鋒博 蔡, profile picture
Uploaded by鋒博 蔡
PDF, PPTX969 views

Pre genetic screen (1)pgs

This document discusses preimplantation genetic screening (PGS) using comprehensive chromosome screening (CCS) techniques like array comparative genomic hybridization (aCGH) to test embryos for chromosome abnormalities. It provides data from over 39,000 PGS procedures performed by Reprogenetics Laboratories showing that CCS-based PGS can double implantation rates and eliminate the negative impact of maternal age on implantation by selecting only euploid embryos for transfer. Randomized controlled trials show pregnancy rates are 20-30% higher with CCS-based PGS compared to untested embryos. The document concludes that CCS-based PGS has proven its ability to improve IVF outcomes by selecting embryos without chromosome abnormalities.

Download as PDF, PPTX
Santiago Munné, PhDPrevention of genetic disease before pregnancy Reprogenetics Laboratories US: Livingston (NJ), Los Angeles (CA), Chicago (IL), Portland (OR), Boca Raton (FL) / Europe: Barcelona (Spain), Oxford (UK), Hamburg (Germany) / Asia: Kobe (Japan), Macao, Abu Dhabi (UAE)/ Latin America: Lima (Peru), Buenos Aires (Argentina), Sao Paulo (Brazil), DF (Mexico)
Genetics and infertility Problem frequency Detection in couple Solution AMA 50% of cycles interview PGS RPL 1% of fertile couples interview PGS Translocations 9% RPL, 2% MF karyotype PGD Hereditary gene defects 2% of couples Carrier screen (CarrierMap) PGD Genetic susceptibility to infertility Unk. Carrier screen (FertilityMap) Pharmaco- genetics De novo gene defects 1/100 autistic babies N/A PGD with whole gene sequencing
Evolution of PGS: Reprogenetics data 0 1000 2000 3000 4000 5000 6000 7000 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 Number of Cases Year aCGH day 5 aCGH day 3 CGH FISH 12 FISH 5-9 Reprogenetics Laboratories: 39,000 PGD procedures up to 12/2013
Waves of technology FISH + micromanipulation CCS + Blastocyst culture Whole genome sequencing + bioinformatics PGS procedures 2013 2007 1993
Why PGS?
Most loss of implantation is caused by chromosome abnormalitiesReprogenetics data: 96 centers, >3500 cycles, >19,000 blastocysts analyzed by aCGH to 9/2013 0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% <35 35-37 38-40 41-42 % euploid no implant % euploid implant % aneuploid
The PGS hypothesis -proven •50%of blastocysts are aneuploid, •Aneuploidy increases with maternal age •Maternal age is inversely proportional to implantation •The error rate of PGS with CCS is low (<2%) •And blastocyst biopsy is non-detrimental Therefore PGS with CCS and blastocyst biopsy: •Should double Implantation rates •Should eliminate the Maternal age effect on implantation CCS: comprehensive chromosome analysis, such as array CGH, qPCR, Karyomaping, NGS
QUESTION Do youthinkthatthePGS hypothesishas nowbeenproved? 1.YES 2.NO
PGD v.2(or CCS) •24 chromosome analysis by arrays•Blastocyst biopsy
•20% of cyclesundiagnosed and replaced (third arm) •59% implantation reduction due to biopsy •PGD vs. Biopsied undiagnosed: 2.8x improvement 59% reduction implantation Control 14.7% Biopsied, undiagnosed6.0% Biopsied and PGD16.8% Effect of day 3 biopsy: Mastenbroeket al. (2007)
Effect of day 3 biopsy and blastocyst biopsy Scott et al. (2013) FertilSteril, in press Patients randomized to cleavage of blastocyst biopsy. Two best embryos randomized 1 to biopsy and 1 to no biopsy, both replaced. Biopsied embryos fingerprinted and compared with the fetus. cleavage stageblastocyst biopsynotbiopsynot Implantation rate31%53%52% 54% P<0.05N.S. (42% reduction) …but biopsy is an operator-dependent procedure and its effect may vary
blastocyst biopsy: Advantages Advantages: •More DNA: less no results •Less mosaicism = low error rate •Reduced impact of embryo biopsy •Less embryos to process •Facilitates single embryo transfer •Frozen cycle: Uterine environment optimized after thaw Disadvantages: •Not all embryos reach blastocyst the same day •4.5% monozygotic twins (Morin et al. 2013)
No results: Day 3 vs. day 5BiopsyEmbryosCenters* stageundiagnosedrangeCleavage3.2%1% -5% Blastocyst2.3%0% -18% Gutierrez-Mateo et al. (2011) Fertil Steril and Reprogenetics data on 9049embryos* Centers with >20 cycles done for that biopsy stage Most experienced Untrained
Is the trophectodermrepresentative of the ICM? •ICM and TE were concordant in 97%(31/32) embryos when analyzed by aCGH (a). •Blastocysts analyzed by aCGH as abnormal were reanalyzed by FISH and were 97.5% (39/40) abnormal (b). (a) Capalboet al. (2013) in press, (b)Collset al. (2013) ASRM
NormalTrisomyMonosomyNormal DNAEmbryo DNA Array Comparative Genome Hybridization
46,XY
46,XX+7-10
aCGH advantages•All 24 chromosome aneuploidies and translocations detected. •Results in<16 hours: allows for day 5 biopsy and 10amday 6transfer•Parental DNAnotrequired: ad hoc decisions possible. •ICSInotrequired.
ApproachErrorsReasonCell lines: karyotype and aCGHsame passage a2.0%unkDay 3: FISH reanalysis of non-replaced embryos b1.8 -3.0%mosaicsDay 3: aCGHreanalysis of non-replaced embryos c0.0 -1.2%mosaicsPBs: aCGHcomparison of PBs and eggs d6.0%unkDay 3: aCGH comparison to NGS e0.0% a BlueGnomeunpublished data, bGutierrez-Mateo et al (2011) FertilSteril, 95:953 and Mir et al. (2011) ASRM, c Biriciket al. (2011) ASHG, Montreal, and Reprogenetics unpublished data, dGeraedtset al. (2011) Human Reprod, in press, e Wells et al. (2013) ASRMaCGH validation: PBs, Day 3 embryos
aCGH validation: reanalysis of blastocysts Fragouliet al. (2011) Hum. Reprod. 26: 480-90, Colls et al. (2013) ASRM P-168, Capalboet al. (2013) Hum Reprod, in press, Wells et al. (2013) ASRM O-435 and unpublished data from Reprogenetics 11% of embryos were mosaic, explaining the 2.4% error rate Reanalysis method ConfirmedEuploid Confirmed abnormal TOTAL Fragouliet al 2011 FISH, aCGH 23/25 27/27 50/52 Capalboet al. 2013 FISH 19/20 50/50 69/70 Collset al. 2013 FISH,aCGH 7/7 39/40 46/47 Wellset al. 2013 Next Gen. Sequencing 23/23 67/67 90/90 Total 96% Sensitivity 99.5% Specificity 1.6% Errorrate
BiopsyReceptionResults by qPCR:day 5day 5, 6pmday 6, am aCGH:day 5day 5, 6pmday 6, noon NGS:day 5day 5, 6pmday 6, noon SNPs:day 5day 5, noonday 6, 6pmSpeedof different techniques
aCGHSNPsqPCRNGSfrequency69,XXX w/o aneuploidynoyesyesyes0.2% a69,XXX with aneuploidyyesyesyesyes7.8% aUPD w/o other abnormalitiesnoyesnoyes>0.01% bTrisomy w/o recombinationyesunkyesyes3% Duplications, deletionsyesyesnoyes5% TranslocationsallsomenoyesunkError rate (day 3-5 biopsy)2-3%c2-4%d1%e0%faCGH vsother techniques: Detection differences aBisignano, Wells, Hartonand Munne (2011) RBObwww.ncbi.nlm.nih.gov/omim, cGutierrez-Mateo et al. (2011), dScott et al. (2012), eTreffet al. (2012) Fertil Steril97:819–24. f Wells wtal. (2013) ASRM
Chromosome abnormalities detected with array CGH
Euploidydecreases with age but not with cohort size N = 4,747 cycles and 29,803 embryos, up to 12/2013. Ata, Munne et al. (2012) ReprodBiomed Online and unpublished data. # of blastocysts % normal embryos egg donors <35 years 35-37 years 38-40 years 41-42 years >42 years 1-3 58% 61% 51% 39% 22% 13% 4-6 62% 60% 52% 38% 23% 17% 7-10 65% 62% 51% 36% 21% 14% >10 68% 63% 55% 37% 25% n/a
Prognosis depending on age and ovarian response N = 3,571 cycles and 19,356 embryos, up to 8/2013. Ata, Munne et al. (2012) ReprodBiomed Online and unpublished data. # of blastocysts % of patients with normal embryos egg donors <35 years 35-37 years 38-40 years 41-42 years >42 years 1-3 86% 85% 72% 60% 58% 24% 4-6 95% 97% 95% 88% 69% 54% 7-10 100% 99% 96% 92% 85% 65% >10 100% 100% 98% 98% 92% 83%
Overall clinical results
CyclesMat.Prev.embryosimplant. agefailedreplaced (+ sac) cyclesCGH : 4537.72.4 2.072% control : 11337.11.2 2.746% p=0.00031st randomized clinical trial: CGH and frozen transfer Schoolcraft et al. (2010) Fertil. Steril. 94:1700
2ndRandomized Clinical Trial: aCGH + fresh transfer, <35 years oldYang et al. (2012) MolecReprod Control PGS patients 48 55 age <35 <35 replacement Day 6 Day 6 replaced 48 (1) 55 (1) Pregnancyrate 45.8% 70.9% P<0.05 Ongoingpregrate 41.7% 69.1% P<0.05 multiples 0 0
Scott et al., 2013 FertilSteril. 3rdrandomized clinical trial: qPCR + fresh transfer PGD Control age 32.2 32.2 N 72 83 blastocysts 8 7.9 Embreplaced 1.9 2.0 implantation 79.8% 63.2% P=0.002 Sustainedimplant 66.4% 47.9% P=0.03 Delivery rate 84.7% 67.5% P=0.01 Good prognosis patients (average 8 blastocysts) Control replaced on day 5, test biopsied on day 5 and replaced on day 6
4thRandomized Clinical Trial: 1 tested vs. 2 untested ongoing pregnancy rate 1 euploid blastocyst 2 untested blastocyst Fresh transfer 65% 70% NS Frozen transfer 55% 52% NS Forman et al. (2013) FertilSteril Mean maternal age 35 (patients <43)
IMPLANTATION RATES IN RCT STUDIES USING PGS v2: Metanalysis Control PGS Yang et al. 2012 46% 69% Scott et al. 2013 63% 80% Forman et al. 2013 40% 58% TOTAL 53% 73% P<0.001
Array CGH with blastocyst biopsy: Unselected compiled results totalrange / center Centers doing d5 biopsy:96 Cycles included:3571 11 -522 Maternal age:35.434.7 -38.6 Av. blasts biopsied:5.64.5 -8.4 Av. Embryos replaced1.10.8 -1.4 Reprogenetics data to 8/2013 Implantation rate51% 35 -79% Pregnancies / cycle49% 28 -72% Pregnancies / transfer71%49 -90% Ongpreg/ cycle45%26 -65% Ongpreg/ transfer64%43 -86%
