J med genet 2014-wells-553-62

Methods
Downloaded from jmg.bmj.com on October 10, 2014 - Published by group.bmj.com
ORIGINAL ARTICLE
Clinical utilisation of a rapid low-pass whole
genome sequencing technique for the diagnosis of
aneuploidy in human embryos prior to implantation
Dagan Wells,1 Kulvinder Kaur,2 Jamie Grifo,3 Michael Glassner,4 Jenny C Taylor,2
Elpida Fragouli,5 Santiago Munne6
▸ Additional material is
published online only. To view
please visit the journal online
(http://dx.doi.org/10.1136/
jmedgenet-2014-102497).
1Nuffield Department of
Obstetrics and Gynaecology,
John Radcliffe Hospital,
University of Oxford, Oxford,
UK
2NIHR Oxford Biomedical
Research Centre, Wellcome
Trust Centre for Human
Genetics, Oxford, UK
3New York University Fertility
Center, New York, New York,
USA
4Main Line Fertility, Bryn
Mawr, Pennsylvania, USA
5Reprogenetics UK, Institute of
Reproductive Sciences, Oxford,
UK
6Reprogenetics LLC, Livingston,
New Jersey, USA
Correspondence to
Dr Dagan Wells,
University of Oxford,
Department of Obstetrics and
Gynaecology, John Radcliffe
Hospital, Women’s Centre,
Oxford, OX3 9DU, UK;
dagan.wells@obs-gyn.ox.ac.uk
Received 29 April 2014
Revised 4 June 2014
Accepted 20 June 2014
To cite: Wells D, Kaur K,
Grifo J, et al. J Med Genet
2014;51:553–562.
ABSTRACT
Background The majority of human embryos created
using in vitro fertilisation (IVF) techniques are aneuploid.
Comprehensive chromosome screening methods,
applicable to single cells biopsied from preimplantation
embryos, allow reliable identification and transfer of
euploid embryos. Recently, randomised trials using such
methods have indicated that aneuploidy screening
improves IVF success rates. However, the high cost of
testing has restricted the availability of this potentially
beneficial strategy. This study aimed to harness next-generation
sequencing (NGS) technology, with the
intention of lowering the costs of preimplantation
aneuploidy screening.
Methods Embryo biopsy, whole genome amplification
and semiconductor sequencing.
Results A rapid (<15 h) NGS protocol was developed,
with consumable cost only two-thirds that of the most
widely used method for embryo aneuploidy detection.
Validation involved blinded analysis of 54 cells from cell
lines or biopsies from human embryos. Sensitivity and
specificity were 100%. The method was applied
clinically, assisting in the selection of euploid embryos in
two IVF cycles, producing healthy children in both cases.
The NGS approach was also able to reveal specified
mutations in the nuclear or mitochondrial genomes in
parallel with chromosome assessment. Interestingly,
elevated mitochondrial DNA content was associated with
aneuploidy ( p<0.05), a finding suggestive of a link
between mitochondria and chromosomal malsegregation.
Conclusions This study demonstrates that NGS
provides highly accurate, low-cost diagnosis of
aneuploidy in cells from human preimplantation embryos
and is rapid enough to allow testing without embryo
cryopreservation. The method described also has the
potential to shed light on other aspects of embryo
genetics of relevance to health and viability.
INTRODUCTION
Chromosome segregation during female meiosis is
particularly error prone in humans, a problem
that worsens with advancing age. Recent studies
have demonstrated that approximately a quarter
of oocytes from women in their early 30s are
chromosomally abnormal, with aneuploidy rates
increasing to over 75% in the oocytes of women
over 40.1 It has been shown that most of the
aneuploid embryos produced from such oocytes
fail to implant in the uterus, although a minority
do succeed in forming a pregnancy only to later
miscarry.2 The high frequency of chromosome
abnormality during the first few days of life is of
great relevance to infertility treatments such as in
vitro fertilisation (IVF). Typically, IVF involves
the fertilisation of several oocytes, but in order to
avoid multiple pregnancy and the associated risks
of complications for the mother and children, it
is recommended that the number of embryos
transferred to the uterus is restricted, ideally to a
single embryo.3 Maximising the likelihood of
obtaining a pregnancy depends on accurate deter-mination
of the embryo with the greatest capacity
for producing a child, ensuring that it is priori-tised
for transfer. Currently, the decision of
which embryo should be transferred is primarily
based on a simple evaluation of morphology.
However, the appearance of an embryo is only
weakly correlated with its potential to form a
pregnancy and reveals no useful information
about its chromosomal status. In theory, screening
for aneuploidy, a problem which has a more
definitive impact on the ability of an embryo to
produce a healthy baby, could provide a valuable
means of identifying viable embryos.
The main obstacle to testing human embryos for
aneuploidy is the extremely limited amount of
tissue available for analysis. At the time when most
genetic testing has traditionally been carried out,
embryos are composed of just 6–10 cells and only
one cell (blastomere) may be safely removed for
analysis. Although obtaining accurate genetic infor-mation
from a single cell is challenging, recent
years have seen several methods developed for this
purpose. Some protocols are based on the use of
microarrays (eg, comparative genomic hybridisation
or analysis of single nucleotide polymorphisms),4 5
while others involve quantitative PCR.6 In the last
2 years, several randomised trials using these tech-niques
have been undertaken, producing clinical
data supporting the hypothesis that screening of
embryos for aneuploidy can improve IVF out-comes,
increasing pregnancy rates and reducing
miscarriages.7–10 However, all methods currently
available for the genetic analysis of preimplantation
embryos suffer from shortcomings which limit
their clinical applicability.
Cost is an important consideration for both clin-ical
and scientific applications of single cell analysis.
In the context of IVF treatment, the cost of aneu-ploidy
screening is multiplied by the number of
embryos produced by the couple (averaging
Open Access
Scan to access more
free content
Wells D, et al. J Med Genet 2014;51:553–562. doi:10.1136/jmedgenet-2014-102497 553

