 174 sequence, 49 style sheet, 196 view preferences, 196 workspace, 181 Save enzyme list, 642 Scale traces, 401 SCARF, file format, 426 Scatter plot, 619 SCF2, file format, 734 SCF3, file format, 734 Score, BLAST search, 276 Scoring matrices Bioinformatics explained, 310 BLOSUM, 310 PAM, 310 Scree plot, 592 Scroll wheel to zoom in, 178 to zoom out, 178 Search, 188 in one location, 188 BLAST, 267, 268 for structures at NCBI, 260 GenBank, 254 GenBank file, 249 handle results from GenBank, 256 handle results from NCBI structure DB, 262

773 handle results from UniProt, 259 hits, number of, 192 in a sequence, 234 in annotations, 234 in Navigation Area, 186 Local BLAST, 271 local data, 713 options, GenBank, 255 options, GenBank structure search, 261 options, UniProt, 258 own motifs, 329 parameters, 255, 258, 261 patterns, 322, 324 Pfam domains, 355 PubMed references, 265 sequence in UniProt, 265 sequence on Google, 264 sequence on NCBI, 264 sequence on web, 264 TrEMBL, 258 troubleshooting, 190 UniProt, 258 Secondary peak calling, 419 Secondary structure predict RNA, 716 Secondary structure prediction, 357, 715 Secondary structure, for primers, 376 Select exact positions, 234 in sequence, 235 parts of a sequence, 235 workspace, 181 Select annotation, 235 Selection mode in the toolbar, 179 Selection, adjust, 235 Selection, expand, 235 Selection, location on sequence, 179 Self annealing, 375 Self end annealing, 376 Separate sequences on gel, 653 using restriction enzymes, 653 Sequence alignment, 659 analysis, 301 display different information, 169 extract from sequence list, 252 find, 234 information, 247

INDEX join, 320 layout, 229 lists, 250 logo, 715 logo Bioinformatics explained, 667 new, 249 region types, 236 search, 234 select, 235 shuffle, 301 statistics, 314 view, 228 view as text, 248 view circular, 237 view format, 169 web info, 264 Sequence logo, 666 Sequencing data, 713 Sequencing primers, 716 Share data, 165, 713 Share Side Panel Settings, 193 Shared BLAST database, 279 Short reads, mapping, 472 Shortcuts, 182 Show enzymes cutting selection, 643 results from a finished process, 180 Show dialogs, 192 Show enzymes with compatible ends, 646 Show/hide Toolbox, 181 Shuffle sequence, 301, 714 Side Panel tutorial, 44 Side Panel Settings export, 193 import, 193 share with others, 193 Side Panel, location of, 193 Signal peptide, 340, 341, 715 SignalP, 340 Bioinformatics explained, 341 Single base editing in mapping, 413 in sequences, 236 Single cutters, 641 Single paired reads, 492 Small RNA analysis, 545 Small RNAs extract and count, 546 trim, 546 SNP detect, 498 SNP detection, 498, 713 Solexa, see Illumina Genome Analyzer SOLiD data, 713 Sort sequences alphabetically, 670 sequences by similarity, 670 Sort sequences by name, 442 Sort, folders, 167 Source element, 219 Species, display name, 169 Staden, file format, 734 Standard layout, trees, 682 Standard Settings, CLC, 198 Star activity, 655 Start Codon, 336 Start-up problems, 32 Statistical analysis, 593 ANOVA, 593 Corrected of p-values, 597 Paired t-test, 593 Repeated measures ANOVA, 593 t-test, 593 Volcano plot, 598 Statistics about sequence, 714 protein, 317 sequence, 314 Status Bar, 180, 181 illustration, 164 .str, file format, 736 Structure scanning, 716 Structure, prediction, 357 Style sheet, preferences, 196 Subcontig, extract part of a mapping, 415 Support mail, 15 Surface probability, 233 .svg-format, export, 213 Swiss-Prot, 258 search, see UniProt Swiss-Prot, file format, 734 Swiss-Prot/TrEMBL, 714 .swp, file format, 736 System requirements, 18 Tab delimited, file format, 736

774

INDEX Tab, file format, 734 Table of fragments, 651 Tabs, use of, 171 Tag profiling, 535 annotate tag experiment, 543 create virtual tag list, 539 Tag-based expression profiling, 713 Tags extract and count, 536 Tags, insert into sequence, 631 TaqMan primers, 716 .tar, file format, 736 Tar, file format, 736 Taxonomy batch edit, 171 tBLASTn, 269 tBLASTx, 268 Terminated processes, 180 Text format, 235 user manual, 38 view sequence, 248 Text, file format, 736 .tif-format, export, 213 Tips for BLAST searches, 146 TMHMM, 347 Toolbar illustration, 164 preferences, 193 Toolbox, 180, 181 illustration, 164 show/hide, 181 Topology layout, trees, 682 Trace colors, 231 Trace data, 400, 713 quality, 403, 450 Traces scale, 401 Transcriptome analysis, 564 Transcriptome sequencing, 520 tag-based, 535 Transcriptomics, 520 tag-based, 535 Transformation, 578 Translate a selection, 232 along DNA sequence, 231 annotation to protein, 236 CDS, 336

775 coding regions, 336 DNA to RNA, 331 nucleotide sequence, 334 ORF, 336 protein, 361 RNA to DNA, 332 to DNA, 715 to protein, 334, 715 Translation of a selection, 232 show together with DNA sequence, 231 Transmembrane helix prediction, 347, 715 TrEMBL, search, 258 Trim, 402, 450, 713 small RNAs, 546 Trimmed regions adjust manually, 410 TSV, file format, 734 Tutorial Getting started, 42 Two-color arrays, 564 Two-group experiment, 565 .txt, file format, 736 UIPAC codes amino acids, 731 Undo limit, 191 Undo/Redo, 175 UniProt, 258 search, 258, 714 search sequence in, 265 UniVec, trimming, 403, 450 UPGMA algorithm, 684, 716 Urls, Navigation Area, 211 User defined view settings, 193 User interface, 164 Variance table, assembly, 416 Vector see cloning, 620 Vector contamination, find automatically, 403, 450 Vector design, 620 Vector graphics, export, 213 VectorNTI file format, 734 View, 171 alignment, 665 dot plots, 305

INDEX GenBank format, 248 preferences, 177 save changes, 174 sequence, 228 sequence as text, 248 View Area, 171 illustration, 164 View preferences, 192 show automatically, 193 style sheet, 196 View settings user defined, 193 Virtual gel, 717 Virtual tag list create, 539 how to annotate, 543 Volcano plot, 598 .vsf, file format for settings, 193 Web page, import sequence from, 206 Wildcard, append to search, 255, 258, 261 Windows installation, 16 Workspace, 181 create, 181 delete, 182 save, 181 select, 181 Wrap sequences, 229 .xls, file format, 736 .xlsx, file format, 736 .xml, file format, 736 Zip, file format, 734--736 Zoom, 178 tutorial, 43 Zoom In, 178 Zoom Out, 178 Zoom to 100% , 179 Zoom, 3D structure, 293

776