Is it worthy to biopsyday 6 blastocysts? Reprogenetics, unpublished The differences between day 5 biopsy and fresh transfer vs. day 5-6 biopsy and vitrification is that the later includes day 6 biopsies: -Day-5 morulaswere cultured to day-6 and biopsied if reached blastocyst -SET of blastocysts either biopsied on day 5 or on day 6, thawed transfer Day 5 biopsy Day 6 biopsy Implantation 61% 60% N.S. Euploidy 56% 42% P<0.025
maternal age effect disappears with full chromosomes analysis
aCGH eliminates the negative effect of maternal age on implantation * SART 2011 ** Harton, Munné et al. (2013) FertilSteril. And unpublished data to 8/2013. N >800 blast biopsies 0% 10% 20% 30% 40% 50% 60% <35 35-37 39-40 41-42 >42 SART blastocyst PGS (aCGH) ** No PGS * Implantation rate Maternal age n/a
Miscarriage rate after blastocyst biopsy 0% 5% 10% 15% 20% 25% 30% 35% 40% <35 35-37 38-40 41-42 Compared to SART: Compared to other studies: Pregnancies age SAB This study 307 34.9 7.5% Scott et al. 2013 72 32.2 8.3% *SART, ** Hartonet al. (2013) FertilSteril, and unpublished data No PGS * PGS **
Harton, Grifo, Munne, Wells et al. (2013) FertilSteril, and unpublished data. N >800 cycles of blast biopsy with follow up, up to 8/2013. 0% 10% 20% 30% 40% 50% 60% 70% 80% <35 35-37 38-40 41-42 OPR/ transfer no transfer OPR/ cycleOngoing pregnancy rate does not change with maternal age but …
0% 10% 20% 30% 40% 50% 60% 70% 80% <35 35-37 38-40 41-42 OPR/ transfer no transfer OPR/ cycle * * cycle… Cycles with no euploidembryos do increase with maternal age … Harton, Grifo, Munne, Wells et al. (2013) FertilSteril, and unpublished data. N >800 cycles of blast biopsy with follow up, up to 8/2013.
0% 10% 20% 30% 40% 50% 60% 70% 80% <35 35-37 38-40 41-42 OPR/ transfer no transfer OPR/ cycle * * … resulting in a decrease in pregnancy rate per cycle Harton, Grifo, Munne, Wells et al. (2013) FertilSteril, and unpublished data. N >800 cycles of blast biopsy with follow up, up to 8/2013. *p<0.001
Maternal age effect and aCGH: conclusions •Euploid embryos implant at the same high rate irrespective of maternal age •However with maternal age there are more cycles without euploid embryos •Therefore pregnancy rates / transfer are independent of maternal age but pregnancy rates per cycle still decrease with age
QUESTION Do youthinkthatthePGS hypothesishas nowbeenproved? 1.YES 2.NO
To replace 1 or 2 euploid blastocysts?
43 Cohort size as a predictor of SET success –Grade of transferred embryo has been correlated to embryo cohort size –The presence of supernumerary embryos is a possible indirect marker for embryo quality –ASRM acknowledges surplus embryos as being indicative of “good prognosis” DEVREKER, et al.1999. Selection of good embryos for transfer depends on embryo cohort size: implications for the ‘mild ovarian stimulation debate’. Hum Reprod, 14, 3002-08. STEINBERG, et al. 2013. Elective single embryo transfer trends and predictors of a good perinatal outcome –United States, 1999 to 2010. FertilSteril; 99, 1937-43. PracticeCommitteeof Society for Assisted ReproductiveTechnologies.2013. Criteria for number of embryos to transfer: a committee opinion. FertilSteril, 99, 44-46.
Average of 3.2 euploid balstocysts1 vs. 2 euploid blastocysts replaced: Effect on pregnancy and multiple rates ongoing pregnancy rate 1 euploid blastocyst 2 untested blastocyst Fresh transfer 65% 70% NS Frozen transfer 55% 52% NS Forman et al. (2013) FertilSteril
45 Success of SET by Euploid Cohort Size No. Euploid Embryos CPR 1 23/55 (41.8%) 2 13/27 (48.1%) 3 9/19 (47.4%) 4 16/21 (76.2%) 5 8/11 (72.7%) 6 6/8 (75.0%) >7 11/15 (78.6%) p < 0.01 S. Morin, K. Melzer, J. Grifo, P. Colls, Z. Zheng, S. Munné (2014) JARG
# euploid # replaced preg / transfer multiples 1-3 1 42%(47/111) P<0.01 0%(0/111) p<0.001 1-3 2 65% (37/57) 38%(14/37) 4 or more 1 75% (41/55) N.S. 10% ( 4/41) p<0.001 4 or more 2 78% (58/74) 52% (30/58) 1 vs. 2 euploid blastocysts replaced: Effect on pregnancy and multiple rates S. Morin, K. Melzer, J. Grifo, P. Colls, Z. Zheng, S. Munné (2014) JARG
EMBRYO BANKING
N = 3,571 cycles and 19,356 embryos, up to 8/2013. Ata, Munne et al. (2012) ReprodBiomed Online and unpublished data. # of blastocysts % of patients with normal embryos egg donors <35 years 35-37 years 38-40 years 41-42 years >42 years 1-3 86% 85% 72% 60% 58% 24% 4-6 95% 97% 95% 88% 69% 54% 7-10 100% 99% 96% 92% 85% 65% >7-10 100% 100% 98% 98% 92% 83% Embryo banking for low responders or bad prognosis patients
Reprogenetics data, unpublished >300 cycles of embryo banking, average age 39.9Embryo banking aneuploidy rates Remain constant 1stcycle 2ndcycle 3rdcycle Total Euploidy rate 29% 29% 27% 28% # euploid blastocysts 0.7 0.9 0.7 2.2
Example: 41 years old 1stcycle (1/4 euploid) ET 2 aneupl. 12 week loss 2ndcycle (1/4 euploid) ET 2 aneupl. No preg 3rdcycle (1/5 euploid) ET 2 aneupl. No preg Without PGD: •Risk of patient drop off •Longer time to pregnancy •Risk of miscarriage 1 2 3 4 5 6 7 8 9 10 11 12 Month:
Example: 41 years old 1stcycle (1/4 euploid) Freeze all 2ndcycle (1/4 euploid) Freeze all 3rdcycle (1/5 euploid) Freeze all ET 1 best of 3 euploid PREGNANCY Embryo banking, one PGD at the end: •Less time to pregnancy •No risk of patient dropping off •Less cost of PGD •More cost of freezing Month: 1 2 3 4 5 6 7 8 9 10 11 12
Advantages •Less patient “fatigue”: less drop out from cycle to cycle. •Cheaper PGD: One fee per package of IVF cycles •Facilitates “guaranteed baby” plans
PGD FOR RECURRENT PREGNANCY LOSS (RPL)
•Defined as 3 or more lost pregnancies•Occurs in 1% of fertile population•Attributed to anatomic, endocrine, immunological or genetic problems but … •…>50% of RPL cases are UNEXPLAINEDBackground of RPL
Werlin L, et al. (2003) Preimplantation genetic diagnosis (PGD) as both a therapeutic and diagnostic tool in assisted reproductive technology. Fertil Steril, 80:467 Munné et al. (2005) Preimplantation genetic diagnosis reduces pregnancy loss in women 35 and older with a history of recurrent miscarriages. Fertil Steril 84:331 Garrisi et al. (2009) Effect of infertility, maternal age, and number of previous miscarriages on the outcome of preimplantation genetic diagnosis for idiopathic recurrent pregnancy loss. Fertil. Steril 92: 288 Idiopathic RPL : All controlled PGD studies on idiopathic RPL show a decrease in miscarriages Rubio et al. (2009) Prognosis factors for Preimplantation Genetic Screening in repeated pregnancy loss. Reprod Biomed Online Hodes-Wertzet al. (2012) Idiopathicrecurrentmiscarriageiscausedmostlybyaneuploid embryos. FertilSteril. 98(3):675-80
Munné et al. 2005 N=122 procedures of PGD of couples with >2 previous loses 0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% <36 >36 total before PGD expected after PGD observed after PGD P<0.05 P<0.001 P<0.001 8% 16% 12% 33% 44% 39% 94% 85% 89% Reduction in miscarriages in RPL patients after PGD-FISH
PGD results according to fertility: methodcycles% loss% loss% conceptionexpectedafter PGDpto termIVF11535%14%p<0.0134% natural12441%15%p<0.00537% Average maternal age: 37.5Garrisi et al. (2009) Reduction in miscarriages in RPL patients after PGD-FISH
maternal preg.% loss% lossagecyclesexpectedafter PGD<352726.3%3.7%p<0.001≥355936.7%8.5%p<0.001 Total8933.5%7.0%p<0.001Results of PGD by aCGH for RPL: age effectGrifo et al. (ASRM 2011), and Grifo et al. (submitted)
day preg.% loss% loss biopsy cyclesexpectedafter PGDDay 35936%9%p<0.001Day 54042%3%p<0.001Total9938%6%p<0.001Results of PGD by aCGH for RPL: biopsy stage effect Hodes-Wertz et al. (2012) Fert Ster
Prev.day preg.% loss% loss losesbiopsy cyclesexpectedafter PGD2Day 53432%9%p<0.05>2Day 54042%3%p<0.001Total7437%5%p<0.001Results of PGD by aCGH for RPL: 2 vs 3 or more loses Hodes-Wertz et al. (2012) Fert Ster
Real case: 35 years old, triplet pregnancy miscarriageMultiple pregnancies with euploid and aneuploid fetuses 47,XX + 4 46,XX 47,XY + 20 By PGD only the euploid embryo would have been replaced probably preventing this miscarriage POC analysis:
PGD for translocationsand 24 chromosome abnormalities
•Munné et al (1998). Spontaneous abortions are reduced after pre-conception diagnosis of translocations. J Assisted Reprod Genet 290: •Munné S et al. (2000) Outcome of Preimplantation Genetic Diagnosis of translocations. Fertil Steril. 73:1209 •Verlinsky et al. (2005) Preimplantation testing for chromosomal disorders improves reproductive outcome of poor prognosis patients. Reprod Biomed Online 11:219 •Otani et al.(2006) Preimplantation genetic diagnosis significantly improves the pregnancy outcome of translocation carriers with a history of recurrent miscarriage and failing to produce a live birth. Reprod Biomed Online 13: 879 RPL due to translocations: •Munné S (2006) Preimplantation genetic diagnosis for translocations. Hum Reprod 21: 839All PGD studies on RPL for translocations show a decrease in miscarriages •Fischer J, Colls P, Escudero T, Munné S (2010) Preimplantation Genetic Diagnosis (PGD) improves pregnancy outcome for translocation carriers with a history of recurrent losses. Fertil Steril, In press