Methods
approximately six, but in some cases exceeding 20). The
expense associated with the testing of multiple samples puts
chromosome analysis beyond the reach of many patients. The
potential for producing a large number of embryos in a single
cycle of IVF treatment also means that any test must be scalable,
allowing multiple samples to be assessed simultaneously. For any
clinically applied diagnostic assay, it is advantageous if results
can be provided rapidly. However, in the case of preimplanta-tion
embryo testing the speed of the procedure assumes even
greater importance since the window of time during which the
embryo has the capacity to implant and the mother’s endomet-rium
is receptive is narrow. Depending on the exact embryo
biopsy strategy employed, there may be less than 24 h available
for genetic analysis.
This study aimed to develop a rapid, scalable, cost-effective
method for the genetic analysis of single cells (blastomeres) or
trophectoderm biopsies derived from human preimplantation
embryos. For this purpose, we chose to employ next-generation
sequencing (NGS) technology. NGS is a term that encompasses
a variety of different methods capable of generating large
quantities of DNA sequence information, rapidly and at a low
cost per base. Our data confirm that NGS can be successfully
applied to the diagnosis of a variety of genetic abnormalities
in single cells from human embryos and has various advantages
over traditional technologies used for preimplantation genetic
diagnosis and screening. Clinical applicability was
demonstrated.
RESULTS
Optimisation of an NGS protocol for use with whole
genome amplification products from single cells
Optimisation of the NGS protocol was performed in order to
maximise the quantity of data (ie, number of reads) obtained
per sequencing run. The number of reads per run is an
important consideration, as the greater the amount of
sequence data produced the larger the number of samples that
can be simultaneously tested. Multiplex analysis of samples is
an essential factor in lowering the per-embryo costs of NGS.
Efforts were also made to reduce the time from sample acqui-sition
to results, which is important given the extremely
limited time available for the assessment of preimplantation
embryos. Protocol improvements increased the amount of
sequence data obtained more than threefold compared with
initial results, producing an average per chip of 356.62 Mb.
A time series of incubations was performed on a range of
input DNA concentrations (100–500 ng) of whole genome
amplification (WGA) product to establish the optimal frag-mentation
conditions for samples derived from single cells.
An amount of 100 ng of input DNA was found to be suffi-cient
for generating successful sequencing libraries and was
used for all subsequent samples in order to minimise the
amount of WGA necessary. Reducing the amount of amplifi-cation
decreases the risk of artefacts and allows for an acceler-ated
protocol. Accurate quantification of the input material
was essential for enabling this lower range of WGA DNA to
be used. Quantification using a Nanodrop spectrophotomer
consistently resulted in an overestimation of the DNA concen-tration
resulting in insufficient input material being used for
library generation. The Qubit high sensitivity double stranded
DNA (HS dsDNA) quantification method was found to give a
much more accurate estimation of the amount of DNA
present in the sample. Incubation times of 15 and 17.5 min
provided the optimal size fragment distribution for Ion
Torrent 100 and 200 bp chemistries, respectively.
Agarose and solid phase reversible immobilisation (SPRI)
bead-based methods were both tested for size selection of the
sequencing libraries. For the SPRI bead size selection, the
AxyPrep FragmentSelect-I kit (Appleton Woods) was trialled. A
ratio of 2× input sample volume to 1.8× input volume of
binding to wash off was used to select the fragment at 300 bp.
This method was reproducible, rapid and effective for fully
removing the upper and lower fragments of DNA, but resulted
in a relatively broad size range distribution. This negatively
affected the amount of data generated on the Ion Torrent
PGM sequencer, as the shorter fragments were preferentially
amplified. Gel excision was found to give a much tighter distri-bution
of read lengths. The sample fraction at 300 bp was
excised using E-Gel SizeSelect Gels (Life Technologies).
Both 100 and 200 bp sequencing chemistry were found to
be appropriate for analysis of aneuploidy and DNA sequence
in single cells. Ultimately, in order to generate as much data
as possible for each sample, the 200 bp chemistry was
selected. A minimum of five cycles of adaptor mediated amp-lification
was required to generate quantifiable sequence-ready
libraries. The samples were quantified on a 2100 Bioanalyser
High Sensitivity Chip (Agilent Technologies, Santa Clara,
California, USA). Clonal amplification for template prepar-ation
was performed on the Ion OneTouch system. Input con-centrations
of 18 and 24 pM were tested to establish the
optimal sample to bead ratio for template preparation.
An amount of 24 pM input concentration resulted in a
greater yield of data without generating significantly more
polyclonal reads.
Aneuploidy can be detected in single cells from embryos
using a rapid low-pass genome sequencing methodology
The current research focused on the use of multiple displace-ment
amplification (MDA) in order to generate sufficient
DNA for subsequent NGS. Amplification was obtained
from 61/61 (100%) samples. Initially, NGS was applied to
single cells isolated from six well characterised, karyotypically
stable cell lines (samples 1–18 in table 1).
From the analysis of single cells of known karyotype, it was
clear that WGA introduced distortions in the relationship
between the number of sequence reads and chromosome
length, complicating attempts to assess aneuploidy based on
reads per chromosome. However, these deviations were found
to be highly reproducible from one sample to the next, pre-sumably
a consequence of preferential DNA amplification
associated with differences in the base composition and chro-matin
structure of individual chromosomes. The consistency
of the distortions meant that it was relatively simple to com-pensate
for amplification bias. This was achieved by compar-ing
results obtained from cell line and embryo cells with
those obtained from a series of chromosomally normal refer-ence
samples. Essentially, a set of 24 reference values were
created by averaging the percentage of mapped reads attribut-able
to each chromosome in a series of euploid samples (see
online supplementary table S1). For embryo (test) samples,
the percentage of reads derived from each chromosome was
divided by the reference value for the same chromosome.
Chromosomes present in a normal (disomic) state displayed a
test to reference ratio ranging from 0.7 to 1.2, whereas
chromosomal gain (eg, trisomy) and loss (eg, monosomy)
were associated with ratios >1.2 and <0.7, respectively. Using
this approach, the karyotypes of all single cells derived from
cell lines were correctly defined using NGS (summarised in
table 1).
554 Wells D, et al. J Med Genet 2014;51:553–562. doi:10.1136/jmedgenet-2014-102497

Methods
Table 1 Samples assessed and cytogenetic results obtained
Sample number Predicted karyotype based on NGS result Source of cells Confirmatory result (method)
1–3 47,XY,+21 Single cell from cell line 47,XY,+21 (G-banding)
4–6 45,X Single cell from cell line 45,X (G-banding)
7 and 8 47,XY,+16 Single cell from cell line 47,XY,+16 (G-banding)
9 and 10 47,XY,+18 Single cell from cell line 47,XY,+18 (G-banding)
11–14 46,XY Single cell from cell line 46,XY (G-banding)
15–18 46,XX Single cell from cell line 46,XX (G-banding)
19 47,XX,+12 Embryo (blastomere) 47,XX,+12 (aCGH)
20 47,XX,+6 Embryo (blastomere) 47,XX,+6 (aCGH)
21 48,XX,+8,+9 Embryo (blastomere) 48,XX,+8,+9 (aCGH)
22 43,XY,−17,−21,−22 Embryo (blastomere) 43,XY,−17,−21,−22 (aCGH)
23 46,XY Embryo (trophectoderm) 46,XY (aCGH)
26 46,XY,−13,+21 Embryo (trophectoderm) 46,XY,−13,+21 (aCGH)
27 46,XX,+14,−16 Embryo (trophectoderm) 46,XX,+14,−16 (aCGH)
29 45,XX,−9 Embryo (trophectoderm) 45,XX,−9 (aCGH)
30 46,XX Embryo (trophectoderm) 46,XX (aCGH)
31 48,XX,+11,+19 Embryo (trophectoderm) 48,XX,+11,+19 (aCGH)
32 44,XY,−10,−18 Embryo (trophectoderm) 44,XY,−10,−18 (aCGH)
33 46,XX,-2,+16 Embryo (trophectoderm) 46,XX,−2,+16 (aCGH)
34 46,XY,+1,+9,−10,+11,−12,−22 Embryo (trophectoderm) 44,XY,+9,−10,−12,−22 (aCGH)
35 47,XX,+9,+10,−21 Embryo (trophectoderm) 47,XX,+9,+10,−21 (aCGH)
37 45,XXY,−15,−17 Embryo (trophectoderm) 45,XXY,−13,−15,+16,−17 (aCGH)
38 45,XY,−18 Embryo (trophectoderm) 45,XY,−18 (aCGH)
40 47,XY,+14 Embryo (trophectoderm) 47,XY,+14 (aCGH)
41 47,XX,+21 Embryo (trophectoderm) 47,XX,+21 (aCGH)
46 45,X Embryo (trophectoderm) 45,X (aCGH)
48a 45,XX,−22 Embryo (trophectoderm) 45,XX−22 (aCGH)
48b 45,XX,−22 Embryo (trophectoderm)
48c 45,XX,−22 Embryo (trophectoderm)
49 46,XX Embryo (trophectoderm) 46,XX (aCGH)
54 47,XY,+22 Embryo (trophectoderm) 47,XY,+22 (aCGH)
55 46,XX Clinical embryo biopsy (trophectoderm) Not applicable
56 46,XY Clinical embryo biopsy (trophectoderm) Not applicable
57 45,XY,−12 Clinical embryo biopsy (trophectoderm) Not applicable
58 45,XX−2 Clinical embryo biopsy (trophectoderm) Not applicable
59 46,XX Clinical embryo biopsy (trophectoderm) Not applicable
Samples 23–54 (excluding 48b and 48c) were tested a second time as part of a large barcoded multiplex (a total of 32 samples) and yielded identical cytogenetic results. Samples 48a,
48b and 48c represent three separate trophectoderm biopsies performed on the same embryo.
aCGH, microarray comparative genomic hybridisation; NGS, next-generation sequencing.

