Genetic Engineering
Dr. Munzir M.E. Ahmed
Associate Professor
Biochemistry Department
Genetic Engineering
Definitions:
also called genetic modification, recombinant
DNA technology.
The term genetic engineering is generally
used to refer to methods of recombinant
DNA technology
Genetics engineering is the modification of
an organism's genes using technology.
Genetic Engineering
As well as inserting genes, the process can be used to
remove, or "knock out", genes. The new DNA can be
inserted to a specific part of the genome.
Unlike traditional animal and plant breeding, which
involves doing multiple crosses and then selecting for the
organism with the desired phenotype, genetic engineering
takes the gene directly from one organism and delivers it to
the other. This is much faster.
Genetic Engineering
The first recombinant DNA
molecule was made by Paul
Berg in 1972
Genetically engineered
human insulin was produced
in 1978 and insulin-
producing bacteria were
commercialised in 1982.
Overview
To facilitate the study of genes,
they can be isolated and amplified.
One method of isolation and amplification of a gene of
interest is to clone the gene by inserting it into another
DNA molecule that serves as a vehicle or vector that
can be replicated in living cells.
When these two DNAs of different origin are
combined, the result is a recombinant DNA molecule.
• The recombinant DNA molecule is placed in a host cell, either
prokaryotic or eukaryotic.
• The host cell then replicates (producing a clone), and the
vector with its foreign piece of DNA also replicates.
• The foreign DNA thus becomes amplified in number, and
following its amplification can be purified for further analysis.
Applications of Genetic Engineering
1/ Production of Hormones
(insulin, Growth hormone).
2/ Genetically modified
animals are the most common
genetically engineered animal
model. They have been used to
study and model cancer, obesity,
heart disease, diabetes, etc..
Applications of Genetic Engineering
3/ Gene therapy is the genetic engineering of humans, generally
by replacing defective genes with effective ones
(phenylketonuria)
4/ Production of Antibiotics. (fungi are used for mass production
of famous antibiotics penicillin and streptomycin).
5/ Production of Enzymes: Enzyme urikinase, which is used to
dissolve blood clots.
6/ Vaccines: Influenza, Hepatitis B.
Steps of Recombinant DNA Technologies
1) Determine the gene of interest:
ex, this gene of interest was overexpression (unregulated) in patient
infected with covid 19 or Insulin
2) Isolation the Gene of interest (DNA)
Total RNA isolation and mRNA reverse transcription (cDNA).
Design of the primers: designed to match to the segment of interest
DNA to copy.
PCR Reaction: Polymerase chain reaction (PCR) is a technique
widely used to amplify a piece of DNA by in vitro enzymatic
replication.
Primer Sequence
Sense 5’-CACAAGCTTGTCATGTCCCGGCAGCTGT-3’
Antisense 5’-CACATCGATCGATGGGCCTAGCGGAAGT-3’
Figure 9.1.2
Steps of Recombinant DNA Technologies
Vol./reactio
Temperatur No. of
Time Reagent n (μl)
Step e Cycle
DNA (cDNA) 1 μl
1 94°C 5 minutes 1 10X Pyrobest Buffer II 5 μl
94°C 30 second 10 mM dNTP 4 μl
Pyrobest DNA Polymerase 0.5 μl
2 56°C 45 second 40X
Forward primer 20uM 1 μl
72°C I minute Reverse primer 20uM 1 μl
3 72°C 7 minutes 1 H2O 37.5 μl
4 ∞ Total 50 μl
4°C
PCR cycling conditions PCR reaction mixture
PCR products are analyzed by agarose gel electrophoresis. We routinely
run out 5μl of product on 1.5% agarose gels to check the products.
Steps of Recombinant DNA Technologies
3) Cut DNA in both organisms
(Digestion of DNA) Reagent Vol./reacti
on (μl)
DNA fragments and vector plasmids by
DNA 10 μl (1 μg)
restriction enzymes (EcoR1, HindIII, ClaI)
10X Restriction
To insert foreign DNA, we must first use 2 μl
Buffer
restriction enzymes to cleave the vector at
HindIII 1 μl
the specific site (cloning site). For example,
ClaI 1 μl
EcoR1 cleaves the sequence to produce
H2O 6 μl
single stranded ends called sticky ends.
Total 20 μl
These can hybridize with any piece of DNA
Restriction reaction for DNA digestion
that has also been cut with EcoR1. Incubate at 37°C for about 8 hours or overnight
Steps of Recombinant DNA Technologies
4) Gel purification of DNA
Run the digestion reaction on
agarose ge l to identify your
DNA (ex, Molecular weight is right ).
After the running the
electrophoresis and visualized
the band, excise the DNA
fragment of interest using a
wide, clean, sharp scalpel
(minimize the size of the gel
slice by removing extra
agarose).
Steps of Recombinant DNA Technologies
5) Ligation: Reagent
Vol./react
ion (μl)
The sticky ends of the foreign and
Digested DNA (akr7a3)
plasmid DNA molecules hybridize and 15 μl
then are sealed into phosphodiester Digested vector (CMV)
5 μl
linkages by the en zyme DNA ligase, 10X Ligase Buffer 2.5 μl
creating a recombinant plasmids
T4 DNA Ligase 1 μl
contains the inserted DNA fragment, an
H2O 1.5 μl
ampicillin resistance gene, and a
Total 25 μl
replication origin.
Ligation reaction for PCR
gene from recombinant Incubate at 16°C for overnight
cut DNA other organism plasmid
plasmid + vector
Steps of Recombinant DNA Technologies
6) Transformation: The vector inserts the DNA into a
new cell, which is grown to form a clone. (bacteria, yeast)
Each plasmid carries a unique fragment of foreign DNA.
Next, host cells (ex, DH5α bacteria) are added to the
recombinant plasmids. The cells have been treated with CaCl2
to make them permeable to DNA molecules.
Through a process called transformation, a few cells take up a
recombinant plasmid while most other cells do not.
7) Large quantities of the gene product can be harvested
from the clone.
transformed
gene from bacteria
recombinant
other organism
plasmid
+ vector
plasmid
grow
bacteria
harvest (purify)
protein
Why mix genes together?
• Gene produces protein in different
organism or different individual
human insulin gene in bacteria
TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC
CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC
“new” protein from organism ex: human insulin from bacteria
aa aa aa aa aa aa aa aa aa aa
bacteria human insulin