aCGH for translocations and24 chromosome aneuploidy Patient: 46,XX,t(3;11)(q22.2;q23.3)
Validation of aCGH forTranslocations + Aneuploidy•0%-2% error rate with aCGH (a,b) •All 931 translocations previously studied at Reprogenetics by FISH can be identified by aCGH (a) a: Colls et al. (2012) RBO, b: Fiorentino et al. (2011) Human Reprod Patient: 46,XY,t(3;11)(q22.2;q23.3) Gain 3q Loss 11q Tel 3p (green) Tel 3q (orange) Cent 11 (green) Tel 11q (orange)
PGD for gene defects
PGD for gene disorders Disease tested:Acetil Co Oxidase type I defficiency, Adrenoleucodistrophy, Alpha-thalassemia, Alport syndrome, Autosomal Dominant Polycystic Kidney Disease (ADPKD), Autosomal Recesive Polycystic Kidney Disease (ARPKD), Beta-thalassemia, Branchio-Oto-Renal syndrome (BOR), BRCA1 breast cancer predisposition, BRCA2 breast cancer predisposition, CanavanCharcot-Marie-Tooth type IA (CMT1a), Choroideremia, Congenital adrenal hyperplasia (CAH), Congenital neutropenia, Connexin 26 hearing loss, Cystic fibrosis, Duchenne/Becker Muscular Dystrophy (DMD), Ectrodactyly, Ectodermal dysplasia, and Cleft lip/palate syndrome (EEC1), Fabry Disease, Familial adenomatous poliposis coli (FAP), Familial dysautonomia, Familial intrahepatic cholestasis 2, Fanconi anemia, Fragile site mental retardation , Gangliosidosis type 1 (GM1), Gaucher disease, Glomuvenous malformations (GVM), Glycogen-storage disease type I (GSD1), Glycosylation type 1C, Hemoglobin SC disease, Hemophilia A, Hemophilia B, Hereditary nonpolyposis colon cancer (HNPCC), Hereditary pancreatitis, HLA matching Huntington disease, Hurler syndrome, Hypophosphatasia, Incontinential pigmenti, Krabbe disease (Globoid cell leukodystrophy), Long QT syndrome, Marfan syndrome, Meckle gruber, Metachromatic leukodystrophy (MLD), Methylmalonic aciduria cblC type (MMACHC), Myotonic Dystrophy 1, Myotubular myopathy, Neurofibromatosis 1, Neurofibromatosis 2, Niemann-Pick Disease, Noonan syndrome, Oculocutaneous albinism 1 (OCA1), Ornithine carbamoyltransferase deficiency (OTC), Osteogenesis Imperfecta 1, Rapp Hodgkin ectodermal dysplasia, Retinitis pigmentosa, Retinoblastoma, Sickle Cell Anemia, Smith- Lemli-Opitz syndrome (SLOS), Spinal bulbar muscular atrophy (SBMA), Spinal Muscular Atrophy Type 1 (SMA1), Tay Sachs, Tuberous sclerosis 1 (TSC1), Tuberous sclerosis 2 (TSC2), Von Hippel-Lindau Syndrome (vHL), X-linked dominant Charcot–Marie–Tooth (CMTX), etc…… (see review Gutierrez et al. (2008)) We can do PGD for any disease with known mutation
Prates et al. (2013) FertilSteril, ASRM Day 3 vs. day 5 biopsy for PGD Of gene defects Day 3 Day 5 Totalembryos 2634 797 No Results 12.1% 5.3% <0.0001 ADO rate 9.8% 1% <0.0001
51.0% 21.9% 18.9% 8.2% affected andchromosomallyabnormal embryos unaffected andchromosomallyabnormal embryos unaffected and Euploidembryos no results (fragmented, arrested or otherwisepoor quality embryos) aCGH and Single Gene Disorders: Results N= 329 embryos tested Prates et al. (2013) ASRM
Improved pregnancy results Test typeAv agePregnancy rate SGD31.6 54% (14/26) SGD + CCS32.3 86% (12/14) p<0.05
A A A A A A Reducing work-up time for PGD of single gene disorders -Karyomapping Thousands of polymorphisms on each chromosomes Each chromosome (region) has a unique DNA fingerprint A A A A B B A B A B B A B B A A B A A B B A A A A A A A M A B B A A A A A A A B B M B B B B B A B B B B B B A A B A A B B A A A A B A B B A Carrier Carrier and trisomic Mother Father A A A A B B B B A A B A Affected child M M M M
PGD v3: Next Generation Sequencing
2014 1000$ * The $1000 genome is here * Not including equipment, labor, overhead, analysis, etc
Differences between PGD methods PCRPCR +SNPNext Gen aCGHarrays*Sequencing Detects aneuploidynoyesyesyes Detects gene defectsyesyesyesyes Detects mitotic errorsnoyesnoyes >2 month of Preparation yes yesnono Requires affected probandnonoyesno # genomes / run0001 * * KaryomappingusingBlueGnome ** withNextSeq
CAGCGGCAGATGATTCGGGGATATTG AGGATACGACTTGCAGCGGCAGATGATT GTACCATAGGATACGACTTGCAGCGGCA ATATTGCGTATA CAGATGATTCGGGGATATTGCGTA TGCGTATAGG ACCATAGGATACGACTTGCAGCGGC TAGAGTACCATAGGATACGACTTGCAACGGCAGATGATTCGGGGATATTGCGTATAGGCTA Known sequence (CFTR gene chromosome 7) Each region of the genome sequenced multiple times Millions of short sequences produced Sequences are compared to the known human genome Mutations identified and amount of DNA (aneuploidy) revealed FragmentationNext Generation Sequencing (NGS) SlideadaptedfromD. Wells
NGS analysis of amplified DNA from single cells: chr 1 chr 2 chr 3 chr 4 chr 5 chr 6 chr 7 chr 8 chr 9 chr 10 chr 11 chr 12 chr 13 chr 14 chr 15 chr 16 chr 17 chr 18 chr 19 chr 20 chr 21 chr 22 chr X chr Y % of total sequence reads Chromosomally normal control Embryo sample Trisomy 22 PGS: Not all regions amplify equally SlideadaptedfromD. Wells
Platforms used for PGS Ion torrent(ThermoFisher): •PGM •Proton Illumina: •MiSeq •NextSeq •HiSeq Complete genomics (BGI)
Different output for different needs samples / run * Genome1 Exome6-12 NIPT16-20 Carrier screen24-96 PGS96 chromosome screening needs less output * using NextSeq, x30 coverage, 120 Gb
However, price per sample can be competitive using barcodes Barcoding CAGATGATTCGTGGATATTGCGTA AAGGCAGATGATTCGTGGATATTGCGTA CCTT CAGATGATTCGTGGATATTGCGTA CAGATGATTCGGGGATATTGCGTA Embryo 1 Embryo 2 Embryo 3 AAGG GTAC CCTTCAGATGATTCGTGGATATTGCGTA GTACCAGATGATTCGGGGATATTGCGTA Add barcodes Pool samples Sequence GTAC SlideadaptedfromD. Wells
Barcoding: More samples, less sequence samplesgenome depth of / runcoveragecoverage Genome1100% x 30 PGS *16-96≤ 10% x1 to x3 * Output: MiSeq= PGM << NextSeq Wells, Kaur, Rico, Grifo, Anderson, Sherlock, Taylor, Munne (2013) ESHRE, Yin et al (2013) BiolReprod88, 69
PGS with NGS: Method •Whole Genome Amplification of Sample •Library preparation: –Fragment DNA –Ligate adapters and barcodes (≥16) •Sequence D Wells, K Kaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (2013) ESHRE
78 blastocysts previously diagnosed by aCGH were reanalyzed by NGS in a blinded experiment. 21/21 euploid 55/56 aneuploid 1 polyploid 1.3%discordance with aCGH, polyploidy detected. validation ofNext Generation Sequencing (NGS) Allen Kung et al. (2014) ESHRE
Example Trisomy 13 male (47,XY,+13) aCGH NGS Adapted from G.Harton, platform: MiSeq
Example Trisomy 21, male (47,XY + 21) 21 X Y Adapted from G.Harton, platform: MiSeq
Example Monosomy2, male (45,XY -2) And mosaic for 11? X Y 11 2 Adapted from G.Harton, platform: MiSeq
Example 49,XY +3 +7 +12 +21 -22 By Reprogenetics, using ion torrent PGM
First baby born from NGS First NGS baby: David Levy A collaboration of Reprogenetics-US, Reprogenetics-UK (Dagan Wells) and Main Line Fertility (Dr. Glassner)
Conclusions
Conclusions •Euploid embryos implant at the same high rate irrespective of maternal age •However with maternal age there are more cycles without euploid embryos •Therefore pregnancy rates per transfer are independent of maternal age but pregnancy rates per cycle still decrease with age
Conclusion •Arrays are fully validated and combined with Blastocyst biopsy provide a significant improvement in ongoing pregnancy rates. •Arrays alone or in combination with karyomappingcan screen for aneuploidy and gene defects simultaneously. •Next generation sequencing will allow further information to be detected once prices decrease.
We are in great need of techniques that can identify embryos resulting in a healthy newborn, make the process more efficient, and keep failed cycles to a minimum. want to avoid establishing a pregnancy that ends up in miscarriage, losing up to 6 months from patients attempts at conception our current understanding is that blastocyst biopsy does not appear to affect embryo viability and gives a high rate of diagnostic accuracy. The risk of multiple pregnancies is greatest in good responders. Using PGS in those IVF, allows for single-embryo transfer, resulting in a marked decrease inmultiple pregnancies, without loss of pregnancy potential. For older women, PGS promises to be a major advance by achievingthe best neonatal outcomes for the resulting pregnancy. With 24-chromosome PGS, the rate of miscarriage is running only at <10%, a remarkable finding.
munne@reprogenetics.comwww.reprogenetics.comScientistsJacques Cohen, PhD (US) Santiago Munne, PhD (US) DaganWells, PhD (UK) Renata Prates (US) SamerAlfarawati(UK) SourayaJaroudi(UAE) Tomas Escudero (US) MireiaSandalinas, PhD (Spain) Luis Guzman, PhD (Peru) J. Horcajadas, PhD (Latin Am.) M. Konstantinidis, PhD (US) N’NekaGoodall(US) Allen Kung (US) LiaRibustello(US) Lab & Medical Directors Pere Colls, PhD (US) CarlesGimenez, PhD (Spain) ElpidaFragouli, PhD (UK) KarstenHeld, MD (Germany) Tetsuo Otani, MD (Japan) Muriel Roche, PhD (Japan) BraulioPeramo, MD (UAE) Ahmed Yesilyurt, MD (Turkey) XuezhongZeng, MD (China) Francisco Rocha (Mexico) ReprogeneticsEmbryologistsKelly KettersonCatherine WelchTim SchimmelGenetic CouncilorsJill FischerAmy JordanErin MillsG. Manassero, MD