Methods
NGS provides a highly accurate detection of aneuploidy and
confirms that monosomy and other unusual forms of
aneuploidy remain common at the final stage of
preimplantation development
During the initial validation phase of this study, 38 samples
from human embryos were analysed using NGS. Results were
obtained from all embryos tested (100%). The samples assessed
included cells from 32 blastocysts, the final stage of preimplan-tation
development. The blastocysts were derived from five
infertile couples of advanced reproductive age (average female
age 42 years). Overall, 24 of the embryos were diagnosed abnor-mal
(75%), emphasising the high risk of transferring an aneu-ploid
embryo to the uterus when such patients undergo IVF
treatment. A total of 51 chromosome errors were detected
(table 1; see online supplementary figure S1). With the excep-tion
of chromosomes 3, 4, 5 and 20, all chromosomes were
affected by aneuploidy at least once in this set of samples, with
chromosome 22 displaying the greatest number of errors.
Monosomies and trisomies occurred at similar frequencies.
A second biopsy was taken from each embryo, coded and
blindly assessed using a well-established microarray-comparative
genomic hybridisation (CGH) approach. After decoding, the
diagnostic results from the two analyses were compared. In all
cases, the tests were in agreement concerning the embryos that
were chromosomally normal and those that were aneuploid
(figure 1). The karyotypes predicted by microarray comparative
genomic hybridisation (aCGH) and NGS were entirely identical
for all but two embryos. The embryos with discrepant results
(numbers 34 and 37 in table 1) were considered highly abnor-mal
using both methods, each affected by several aneuploidies
(>3 abnormal chromosomes each). Considering the 1296 chro-mosomes
assessed in the 54 samples used to evaluate the accur-acy
of NGS, the concordance rate per chromosome was 99.7%.
Chromosomal analysis of embryos using NGS can be carried
out at a speed, throughput and cost appropriate for use in
conjunction with standard embryo biopsy and transfer
protocols
Given the quantity of sequence data produced from each
sequencing chip, it seemed likely that a large number of samples
could be simultaneously tested, significantly reducing costs per
sample and greatly increasing throughput. To verify this, 32
samples derived from cells biopsied from human embryos were
multiplexed together. Different adapters of unique DNA
sequence (ie, ‘barcodes’) were ligated to the DNA fragments
obtained from each embryo and samples were pooled together
and then sequenced simultaneously. Once the process was com-plete,
the sequence of the barcode at the beginning of each
DNA fragment was examined allowing the fragment to be
assigned to an individual embryo (see online supplementary
figure S2). The cytogenetic diagnoses obtained were found to be
identical regardless of whether cells were analysed individually
or multiplexed together. The robust results obtained for the sim-ultaneous
analysis of 32 samples suggest that even higher levels
of multiplexing are likely to be possible.
Figure 1 Aneuploidy analysis of cells biopsied from a human blastocyst. (A) Analysis of embryo #41 using next-generation sequencing (NGS)
predicting a female trisomic for chromosome 21; (B) Microarray-CGH analysis of a second embryo biopsy sample from embryo #41, confirming the
NGS result.

Chromosomal analysis of cells from embryos could be com-pleted
within 15 h using the optimised NGS protocol. However,
even faster testing was shown to be possible using the new Ion
Isothermal Amplification Chemistry (Life Technologies), which
streamlines the sequencing procedure, eliminating the need for
emulsion PCR. Using this approach, chromosome screening
data could be obtained within 8 h (see online supplementary
table S3). A total of 17 embryo biopsy specimens were simultan-eously
tested using this new approach and chromosomal copy
number assessments were shown to be concordant with aCGH
in all cases (see online supplementary table S4).
NGS allows the potential for simultaneous chromosomal
analysis and diagnosis of gene mutations in single cells
In the current study, low-pass sequencing of WGA products
yielded <0.1% coverage of the genome, so the chances of a
given locus being represented were extremely low. For this
reason, attempts to provide data on specific mutations required
a semitargeted approach, enriching the genomic sequences rele-vant
for diagnosis (ie, the mutation sites and/or informative
linked polymorphisms) before carrying out NGS. As a proof of
concept, single cells were isolated from a cell line homozygous
for the common CFTR ▵F508 mutation, associated with cystic
fibrosis. After cell lysis and WGA, an aliquot of the amplified
product was subjected to PCR, amplifying a 95 bp DNA frag-ment
encompassing the ▵F508 mutation site. Sequencing librar-ies
were generated from the original WGA product and the
locus-specific PCR product. The two libraries were then com-bined
together and simultaneously sequenced. This approach
provided sufficient DNA sequence information across all chro-mosomes
to allow detection of aneuploidy, while also sequen-cing
the region of CFTR containing ▵F508 multiple times
(sequenced to a coverage depth of approximately 30×). All of
the CFTR sequence reads obtained confirmed the
homozygous-affected genotype of the tested cells (see online
supplementary figure S3).
The NGS method provides quantitative data on mtDNA copy
number and mutation load
Not only did the optimised NGS protocol allow accurate detec-tion
of aneuploidy, it also succeeded in sequencing the entirety
of the mitochondrial genome in single cells to a coverage depth
of 20–60×. Interestingly, when the ratio of mitochondrial DNA
(mtDNA) sequences to nuclear DNA sequences was considered,
significant differences were seen between embryos derived from
the same couple. In most cases, the embryo with the largest
quantity of mtDNA from a single couple had three to sixfold
more than the embryo with the least. However, more extreme
variations were also detected. In one instance, a 97-fold differ-ence
in mtDNA content was observed between two embryos
derived from the same parents. It seems highly likely that such
dramatic differences in a key organelle would have functional
consequences for the affected cells. Indeed, a potentially
important observation was that embryos with high levels of
mtDNA had an elevated risk of aneuploidy (p<0.05) (figure 2).
The use of real-time PCR to quantify a fragment of the mito-chondrial
genome in trophectoderm samples from human blas-tocysts
verified the results of NGS-based mtDNA quantification
(see online supplementary figure S4).
In the current study, a blinded analysis was carried out on
individual cells isolated from a cell line affected with an mtDNA
disorder. Analysis of DNA from the cell line using conventional
methods had previously shown that ∼70% of the mitochondrial
genomes were affected by a clinically significant 7438 bp
Methods
deletion. The single cell NGS method was capable of detecting
the mutation, correctly defining the breakpoints of the deletion,
and provided an accurate estimation of the proportion of mito-chondria
affected (see online supplementary figure S5).
Additionally, the chromosomal status of the cell tested (euploid)
was simultaneously confirmed using the same method discussed
above. Other research supports the suggestion that mtDNA can
be accurately sequenced in small numbers of cells derived from
human preimplantation embryos.11
Clinical application of NGS to screen human embryos for
aneuploidy, resulting in pregnancies and births
After confirmation of the accuracy of aneuploidy detection in
the blinded study outlined above, the NGS method was used to
help guide the selection of embryos produced by two infertile
couples (women aged 35 and 37 years). A total of five blastocyst
stage embryos suitable for biopsy were produced in one IVF
cycle and two in the other. A trophectoderm sample (composed
of ∼5 cells) was taken from each embryo and tested for aneu-ploidy
using the NGS method. Two embryos were found to
have abnormalities, predicted to lead to failure of implantation
or early pregnancy loss and were excluded (table 1, samples 57
and 58). The remaining embryos were shown to be euploid.
One chromosomally normal embryo, containing typical quan-tities
of mtDNA, was transferred in each instance and resulted
in the birth of a healthy baby in the summer of 2013 in both
cases. The sex and chromosomal status of the two children were
confirmed to be identical to that predicted by NGS.
DISCUSSION
This study describes the design, optimisation, validation and
clinical application of an aneuploidy detection method applic-able
to single cells. The method, based on NGS, was shown to
be rapid and highly accurate. Compatibility with utilisation in a
Figure 2 Relationship between blastocyst aneuploidy and relative
mitochondrial DNA (mtDNA) quantity in human blastocyst stage
embryos. The amount of mtDNA relative to nuclear DNA is significantly
lower in biopsies of trophectoderm cells from euploid embryos
(p<0.05, two-tailed t test). Red spots indicate the mtDNA content of
the two chromosomally normal embryos that were transferred to
patients and produced viable pregnancies.

Methods
clinical setting was demonstrated by the testing of embryos pro-duced
using IVF technology, assisting in the identification and
transfer to the uterus of chromosomally normal embryos. This
resulted in viable pregnancies and the birth of healthy children.
Although alternative methods for the detection of aneuploidy in
human preimplantation embryos already exist, NGS offers sig-nificant
advantages in terms of the breadth and scope of the
information provided and the cost of testing.
The number of patients requesting preimplantation genetic
testing of their embryos is growing significantly. In our own
laboratory, we have seen referrals for preimplantation genetic
diagnosis (PGD) and preimplantation genetic screening (PGS)
rise by over 50% in the last 2 years and many other clinics have
witnessed similar increases. The upsurge in the number of cases
has intensified the need to develop methods capable of deliver-ing
accurate diagnosis of embryos at reduced cost, thereby redu-cing
the financial burden on patients and healthcare systems.
The results of the current research confirm that NGS provides
highly accurate aneuploidy detection at substantially lower cost
than existing methods used for PGS and that testing can be per-formed
within a fresh IVF cycle, avoiding the complication of
cryopreservation. A small number of previous studies had sug-gested
that the combination of WGA and NGS might be
capable of producing useful genomic data from single cells.12–15
However, previous attempts to harness massively-parallel
sequencing methods for the detection of aneuploidy in single
cells required several days to complete, meaning that preimplan-tation
genetic testing could only be carried out if embryos were
cryopreserved after biopsy. The addition of embryo cryopreser-vation
represents a deviation from the most widely used strat-egies
for embryo analysis, which increases the cost of the
procedure and carries a risk of harm to the embryo (most fertil-ity
clinics report that 5%–10% of embryos do not survive freez-ing
and thawing).
The need for rapid methods for the genetic testing of preim-plantation
embryos stems from the fact that the window of time
during which implantation can occur is narrow. If embryo
biopsy is undertaken at the blastocyst stage (5 days after fertilisa-tion
of the oocyte)—increasingly the preferred strategy for PGD
and PGS—less than 24 h are available for genetic analysis. In
the current study, a protocol requiring under 15 h was used suc-cessfully
in clinical cycles, a turnaround time similar to speeds
achieved using the most rapid microarray-CGH methods cur-rently
available and considerably quicker than alternative PGD
and PGS methods based on the use of SNP microarrays (see
online supplementary table S2). Subsequent work, carried out
after the initial clinical cases, demonstrated that reliable aneu-ploidy
detection in single cells biopsied from human embryos is
possible in even shorter timeframes (less than 8 h) when using
NGS.
As well as the requirement for rapid results, methods used for
the analysis of preimplantation embryos must also permit simul-taneous
testing of multiple samples. Individual patients undergo-ing
IVF/PGD treatment typically produce several embryos, each
of which needs to be examined. The fact that each patient is
associated with multiple tests is problematic for some PGD and
PGS methods: technical bottlenecks mean that equipment used
for analysis must be duplicated in order to accommodate all of
the samples. NGS has the advantage in that it allows large
numbers of samples to be processed concurrently. Up to 32
samples were processed simultaneously during this study and
the data obtained suggest that two or three times that number
could potentially be multiplexed together without any signifi-cant
loss of accuracy. Multiplex analysis also has implications in
terms of the price of the test. Although, NGS is becoming less
expensive every year, at present each run is still associated with
an appreciable cost. However, consumable expenses can be
shared across several samples tested during the same run using
molecular ‘barcoding’ (see online supplementary figure S2). In
the current study, this approach allowed NGS to reduce the per-embryo
cost by more than a third compared with the most
widely used microarray-based approaches (based on 32-plex
analysis and manufacturer’s list prices). Such a reduction has
substantial implications for embryo chromosome screening,
strengthening the health-economics argument for clinical utilisa-tion
and potentially making it accessible to much greater
numbers of infertile couples.
The data presented here provide reassurance concerning the
accuracy of aneuploidy detection in cells from preimplantation
embryos using NGS. Near complete concordance was achieved
in comparison with results obtained using a highly validated
aCGH method (see online supplementary tables S5 and S6).4 16
A total of 54 samples were tested during the initial validation
phase of this study and the diagnosis (normal or abnormal)
using the two methods was identical in all cases. Agreement was
seen for 99.7% of the 1296 chromosomes evaluated. The only
two embryos with any discrepant findings (numbers 34 and 37
in table 1) were each highly abnormal, containing multiple
aneuploidies (>3 abnormal chromosomes each). Embryos
affected by several chromosome abnormalities frequently display
chromosomal mosaicism and consequently a degree of cytogen-etic
divergence between the different biopsy specimens is
expected. In these two cases, most of the aneuploidies were
present in both biopsies taken from the same embryo and may
have been a consequence of meiotic errors. However, additional
aneuploidies were present in one of the two samples. The dis-crepant
findings could be explained by mitotic errors occurring
after fertilisation, but this cannot be proven conclusively on this
occasion as no further embryo material was available for ana-lysis.
The spectrum of abnormalities detected in the embryos
analysed during this study are in agreement with the findings of
numerous previous investigations, using a variety of cytogenetic
techniques, and confirm that a wide range of abnormalities,
including types never seen in established pregnancies or miscar-riages
and presumably lethal during early development, are
common prior to implantation.
Diagnosis of mutations responsible for single gene disorders
in embryos produced using IVF technology (ie, PGD) is increas-ingly
requested by couples at high-risk of transmitting an inher-ited
disorder to their children.17 In most cases, this involves
biopsy of single cells at the cleavage stage, genetic testing and
transfer of unaffected embryos to the mother’s uterus. Any
pregnancies that result following this process should be free of
the familial disorder and therefore the issue of selected preg-nancy
termination is avoided. However, on some occasions the
embryos transferred miscarry due to a spontaneously arising
chromosome abnormality. This is a particular issue for couples
requesting PGD who carry a single gene mutation and are at
increased risk of aneuploid conception due to female age.
Although the research reported in this paper was principally
focused on the use of NGS for preimplantation aneuploidy
detection, a pilot experiment was undertaken to assess the feasi-bility
of testing for alterations of DNA sequence in parallel with
chromosome screening. Historically, the combination of DNA
sequence analysis and chromosome copy number testing in
single cells has been challenging. Of the hundreds of protocols
for the PGD of gene mutations published in the literature, only
a handful are compatible with comprehensive chromosome