More Related Content

PPTX
2018 07-cooper surgical-santiago munne_02072018
bySantiago Munne
 
PPTX
Preimplantation Genetic Diagnosis using Next Generation Sequencing for Social...
byMaryam Rafati
 
PPTX
aCGH in PGD/PGS
byDmytro Mykytenko
 
PPTX
PGS-NGS 360°™
byINVICTA GENETICS
 
PPTX
Preimplantation Genetics: A 25-Year Perspective
byProfessor Alan H Handyside
 
PDF
Application of NGS technologies to Preimplantation Genetic Diagnosis (PGD)
byAndreu Paytuví
 
PPT
Munne Array Cgh Update 2010 05
bysmunne
 
PDF
munné (2) pgs
by鋒博 蔡
 
2018 07-cooper surgical-santiago munne_02072018
bySantiago Munne
 
Preimplantation Genetic Diagnosis using Next Generation Sequencing for Social...
byMaryam Rafati
 
aCGH in PGD/PGS
byDmytro Mykytenko
 
PGS-NGS 360°™
byINVICTA GENETICS
 
Preimplantation Genetics: A 25-Year Perspective
byProfessor Alan H Handyside
 
Application of NGS technologies to Preimplantation Genetic Diagnosis (PGD)
byAndreu Paytuví
 
Munne Array Cgh Update 2010 05
bysmunne
 
munné (2) pgs
by鋒博 蔡
 

What's hot

PPTX
I Jornada Actualización en Genética Reproductiva y Fertilidad
byTECNALIA Research & Innovation
 
PPTX
iMGE Test™
byINVICTA GENETICS
 
PPT
PGD and PGS in India - the good, bad and ugly
byDr Aniruddha Malpani
 
PPTX
I Jornada Actualización en Genética Reproductiva y Fertilidad
byTECNALIA Research & Innovation
 
PDF
Preimplantation genetic screening &amp; diagnosis brochures
bymedgenome claria
 
PDF
Comprehensive chromosome screeningccs
byt7260678
 
PPTX
Preimplantation Genetic Diagnosis (PGD) of a wide range of single gene disorders
byMaryam Rafati
 
PPTX
PGT Applications and Biopsy procedures - COOK Media workshop- Dubai 2014
byMetwalley Metwalley
 
PPTX
Genetics in Congenital Disorders of the Urinary Tract
byMaryam Rafati
 
PPT
Munne et al ASRM 2009 Abstract O6
bysmunne
 
PDF
Knl wells
byt7260678
 
PPTX
Invicta eshre-poster-pregnancy rate after frozen blastocyst
byINVICTA GENETICS
 
PDF
Preimplantation genetic screening
byTevfik Yoldemir
 
PPTX
Invicta ngs fresh poster eshre 2014
byINVICTA GENETICS
 
PPTX
Invicta robertsonian poster eshre 2014
byINVICTA GENETICS
 
PDF
35170
by鋒博 蔡
 
PPTX
PGD-ONE FM™
byINVICTA GENETICS
 
PPTX
Invicta eshre-poster-frequency of aneuploidy
byINVICTA GENETICS
 
PPT
Preimplantation Genetic Diagnosis and Screening
byUlun Uluğ
 
PPTX
PGD-ONE™
byINVICTA GENETICS
 
I Jornada Actualización en Genética Reproductiva y Fertilidad
byTECNALIA Research & Innovation
 
iMGE Test™
byINVICTA GENETICS
 
PGD and PGS in India - the good, bad and ugly
byDr Aniruddha Malpani
 
I Jornada Actualización en Genética Reproductiva y Fertilidad
byTECNALIA Research & Innovation
 
Preimplantation genetic screening &amp; diagnosis brochures
bymedgenome claria
 
Comprehensive chromosome screeningccs
byt7260678
 
Preimplantation Genetic Diagnosis (PGD) of a wide range of single gene disorders
byMaryam Rafati
 
PGT Applications and Biopsy procedures - COOK Media workshop- Dubai 2014
byMetwalley Metwalley
 
Genetics in Congenital Disorders of the Urinary Tract
byMaryam Rafati
 
Munne et al ASRM 2009 Abstract O6
bysmunne
 
Knl wells
byt7260678
 
Invicta eshre-poster-pregnancy rate after frozen blastocyst
byINVICTA GENETICS
 
Preimplantation genetic screening
byTevfik Yoldemir
 
Invicta ngs fresh poster eshre 2014
byINVICTA GENETICS
 
Invicta robertsonian poster eshre 2014
byINVICTA GENETICS
 
35170
by鋒博 蔡
 
PGD-ONE FM™
byINVICTA GENETICS
 
Invicta eshre-poster-frequency of aneuploidy
byINVICTA GENETICS
 
Preimplantation Genetic Diagnosis and Screening
byUlun Uluğ
 
PGD-ONE™
byINVICTA GENETICS
 

Viewers also liked

PDF
Mu (2)
by鋒博 蔡
 
PDF
How to-evaluate-success-with-pgs-don-leigh
byt7260678
 
PPTX
Preimplantation Genetic Testing-Viafet
byMetwalley Metwalley
 
PDF
Next generation sequencing in preimplantation genetic screening (NGS in PGS)
byMahidol University, Thailand
 
PPT
Infertility.(By Craig)
bydrmcbansal
 
PDF
Preimplantation genetic testinng
byOsama Abdalmageed
 
PDF
Whole Genome Amplification from Single Cell
byQIAGEN
 
PPTX
Embed Repro Test
byaskreprogenetics
 
PPTX
Dagan Asrm 2009 Abstract O268
bysmunne
 
PDF
Ngs pgd
by鋒博 蔡
 
Mu (2)
by鋒博 蔡
 
How to-evaluate-success-with-pgs-don-leigh
byt7260678
 
Preimplantation Genetic Testing-Viafet
byMetwalley Metwalley
 
Next generation sequencing in preimplantation genetic screening (NGS in PGS)
byMahidol University, Thailand
 
Infertility.(By Craig)
bydrmcbansal
 
Preimplantation genetic testinng
byOsama Abdalmageed
 
Whole Genome Amplification from Single Cell
byQIAGEN
 
Embed Repro Test
byaskreprogenetics
 
Dagan Asrm 2009 Abstract O268
bysmunne
 
Ngs pgd
by鋒博 蔡
 

Similar to Pre genetic screen (1)pgs

PDF
Mu (1)
by鋒博 蔡
 
PDF
L08 munne
by鋒博 蔡
 
PDF
L17 munné (2)
by鋒博 蔡
 
PPTX
Mykytenko uarm-120413015034-phpapp02 (1)
byt7260678
 
PDF
Mu
by鋒博 蔡
 
PDF
Mu
by鋒博 蔡
 
PDF
Mu
by鋒博 蔡
 
PDF
Mu
byt7260678
 
PDF
L17 munné (1)
by鋒博 蔡
 
PDF
L17 munné
by鋒博 蔡
 
PPT
論文
byt7260678
 
PDF
L6 keysslides
byt7260678
 
PPTX
Daganasrm2009abstracto268 12564089438001-phpapp02 (1)
byt7260678
 
PPTX
Daganasrm2009abstracto268 12564089438001-phpapp02
byt7260678
 
PPTX
Mykytenko uarm-120413015034-phpapp02
byt7260678
 
PDF
1 s2.0-s0929664613000958-main
by鋒博 蔡
 
PDF
Cgh
byt7260678
 
PPT
Munne Overview Pgd China 2009 11 With Sound
bysmunne
 
PDF
1 s2.0-s1472648313006366-main
by鋒博 蔡
 
PDF
P lo s on
byt7260678
 
Mu (1)
by鋒博 蔡
 
L08 munne
by鋒博 蔡
 
L17 munné (2)
by鋒博 蔡
 
Mykytenko uarm-120413015034-phpapp02 (1)
byt7260678
 
Mu
by鋒博 蔡
 
Mu
by鋒博 蔡
 
Mu
by鋒博 蔡
 
Mu
byt7260678
 
L17 munné (1)
by鋒博 蔡
 
L17 munné
by鋒博 蔡
 
論文
byt7260678
 
L6 keysslides
byt7260678
 
Daganasrm2009abstracto268 12564089438001-phpapp02 (1)
byt7260678
 
Daganasrm2009abstracto268 12564089438001-phpapp02
byt7260678
 
Mykytenko uarm-120413015034-phpapp02
byt7260678
 
1 s2.0-s0929664613000958-main
by鋒博 蔡
 
Cgh
byt7260678
 
Munne Overview Pgd China 2009 11 With Sound
bysmunne
 
1 s2.0-s1472648313006366-main
by鋒博 蔡
 
P lo s on
byt7260678
 

More from 鋒博 蔡

PPTX
Shapiro
by鋒博 蔡
 
PDF
1 s2.0-s1472648313006354-main
by鋒博 蔡
 
PDF
Twin zygosity nipt
by鋒博 蔡
 
PDF
Fetal quant cuhk bioinformatics
by鋒博 蔡
 
PDF
Fetal fraction nipt pnd
by鋒博 蔡
 
PPT
Fresh or frozen embryos – which are better
by鋒博 蔡
 
PDF
Introduction: Preimplantation genetic screening is alive and very well. Meldr...
by鋒博 蔡
 
PDF
1 s2.0-s0015028213027441-main
by鋒博 蔡
 
PDF
Art%3 a10.1007%2fs10815 014-0230-3
by鋒博 蔡
 
PDF
1 s2.0-s1472648313005798-main
by鋒博 蔡
 
PDF
Art%3 a10.1007%2fs10815 014-0355-4
by鋒博 蔡
 
PDF
Art%3 a10.1007%2fs10815 014-0355-4 (1)
by鋒博 蔡
 
PDF
1 s2.0-s0015028214020809-main
by鋒博 蔡
 
PDF
Mat weight ga fetal frac nipt pnd
by鋒博 蔡
 
PDF
Snp nipt pnd
by鋒博 蔡
 
PDF
1 s2.0-s0015028214018603-main
by鋒博 蔡
 
PDF
Nihms379831 stephen quake
by鋒博 蔡
 
PDF
Pone.0034901
by鋒博 蔡
 
PDF
Gb 2011-12-9-228
by鋒博 蔡
 
PDF
Ecas1 1410
by鋒博 蔡
 
Shapiro
by鋒博 蔡
 
1 s2.0-s1472648313006354-main
by鋒博 蔡
 
Twin zygosity nipt
by鋒博 蔡
 
Fetal quant cuhk bioinformatics
by鋒博 蔡
 
Fetal fraction nipt pnd
by鋒博 蔡
 
Fresh or frozen embryos – which are better
by鋒博 蔡
 
Introduction: Preimplantation genetic screening is alive and very well. Meldr...
by鋒博 蔡
 