analysis.18–21 The data presented here are preliminary, but indi-cate
that NGS has the potential to deliver accurate mutation
detection as well as aneuploidy screening, overcoming a limita-tion
of traditional PGD tests. It is important to note, however,
that rates of allele dropout (failure to amplify one of the two
alleles in a heterozygous cell) are appreciable at the single cell
level and consequently a significant error rate would be
expected for diagnostics based on analysis of the mutation site
alone. For this reason, analysis of several flanking polymorph-isms
remains advisable, supplementing direct mutation detection
with redundant diagnoses based on linkage analysis. Strategies
using multiple linked markers are commonly used for PGD of
single gene disorders.22
While there is accumulating evidence to suggest that aneu-ploidy
is the single most important factor affecting the ability of
an embryo to implant and form a viable pregnancy,6–10 23 24 it
remains the case that even the transfer of a chromosomally
normal, morphologically perfect embryo to the uterus cannot
guarantee a pregnancy. Clearly there are other, less well-defined
aspects of embryo biology that are also critical for successful
development. A prime candidate in this regard is mitochondrial
copy number, which previous studies have linked to various
aspects of oocyte and embryo competence.25 26 Recent research
in our laboratory has demonstrated that an unusually high level
of mtDNA in human preimplantation embryos is associated
with failure of implantation in the uterus.27 Unlike all other
methods of embryo aneuploidy screening currently in use, NGS
is capable of simultaneously providing data on mtDNA copy
number as well as chromosome imbalance. While further work
is needed to replicate our observations, the evidence thus far
suggests that quantification of mtDNA may provide an extra
dimension to embryo assessment, enhancing our ability to rec-ognise
viable embryos and thereby improving the likelihood of
successful IVF treatment.27
In the current study, the embryos from clinical cycles that pro-duced
babies had typical mtDNA levels, but too few embryos
were transferred to allow any conclusions to be drawn concern-ing
the relevance of mtDNA in terms of IVF success. However,
an observation of biological and clinical importance was that
embryos with high levels of mtDNA had an elevated risk of
aneuploidy (p<0.05) (figure 2). The link between chromosomal
abnormality and mtDNA content, revealed by NGS, was subse-quently
confirmed in our laboratory using qPCR and is con-cordant
with a previous study that employed real-time PCR
methods.28 It is likely that the detection of greater quantities of
mtDNA is indicative of an increased number of mitochondria
present in the cells tested, although this remains to be conclu-sively
proven. Raised quantities of mitochondria could lead to
abnormally elevated metabolism, a factor that previous studies
have speculated might be associated with reduced embryo viabil-ity,
the so-called ‘Quiet Embryo’ hypothesis.29 Alternatively,
expansion of the mitochondrial population could represent a
compensatory mechanism, symptomatic of the presence of
defective organelles, perhaps a consequence of mtDNA
mutation.
The ability of the NGS method described to detect and quan-tify
mtDNA mutation was also demonstrated during this study.
mtDNA disorders are responsible for a number of devastating
conditions for which there is no cure and few treatment
options. In most cases, affected individuals are heteroplasmic,
having a mixture of normal and mutant mitochondria in their
cells. The severity of the symptoms is determined by the propor-tion
of organelles that are defective. As many as one person in
400 is affected by an mtDNA disorder30 and the phenomenon
Methods
of the mitochondrial bottleneck means that the phenotype can
swing from mild to severe in a single generation. One possibility
for the avoidance of mtDNA disorders is to perform PGD,
testing cells biopsied from preimplantation embryos and trans-ferring
to the uterus only those with entirely normal mitochon-dria
or with low (subclinical) mutation loads.31–37 However,
accurate quantification of mtDNA mutations has been technic-ally
difficult at the single cell level, requiring extensive protocol
design and optimisation for each mutation tested. It seems likely
that NGS will provide a single robust method for the detection
and quantification of any mtDNA mutation, streamlining the
PGD process.
CONCLUSIONS
Worldwide, approximately a million assisted reproductive treat-ment
cycles end in failure each year, emphasising the urgent
need for improvements to existing techniques. There is mount-ing
evidence from randomised clinical trials that many infertile
couples can achieve increased IVF success rates if the embryos
chosen for transfer to the uterus have been shown to be
euploid, yet only a small fraction of IVF cycles currently include
chromosome screening. The wider application of genetic ana-lysis
is restrained, in part, by the high costs associated with
testing. The technique detailed in this paper has the capacity to
cut the cost of analysis significantly and should therefore
increase patient access to embryo aneuploidy screening. Unlike
previous studies applying NGS to single cells, this method is
compatible with the most widely used strategies for embryo
testing, which require diagnosis to be completed within ∼24 h
of embryo biopsy. The clinical applicability of the test was
demonstrated in IVF cycles, resulting in the birth of healthy
children. These represent the first births achieved following
NGS-based screening of human embryos in the Western hemi-sphere.
The children produced are healthy and developing nor-mally,
at 1 year of age.
In theory, NGS methods such as those described here could
be extended to allow whole genome sequencing of embryos.
While our data and that of other research groups suggest that
this is technically feasible, sequencing of the entire genome
would greatly increases costs and the time required for analysis,
eliminating two of the chief benefits of the strategy described in
this paper. Furthermore, knowledge of the genome sequence of
a human embryo prior to transfer to the uterus has the potential
to reveal unexpected genetic findings that may be difficult to
interpret (ie, incidental findings of unknown clinical signifi-cance),
not to mention the ethical concerns that may be raised
by the acquisition of such detailed genetic information and its
potential use in embryo selection. The test outlined here deliber-ately
avoided sequencing the whole genome (less than 0.1% was
sequenced from each embryo), focusing on low cost, rapid ana-lysis
and detection of serious genetic abnormalities that have a
well-defined impact on health or embryo viability.
METHODS
Samples analysed during preliminary optimisation and
validation
Samples were derived from cytogenetically characterised cell
lines (Coriell Cell Repositories) or from human embryos previ-ously
shown to be aneuploid during routine preimplantation
genetic screening (Reprogenetics). Initial analyses began in July
2011, with clinical cases initiated in April 2012. Clinical IVF
cycles using NGS took place at Main Line Fertility and
New York University Fertility Center. Genetic analyses were
carried out at Reprogenetics UK and the University of Oxford.