1 s2.0-s0015028213027441-main
by鋒博 蔡
 
Art%3 a10.1007%2fs10815 014-0230-3
by鋒博 蔡
 
1 s2.0-s1472648313005798-main
by鋒博 蔡
 
Art%3 a10.1007%2fs10815 014-0355-4
by鋒博 蔡
 
Art%3 a10.1007%2fs10815 014-0355-4 (1)
by鋒博 蔡
 
1 s2.0-s0015028214020809-main
by鋒博 蔡
 
Mat weight ga fetal frac nipt pnd
by鋒博 蔡
 
Snp nipt pnd
by鋒博 蔡
 
1 s2.0-s0015028214018603-main
by鋒博 蔡
 
Nihms379831 stephen quake
by鋒博 蔡
 
Pone.0034901
by鋒博 蔡
 
Gb 2011-12-9-228
by鋒博 蔡
 
Ecas1 1410
by鋒博 蔡
 

Pre genetic screen (1)pgs

  • 1.
    Santiago Munné, PhDPreventionof genetic disease before pregnancy Reprogenetics Laboratories US: Livingston (NJ), Los Angeles (CA), Chicago (IL), Portland (OR), Boca Raton (FL) / Europe: Barcelona (Spain), Oxford (UK), Hamburg (Germany) / Asia: Kobe (Japan), Macao, Abu Dhabi (UAE)/ Latin America: Lima (Peru), Buenos Aires (Argentina), Sao Paulo (Brazil), DF (Mexico)
  • 2.
    Genetics and infertility Problem frequency Detection in couple Solution AMA 50% of cycles interview PGS RPL 1% of fertile couples interview PGS Translocations 9% RPL, 2% MF karyotype PGD Hereditary gene defects 2% of couples Carrier screen (CarrierMap) PGD Genetic susceptibility to infertility Unk. Carrier screen (FertilityMap) Pharmaco- genetics De novo gene defects 1/100 autistic babies N/A PGD with whole gene sequencing
  • 3.
    Evolution of PGS:Reprogenetics data 0 1000 2000 3000 4000 5000 6000 7000 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 Number of Cases Year aCGH day 5 aCGH day 3 CGH FISH 12 FISH 5-9 Reprogenetics Laboratories: 39,000 PGD procedures up to 12/2013
  • 4.
    Waves of technology FISH + micromanipulation CCS + Blastocyst culture Whole genome sequencing + bioinformatics PGS procedures 2013 2007 1993
  • 5.
  • 6.
    Most loss ofimplantation is caused by chromosome abnormalitiesReprogenetics data: 96 centers, >3500 cycles, >19,000 blastocysts analyzed by aCGH to 9/2013 0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% <35 35-37 38-40 41-42 % euploid no implant % euploid implant % aneuploid
  • 7.
    The PGS hypothesis-proven •50%of blastocysts are aneuploid, •Aneuploidy increases with maternal age •Maternal age is inversely proportional to implantation •The error rate of PGS with CCS is low (<2%) •And blastocyst biopsy is non-detrimental Therefore PGS with CCS and blastocyst biopsy: •Should double Implantation rates •Should eliminate the Maternal age effect on implantation CCS: comprehensive chromosome analysis, such as array CGH, qPCR, Karyomaping, NGS
  • 8.
    QUESTION Do youthinkthatthePGShypothesishas nowbeenproved? 1.YES 2.NO
  • 9.
    PGD v.2(or CCS)•24 chromosome analysis by arrays•Blastocyst biopsy
  • 10.
    •20% of cyclesundiagnosedand replaced (third arm) •59% implantation reduction due to biopsy •PGD vs. Biopsied undiagnosed: 2.8x improvement 59% reduction implantation Control 14.7% Biopsied, undiagnosed6.0% Biopsied and PGD16.8% Effect of day 3 biopsy: Mastenbroeket al. (2007)
  • 11.
    Effect of day3 biopsy and blastocyst biopsy Scott et al. (2013) FertilSteril, in press Patients randomized to cleavage of blastocyst biopsy. Two best embryos randomized 1 to biopsy and 1 to no biopsy, both replaced. Biopsied embryos fingerprinted and compared with the fetus. cleavage stageblastocyst biopsynotbiopsynot Implantation rate31%53%52% 54% P<0.05N.S. (42% reduction) …but biopsy is an operator-dependent procedure and its effect may vary
  • 12.
    blastocyst biopsy: Advantages Advantages: •More DNA: less no results •Less mosaicism = low error rate •Reduced impact of embryo biopsy •Less embryos to process •Facilitates single embryo transfer •Frozen cycle: Uterine environment optimized after thaw Disadvantages: •Not all embryos reach blastocyst the same day •4.5% monozygotic twins (Morin et al. 2013)
  • 13.
    No results: Day3 vs. day 5BiopsyEmbryosCenters* stageundiagnosedrangeCleavage3.2%1% -5% Blastocyst2.3%0% -18% Gutierrez-Mateo et al. (2011) Fertil Steril and Reprogenetics data on 9049embryos* Centers with >20 cycles done for that biopsy stage Most experienced Untrained
  • 14.
    Is the trophectodermrepresentativeof the ICM? •ICM and TE were concordant in 97%(31/32) embryos when analyzed by aCGH (a). •Blastocysts analyzed by aCGH as abnormal were reanalyzed by FISH and were 97.5% (39/40) abnormal (b). (a) Capalboet al. (2013) in press, (b)Collset al. (2013) ASRM
  • 15.
    NormalTrisomyMonosomyNormal DNAEmbryo DNA Array Comparative Genome Hybridization
  • 16.
  • 17.
  • 18.
    aCGH advantages•All 24chromosome aneuploidies and translocations detected. •Results in<16 hours: allows for day 5 biopsy and 10amday 6transfer•Parental DNAnotrequired: ad hoc decisions possible. •ICSInotrequired.
  • 19.
    ApproachErrorsReasonCell lines: karyotypeand aCGHsame passage a2.0%unkDay 3: FISH reanalysis of non-replaced embryos b1.8 -3.0%mosaicsDay 3: aCGHreanalysis of non-replaced embryos c0.0 -1.2%mosaicsPBs: aCGHcomparison of PBs and eggs d6.0%unkDay 3: aCGH comparison to NGS e0.0% a BlueGnomeunpublished data, bGutierrez-Mateo et al (2011) FertilSteril, 95:953 and Mir et al. (2011) ASRM, c Biriciket al. (2011) ASHG, Montreal, and Reprogenetics unpublished data, dGeraedtset al. (2011) Human Reprod, in press, e Wells et al. (2013) ASRMaCGH validation: PBs, Day 3 embryos
  • 20.
    aCGH validation: reanalysisof blastocysts Fragouliet al. (2011) Hum. Reprod. 26: 480-90, Colls et al. (2013) ASRM P-168, Capalboet al. (2013) Hum Reprod, in press, Wells et al. (2013) ASRM O-435 and unpublished data from Reprogenetics 11% of embryos were mosaic, explaining the 2.4% error rate Reanalysis method ConfirmedEuploid Confirmed abnormal TOTAL Fragouliet al 2011 FISH, aCGH 23/25 27/27 50/52 Capalboet al. 2013 FISH 19/20 50/50 69/70 Collset al. 2013 FISH,aCGH 7/7 39/40 46/47 Wellset al. 2013 Next Gen. Sequencing 23/23 67/67 90/90 Total 96% Sensitivity 99.5% Specificity 1.6% Errorrate
  • 21.
    BiopsyReceptionResults by qPCR:day5day 5, 6pmday 6, am aCGH:day 5day 5, 6pmday 6, noon NGS:day 5day 5, 6pmday 6, noon SNPs:day 5day 5, noonday 6, 6pmSpeedof different techniques
  • 22.
    aCGHSNPsqPCRNGSfrequency69,XXX w/o aneuploidynoyesyesyes0.2%a69,XXX with aneuploidyyesyesyesyes7.8% aUPD w/o other abnormalitiesnoyesnoyes>0.01% bTrisomy w/o recombinationyesunkyesyes3% Duplications, deletionsyesyesnoyes5% TranslocationsallsomenoyesunkError rate (day 3-5 biopsy)2-3%c2-4%d1%e0%faCGH vsother techniques: Detection differences aBisignano, Wells, Hartonand Munne (2011) RBObwww.ncbi.nlm.nih.gov/omim, cGutierrez-Mateo et al. (2011), dScott et al. (2012), eTreffet al. (2012) Fertil Steril97:819–24. f Wells wtal. (2013) ASRM
  • 23.
  • 24.
    Euploidydecreases with agebut not with cohort size N = 4,747 cycles and 29,803 embryos, up to 12/2013. Ata, Munne et al. (2012) ReprodBiomed Online and unpublished data. # of blastocysts % normal embryos egg donors <35 years 35-37 years 38-40 years 41-42 years >42 years 1-3 58% 61% 51% 39% 22% 13% 4-6 62% 60% 52% 38% 23% 17% 7-10 65% 62% 51% 36% 21% 14% >10 68% 63% 55% 37% 25% n/a
  • 25.
    Prognosis depending onage and ovarian response N = 3,571 cycles and 19,356 embryos, up to 8/2013. Ata, Munne et al. (2012) ReprodBiomed Online and unpublished data. # of blastocysts % of patients with normal embryos egg donors <35 years 35-37 years 38-40 years 41-42 years >42 years 1-3 86% 85% 72% 60% 58% 24% 4-6 95% 97% 95% 88% 69% 54% 7-10 100% 99% 96% 92% 85% 65% >10 100% 100% 98% 98% 92% 83%
  • 26.
  • 27.
    CyclesMat.Prev.embryosimplant. agefailedreplaced (+sac) cyclesCGH : 4537.72.4 2.072% control : 11337.11.2 2.746% p=0.00031st randomized clinical trial: CGH and frozen transfer Schoolcraft et al. (2010) Fertil. Steril. 94:1700
  • 28.
    2ndRandomized Clinical Trial:aCGH + fresh transfer, <35 years oldYang et al. (2012) MolecReprod Control PGS patients 48 55 age <35 <35 replacement Day 6 Day 6 replaced 48 (1) 55 (1) Pregnancyrate 45.8% 70.9% P<0.05 Ongoingpregrate 41.7% 69.1% P<0.05 multiples 0 0
  • 29.
    Scott et al.,2013 FertilSteril. 3rdrandomized clinical trial: qPCR + fresh transfer PGD Control age 32.2 32.2 N 72 83 blastocysts 8 7.9 Embreplaced 1.9 2.0 implantation 79.8% 63.2% P=0.002 Sustainedimplant 66.4% 47.9% P=0.03 Delivery rate 84.7% 67.5% P=0.01 Good prognosis patients (average 8 blastocysts) Control replaced on day 5, test biopsied on day 5 and replaced on day 6
  • 30.
    4thRandomized Clinical Trial: 1 tested vs. 2 untested ongoing pregnancy rate 1 euploid blastocyst 2 untested blastocyst Fresh transfer 65% 70% NS Frozen transfer 55% 52% NS Forman et al. (2013) FertilSteril Mean maternal age 35 (patients <43)
  • 31.
    IMPLANTATION RATES INRCT STUDIES USING PGS v2: Metanalysis Control PGS Yang et al. 2012 46% 69% Scott et al. 2013 63% 80% Forman et al. 2013 40% 58% TOTAL 53% 73% P<0.001
  • 32.
    Array CGH withblastocyst biopsy: Unselected compiled results totalrange / center Centers doing d5 biopsy:96 Cycles included:3571 11 -522 Maternal age:35.434.7 -38.6 Av. blasts biopsied:5.64.5 -8.4 Av. Embryos replaced1.10.8 -1.4 Reprogenetics data to 8/2013 Implantation rate51% 35 -79% Pregnancies / cycle49% 28 -72% Pregnancies / transfer71%49 -90% Ongpreg/ cycle45%26 -65% Ongpreg/ transfer64%43 -86%
  • 33.
    Is it worthyto biopsyday 6 blastocysts? Reprogenetics, unpublished The differences between day 5 biopsy and fresh transfer vs. day 5-6 biopsy and vitrification is that the later includes day 6 biopsies: -Day-5 morulaswere cultured to day-6 and biopsied if reached blastocyst -SET of blastocysts either biopsied on day 5 or on day 6, thawed transfer Day 5 biopsy Day 6 biopsy Implantation 61% 60% N.S. Euploidy 56% 42% P<0.025
  • 34.
    maternal age effectdisappears with full chromosomes analysis
  • 35.
    aCGH eliminates thenegative effect of maternal age on implantation * SART 2011 ** Harton, Munné et al. (2013) FertilSteril. And unpublished data to 8/2013. N >800 blast biopsies 0% 10% 20% 30% 40% 50% 60% <35 35-37 39-40 41-42 >42 SART blastocyst PGS (aCGH) ** No PGS * Implantation rate Maternal age n/a
  • 36.
    Miscarriage rate afterblastocyst biopsy 0% 5% 10% 15% 20% 25% 30% 35% 40% <35 35-37 38-40 41-42 Compared to SART: Compared to other studies: Pregnancies age SAB This study 307 34.9 7.5% Scott et al. 2013 72 32.2 8.3% *SART, ** Hartonet al. (2013) FertilSteril, and unpublished data No PGS * PGS **
  • 37.
    Harton, Grifo, Munne,Wells et al. (2013) FertilSteril, and unpublished data. N >800 cycles of blast biopsy with follow up, up to 8/2013. 0% 10% 20% 30% 40% 50% 60% 70% 80% <35 35-37 38-40 41-42 OPR/ transfer no transfer OPR/ cycleOngoing pregnancy rate does not change with maternal age but …
  • 38.
    0% 10% 20% 30% 40% 50% 60% 70% 80% <35 35-37 38-40 41-42 OPR/ transfer no transfer OPR/ cycle * * cycle… Cycles with no euploidembryos do increase with maternal age … Harton, Grifo, Munne, Wells et al. (2013) FertilSteril, and unpublished data. N >800 cycles of blast biopsy with follow up, up to 8/2013.
  • 39.
    0% 10% 20% 30% 40% 50% 60% 70% 80% <35 35-37 38-40 41-42 OPR/ transfer no transfer OPR/ cycle * * … resulting in a decrease in pregnancy rate per cycle Harton, Grifo, Munne, Wells et al. (2013) FertilSteril, and unpublished data. N >800 cycles of blast biopsy with follow up, up to 8/2013. *p<0.001
  • 40.
    Maternal age effectand aCGH: conclusions •Euploid embryos implant at the same high rate irrespective of maternal age •However with maternal age there are more cycles without euploid embryos •Therefore pregnancy rates / transfer are independent of maternal age but pregnancy rates per cycle still decrease with age
  • 41.
    QUESTION Do youthinkthatthePGShypothesishas nowbeenproved? 1.YES 2.NO
  • 42.
    To replace 1or 2 euploid blastocysts?
  • 43.
    43 Cohort sizeas a predictor of SET success –Grade of transferred embryo has been correlated to embryo cohort size –The presence of supernumerary embryos is a possible indirect marker for embryo quality –ASRM acknowledges surplus embryos as being indicative of “good prognosis” DEVREKER, et al.1999. Selection of good embryos for transfer depends on embryo cohort size: implications for the ‘mild ovarian stimulation debate’. Hum Reprod, 14, 3002-08. STEINBERG, et al. 2013. Elective single embryo transfer trends and predictors of a good perinatal outcome –United States, 1999 to 2010. FertilSteril; 99, 1937-43. PracticeCommitteeof Society for Assisted ReproductiveTechnologies.2013. Criteria for number of embryos to transfer: a committee opinion. FertilSteril, 99, 44-46.
  • 44.
    Average of 3.2euploid balstocysts1 vs. 2 euploid blastocysts replaced: Effect on pregnancy and multiple rates ongoing pregnancy rate 1 euploid blastocyst 2 untested blastocyst Fresh transfer 65% 70% NS Frozen transfer 55% 52% NS Forman et al. (2013) FertilSteril
  • 45.
    45 Success ofSET by Euploid Cohort Size No. Euploid Embryos CPR 1 23/55 (41.8%) 2 13/27 (48.1%) 3 9/19 (47.4%) 4 16/21 (76.2%) 5 8/11 (72.7%) 6 6/8 (75.0%) >7 11/15 (78.6%) p < 0.01 S. Morin, K. Melzer, J. Grifo, P. Colls, Z. Zheng, S. Munné (2014) JARG
  • 46.
    # euploid #replaced preg / transfer multiples 1-3 1 42%(47/111) P<0.01 0%(0/111) p<0.001 1-3 2 65% (37/57) 38%(14/37) 4 or more 1 75% (41/55) N.S. 10% ( 4/41) p<0.001 4 or more 2 78% (58/74) 52% (30/58) 1 vs. 2 euploid blastocysts replaced: Effect on pregnancy and multiple rates S. Morin, K. Melzer, J. Grifo, P. Colls, Z. Zheng, S. Munné (2014) JARG
  • 47.
  • 48.
    N = 3,571cycles and 19,356 embryos, up to 8/2013. Ata, Munne et al. (2012) ReprodBiomed Online and unpublished data. # of blastocysts % of patients with normal embryos egg donors <35 years 35-37 years 38-40 years 41-42 years >42 years 1-3 86% 85% 72% 60% 58% 24% 4-6 95% 97% 95% 88% 69% 54% 7-10 100% 99% 96% 92% 85% 65% >7-10 100% 100% 98% 98% 92% 83% Embryo banking for low responders or bad prognosis patients
  • 49.
    Reprogenetics data, unpublished >300 cycles of embryo banking, average age 39.9Embryo banking aneuploidy rates Remain constant 1stcycle 2ndcycle 3rdcycle Total Euploidy rate 29% 29% 27% 28% # euploid blastocysts 0.7 0.9 0.7 2.2
  • 50.
    Example: 41 yearsold 1stcycle (1/4 euploid) ET 2 aneupl. 12 week loss 2ndcycle (1/4 euploid) ET 2 aneupl. No preg 3rdcycle (1/5 euploid) ET 2 aneupl. No preg Without PGD: •Risk of patient drop off •Longer time to pregnancy •Risk of miscarriage 1 2 3 4 5 6 7 8 9 10 11 12 Month:
  • 51.
    Example: 41 yearsold 1stcycle (1/4 euploid) Freeze all 2ndcycle (1/4 euploid) Freeze all 3rdcycle (1/5 euploid) Freeze all ET 1 best of 3 euploid PREGNANCY Embryo banking, one PGD at the end: •Less time to pregnancy •No risk of patient dropping off •Less cost of PGD •More cost of freezing Month: 1 2 3 4 5 6 7 8 9 10 11 12
  • 52.
    Advantages •Less patient“fatigue”: less drop out from cycle to cycle. •Cheaper PGD: One fee per package of IVF cycles •Facilitates “guaranteed baby” plans
  • 53.
    PGD FOR RECURRENTPREGNANCY LOSS (RPL)
  • 54.
    •Defined as 3or more lost pregnancies•Occurs in 1% of fertile population•Attributed to anatomic, endocrine, immunological or genetic problems but … •…>50% of RPL cases are UNEXPLAINEDBackground of RPL
  • 55.
    Werlin L, etal. (2003) Preimplantation genetic diagnosis (PGD) as both a therapeutic and diagnostic tool in assisted reproductive technology. Fertil Steril, 80:467 Munné et al. (2005) Preimplantation genetic diagnosis reduces pregnancy loss in women 35 and older with a history of recurrent miscarriages. Fertil Steril 84:331 Garrisi et al. (2009) Effect of infertility, maternal age, and number of previous miscarriages on the outcome of preimplantation genetic diagnosis for idiopathic recurrent pregnancy loss. Fertil. Steril 92: 288 Idiopathic RPL : All controlled PGD studies on idiopathic RPL show a decrease in miscarriages Rubio et al. (2009) Prognosis factors for Preimplantation Genetic Screening in repeated pregnancy loss. Reprod Biomed Online Hodes-Wertzet al. (2012) Idiopathicrecurrentmiscarriageiscausedmostlybyaneuploid embryos. FertilSteril. 98(3):675-80
  • 56.
    Munné et al.2005 N=122 procedures of PGD of couples with >2 previous loses 0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% <36 >36 total before PGD expected after PGD observed after PGD P<0.05 P<0.001 P<0.001 8% 16% 12% 33% 44% 39% 94% 85% 89% Reduction in miscarriages in RPL patients after PGD-FISH
  • 57.
    PGD results accordingto fertility: methodcycles% loss% loss% conceptionexpectedafter PGDpto termIVF11535%14%p<0.0134% natural12441%15%p<0.00537% Average maternal age: 37.5Garrisi et al. (2009) Reduction in miscarriages in RPL patients after PGD-FISH
  • 58.
    maternal preg.% loss%lossagecyclesexpectedafter PGD<352726.3%3.7%p<0.001≥355936.7%8.5%p<0.001 Total8933.5%7.0%p<0.001Results of PGD by aCGH for RPL: age effectGrifo et al. (ASRM 2011), and Grifo et al. (submitted)
  • 59.
    day preg.% loss%loss biopsy cyclesexpectedafter PGDDay 35936%9%p<0.001Day 54042%3%p<0.001Total9938%6%p<0.001Results of PGD by aCGH for RPL: biopsy stage effect Hodes-Wertz et al. (2012) Fert Ster
  • 60.
    Prev.day preg.% loss%loss losesbiopsy cyclesexpectedafter PGD2Day 53432%9%p<0.05>2Day 54042%3%p<0.001Total7437%5%p<0.001Results of PGD by aCGH for RPL: 2 vs 3 or more loses Hodes-Wertz et al. (2012) Fert Ster
  • 61.
    Real case: 35years old, triplet pregnancy miscarriageMultiple pregnancies with euploid and aneuploid fetuses 47,XX + 4 46,XX 47,XY + 20 By PGD only the euploid embryo would have been replaced probably preventing this miscarriage POC analysis:
  • 62.
    PGD for translocationsand24 chromosome abnormalities
  • 63.
    •Munné et al(1998). Spontaneous abortions are reduced after pre-conception diagnosis of translocations. J Assisted Reprod Genet 290: •Munné S et al. (2000) Outcome of Preimplantation Genetic Diagnosis of translocations. Fertil Steril. 73:1209 •Verlinsky et al. (2005) Preimplantation testing for chromosomal disorders improves reproductive outcome of poor prognosis patients. Reprod Biomed Online 11:219 •Otani et al.(2006) Preimplantation genetic diagnosis significantly improves the pregnancy outcome of translocation carriers with a history of recurrent miscarriage and failing to produce a live birth. Reprod Biomed Online 13: 879 RPL due to translocations: •Munné S (2006) Preimplantation genetic diagnosis for translocations. Hum Reprod 21: 839All PGD studies on RPL for translocations show a decrease in miscarriages •Fischer J, Colls P, Escudero T, Munné S (2010) Preimplantation Genetic Diagnosis (PGD) improves pregnancy outcome for translocation carriers with a history of recurrent losses. Fertil Steril, In press