Methods
Single cell lysis
An amount of 2.5 μL of the alkaline lysis buffer (0.75 μL
PCR-grade water (Promega, Madison, USA); 1.25 μL dithio-threitol
(DTT) (0.1 M) (Sigma, Gillingham, UK); 0.5 μL NaOH
(1.0 M) (Sigma)) was added to a 0.2 mL microcentrifuge tube
containing a single cell or trophectoderm biopsy (5–10 cells)
suspended in 0.5–2.0 μL of phosphate buffered saline. The
samples were then incubated for 10 min at 65°C in a thermal
cycler.
Whole genome amplification
After lysis, whole genome amplification reagents were then
added to each tube (44 μL per sample): 12.5 μL of PCR-grade
water (Promega); 2.5 μL of tricine (0.4 M) (Sigma); 29 μL of
Repli-g Midi Reaction buffer (Qiagen, Crawley, UK); and 1 μL
of Repli-g Midi DNA polymerase (Qiagen). Samples were incu-bated
at 30°C for 120 min and 65°C for a further 5 min.
Optimised NGS protocol
WGA product was quantified using a Qubit (HS dsDNA) and
100 ng fragmented using NEBNext DNA fragmentation enzyme
for 17.5 min for Ion Torrent 200 bp chemistry.
Electrophoresis was performed and the sample fraction at
300 bp was excised using E-Gel SizeSelect Gels (Life
Technologies).
A minimum of five cycles of adaptor mediated amplification
was required to generate quantifiable sequence-ready libraries.
The samples were evaluated using a 2100 Bioanalyser High
Sensitivity Chip (Agilent Technologies). All samples were diluted
to a 24 pmol concentration and a 5 mL aliquot of the sample
was used as a template for clonal amplification using the Ion
OneTouch system (Life Technologies). Sample enrichment was
performed on the Ion OneTouch ES module and Ion 316 chips
were used for sequencing. The chip was prepared for sequen-cing
by the use of a modified protocol whereby 30 mL of
sample was added between five rounds of 2 min centrifugation
steps, resulting in high levels of data generated with each
sequencing run.
Data were analysed using the coverageAnalysis (V.2.2.3)
plugin in the Torrent Suite V.2.2 (Life Technologies), providing
the percentage of DNA sequence reads mapped to each chromo-some.
The percentage of the reads derived from a given
chromosome for an embryo (test) sample was divided by the ref-erence
value for the same chromosome as described in the
Results section (see also online supplementary table S1).
Chromosomal gains were associated with ratios >1.2 and losses
with ratios <0.7. For each sample, the number of mtDNA reads
was divided by the number of reads attributable to the nuclear
genome. This provided an indication of the amount of mtDNA
per cell.
Up to 32 samples were multiplexed together and sequenced on
the same chip. In order to achieve this, prior to sequencing, ampli-fied
DNAs from each sample were fragmented and different adap-ters
of unique DNA sequence (ie, barcodes) from the Ion Xpress
Barcode Adapters 1–16 and 17–32 kits were ligated, allowing for
postsequencing demultiplexing. The samples were diluted to a con-centration
of 24 pmol and pooled prior to clonal amplification on
the Ion OneTouch system. Semiconductor sequencing of 100 bp
was performed on the Ion PGM Sequencer using 200 bp chemistry
on a single Ion 316 chip. The fragments sequenced were assigned
to specific samples based on their unique barcode.
Procedures for blinded analysis of aneuploidy
A second biopsy was taken from each embryo and coded by a
technician who had no other involvement in the study. Analysis
of the coded samples was undertaken using a well-established
microarray-CGH approach, carried out by scientists in a differ-ent
laboratory from those performing NGS. The results of both
tests (ie, aneuploidy diagnosis using NGS and aCGH) were
communicated to an independent adjudicator, samples decoded
and diagnostic results compared.
Confirmation of NGS-based mtDNA quantification using
real-time PCR
Whole genome amplification products from cells biopsied from
blastocyst stage embryos were analysed using real-time PCR. A
custom-designed TaqMan Assay (Life Technologies, UK) was used
to target and amplify the mitochondrial 16 s ribosomal RNA
sequence (probe sequence: AATTTAACTGTTAGTCCAAAGAG).
Normalisation of input DNA took place with the reference to a
second TaqMan Assay amplifying the multicopy Alu sequence
(YB8-ALU-S68) (probe sequence: AGCTACTCGGGAGGCTG
AAGGCAGGA). This normalisation was employed to avoid issues
such as variation in whole genome amplification efficiency and dif-ferences
in the number of cells contained in the biopsy specimen.
Additionally, a reference DNA sample consisting of amplified 46,
XY DNA was included each time real-time PCR was undertaken,
allowing variation between experiments to be controlled for. A
negative control (nuclease free H2O and PCR master-mix) was also
included in all experiments. Alu and mtDNA sequences were amp-lified
in triplicate from each PicoPlex product. Reactions contained
1 μL of whole genome amplified embryonic DNA, 8 μL of
nuclease-free H2O, 10 μL of TaqMan Universal Master-mix II
(2X)/no UNG (Life Technologies, UK) and 1 μL of the 20×
TaqMan mtDNA or Alu assay (Life Technologies, UK), for a total
volume of 20 μL. The thermal cycler used was a StepOne
Real-Time PCR System (Life Technologies, UK), and the following
conditions were employed: incubation at 50°C for 2 min, incuba-tion
at 95°C for 10 min and then 30 cycles of 95°C for 15 s and
60°C for 1 min.
PCR amplification of the CFTR gene ▵F508 mutation site
After cell lysis and WGA, a 0.5 μL aliquot was removed from the
MDA product and added to 14.5 μL of PCR mixture. The PCR
mixture was composed of the following: 1.45 μL 10× Enzyme
Buffer (5 Prime, Hamberg, Germany); 0.15 μL of primer mixture
(Forward GTTTTCCTGGATTATGCCTGGCAC; Reverse
GTTGGCATGCTTTGATGACGCTTC; each at 10 μM); 0.2 mM
dNTPs (Sigma); 0.45 units of Hot Master Taq enzyme (5 Prime);
and PCR-grade water (Promega). The PCR programme was: 96°C
for 1 min; 30 cycles of 94°C for 15 s, 59°C for 15 s, 65°C for 45 s;
65°C for 2 min. This yielded a DNA fragment encompassing the
▵F508 mutation site (95 bp in length if normal, 92 bp if ▵F508
was present). Sequencing libraries were generated from the original
WGA product and the resulting PCR product. For clonal amplifica-tion
and based on template dilution factors calculated according to
manufacturer protocol, 1.3 mL of the library from the PCR
product (diluted 1:500) was added to 3.7 mL of a 1:16 dilution of
the library from the original WGA. The WGA-PCR library mixture
was then analysed using NGS as described above.
Microarray-CGH
Microarray-CGH analysis was undertaken according to our pre-viously
validated protocol using 24Sure Cytochip (Illumina,
Cambridge, UK) (see online supplementary tables S5 and S6).

Lysis and whole genome amplification of single cells biopsied
from embryos were achieved using the SurePlex kit (Illumina).
The entirety of this procedure took place according to the man-ufacturer’s
instructions. The fluorescence labelling system
(Illumina) was used for the labelling of the amplified ethylene-diaminetetraacetic
acid-Tris (TE) samples and also for labelling a
commercially available reference DNA (Illumina). Test TE
samples were labelled with Cy3 while the reference 46,XY
DNA was labelled with Cy5. Test and reference DNAs’
co-precipitation, their denaturation, array hybridisation and the
posthybridisation washes all took place according to protocols
provided by the manufacturer. The hybridisation time was 16 h.
A laser scanner (InnoScan 710, Innopsys, Carbonne, France)
was used to analyse the microarrays after washing and drying.
The resulting images were stored in TIFF format file and exam-ined
by the BlueFuse Multi analysis software (Illumina).
Chromosome profiles were examined for gain or loss with the
use of a 3× SD assessment.
Clinical application of NGS for preimplantation aneuploidy
detection
Two infertile couples (women aged 35 and 37) gave consent for
NGS analysis of their embryos following counselling. The pro-tocols
used for ovarian stimulation, IVF and embryo culture did
not differ from methods considered to be standard. At the
blastocyst stage, 5 days after oocyte fertilisation, the zona pellu-cida
encapsulating the embryo was breached with a laser and ∼5
trophectoderm cells were carefully removed using a micromani-pulator.
The cells were washed in three 5 μL droplets of PBS
+0.1% polyvinyl alcohol and then transferred to a 0.2 mL
microcentrifuge tube in a total volume of 1.5 μL. Cell lysis,
MDA and NGS were carried out as described above. One
euploid embryo was transferred in each case, while additional
euploid embryos remained cryopreserved (vitrified).
Preliminary evaluation of an ultra-rapid method of
NGS-based aneuploidy screening
Subsequent to the validation and clinical application of NGS for
the purposes of aneuploidy detection, an even more rapid evo-lution
of the original protocol was evaluated. This involved ana-lysis
of 17 samples (∼5 cells each) derived from human
blastocysts. In some cases, embryos were biopsied twice, allow-ing
independent testing of cells derived from the inner cell mass
and trophectoderm. For all samples, cell lysis and whole
genome amplification (MDA) were carried out as described
above. This was followed by creation of barcoded libraries from
100 ng of MDA samples using the Ion Xpress Plus protocol
described previously with six cycles of amplification. The ampli-fied
libraries were run on an EGel SizeSelect 2% agarose gel
(Invitrogen) and the fraction corresponding to a 350 bp insert
was purified with 0.5× of AMPure beads (Agencourt).
Concentrations were estimated by qPCR using the Ion Library
Quantitation Kit (Life Technologies) and 1.7 mL of a 50 pM
dilution was used as an input for Ion Isothermal Amplification
Chemistry (Life Technologies). This generated templated
spheres in 30 min. Spheres were then enriched, loaded on an
Ion 316 chip (10 samples multiplexed at a time) and sequenced
on the Ion PGM for 260 flows using the Ion PGM 200 V.2
Sequencing kit (Life Technologies). Analysis of the DNA
sequence reads produced was carried out as described above.
Acknowledgement This work was supported by the Oxford NIHR Biomedical
Research Centre Programme.
Methods
Contributors All authors had essential roles in this study and each participated in
the writing and/or review of the manuscript. DW—study concept, laboratory work,
manuscript preparation; KK—laboratory work; JG and MG—patient counselling and
treatment (IVF); JCT, EF, SM—genetics support, data analysis.
Competing interests None.
Ethics approval NRES Committee South Central.
Provenance and peer review Not commissioned; externally peer reviewed.
Open Access This is an Open Access article distributed in accordance with the
Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which
permits others to distribute, remix, adapt, build upon this work non-commercially,
and license their derivative works on different terms, provided the original work is
properly cited and the use is non-commercial. See: http://creativecommons.org/
licenses/by-nc/4.0/
REFERENCES
1 Fragouli E, Alfarawati S, Goodall NN, Sánchez-García JF, Colls P, Wells D. The
cytogenetics of polar bodies: insights into female meiosis and the diagnosis of
aneuploidy. Mol Hum Reprod, 2011;17:286–95.
2 Scott RT, Ferry K, Su J, Tao X, Scott K, Treff NR. Comprehensive chromosome
screening is highly predictive of the reproductive potential of human embryos: a
prospective, blinded, nonselection study. Fertil Steril, 2012;97:870–5.
3 Bromer JG, Ata B, Seli M, Lockwood CJ, Seli E. Preterm deliveries that result from
multiple pregnancies associated with assisted reproductive technologies in the USA:
a cost analysis. Curr Opin Obstet Gynecol 2011;23:168–73.
4 Gutiérrez-Mateo C, Colls P, Sánchez-García J, Escudero T, Prates R, Ketterson K,
Wells D, Munné S. Validation of microarray comparative genomic hybridization for
comprehensive chromosome analysis of embryos. Fertil Steril 2011;95:953–8.
5 Johnson DS, Gemelos G, Baner J, Ryan A, Cinnioglu C, Banjevic M, Ross R,
Alper M, Barrett B, Frederick J, Potter D, Behr B, Rabinowitz M. Preclinical
validation of a microarray method for full molecular karyotyping of blastomeres in a
24-h protocol. Hum Reprod 2010;25:1066–75.
6 Treff NR, Tao X, Ferry KM, Su J, Taylor D, Scott RT. Development and validation of
an accurate quantitative real-time polymerase chain reaction-based assay for human
blastocyst comprehensive chromosomal aneuploidy screening. Fertil Steril
2012;97:819–24.
7 Yang Z, Liu J, Collins GS, Salem SA, Liu X, Lyle SS, Peck AC, Sills ES, Salem RD.
Selection of single blastocysts for fresh transfer via standard morphology assessment
alone and with array CGH for good prognosis IVF patients: results from a
randomized pilot study. Mol Cytogenet 2012;5:24.
8 Forman EJ, Hong KH, Ferry KM, Tao X, Taylor D, Levy B, Treff NR, Scott RT. In vitro
fertilization with single euploid blastocyst transfer: a randomized controlled trial.
Fertil Steril 2013;100:100–7.
9 Schoolcraft WB, Surrey E, Minjarez D, Gustofson RL, Scott RT, Katz-Jaffe MG.
Comprehensive chromosome screening (CCS) with vitrification results in improved
clinical outcome in women >35 years: a randomized control trial. Fertil Steril
2012;98:S1.
10 Scott RT, Upham KM, Forman EJ, Hong KH, Scott KL, Taylor D, Tao X, Treff NR.
Blastocyst biopsy with comprehensive chromosome screening and fresh embryo
transfer significantly increases in vitro fertilization implantation and delivery rates: a
randomized controlled trial. Fertil Steril 2013;100:697–703.
11 Hong KH, Taylor DM, Forman E, Tao X, Treff NR. Development of a novel next-gen
sequencing (NGS) methodology for accurate characterization of genome-wide
mitochondrial heteroplasmy in human embryos. Fertil Steril 2012;98:S58–9.
12 Zhang C, Zhang C, Chen S, Yin X, Pan X, Lin G, Tan Y, Tan K, Xu Z, Hu P, Li X,
Chen F, Xu X, Li Y, Zhang X, Jiang H, Wang W. A single cell level based method
for copy number variation analysis by low coverage massively parallel sequencing.
PLoS ONE 2013;8:e54236.
13 Navin N, Kendall J, Troge J, Andrews P, Rodgers L, McIndoo J, Cook K,
Stepansky A, Levy D, Esposito D, Muthuswamy L, Krasnitz A, McCombie WR,
Hicks J, Wigler M. Tumour evolution inferred by single-cell sequencing. Nature
2011;472:90–4.
14 Voet T, Kumar P, Van Loo P, Cooke SL, Marshall J, Lin ML, Zamani Esteki M, Van
der Aa N, Mateiu L, McBride DJ, Bignell GR, McLaren S, Teague J, Butler A,
Raine K, Stebbings LA, Quail MA, D’Hooghe T, Moreau Y, Futreal PA, Stratton MR,
Vermeesch JR, Campbell PJ. Single-cell paired-end genome sequencing reveals
structural variation per cell cycle. Nucleic Acids Res 2013;41:6119–38.
15 Yin X, Tan K, Vajta G, Jiang H, Tan Y, Zhang C, Chen F, Chen S, Zhang C, Pan X,
Gong C, Li X, Lin C, Gao Y, Liang Y, Yi X, Mu F, Zhao L, Peng H, Xiong B,
Zhang S, Cheng D, Lu G, Zhang X, Lin G, Wang W. Massively parallel sequencing
for chromosomal abnormality testing in trophectoderm cells of human blastocysts.
Biol Reprod 2013;88:69.
16 Fragouli E, Alfarawati S, Daphnis DD, Goodall NN, Mania A, Griffiths T, Gordon A,
Wells D. Cytogenetic analysis of human blastocysts with the use of FISH, CGH and
aCGH: scientific data and technical evaluation. Hum Reprod 2011;26:480–90.