  • 64.
    aCGH for translocationsand24 chromosome aneuploidy Patient: 46,XX,t(3;11)(q22.2;q23.3)
  • 65.
    Validation of aCGHforTranslocations + Aneuploidy•0%-2% error rate with aCGH (a,b) •All 931 translocations previously studied at Reprogenetics by FISH can be identified by aCGH (a) a: Colls et al. (2012) RBO, b: Fiorentino et al. (2011) Human Reprod Patient: 46,XY,t(3;11)(q22.2;q23.3) Gain 3q Loss 11q Tel 3p (green) Tel 3q (orange) Cent 11 (green) Tel 11q (orange)
  • 66.
    PGD for genedefects
  • 67.
    PGD for genedisorders Disease tested:Acetil Co Oxidase type I defficiency, Adrenoleucodistrophy, Alpha-thalassemia, Alport syndrome, Autosomal Dominant Polycystic Kidney Disease (ADPKD), Autosomal Recesive Polycystic Kidney Disease (ARPKD), Beta-thalassemia, Branchio-Oto-Renal syndrome (BOR), BRCA1 breast cancer predisposition, BRCA2 breast cancer predisposition, CanavanCharcot-Marie-Tooth type IA (CMT1a), Choroideremia, Congenital adrenal hyperplasia (CAH), Congenital neutropenia, Connexin 26 hearing loss, Cystic fibrosis, Duchenne/Becker Muscular Dystrophy (DMD), Ectrodactyly, Ectodermal dysplasia, and Cleft lip/palate syndrome (EEC1), Fabry Disease, Familial adenomatous poliposis coli (FAP), Familial dysautonomia, Familial intrahepatic cholestasis 2, Fanconi anemia, Fragile site mental retardation , Gangliosidosis type 1 (GM1), Gaucher disease, Glomuvenous malformations (GVM), Glycogen-storage disease type I (GSD1), Glycosylation type 1C, Hemoglobin SC disease, Hemophilia A, Hemophilia B, Hereditary nonpolyposis colon cancer (HNPCC), Hereditary pancreatitis, HLA matching Huntington disease, Hurler syndrome, Hypophosphatasia, Incontinential pigmenti, Krabbe disease (Globoid cell leukodystrophy), Long QT syndrome, Marfan syndrome, Meckle gruber, Metachromatic leukodystrophy (MLD), Methylmalonic aciduria cblC type (MMACHC), Myotonic Dystrophy 1, Myotubular myopathy, Neurofibromatosis 1, Neurofibromatosis 2, Niemann-Pick Disease, Noonan syndrome, Oculocutaneous albinism 1 (OCA1), Ornithine carbamoyltransferase deficiency (OTC), Osteogenesis Imperfecta 1, Rapp Hodgkin ectodermal dysplasia, Retinitis pigmentosa, Retinoblastoma, Sickle Cell Anemia, Smith- Lemli-Opitz syndrome (SLOS), Spinal bulbar muscular atrophy (SBMA), Spinal Muscular Atrophy Type 1 (SMA1), Tay Sachs, Tuberous sclerosis 1 (TSC1), Tuberous sclerosis 2 (TSC2), Von Hippel-Lindau Syndrome (vHL), X-linked dominant Charcot–Marie–Tooth (CMTX), etc…… (see review Gutierrez et al. (2008)) We can do PGD for any disease with known mutation
  • 68.
    Prates et al.(2013) FertilSteril, ASRM Day 3 vs. day 5 biopsy for PGD Of gene defects Day 3 Day 5 Totalembryos 2634 797 No Results 12.1% 5.3% <0.0001 ADO rate 9.8% 1% <0.0001
  • 69.
    51.0% 21.9% 18.9% 8.2% affected andchromosomallyabnormal embryos unaffected andchromosomallyabnormal embryos unaffected and Euploidembryos no results (fragmented, arrested or otherwisepoor quality embryos) aCGH and Single Gene Disorders: Results N= 329 embryos tested Prates et al. (2013) ASRM
  • 70.
    Improved pregnancy results Test typeAv agePregnancy rate SGD31.6 54% (14/26) SGD + CCS32.3 86% (12/14) p<0.05
  • 71.
    A A A A A A Reducing work-up time for PGD of single gene disorders -Karyomapping Thousands of polymorphisms on each chromosomes Each chromosome (region) has a unique DNA fingerprint A A A A B B A B A B B A B B A A B A A B B A A A A A A A M A B B A A A A A A A B B M B B B B B A B B B B B B A A B A A B B A A A A B A B B A Carrier Carrier and trisomic Mother Father A A A A B B B B A A B A Affected child M M M M
  • 72.
    PGD v3: NextGeneration Sequencing
  • 73.
    2014 1000$ * The $1000 genome is here * Not including equipment, labor, overhead, analysis, etc
  • 74.
    Differences between PGDmethods PCRPCR +SNPNext Gen aCGHarrays*Sequencing Detects aneuploidynoyesyesyes Detects gene defectsyesyesyesyes Detects mitotic errorsnoyesnoyes >2 month of Preparation yes yesnono Requires affected probandnonoyesno # genomes / run0001 * * KaryomappingusingBlueGnome ** withNextSeq
  • 75.
    CAGCGGCAGATGATTCGGGGATATTG AGGATACGACTTGCAGCGGCAGATGATT GTACCATAGGATACGACTTGCAGCGGCA ATATTGCGTATA CAGATGATTCGGGGATATTGCGTA TGCGTATAGG ACCATAGGATACGACTTGCAGCGGC TAGAGTACCATAGGATACGACTTGCAACGGCAGATGATTCGGGGATATTGCGTATAGGCTA Known sequence (CFTR gene chromosome 7) Each region of the genome sequenced multiple times Millions of short sequences produced Sequences are compared to the known human genome Mutations identified and amount of DNA (aneuploidy) revealed FragmentationNext Generation Sequencing (NGS) SlideadaptedfromD. Wells
  • 76.
    NGS analysis ofamplified DNA from single cells: chr 1 chr 2 chr 3 chr 4 chr 5 chr 6 chr 7 chr 8 chr 9 chr 10 chr 11 chr 12 chr 13 chr 14 chr 15 chr 16 chr 17 chr 18 chr 19 chr 20 chr 21 chr 22 chr X chr Y % of total sequence reads Chromosomally normal control Embryo sample Trisomy 22 PGS: Not all regions amplify equally SlideadaptedfromD. Wells
  • 77.
    Platforms used forPGS Ion torrent(ThermoFisher): •PGM •Proton Illumina: •MiSeq •NextSeq •HiSeq Complete genomics (BGI)
  • 78.
    Different output fordifferent needs samples / run * Genome1 Exome6-12 NIPT16-20 Carrier screen24-96 PGS96 chromosome screening needs less output * using NextSeq, x30 coverage, 120 Gb
  • 79.
    However, price persample can be competitive using barcodes Barcoding CAGATGATTCGTGGATATTGCGTA AAGGCAGATGATTCGTGGATATTGCGTA CCTT CAGATGATTCGTGGATATTGCGTA CAGATGATTCGGGGATATTGCGTA Embryo 1 Embryo 2 Embryo 3 AAGG GTAC CCTTCAGATGATTCGTGGATATTGCGTA GTACCAGATGATTCGGGGATATTGCGTA Add barcodes Pool samples Sequence GTAC SlideadaptedfromD. Wells
  • 80.
    Barcoding: More samples,less sequence samplesgenome depth of / runcoveragecoverage Genome1100% x 30 PGS *16-96≤ 10% x1 to x3 * Output: MiSeq= PGM << NextSeq Wells, Kaur, Rico, Grifo, Anderson, Sherlock, Taylor, Munne (2013) ESHRE, Yin et al (2013) BiolReprod88, 69
  • 81.
    PGS with NGS:Method •Whole Genome Amplification of Sample •Library preparation: –Fragment DNA –Ligate adapters and barcodes (≥16) •Sequence D Wells, K Kaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (2013) ESHRE
  • 82.
    78 blastocysts previouslydiagnosed by aCGH were reanalyzed by NGS in a blinded experiment. 21/21 euploid 55/56 aneuploid 1 polyploid 1.3%discordance with aCGH, polyploidy detected. validation ofNext Generation Sequencing (NGS) Allen Kung et al. (2014) ESHRE
  • 83.
    Example Trisomy 13male (47,XY,+13) aCGH NGS Adapted from G.Harton, platform: MiSeq
  • 84.
    Example Trisomy 21,male (47,XY + 21) 21 X Y Adapted from G.Harton, platform: MiSeq
  • 85.
    Example Monosomy2, male(45,XY -2) And mosaic for 11? X Y 11 2 Adapted from G.Harton, platform: MiSeq
  • 86.
    Example 49,XY +3+7 +12 +21 -22 By Reprogenetics, using ion torrent PGM
  • 87.
    First baby bornfrom NGS First NGS baby: David Levy A collaboration of Reprogenetics-US, Reprogenetics-UK (Dagan Wells) and Main Line Fertility (Dr. Glassner)
  • 88.
  • 89.
    Conclusions •Euploid embryosimplant at the same high rate irrespective of maternal age •However with maternal age there are more cycles without euploid embryos •Therefore pregnancy rates per transfer are independent of maternal age but pregnancy rates per cycle still decrease with age
  • 90.
    Conclusion •Arrays arefully validated and combined with Blastocyst biopsy provide a significant improvement in ongoing pregnancy rates. •Arrays alone or in combination with karyomappingcan screen for aneuploidy and gene defects simultaneously. •Next generation sequencing will allow further information to be detected once prices decrease.
  • 91.
    We are ingreat need of techniques that can identify embryos resulting in a healthy newborn, make the process more efficient, and keep failed cycles to a minimum. want to avoid establishing a pregnancy that ends up in miscarriage, losing up to 6 months from patients attempts at conception our current understanding is that blastocyst biopsy does not appear to affect embryo viability and gives a high rate of diagnostic accuracy. The risk of multiple pregnancies is greatest in good responders. Using PGS in those IVF, allows for single-embryo transfer, resulting in a marked decrease inmultiple pregnancies, without loss of pregnancy potential. For older women, PGS promises to be a major advance by achievingthe best neonatal outcomes for the resulting pregnancy. With 24-chromosome PGS, the rate of miscarriage is running only at <10%, a remarkable finding.
  • 92.
    [email protected] Cohen, PhD(US) Santiago Munne, PhD (US) DaganWells, PhD (UK) Renata Prates (US) SamerAlfarawati(UK) SourayaJaroudi(UAE) Tomas Escudero (US) MireiaSandalinas, PhD (Spain) Luis Guzman, PhD (Peru) J. Horcajadas, PhD (Latin Am.) M. Konstantinidis, PhD (US) N’NekaGoodall(US) Allen Kung (US) LiaRibustello(US) Lab & Medical Directors Pere Colls, PhD (US) CarlesGimenez, PhD (Spain) ElpidaFragouli, PhD (UK) KarstenHeld, MD (Germany) Tetsuo Otani, MD (Japan) Muriel Roche, PhD (Japan) BraulioPeramo, MD (UAE) Ahmed Yesilyurt, MD (Turkey) XuezhongZeng, MD (China) Francisco Rocha (Mexico) ReprogeneticsEmbryologistsKelly KettersonCatherine WelchTim SchimmelGenetic CouncilorsJill FischerAmy JordanErin MillsG. Manassero, MD