Methods
17 Harper JC, Wilton L, Traeger-Synodinos J, Goossens V, Moutou C, SenGupta SB,
Pehlivan Budak T, Renwick P, De Rycke M, Geraedts JP, Harton G. The ESHRE PGD
Consortium: 10 years of data collection. Hum Reprod Update 2012;18:234–47.
18 Obradors A, Fernández E, Oliver-Bonet M, Rius M, de la Fuente A, Wells D,
Benet J, Navarro J. Birth of a healthy boy after a double factor PGD in a couple
carrying a genetic disease and at risk for aneuploidy: Case Report. Hum Reprod
2008;23:1949–56.
19 Rechitsky S, Verlinsky O, Kuliev A. PGD for cystic fibrosis patients and couples at
risk of an additional genetic disorder combined with 24-chromosome aneuploidy
testing. Reprod Biomed Online 2013;26:420–30.
20 Brezina PR, Benner A, Rechitsky S, Kuliev A, Pomerantseva E, Pauling D,
Kearns WG. Single-gene testing combined with single nucleotide polymorphism
microarray preimplantation genetic diagnosis for aneuploidy: a novel approach in
optimizing pregnancy outcome. Fertil Steril 2011;95:1786.e5–1786.e8.
21 Treff NR, Fedick A, Tao X, Devkota B, Taylor D, Scott RT. Evaluation of targeted
next-generation sequencing-based preimplantation genetic diagnosis of monogenic
disease. Fertil Steril 2013;99:1377–84.
22 Wells D, Fragouli E. Preimplantation genetic diagnosis. In: Coward K, Wells D. Eds.
The Textbook of Clinical Embryology. UK: Cambridge University Press,
2013:346–56.
23 Schoolcraft WB, Fragouli E, Stevens J, Munne S, Katz-Jaffe MG, Wells D. Clinical
application of comprehensive chromosomal screening at the blastocyst stage. Fertil
Steril 2012;94:1700–6.
24 Forman EJ, Tao X, Ferry KM, Taylor D, Treff NR, Scott RT. Single embryo transfer
with comprehensive chromosome screening results in improved ongoing pregnancy
rates and decreased miscarriage rates. Hum Reprod 2012;27:1217–22.
25 Wai T, Ao A, Zhang X, Cyr D, Dufort D, Shoubridge EA. The role of mitochondrial
DNA copy number in mammalian fertility. Biol Reprod 2010;83:52–62.
26 El Shourbagy SH, Spikings EC, Freitas M, St John JC. Mitochondria directly influence
fertilisation outcome in the pig. Reproduction 2006;131:233–45.
27 Fragouli E, Spath K, Alfarawati S, Wells D. Quantification of mitochondrial DNA
predicts the implantation potential of chromosomally normal embryos. Fertil Steril
2013;100:S1.
28 Su J, Tao X, Baglione G, Treff NR, Scott RT. Mitochondrial DNA is significantly
increased in aneuploid human embryos. Fertil Steril 2010;94:S88–9.
29 Leese HJ. Quiet please, do not disturb: a hypothesis of embryo metabolism and
viability. Bioessays 2002;24:845–9.
30 Manwaring N, Jones MM, Wang JJ, Rochtchina E, Howard C, Mitchell P, Sue CM.
Population prevalence of the MELAS A3243G mutation. Mitochondrion 2007;7:230–3.
31 Gigarel N, Hesters L, Samuels DC, Monnot S, Burlet P, Kerbrat V, Lamazou F,
Benachi A, Frydman R, Feingold J, Rotig A, Munnich A, Bonnefont JP, Frydman N,
Steffann J. Poor correlations in the levels of pathogenic mitochondrial DNA
mutations in polar bodies versus oocytes and blastomeres in humans. Am J Hum
Genet 2011;88:494–8.
32 Tajima H, Sueoka K, Moon SY, Nakabayashi A, Sakurai T, Murakoshi Y,
Watanabe H, Iwata S, Hashiba T, Kato S, Goto Y, Yoshimura Y. The development of
novel quantification assay for mitochondrial DNA heteroplasmy aimed at
preimplantation genetic diagnosis of Leigh encephalopathy. J Assist Reprod Genet
2007;24:227–32.
33 Bredenoord AL, Dondorp W, Pennings G, De Die-Smulders CE, De Wert G. PGD to
reduce reproductive risk: the case of mitochondrial DNA disorders. Hum Reprod
2008;23:2392–401.
34 Treff NR, Campos J, Tao X, Levy B, Ferry KM, Scott RT. Blastocyst preimplantation
genetic diagnosis (PGD) of a mitochondrial DNA disorder. Fertil Steril
2012;98:1236–40.
35 Monnot S, Gigarel N, Samuels DC, Burlet P, Hesters L, Frydman N, Frydman R,
Kerbrat V, Funalot B, Martinovic J, Benachi A, Feingold J, Munnich A, Bonnefont JP,
Steffann J. Segregation of mtDNA throughout human embryofetal development:
m.3243A>G as a model system. Hum Mutat 2011;32:116–25.
36 Thorburn D, Wilton L, Stock-Myer S. Healthy baby girl born following
pre-implantation genetic diagnosis for mitochondrial DNA m.8993t>g mutation.
Mol Genet Metab 2009;98:5–6.
37 Steffann J, Frydman N, Gigarel N, Burlet P, Ray PF, Fanchin R, Feyereisen E,
Kerbrat V, Tachdjian G, Bonnefont JP, Frydman R, Munnich A. Analysis of mtDNA
variant segregation during early human embryonic development: a tool for
successful NARP preimplantation diagnosis. J Med Genet 2006;43:244–7.

Clinical utilisation of a rapid low-pass whole
genome sequencing technique for the
diagnosis of aneuploidy in human embryos
prior to implantation
Dagan Wells, Kulvinder Kaur, Jamie Grifo, et al.
J Med Genet 2014 51: 553-562
doi: 10.1136/jmedgenet-2014-102497
Updated information and services can be found at:
http://jmg.bmj.com/content/51/8/553.full.html
These include:
Data Supplement
"Supplementary Data"
http://jmg.bmj.com/content/suppl/2014/07/16/jmedgenet-2014-102497.DC1.html
References
This article cites 36 articles, 12 of which can be accessed free at:
http://jmg.bmj.com/content/51/8/553.full.html#ref-list-1
Open Access
This is an Open Access article distributed in accordance with the
Creative Commons Attribution Non Commercial (CC BY-NC 4.0)
license, which permits others to distribute, remix, adapt, build upon this
work non-commercially, and license their derivative works on different
terms, provided the original work is properly cited and the use is
non-commercial. See: http://creativecommons.org/licenses/by-nc/4.0/
Email alerting
service
Receive free email alerts when new articles cite this article. Sign up in
the box at the top right corner of the online article.
To request permissions go to:
http://group.bmj.com/group/rights-licensing/permissions
To order reprints go to:
http://journals.bmj.com/cgi/reprintform
To subscribe to BMJ go to:
http://group.bmj.com/subscribe/

Topic
Collections
Articles on similar topics can be found in the following collections
• Editor's choice (91 articles)
• Open access (113 articles)
• Reproductive medicine (494 articles)
• Epidemiology (583 articles)
• Clinical diagnostic tests (334 articles)
• Surgery (100 articles)
• Surgical diagnostic tests (100 articles)
Notes
To request permissions go to:
http://group.bmj.com/group/rights-licensing/permissions
To order reprints go to:
http://journals.bmj.com/cgi/reprintform
To subscribe to BMJ go to:
http://group.bmj.com/subscribe/

J med genet 2014-wells-553-62

More Related Content

What's hot

Viewers also liked

Similar to J med genet 2014-wells-553-62

More from t7260678

J med genet 2014-wells-553-62